version

Summary of OsREG532 (All List)

OrganismOryza sativa  
IDOsREG532  
SequenceCCCACTCC  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count1090  

Entry Sequences (1090 entries)

LocusGene modelSequenceDescription
Os01g0184900AF503585CCCACTCCNONE 
AK066832CCCACTCCSimilar to SSRP1 protein. 
AK068959CCCACTCCNONE 
J013055F18CCCACTCCNONE 
Os01g0253600009-171-F12GGAGTGGGNONE 
AB111915GGAGTGGGNONE 
AK058837GGAGTGGGNucleic acid-binding, OB-fold domain containing protein. 
J065009D06GGAGTGGGNONE 
J065056K18GGAGTGGGNONE 
J065073B17GGAGTGGGNONE 
J065073H13GGAGTGGGNONE 
J065090I06GGAGTGGGNONE 
J065123N02GGAGTGGGNONE 
J075124D17GGAGTGGGNONE 
Os01g0281200AK107209CCCACTCCSimilar to Type B-like cyclin (Fragment). 
AY647458CCCACTCCNONE 
Os01g0283000AK073165GGAGTGGGConserved hypothetical protein. 
J033023G08GGAGTGGGNONE 
Os01g0283100004-018-B01CCCACTCCNONE 
AK060908CCCACTCCNONE 
AK071713CCCACTCCSimilar to Ferripyochelin-binding protein-like. 
AK104205CCCACTCCNONE 
AK122051CCCACTCCNONE 
J023109L19CCCACTCCNONE 
Os01g0323600J023095C13GGGTGGGCCCCACTCCNONE 
Os01g0327000AK121616CCCACTCCNONE 
J033044C11CCCACTCCNONE 
J075195C11CCCACTCCNONE 
Os01g0331100J090084H20GGGGCCCGCCCACTCCNONE 
Os01g0337700015-049-E12CCCACTCCNONE 
AK106340CCCACTCCNONE 
AK106939CCCACTCCConserved hypothetical protein. 
AK109210CCCACTCCNONE 
J075198P18CCCACTCCNONE 
J100031N01CCCACTCCNONE 
J100073P13CCCACTCCNONE 
Os01g0551000006-104-A04CCCACTCCNONE 
009-183-B08CCCACTCCNONE 
AK071219CCCACTCCConserved hypothetical protein. 
AK106034CCCACTCCNONE 
Os01g0588500AK103037CCCACTCCSimilar to Avr9/Cf-9 induced kinase 1. 
Os01g0588900AK071695GGACCCACTCCConserved hypothetical protein 730 family protein. 
AK111103GGACCCACTCCNONE 
J013134L19GGACCCACTCCNONE 
J023074A10GGACCCACTCCNONE 
J023109F04GGACCCACTCCNONE 
J023143L07GGACCCACTCCNONE 
J065022F16GGACCCACTCCNONE 
J065083N22GGACCCACTCCNONE 
J100040N10GGACCCACTCCNONE 
J100043F13GGACCCACTCCNONE 
J100075D13GGACCCACTCCNONE 
J100080D22GGACCCACTCCNONE 
Os01g0598600AK104992GGAGTGGGNONE 
Os01g0616300J075016P07CCCACTCCNONE 
J075161B03CCCACTCCThioredoxin-like fold domain containing protein. 
Os01g0665500AK111013GGAGTGGGNONE 
Os01g0728250J065164C03CCCACTCCConserved hypothetical protein. 
Os01g0787000006-035-E12CCCACTCCNONE 
015-056-B07CCCACTCCNONE 
AK101743CCCACTCCSimilar to Peroxidase (EC 1.11.1.7). 
AK109348CCCACTCCNONE 
J065096L02CCCACTCCNONE 
J065185H10CCCACTCCNONE 
J065186E06CCCACTCCNONE 
J090081I17CCCACTCCNONE 
Os01g0788500AK120325CCCACTCCCACTCCSimilar to Disease resistance gene analog PIC21 (Fragment). 
J013057M10CCCACTCCCACTCCNONE 
J013149E08CCCACTCCCACTCCNONE 
J033022H20CCCACTCCCACTCCNONE 
J065117B18CCCACTCCCACTCCNONE 
J075105E06CCCACTCCCACTCCNONE 
Os01g0844900AK066659CCCACTCCHomeodomain-like containing protein. 
Os01g0870100AK067564GGAGTGGGProtein of unknown function DUF1012 family protein. 
AK072312GGAGTGGGNONE 
AK103428GGAGTGGGNONE 
Os01g0878000006-045-H09GGAGTGGGNONE 
006-078-F07GGAGTGGGNONE 
016-050-A09GGAGTGGGNONE 
AK060162GGAGTGGGConserved hypothetical protein. 
AK061119GGAGTGGGNONE 
AK104289GGAGTGGGNONE 
Os01g0880200AK105039GGAGTGGGNONE 
Os01g0948900AK100894CCCACTCCAnkyrin repeat containing protein. 
AK100932CCCACTCCNONE 
J023131A22CCCACTCCNONE 
J023135M02CCCACTCCNONE 
Os01g0969100AK070623GGAGTGGGCCACNAD-dependent epimerase/dehydratase family protein. 
Os01g0972300009-034-G05TGGGTCCCACCCACTCCCACTCCNONE 
AK062432TGGGTCCCACCCACTCCCACTCCDVL family protein. 
Os01g0976800J065105P05CCCACTCCCACTGACZinc finger, GATA-type domain containing protein. 
J065189M03CCCACTCCCACTGACNONE 
Os02g0105500AK063929CCCACTCCNONE 
AK102953CCCACTCCIQ calmodulin-binding region domain containing protein. 
Os02g0121100012-035-F06CAAGGCCCACTCCCCCACGNONE 
013-031-H05CAAGGCCCACTCCCCCACGNONE 
013-058-E11CAAGGCCCACTCCCCCACGNONE 
014-010-D01CAAGGCCCACTCCCCCACGNONE 
AK070711CAAGGCCCACTCCCCCACGConserved hypothetical protein. 
AK119758CAAGGCCCACTCCCCCACGNONE 
J013033G12CAAGGCCCACTCCCCCACGNONE 
J023007M16CAAGGCCCACTCCCCCACGNONE 
J023020K20CAAGGCCCACTCCCCCACGNONE 
J023061H10CAAGGCCCACTCCCCCACGNONE 
J033027H20CAAGGCCCACTCCCCCACGNONE 
J033051E18CAAGGCCCACTCCCCCACGNONE 
J090005F12CAAGGCCCACTCCCCCACGNONE 
J090017A20CAAGGCCCACTCCCCCACGNONE 
J090018G11CAAGGCCCACTCCCCCACGNONE 
J090062C18CAAGGCCCACTCCCCCACGNONE 
J100027N10CAAGGCCCACTCCCCCACGNONE 
J100032L14CAAGGCCCACTCCCCCACGNONE 
J100045C14CAAGGCCCACTCCCCCACGNONE 
J100061M09CAAGGCCCACTCCCCCACGNONE 
J100062K11CAAGGCCCACTCCCCCACGNONE 
J100064H11CAAGGCCCACTCCCCCACGNONE 
J100074H16CAAGGCCCACTCCCCCACGNONE 
J100082N01CAAGGCCCACTCCCCCACGNONE 
Os02g0190500AK111710CCCACTCCProtein kinase domain containing protein. 
Os02g0191800009-192-E11CCCACTCCNONE 
AK063218CCCACTCCConserved hypothetical protein. 
Os02g0192300Os02g0192300TGGGTCCCACTCCZinc finger, FYVE/PHD-type domain containing protein. 
Os02g0211100AK120042CCCACTCCHypothetical protein. 
Os02g0302900AK110752GGACCCACTCCReticulon family protein. 
Os02g0450000AK122096GGAGTGGGConserved hypothetical protein. 
J065170J20GGAGTGGGNONE 
J090015E20GGAGTGGGNONE 
Os02g0456500Os02g0456500CCCACTCCNONE 
Os02g0502500011-068-G11CCCACTCCNONE 
AK100111CCCACTCCNONE 
AK100315CCCACTCCProtein kinase-like domain containing protein. 
J013074C19CCCACTCCNONE 
J013153K16CCCACTCCNONE 
J023078O21CCCACTCCNONE 
J033127M18CCCACTCCNONE 
J043038D17CCCACTCCNONE 
J065090L08CCCACTCCNONE 
J065110P16CCCACTCCNONE 
J065163C03CCCACTCCNONE 
J065213D23CCCACTCCNONE 
J090010M14CCCACTCCNONE 
J090016E02CCCACTCCNONE 
J090044J20CCCACTCCNONE 
J090091M16CCCACTCCNONE 
J090099I23CCCACTCCNONE 
Os02g0530600AK102681CCCACTCCBRCT domain containing protein. 
Os02g0537900AK070310GGAGTGGGCTGTSimilar to Vacuolar-type H+-translocating inorganic pyrophosphatase (EC 3.6.1.1). 
Os02g0564000AJ486976GGAGTGGGNONE 
AK073086GGAGTGGGSimilar to Glutathione S-transferase. 
J065021E14GGAGTGGGNONE 
J065139E02GGAGTGGGNONE 
J065165G05GGAGTGGGNONE 
J065181H16GGAGTGGGNONE 
J065217K07GGAGTGGGNONE 
J065218L13GGAGTGGGNONE 
J100082K21GGAGTGGGNONE 
J100084K19GGAGTGGGNONE 
Os02g0625500011-025-C06GGAGTGGGNONE 
AB050624GGAGTGGGNONE 
AK059188GGAGTGGGNONE 
AK059771GGAGTGGGNONE 
AK101791GGAGTGGGSimilar to Adenosine kinase-like protein (Fragment). 
AY224510GGAGTGGGNONE 
J013152H02GGAGTGGGNONE 
J023012P09GGAGTGGGNONE 
J023127D16GGAGTGGGNONE 
J033024G01GGAGTGGGNONE 
J033025L19GGAGTGGGNONE 
J033080M04GGAGTGGGNONE 
J033101A08GGAGTGGGNONE 
J033121L12GGAGTGGGNONE 
J043017N15GGAGTGGGNONE 
J065207J01GGAGTGGGNONE 
J090049G12GGAGTGGGNONE 
J100036A07GGAGTGGGNONE 
J100076C04GGAGTGGGNONE 
J100080N22GGAGTGGGNONE 
Os02g0651500AK066333GTCCCACCCCCACTCCNONE 
AK121865GTCCCACCCCCACTCCHypothetical protein. 
J090038J11GTCCCACCCCCACTCCNONE 
Os02g0686700AK111294AGGGCCCACTCCProtein of unknown function DUF581 family protein. 
Os02g0697500AK105680CCCACTCCSimilar to Selenium-binding protein-like. 
Os02g0703900AK102115GGAGTGGGSimilar to Nodulin-like protein. 
AK121966GGAGTGGGNONE 
J023109K03GGAGTGGGNONE 
J033051G23GGAGTGGGNONE 
J033084H22GGAGTGGGNONE 
J090056B12GGAGTGGGNONE 
J090059L13GGAGTGGGNONE 
J090080M03GGAGTGGGNONE 
Os02g0748300009-089-D04GGAGTGGGNONE 
AK100919GGAGTGGGNONE 
J023133K05GGAGTGGGNONE 
Os02g0753000AK121015GCTGGGCCCACTCCSimilar to Trehalose-6-phosphate phosphatase. 
Os02g0792900AK068367CCCACTCCTMS membrane protein/tumour differentially expressed protein family protein. 
AK104731CCCACTCCNONE 
AK106174CCCACTCCNONE 
AK119191CCCACTCCNONE 
Os02g0812000AK107665CCCACTCCNAD-dependent epimerase/dehydratase family protein. 
Os02g0816100AK058331GGAGTGGGHAD-superfamily hydrolase, subfamily IA, variant 2 protein. 
AK060021GGAGTGGGNONE 
J065132K03GGAGTGGGNONE 
Os03g0107700014-091-A02GCCCATGAGGAGTGGGNONE 
AK063743GCCCATGAGGAGTGGGSimilar to EL2 protein. 
D64038GCCCATGAGGAGTGGGNONE 
J065001A12GCCCATGAGGAGTGGGNONE 
J065046K10GCCCATGAGGAGTGGGNONE 
J065063C24GCCCATGAGGAGTGGGNONE 
J065094D16GCCCATGAGGAGTGGGNONE 
J065152A12GCCCATGAGGAGTGGGNONE 
J065158D05GCCCATGAGGAGTGGGNONE 
J065166L15GCCCATGAGGAGTGGGNONE 
J065190D04GCCCATGAGGAGTGGGNONE 
J075056F01GCCCATGAGGAGTGGGNONE 
J075148A07GCCCATGAGGAGTGGGNONE 
J080074L17GCCCATGAGGAGTGGGNONE 
J080094A13GCCCATGAGGAGTGGGNONE 
J090044B15GCCCATGAGGAGTGGGNONE 
J090065N04GCCCATGAGGAGTGGGNONE 
Os03g0120200AK102865CCCACTCCNONE 
Os03g0125900AK060370GCCCACGCCCACTCCConserved hypothetical protein. 
AK071921GCCCACGCCCACTCCNONE 
Os03g0130100AK110783GGCCCCACTCCSimilar to Acyl-activating enzyme 11. 
J065172I17GGCCCCACTCCNONE 
Os03g0146500006-036-F10CCCACTCCNONE 
006-082-C03CCCACTCCNONE 
006-098-E04CCCACTCCNONE 
006-110-C03CCCACTCCNONE 
009-057-C11CCCACTCCNONE 
009-182-D02CCCACTCCNONE 
AK059776CCCACTCCGalactose-binding like domain containing protein. 
AK071628CCCACTCCNONE 
AK104105CCCACTCCNONE 
AK104220CCCACTCCNONE 
J065168B02CCCACTCCNONE 
Os03g0180400006-067-C02CCCACTCCNONE 
006-091-E05CCCACTCCNONE 
006-094-F06CCCACTCCNONE 
009-126-C06CCCACTCCNONE 
AB026558CCCACTCCNONE 
AK059929CCCACTCCNONE 
AK060026CCCACTCCNONE 
AK101031CCCACTCCProteasome subunit alpha type 6 (EC 3.4.25.1) (20S proteasome alpha subunit A) (20S proteasome subunit alpha-1). 
AK104324CCCACTCCNONE 
J023001I24CCCACTCCNONE 
J023150K05CCCACTCCNONE 
J033086P06CCCACTCCNONE 
J043017O21CCCACTCCNONE 
J043021K10CCCACTCCNONE 
J053034G22CCCACTCCNONE 
J053055G07CCCACTCCNONE 
J053095K16CCCACTCCNONE 
J065012G02CCCACTCCNONE 
J065022K22CCCACTCCNONE 
J065030B18CCCACTCCNONE 
J065030N19CCCACTCCNONE 
J065032A17CCCACTCCNONE 
J065032G24CCCACTCCNONE 
J065040M17CCCACTCCNONE 
J065071D18CCCACTCCNONE 
J065072E08CCCACTCCNONE 
J065085G14CCCACTCCNONE 
J065091H03CCCACTCCNONE 
J065108B21CCCACTCCNONE 
J065120G08CCCACTCCNONE 
J065124L20CCCACTCCNONE 
J065130M23CCCACTCCNONE 
J065138N18CCCACTCCNONE 
J065150F03CCCACTCCNONE 
J065169L24CCCACTCCNONE 
J065173G21CCCACTCCNONE 
J065201E10CCCACTCCNONE 
J065209P07CCCACTCCNONE 
J065218B04CCCACTCCNONE 
J075062P08CCCACTCCNONE 
J075097O11CCCACTCCNONE 
J090060L06CCCACTCCNONE 
J090067F04CCCACTCCNONE 
J090074G17CCCACTCCNONE 
Os03g0195900J065063O15GGAGTGGGCCGGTNONE 
Os03g0211900AK059280CCCACTCCLeucine rich repeat, N-terminal domain containing protein. 
AK121380CCCACTCCNONE 
J033102D09CCCACTCCNONE 
J053089G04CCCACTCCNONE 
J065138D22CCCACTCCNONE 
Os03g0218400AK069202CCCACTCCSimilar to Hexose transporter. 
AK099306CCCACTCCNONE 
AY342321CCCACTCCNONE 
J023066K08CCCACTCCNONE 
J100032N19CCCACTCCNONE 
Os03g0227700AB206579CCCACTCCCytochrome P450 family protein. 
Os03g0255200AK058212CAGGTGGGGCCCACTCCNONE 
AK071625CAGGTGGGGCCCACTCCHeat shock protein DnaJ, N-terminal domain containing protein. 
Os03g0267700014-016-F10GGAGTGGGNONE 
AK071979GGAGTGGGMitochondrial substrate carrier family protein. 
AK105349GGAGTGGGNONE 
Os03g0278000014-078-B07GGAGTGGGNONE 
AB079064GGAGTGGGNONE 
AK060031GGAGTGGGNONE 
AK100908GGAGTGGGUDP-glucuronic acid decarboxylase. 
J023007P12GGAGTGGGNONE 
J023045J24GGAGTGGGNONE 
J023054L14GGAGTGGGNONE 
J023085K21GGAGTGGGNONE 
J023121H11GGAGTGGGNONE 
J023125J04GGAGTGGGNONE 
J023126B13GGAGTGGGNONE 
J023132P15GGAGTGGGNONE 
J033117K15GGAGTGGGNONE 
J033140G17GGAGTGGGNONE 
J043034K23GGAGTGGGNONE 
J043037H03GGAGTGGGNONE 
J053064B01GGAGTGGGNONE 
J075146I22GGAGTGGGNONE 
J090001H15GGAGTGGGNONE 
J090043P06GGAGTGGGNONE 
J090067M04GGAGTGGGNONE 
J090095K23GGAGTGGGNONE 
J100017L23GGAGTGGGNONE 
J100031B08GGAGTGGGNONE 
J100070O13GGAGTGGGNONE 
J100088D21GGAGTGGGNONE 
Os03g0289200016-011-H02GGAGTGGGNONE 
AK064364GGAGTGGGSimilar to H/ACA ribonucleoprotein complex subunit 1-like protein (GCR 101 snRNP). 
AK073108GGAGTGGGNONE 
J043024P22GGAGTGGGNONE 
J100074J04GGAGTGGGNONE 
Os03g0292800012-077-B05CCCACTCCNONE 
AK069970CCCACTCCSimilar to Ran binding protein 1 homolog. 
J065138F22CCCACTCCNONE 
Os03g0307900AK072469GGAGTGGGConserved hypothetical protein. 
Os03g0323100009-108-G02GGAGTGGGNONE 
AK062803GGAGTGGGHypothetical protein. 
AK070776GGAGTGGGNONE 
Os03g0323200AK067323CCCACTCCSimilar to Protoporphyrin IX Mg-chelatase subunit precursor. 
Os03g0343400AK105611CCCACTCCSimilar to Photolyase/blue-light receptor PHR2. 
Os03g0415500AK108435GGAGTGGGTCCCACMitochondrial import inner membrane translocase, subunit Tim17/22 family protein. 
J065182P12GGAGTGGGTCCCACNONE 
Os03g0421800AK099491CCCACTCCVirulence factor, pectin lyase fold family protein. 
J065198F08CCCACTCCNONE 
Os03g0428800AK060233GGAGTGGGTetratricopeptide-like helical domain containing protein. 
Os03g0583800AK064786CCCACTCCMpv17/PMP22 family protein. 
AK099233CCCACTCCNONE 
J013000B17CCCACTCCNONE 
J013071N13CCCACTCCNONE 
J013095M11CCCACTCCNONE 
J080068F05CCCACTCCNONE 
J080069C02CCCACTCCNONE 
J080072E22CCCACTCCNONE 
J100052H10CCCACTCCNONE 
J100053H09CCCACTCCNONE 
J100056G03CCCACTCCNONE 
Os03g0586300AK100442CCCACTCCReticulon family protein. 
J023031G06CCCACTCCNONE 
J023089N19CCCACTCCNONE 
J023099N13CCCACTCCNONE 
J065026N17CCCACTCCNONE 
J065045N16CCCACTCCNONE 
J065163L12CCCACTCCNONE 
Os03g0701500009-150-F12CCAAGCCCACTCCNONE 
AK063166CCAAGCCCACTCCGNS1/SUR4 membrane protein family protein. 
Os03g0713100J013039M09CCCACTCCCTGGGGCCCACCTGNONE 
J023007K01CCCACTCCCTGGGGCCCACCTGNONE 
J023073H01CCCACTCCCTGGGGCCCACCTGNONE 
J023087M20CCCACTCCCTGGGGCCCACCTGNONE 
J023142E01CCCACTCCCTGGGGCCCACCTGNONE 
J033048E03CCCACTCCCTGGGGCCCACCTGNONE 
J033048F03CCCACTCCCTGGGGCCCACCTGSimilar to Dynamin-related protein 1C (Dynamin-like protein C) (Dynamin-like protein 5) (Dynamin-like protein DLP1). 
J033058C11CCCACTCCCTGGGGCCCACCTGNONE 
J033074M20CCCACTCCCTGGGGCCCACCTGNONE 
J033084M11CCCACTCCCTGGGGCCCACCTGNONE 
J033091I23CCCACTCCCTGGGGCCCACCTGNONE 
J033100C08CCCACTCCCTGGGGCCCACCTGNONE 
J033123K19CCCACTCCCTGGGGCCCACCTGNONE 
J090006P21CCCACTCCCTGGGGCCCACCTGNONE 
J090045O16CCCACTCCCTGGGGCCCACCTGNONE 
J100087M13CCCACTCCCTGGGGCCCACCTGNONE 
Os03g0716200Os03g0716200ATGGCCCACCGGAGTGGGCCCCACAConserved hypothetical protein. 
Os03g0719500AK106321CATCCCCCACTCCNONE 
Os03g0722500AK099926GGAGTGGGGlycoside hydrolase, family 17 protein. 
AK100108GGAGTGGGNONE 
J023004N24GGAGTGGGNONE 
J100018K24GGAGTGGGNONE 
J100032B22GGAGTGGGNONE 
J100036K14GGAGTGGGNONE 
J100043B05GGAGTGGGNONE 
Os03g0735000AK069296GGAGTGGGSimilar to Glucose-1-phosphate adenylyltransferase large subunit 2 (EC 2.7.7.27) (ADP-glucose synthase) (ADP-glucose pyrophosphorylase) (AGPASE S) (Alpha-D-glucose-1-phosphate adenyl transferase) (BLPL) (Fragment). 
Os03g0756800009-100-H11GGAGTGGGNONE 
AK120423GGAGTGGGProtein of unknown function UPF0139 family protein. 
J013095D02GGAGTGGGNONE 
J023091G12GGAGTGGGNONE 
J065207J17GGAGTGGGNONE 
J100067G13GGAGTGGGNONE 
J100089L11GGAGTGGGNONE 
Os03g0762400AK071181CCCACTCCSimilar to Peroxidase2 precursor (EC 1.11.1.7). 
J023084I20CCCACTCCNONE 
J033039C18CCCACTCCNONE 
J033108N03CCCACTCCNONE 
J043017N16CCCACTCCNONE 
J065026C13CCCACTCCNONE 
J065045C01CCCACTCCNONE 
J065045D11CCCACTCCNONE 
J065050N09CCCACTCCNONE 
J065058P21CCCACTCCNONE 
J065075I20CCCACTCCNONE 
J065077I17CCCACTCCNONE 
J065081I20CCCACTCCNONE 
J065085B14CCCACTCCNONE 
J065101K21CCCACTCCNONE 
J065112A17CCCACTCCNONE 
J065112N13CCCACTCCNONE 
J065118J02CCCACTCCNONE 
J065123E01CCCACTCCNONE 
J065134N12CCCACTCCNONE 
J065139L04CCCACTCCNONE 
J065141I11CCCACTCCNONE 
J065161J24CCCACTCCNONE 
J065164I10CCCACTCCNONE 
J065171L01CCCACTCCNONE 
J065178P21CCCACTCCNONE 
J065185L24CCCACTCCNONE 
J065219C04CCCACTCCNONE 
J075029B07CCCACTCCNONE 
J075033G20CCCACTCCNONE 
J075054N01CCCACTCCNONE 
J075068B22CCCACTCCNONE 
J075096N11CCCACTCCNONE 
J075098C11CCCACTCCNONE 
J075115J22CCCACTCCNONE 
J075127D11CCCACTCCNONE 
J075156J21CCCACTCCNONE 
J075166G08CCCACTCCNONE 
J075166P17CCCACTCCNONE 
J075170O18CCCACTCCNONE 
J075181A16CCCACTCCNONE 
J075195J11CCCACTCCNONE 
Os03g0770800015-057-H01CCCACTCCNONE 
AF435641CCCACTCCNONE 
AK121805CCCACTCCCSLC9. 
J023034N23CCCACTCCNONE 
J023037A20CCCACTCCNONE 
J023080E22CCCACTCCNONE 
J023090M05CCCACTCCNONE 
J033085E01CCCACTCCNONE 
J033097L05CCCACTCCNONE 
J100059A04CCCACTCCNONE 
J100073A18CCCACTCCNONE 
Os03g0782500AK105637CCCACTCCBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
Os03g0788800AK071670CCCACTCCZinc finger, RING-type domain containing protein. 
J013090J22CCCACTCCNONE 
J023050M06CCCACTCCNONE 
J023073A12CCCACTCCNONE 
J023075P21CCCACTCCNONE 
J023106F04CCCACTCCNONE 
J075181H19CCCACTCCNONE 
J090009C24CCCACTCCNONE 
J100027L24CCCACTCCNONE 
J100055F06CCCACTCCNONE 
J100081C22CCCACTCCNONE 
J100084I21CCCACTCCNONE 
Os03g0803500AK059759CCCACTCCSimilar to Prolyl 4-hydroxylase alpha-1 subunit-like protein. 
J065094L11CCCACTCCNONE 
J065123P07CCCACTCCNONE 
J065162G09CCCACTCCNONE 
J065163N13CCCACTCCNONE 
J065212F04CCCACTCCNONE 
J065214A05CCCACTCCNONE 
Os03g0807700AK059286CCCACTCCGlutelin family protein. 
AK121037CCCACTCCNONE 
Os03g0851100AF303468GGAGTGGGCCTATGGGCCCTAGTGGGCCTATGGGCCCTAGTGGGCCGTACGGCCCATTTNONE 
AK102069GGAGTGGGCCTATGGGCCCTAGTGGGCCTATGGGCCCTAGTGGGCCGTACGGCCCATTTSimilar to Translational elongation factor EF-TuM. 
J033082G06GGAGTGGGCCTATGGGCCCTAGTGGGCCTATGGGCCCTAGTGGGCCGTACGGCCCATTTNONE 
J043036M21GGAGTGGGCCTATGGGCCCTAGTGGGCCTATGGGCCCTAGTGGGCCGTACGGCCCATTTNONE 
J065158H05GGAGTGGGCCTATGGGCCCTAGTGGGCCTATGGGCCCTAGTGGGCCGTACGGCCCATTTNONE 
J065192A04GGAGTGGGCCTATGGGCCCTAGTGGGCCTATGGGCCCTAGTGGGCCGTACGGCCCATTTNONE 
Os03g0851200009-035-B01AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
009-134-F10AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
009-154-H05AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
AK059425AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCSimilar to CAXIP1 protein. 
J065065D24AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
J075046G20AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
J075046O19AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
J075048O04AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
J075181I09AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
J080303G20AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
J090086F12AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
J090088E07AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
Os04g0390500AK066575CCCACTCCNONE 
AK099908CCCACTCCNONE 
AK100148CCCACTCCNONE 
Os04g0418500AK121255CCCACTCCU box domain containing protein. 
J065172M13CCCACTCCNONE 
J100026H21CCCACTCCNONE 
J100032D22CCCACTCCNONE 
Os04g0443000011-022-G04GGAGTGGGNONE 
AK100533GGAGTGGGFAR1 domain containing protein. 
J023101L24GGAGTGGGNONE 
Os04g0466600J065051L19CCCACTCCNONE 
J090042O12CCCACTCCNONE 
Os04g0490000AK108365TCCACGCCTCCCACTCCSimilar to Glutamate synthase [NADH], chloroplast precursor (EC 1.4.1.14) (NADH- GOGAT). 
Os04g0503500AK099404CCCACTCCLeucine-rich repeat, cysteine-containing subtype containing protein. 
AK101695CCCACTCCNONE 
Os04g0574500AK110934GGAGTGGGSimilar to Growth-regulating factor 3. 
J065101K11GGAGTGGGNONE 
J065207F18GGAGTGGGNONE 
Os04g0623800AK059270CCCACTCCNONE 
AK099234CCCACTCCSimilar to Aminomethyltransferase, mitochondrial precursor (EC 2.1.2.10) (Glycine cleavage system T protein) (GCVT). 
Os04g0635800006-033-E07GGAGTGGGNONE 
011-067-A08GGAGTGGGNONE 
AK060110GGAGTGGGNONE 
AK099507GGAGTGGGGCN5-related N-acetyltransferase domain containing protein. 
AK104741GGAGTGGGNONE 
AK120021GGAGTGGGNONE 
J013029B17GGAGTGGGNONE 
J013134M07GGAGTGGGNONE 
J013149N18GGAGTGGGNONE 
J013153L10GGAGTGGGNONE 
J033131F08GGAGTGGGNONE 
J043010E02GGAGTGGGNONE 
J065031J05GGAGTGGGNONE 
J065031J06GGAGTGGGNONE 
J075030K04GGAGTGGGNONE 
J075178K05GGAGTGGGNONE 
J080001B10GGAGTGGGNONE 
J080003N19GGAGTGGGNONE 
J080005F20GGAGTGGGNONE 
J080005G16GGAGTGGGNONE 
J080007N02GGAGTGGGNONE 
J080009J04GGAGTGGGNONE 
J080017D04GGAGTGGGNONE 
J080020M22GGAGTGGGNONE 
J080021A15GGAGTGGGNONE 
J080021F21GGAGTGGGNONE 
J080023P05GGAGTGGGNONE 
J080024P22GGAGTGGGNONE 
J080027C20GGAGTGGGNONE 
J080029K03GGAGTGGGNONE 
J080035M18GGAGTGGGNONE 
J080039F22GGAGTGGGNONE 
J080039J03GGAGTGGGNONE 
J080039L03GGAGTGGGNONE 
J080039P14GGAGTGGGNONE 
J080042E12GGAGTGGGNONE 
J080047D19GGAGTGGGNONE 
J080047M21GGAGTGGGNONE 
J080049N03GGAGTGGGNONE 
J080056J12GGAGTGGGNONE 
J080060B10GGAGTGGGNONE 
J080062K08GGAGTGGGNONE 
J080064L07GGAGTGGGNONE 
J080069C15GGAGTGGGNONE 
J080074H06GGAGTGGGNONE 
J080086O14GGAGTGGGNONE 
J080090C20GGAGTGGGNONE 
J080090L14GGAGTGGGNONE 
J080095G08GGAGTGGGNONE 
J080097C07GGAGTGGGNONE 
J090011F03GGAGTGGGNONE 
J090082O17GGAGTGGGNONE 
Os04g0645600AK100006CCCACTCCProtein of unknown function DUF6, transmembrane domain containing protein. 
J013135P10CCCACTCCNONE 
Os04g0678200006-037-E05CCCACTCCNONE 
006-059-G04CCCACTCCNONE 
006-097-A11CCCACTCCNONE 
006-098-D11CCCACTCCNONE 
009-154-H11CCCACTCCNONE 
AK106193CCCACTCCProtein of unknown function DUF1218 family protein. 
J013064K07CCCACTCCNONE 
Os05g0145900006-095-D04CCACGGCCCACGCCCACTCCNONE 
006-104-B04CCACGGCCCACGCCCACTCCNONE 
AK121187CCACGGCCCACGCCCACTCCConserved hypothetical protein. 
J043034M11CCACGGCCCACGCCCACTCCNONE 
J053032K19CCACGGCCCACGCCCACTCCNONE 
J090096F20CCACGGCCCACGCCCACTCCNONE 
Os05g0182700003-102-E07GGAGTGGGNONE 
011-019-D04GGAGTGGGNONE 
013-068-D09GGAGTGGGNONE 
014-032-G03GGAGTGGGNONE 
AK065911GGAGTGGGProtein of unknown function DUF1664 family protein. 
AK104343GGAGTGGGNONE 
J013045E01GGAGTGGGNONE 
J013156L15GGAGTGGGNONE 
J023029P17GGAGTGGGNONE 
J023134I24GGAGTGGGNONE 
J033099A10GGAGTGGGNONE 
J033115L16GGAGTGGGNONE 
J090007M24GGAGTGGGNONE 
J090019F02GGAGTGGGNONE 
Os05g0188500AK069089CCCACTCCArmadillo-like helical domain containing protein. 
AK100219CCCACTCCNONE 
Os05g0197300AK106389TGGGACCCACTCCIQ calmodulin-binding region domain containing protein. 
Os05g0207700AK102665TGCGGGCCCACCCCCACTCCNONE 
AK103861TGCGGGCCCACCCCCACTCCSimilar to Serine/threonine-protein kinase PBS1 (EC 2.7.1.37) (AvrPphB susceptible protein 1). 
Os05g0226300AK067770CCCACTCCConserved hypothetical protein. 
J013120H22CCCACTCCNONE 
J013146E15CCCACTCCNONE 
Os05g0243200009-073-F12TCAGGCCCACTCCNONE 
AK061317TCAGGCCCACTCCSimilar to Ribosomal protein L13. 
J065120F21TCAGGCCCACTCCNONE 
J065185K05TCAGGCCCACTCCNONE 
Os05g0391500AK119412TTGGCCCACTCCSimilar to Endo-beta-mannosidase. 
Os05g0429000AK109617CCCACTCCSimilar to Hydroxymethyltransferase. 
Os05g0461300AK111917AATTGGGCCCCACTCCSimilar to RAB8C. 
AK111946AATTGGGCCCCACTCCNONE 
AK111972AATTGGGCCCCACTCCNONE 
AK112021AATTGGGCCCCACTCCNONE 
J033135H16AATTGGGCCCCACTCCNONE 
J043036O11AATTGGGCCCCACTCCNONE 
Os05g0466600009-088-F09CCCACTCCNONE 
009-105-C11CCCACTCCNONE 
009-156-C06CCCACTCCNONE 
AK119240CCCACTCChistone H4 [Oryza sativa (japonica cultivar-group)]. 
Os05g0506000AF031609CCCACTCCCCCANONE 
AK062012CCCACTCCCCCANONE 
AK098900CCCACTCCCCCANONE 
AK122090CCCACTCCCCCASimilar to MS5-like protein (Fragment). 
J013002B13CCCACTCCCCCANONE 
J023149G13CCCACTCCCCCANONE 
J033123O20CCCACTCCCCCANONE 
J080315O17CCCACTCCCCCANONE 
Os05g0510100Os05g0510100CCCACTCCProtein of unknown function DUF567 family protein. 
Os05g0533600AK067577TCCGGGCCCCACTCCSimilar to Starch synthase IVa (Glycogen (Starch) synthase-like). 
AY224560TCCGGGCCCCACTCCNONE 
AY373258TCCGGGCCCCACTCCNONE 
Os05g0535900AK101539GGAGTGGGACCCACNONE 
AK101555GGAGTGGGACCCACIQ calmodulin-binding region domain containing protein. 
J013047J05GGAGTGGGACCCACNONE 
Os05g0552300AK062179CCCACTCCSimilar to Guanine nucleotide-binding protein beta subunit-like protein (GPB-LR) (RWD). 
AK065272CCCACTCCNONE 
AK121567CCCACTCCNONE 
J013002L07CCCACTCCNONE 
J013096F06CCCACTCCNONE 
J013111B06CCCACTCCNONE 
J023024K23CCCACTCCNONE 
J023036P19CCCACTCCNONE 
J033034A18CCCACTCCNONE 
J033034P13CCCACTCCNONE 
J033051E12CCCACTCCNONE 
J033087M05CCCACTCCNONE 
J033092G03CCCACTCCNONE 
J033098N21CCCACTCCNONE 
J033103B15CCCACTCCNONE 
J043038F23CCCACTCCNONE 
J065096K22CCCACTCCNONE 
J065167D17CCCACTCCNONE 
J100040H06CCCACTCCNONE 
J100048M06CCCACTCCNONE 
J100087G01CCCACTCCNONE 
Os05g0576600AK107732GCCCCCACTCCConserved hypothetical protein. 
Os05g0585900AK062575GTGGGTCCCACTCCMitochondrial substrate carrier family protein. 
AK098854GTGGGTCCCACTCCNONE 
J013000H16GTGGGTCCCACTCCNONE 
J033118D07GTGGGTCCCACTCCNONE 
Os05g0586500AK106883GGAGTGGGAmino acid transporter, transmembrane family protein. 
Os05g0591400AK120015GGAGTGGGHeat shock protein Hsp70 family protein. 
Os05g0594800AK058332GGAGTGGGAdhesion regulating molecule family protein. 
AK068013GGAGTGGGNONE 
J013129L24GGAGTGGGNONE 
Os06g0102700AK067611GGAGTGGGSimilar to E3 ubiquitin ligase PUB14 (EC 6.3.2.-) (Prototypical U-box domain protein 14). 
AK071080GGAGTGGGNONE 
Os06g0128300AK064342CCCACTCCNONE 
AK072699CCCACTCCSimilar to Mitochondrial half-ABC transporter. 
Os06g0136900AK107405TGGTGGGCCCCACTCCProtein of unknown function DUF296 domain containing protein. 
Os06g0152800003-125-D04CCCACTCCNONE 
AK099578CCCACTCCConserved hypothetical protein. 
Os06g0205250J065122J15CCCACTCCConserved hypothetical protein. 
Os06g0212900AK071518GGCCGGGCCCCACTCCHeat shock protein Hsp70 family protein. 
AK104048GGCCGGGCCCCACTCCNONE 
J023019O18GGCCGGGCCCCACTCCNONE 
J023090N13GGCCGGGCCCCACTCCNONE 
J023101M15GGCCGGGCCCCACTCCNONE 
J023122F06GGCCGGGCCCCACTCCNONE 
J075023H16GGCCGGGCCCCACTCCNONE 
J090006J22GGCCGGGCCCCACTCCNONE 
J090075F24GGCCGGGCCCCACTCCNONE 
J090095A17GGCCGGGCCCCACTCCNONE 
Os06g0213900AK106922CCCACTCCConserved hypothetical protein. 
J090028K09CCCACTCCNONE 
J100078N13CCCACTCCNONE 
Os06g0222900AK109820CCCACTCCSimilar to Type I inositol-1,4,5-trisphosphate 5-phosphatase 2 (EC 3.1.3.56) (At5PTase2). 
Os06g0233200AK108060CCCACTCCSimilar to RING-H2 finger protein ATL1R (RING-H2 finger protein ATL8). 
Os06g0530400AB028186CCCACTCCOsNAC7 protein. 
AK102224CCCACTCCNONE 
J033030I06CCCACTCCNONE 
J033030M04CCCACTCCNONE 
J033037J02CCCACTCCNONE 
J033040P15CCCACTCCNONE 
J033068A10CCCACTCCNONE 
J033076J08CCCACTCCNONE 
J033087M22CCCACTCCNONE 
J033091L09CCCACTCCNONE 
J033108I07CCCACTCCNONE 
J033125A12CCCACTCCNONE 
J033125C12CCCACTCCNONE 
J065085E24CCCACTCCNONE 
J065119D20CCCACTCCNONE 
Os06g0545900AK070128CCCACTCCProtein of unknown function DUF246, plant family protein. 
Os06g0547500AK107081CCCACTCCConserved hypothetical protein. 
Os06g0562700AK109753CCCACTCCConserved hypothetical protein. 
Os06g0646600AB061818CCCACTCCKNOX family class 2 homeodomain protein. 
J023088C09CCCACTCCNONE 
J065162G03CCCACTCCNONE 
Os06g0666800AK103209CCCACTCTCCCACTCCCACTCCNONE 
AK107710CCCACTCTCCCACTCCCACTCCConserved hypothetical protein. 
Os06g0682300009-098-E01CCCACTCCNONE 
009-134-F09CCCACTCCNONE 
009-137-E02CCCACTCCNONE 
009-198-E05CCCACTCCNONE 
AK062934CCCACTCCHypothetical protein. 
J075053E04CCCACTCCNONE 
Os06g0704100AK103758CCCACTCCProtein of unknown function DUF547 domain containing protein. 
J033143F04CCCACTCCNONE 
J033144M16CCCACTCCNONE 
J033145M16CCCACTCCNONE 
Os06g0705000J075046P19CCCACTCCCATCCACCACGGCCCCAGConserved hypothetical protein. 
J075169H23CCCACTCCCATCCACCACGGCCCCAGNONE 
Os06g0712700AB003323GGAGTGGGNONE 
AF077760GGAGTGGGNONE 
AK069317GGAGTGGGMADS-box protein SPW1. 
J023014M24GGAGTGGGNONE 
J090059F11GGAGTGGGNONE 
J090084J02GGAGTGGGNONE 
Os07g0139400AB096864CGCGTGGGCCCCACTCCNONE 
AK065558CGCGTGGGCCCCACTCCUDP-glucose 4-epimerase family protein. 
AK099140CGCGTGGGCCCCACTCCNONE 
AK099183CGCGTGGGCCCCACTCCNONE 
J013033B01CGCGTGGGCCCCACTCCNONE 
J013157B14CGCGTGGGCCCCACTCCNONE 
J023052E04CGCGTGGGCCCCACTCCNONE 
J023086K05CGCGTGGGCCCCACTCCNONE 
J023099C15CGCGTGGGCCCCACTCCNONE 
J033025C08CGCGTGGGCCCCACTCCNONE 
J033072I24CGCGTGGGCCCCACTCCNONE 
J043020I04CGCGTGGGCCCCACTCCNONE 
J090039I21CGCGTGGGCCCCACTCCNONE 
J090078P20CGCGTGGGCCCCACTCCNONE 
J090084C18CGCGTGGGCCCCACTCCNONE 
J100024F07CGCGTGGGCCCCACTCCNONE 
J100054D22CGCGTGGGCCCCACTCCNONE 
J100062O08CGCGTGGGCCCCACTCCNONE 
Os07g0181000AK066918CACGTGGCCCCACTCCNONE 
AK070512CACGTGGCCCCACTCCSimilar to Pyruvate kinase isozyme A, chloroplast precursor (EC 2.7.1.40). 
Os07g0184900AK102066TCGGCCCGTGGGCCGTGTTGGGCCGAGGCCCACGTGGGAGTGGGAAGGCCCACGCACCGCSimilar to Ku70-like protein. 
Os07g0409100003-111-B11CCCACTCCNONE 
AK060230CCCACTCCSimilar to CLB1. 
J065178I05CCCACTCCNONE 
Os07g0442000AK068559CCCACTCCCyclin-like F-box domain containing protein. 
Os07g0486000AK069343ACAGCCCACTCCSimilar to MSH4. 
Os07g0561300AK072982CCCACTCCGCCCAACCCyclin-like F-box domain containing protein. 
J023149I22CCCACTCCGCCCAACCNONE 
J065149C18CCCACTCCGCCCAACCNONE 
J065166N15CCCACTCCGCCCAACCNONE 
J075011J01CCCACTCCGCCCAACCNONE 
J075013I05CCCACTCCGCCCAACCNONE 
J075039H11CCCACTCCGCCCAACCNONE 
J075067J09CCCACTCCGCCCAACCNONE 
J075084E08CCCACTCCGCCCAACCNONE 
J075085E12CCCACTCCGCCCAACCNONE 
J075090D11CCCACTCCGCCCAACCNONE 
J075092D12CCCACTCCGCCCAACCNONE 
J075126N17CCCACTCCGCCCAACCNONE 
J075179F01CCCACTCCGCCCAACCNONE 
J075184P21CCCACTCCGCCCAACCNONE 
Os07g0562800AY374513TGGGGGAGTGGGMyosin heavy chain class VIII A1 protein. 
J013050C16TGGGGGAGTGGGNONE 
J013071C23TGGGGGAGTGGGNONE 
J013126F22TGGGGGAGTGGGNONE 
J013155K02TGGGGGAGTGGGNONE 
J013170J03TGGGGGAGTGGGNONE 
J033031C06TGGGGGAGTGGGNONE 
J033067N11TGGGGGAGTGGGNONE 
J033098C14TGGGGGAGTGGGNONE 
J033110O21TGGGGGAGTGGGNONE 
J090034G13TGGGGGAGTGGGNONE 
J090039H15TGGGGGAGTGGGNONE 
J090076F24TGGGGGAGTGGGNONE 
J090077N06TGGGGGAGTGGGNONE 
J090097E03TGGGGGAGTGGGNONE 
Os07g0578600AK067155TTCGGCCCGGCCCACTCCSimilar to 5-formyltetrahydrofolate cycloligase (EC 6.3.3.2). 
AK106065TTCGGCCCGGCCCACTCCNONE 
Os07g0584500003-129-F05GGCCCCACTCCNONE 
006-119-H08GGCCCCACTCCNONE 
011-022-G03GGCCCCACTCCNONE 
AK067725GGCCCCACTCCRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
AK121109GGCCCCACTCCNONE 
J013055C05GGCCCCACTCCNONE 
J013062F12GGCCCCACTCCNONE 
J013069J22GGCCCCACTCCNONE 
J013114I11GGCCCCACTCCNONE 
J023072P12GGCCCCACTCCNONE 
Os07g0611700AK109158CCCACTCCPeptidase C1A, papain family protein. 
Os07g0611800Os07g0611800CCCACTCCNONE 
Os07g0614100AB032062TCTGGGCCCACTCCNONE 
AK058885TCTGGGCCCACTCCNONE 
AK069145TCTGGGCCCACTCCNONE 
AK102448TCTGGGCCCACTCCAlpha 1-2 subunit of 20S proteasome. 
J023007E07TCTGGGCCCACTCCNONE 
J033093O06TCTGGGCCCACTCCNONE 
Os07g0639900J080305F09CCCACTCCNONE 
J080305J22CCCACTCCThymidylate kinase domain containing protein. 
J080311G07CCCACTCCNONE 
J080315B14CCCACTCCNONE 
J080317C02CCCACTCCNONE 
Os07g0670300006-085-D04CAAGTGGGTCCCACTCCNONE 
006-116-A08CAAGTGGGTCCCACTCCNONE 
AK061154CAAGTGGGTCCCACTCCC2 calcium/lipid-binding region, CaLB domain containing protein. 
AK099020CAAGTGGGTCCCACTCCNONE 
J100056C05CAAGTGGGTCCCACTCCNONE 
Os07g0686300009-078-D10GGAGTGGGNONE 
AK062636GGAGTGGGZinc finger, RING-type domain containing protein. 
Os08g0157900012-025-H08GGAGTGGGGGATNONE 
012-069-E02GGAGTGGGGGATNONE 
012-074-H11GGAGTGGGGGATNONE 
AK065294GGAGTGGGGGATSimilar to NAM protein. 
J013002N10GGAGTGGGGGATNONE 
J013042J10GGAGTGGGGGATNONE 
J023060K03GGAGTGGGGGATNONE 
J023145N12GGAGTGGGGGATNONE 
J033040L20GGAGTGGGGGATNONE 
J033044L13GGAGTGGGGGATNONE 
J033057C19GGAGTGGGGGATNONE 
J033107E01GGAGTGGGGGATNONE 
J033123M07GGAGTGGGGGATNONE 
J033136I18GGAGTGGGGGATNONE 
J065051P18GGAGTGGGGGATNONE 
J065055L08GGAGTGGGGGATNONE 
J065196D15GGAGTGGGGGATNONE 
Os08g0158200AK069480CCCACTCCFAD linked oxidase, N-terminal domain containing protein. 
AK104045CCCACTCCNONE 
J023019G18CCCACTCCNONE 
Os08g0163400AB005290CCCACTCCSigma-70 factor family protein. 
AK065997CCCACTCCNONE 
AK071725CCCACTCCNONE 
Os08g0260400Os08g0260400GGGCCCCACTCCCCCAHelix-loop-helix DNA-binding domain containing protein. 
Os08g0267900AK107040CCCACTCCCCACGCGConserved hypothetical protein. 
Os08g0322600AK069839CCCACTCCSimilar to PGT-2. 
AK119582CCCACTCCNONE 
J023031A12CCCACTCCNONE 
Os08g0474000009-121-F01CCCACTCCNONE 
009-124-B06CCCACTCCNONE 
AK062882CCCACTCCSimilar to AP2 domain containing protein RAP2.6 (Fragment). 
Os08g0476000J065040M11CCCACTCCNONE 
J065051M03CCCACTCCNONE 
J065065F08CCCACTCCNONE 
Os08g0562200012-007-B02GGAGTGGGNONE 
015-036-E09GGAGTGGGNONE 
AK069733GGAGTGGGNONE 
AK099629GGAGTGGGNONE 
AK120773GGAGTGGGSimilar to CUC2. 
J013027E01GGAGTGGGNONE 
J013031K05GGAGTGGGNONE 
J013042K12GGAGTGGGNONE 
J013043K01GGAGTGGGNONE 
J013049B18GGAGTGGGNONE 
J013057C07GGAGTGGGNONE 
J013065D15GGAGTGGGNONE 
J013088P16GGAGTGGGNONE 
J013130H20GGAGTGGGNONE 
J013157B22GGAGTGGGNONE 
J013159D19GGAGTGGGNONE 
J023008J18GGAGTGGGNONE 
J023027C11GGAGTGGGNONE 
J023030H12GGAGTGGGNONE 
J023075L24GGAGTGGGNONE 
J023088D11GGAGTGGGNONE 
J023092B13GGAGTGGGNONE 
J023107F04GGAGTGGGNONE 
J023139O06GGAGTGGGNONE 
J033035M23GGAGTGGGNONE 
J033067N08GGAGTGGGNONE 
J033074F09GGAGTGGGNONE 
J033076F16GGAGTGGGNONE 
J033086J22GGAGTGGGNONE 
J033089C24GGAGTGGGNONE 
J033117K16GGAGTGGGNONE 
J033133E06GGAGTGGGNONE 
J043017H15GGAGTGGGNONE 
J065142G10GGAGTGGGNONE 
J090009K07GGAGTGGGNONE 
J090041F21GGAGTGGGNONE 
J090049B08GGAGTGGGNONE 
J090054A03GGAGTGGGNONE 
J090072E17GGAGTGGGNONE 
J090082H06GGAGTGGGNONE 
J090091F07GGAGTGGGNONE 
J100024G17GGAGTGGGNONE 
J100024O05GGAGTGGGNONE 
J100034B19GGAGTGGGNONE 
J100036P16GGAGTGGGNONE 
J100051A18GGAGTGGGNONE 
J100060M19GGAGTGGGNONE 
J100063L19GGAGTGGGNONE 
J100072L20GGAGTGGGNONE 
J100074D22GGAGTGGGNONE 
Os09g0321300AK122141GGAGTGGGNONE 
Os09g0323000AK121426CGCGTGGGCCCCACTCCACCTGTCSimilar to UDP-galactose 4-epimerase-like protein. 
Os09g0382500009-117-E11GGAGTGGGNONE 
AK105199GGAGTGGGConserved hypothetical protein. 
Os09g0400700009-060-D04CCCACTCCCCCANONE 
009-104-G09CCCACTCCCCCANONE 
009-106-D08CCCACTCCCCCANONE 
014-041-F03CCCACTCCCCCANONE 
AK062784CCCACTCCCCCAConserved hypothetical protein. 
Os09g0401200AK063980GGAGTGGGCTTTSimilar to HSP associated protein like. 
Os09g0402100009-119-F11GACAGGTGGGCCCCACTCCNONE 
009-166-C09GACAGGTGGGCCCCACTCCNONE 
AK068506GACAGGTGGGCCCCACTCCPF1 protein. 
J065130I01GACAGGTGGGCCCCACTCCNONE 
L24390GACAGGTGGGCCCCACTCCNONE 
Os09g0406900012-044-F05GGAGTGGGNONE 
AK063485GGAGTGGGNONE 
AK067460GGAGTGGGConserved hypothetical protein. 
Os09g0418000006-022-F01CCCACTCCNONE 
006-038-G10CCCACTCCNONE 
006-089-G04CCCACTCCNONE 
006-098-F07CCCACTCCNONE 
AK061220CCCACTCCNONE 
AK061493CCCACTCCNONE 
AK100881CCCACTCCNONE 
AK119760CCCACTCCProtein kinase-like domain containing protein. 
J023127H10CCCACTCCNONE 
J033122J01CCCACTCCNONE 
J065162D08CCCACTCCNONE 
J065214P03CCCACTCCNONE 
J090009B17CCCACTCCNONE 
J090093C21CCCACTCCNONE 
J100067C01CCCACTCCNONE 
J100067P06CCCACTCCNONE 
Os09g0437900AK107833GGAGTGGGSimilar to Adrenodoxin. 
Os09g0445500AK120514CTCCCCCACTCCZinc finger, C2H2-type domain containing protein. 
J013124A16CTCCCCCACTCCNONE 
Os09g0527700AK111128CCCACTCCSimilar to Auxin-induced protein IAA4. 
J065124H12CCCACTCCNONE 
J065181I07CCCACTCCNONE 
J065207G14CCCACTCCNONE 
Os09g0547200016-021-H03GGTGGGGCCCACTCCAACGGNONE 
AK073078GGTGGGGCCCACTCCAACGGProtein of unknown function DUF292, eukaryotic domain containing protein. 
AK104984GGTGGGGCCCACTCCAACGGNONE 
J065005L05GGTGGGGCCCACTCCAACGGNONE 
J065039C06GGTGGGGCCCACTCCAACGGNONE 
J065116H17GGTGGGGCCCACTCCAACGGNONE 
J100046A17GGTGGGGCCCACTCCAACGGNONE 
Os11g0102200AJ252142CCCACTCCSimilar to NPH1-1. 
J065179F12CCCACTCCNONE 
Os11g0111200AK109277GGAGTGGGConserved hypothetical protein. 
Os11g0157100012-010-F03GGAGTGGGCCTGAAACGGGCCNONE 
J013028H01GGAGTGGGCCTGAAACGGGCCNONE 
J013061L19GGAGTGGGCCTGAAACGGGCCNONE 
J033044L03GGAGTGGGCCTGAAACGGGCCNONE 
J033064P09GGAGTGGGCCTGAAACGGGCCNONE 
J033076A10GGAGTGGGCCTGAAACGGGCCNONE 
J033076K22GGAGTGGGCCTGAAACGGGCCNONE 
J033084J05GGAGTGGGCCTGAAACGGGCCNONE 
J033145A22GGAGTGGGCCTGAAACGGGCCNONE 
J033148L19GGAGTGGGCCTGAAACGGGCCNONE 
J065027P20GGAGTGGGCCTGAAACGGGCCNONE 
J065085D16GGAGTGGGCCTGAAACGGGCCNONE 
J065091L03GGAGTGGGCCTGAAACGGGCCNONE 
J065195C18GGAGTGGGCCTGAAACGGGCCNONE 
J090018N23GGAGTGGGCCTGAAACGGGCCNONE 
J090048A10GGAGTGGGCCTGAAACGGGCCNONE 
J090048M03GGAGTGGGCCTGAAACGGGCCNONE 
J090066L11GGAGTGGGCCTGAAACGGGCCNONE 
J090075G16GGAGTGGGCCTGAAACGGGCCNONE 
J090083G23GGAGTGGGCCTGAAACGGGCCNONE 
J090087E24GGAGTGGGCCTGAAACGGGCCNONE 
J090096H16GGAGTGGGCCTGAAACGGGCCNONE 
Os11g0210300009-169-E10CCCACTCCGTCCGNONE 
012-007-H08CCCACTCCGTCCGNONE 
012-065-A02CCCACTCCGTCCGNONE 
012-095-H06CCCACTCCGTCCGNONE 
015-007-F02CCCACTCCGTCCGNONE 
015-017-F10CCCACTCCGTCCGNONE 
015-078-F12CCCACTCCGTCCGNONE 
016-085-G04CCCACTCCGTCCGNONE 
AK061267CCCACTCCGTCCGNONE 
AK069330CCCACTCCGTCCGAlcohol dehydrogenase 1. 
D10412CCCACTCCGTCCGNONE 
J023026C01CCCACTCCGTCCGNONE 
J023037O21CCCACTCCGTCCGNONE 
J023044J09CCCACTCCGTCCGNONE 
J023066N19CCCACTCCGTCCGNONE 
J023100L06CCCACTCCGTCCGNONE 
J023121G14CCCACTCCGTCCGNONE 
J023132I24CCCACTCCGTCCGNONE 
J023134J18CCCACTCCGTCCGNONE 
J033024J23CCCACTCCGTCCGNONE 
J033029B21CCCACTCCGTCCGNONE 
J033030H09CCCACTCCGTCCGNONE 
J033040N09CCCACTCCGTCCGNONE 
J033050I11CCCACTCCGTCCGNONE 
J033052F03CCCACTCCGTCCGNONE 
J033067J22CCCACTCCGTCCGNONE 
J033068K15CCCACTCCGTCCGNONE 
J033070A13CCCACTCCGTCCGNONE 
J033072A02CCCACTCCGTCCGNONE 
J033072F17CCCACTCCGTCCGNONE 
J033081C02CCCACTCCGTCCGNONE 
J033082F08CCCACTCCGTCCGNONE 
J033086L02CCCACTCCGTCCGNONE 
J033087O09CCCACTCCGTCCGNONE 
J033088P05CCCACTCCGTCCGNONE 
J033094D13CCCACTCCGTCCGNONE 
J033098I11CCCACTCCGTCCGNONE 
J033102I15CCCACTCCGTCCGNONE 
J033102P13CCCACTCCGTCCGNONE 
J033103N07CCCACTCCGTCCGNONE 
J033109A11CCCACTCCGTCCGNONE 
J033109O05CCCACTCCGTCCGNONE 
J033111K07CCCACTCCGTCCGNONE 
J033113I09CCCACTCCGTCCGNONE 
J033113I10CCCACTCCGTCCGNONE 
J033115B12CCCACTCCGTCCGNONE 
J033121D20CCCACTCCGTCCGNONE 
J033125H21CCCACTCCGTCCGNONE 
J033128M09CCCACTCCGTCCGNONE 
J033135L03CCCACTCCGTCCGNONE 
J033136O13CCCACTCCGTCCGNONE 
J043003H06CCCACTCCGTCCGNONE 
J043010B17CCCACTCCGTCCGNONE 
J043015O11CCCACTCCGTCCGNONE 
J043026D03CCCACTCCGTCCGNONE 
J043030G18CCCACTCCGTCCGNONE 
J043035L17CCCACTCCGTCCGNONE 
J043037K04CCCACTCCGTCCGNONE 
J043040G24CCCACTCCGTCCGNONE 
J053024N13CCCACTCCGTCCGNONE 
J065035H08CCCACTCCGTCCGNONE 
J065116G23CCCACTCCGTCCGNONE 
J065138J15CCCACTCCGTCCGNONE 
J065161L12CCCACTCCGTCCGNONE 
J075011O04CCCACTCCGTCCGNONE 
J075109M05CCCACTCCGTCCGNONE 
J075133K12CCCACTCCGTCCGNONE 
J075167H23CCCACTCCGTCCGNONE 
J075198I09CCCACTCCGTCCGNONE 
J100023O11CCCACTCCGTCCGNONE 
J100042B17CCCACTCCGTCCGNONE 
J100052M16CCCACTCCGTCCGNONE 
J100059M23CCCACTCCGTCCGNONE 
J100076G19CCCACTCCGTCCGNONE 
X16296CCCACTCCGTCCGNONE 
Os11g0438700012-011-H02GGAGTGGGNONE 
AK063434GGAGTGGGSimilar to Tropinone reductase-I (EC 1.1.1.206) (TR-I) (Tropine dehydrogenase). 
AK073524GGAGTGGGNONE 
J033046I10GGAGTGGGNONE 
J043029B09GGAGTGGGNONE 
J065033C17GGAGTGGGNONE 
J065062D11GGAGTGGGNONE 
J065138G10GGAGTGGGNONE 
J065184I11GGAGTGGGNONE 
J080030B02GGAGTGGGNONE 
J090063K06GGAGTGGGNONE 
Os12g0132800AF543419CCCACTCCMajor facilitator superfamily antiporter. 
J065031E22CCCACTCCNONE 
J065057E09CCCACTCCNONE 
Os12g0155200AK067300TTGGCCCACTCCSimilar to Rac GTPase activating protein. 
J090050C04TTGGCCCACTCCNONE 
Os12g0175400009-157-A08CAAGTGGGACCCACTCCNONE 
011-089-A10CAAGTGGGACCCACTCCNONE 
AK063027CAAGTGGGACCCACTCCNONE 
D88618CAAGTGGGACCCACTCCHomeodomain-like containing protein. 
Os12g0189300AK068710GTGGCGTGGGCCCCACTCCCGGCCCACCAGGCCCAGCCCIsocitrate lyase and phosphorylmutase family protein. 
Os12g0194700AK121912CCCACTCCDNA-directed RNA polymerase, 13 to 16 kDa subunit family protein. 
J033106A07CCCACTCCNONE 
Os12g0194800011-016-B07GGAGTGGGNONE 
AK101810GGAGTGGGtRNA pseudouridine synthase family protein. 
AK107780GGAGTGGGNONE 
J043034C07GGAGTGGGNONE 
Os12g0547100009-053-F04CCCACTCCCCCANONE 
009-080-H03CCCACTCCCCCANONE 
AK105589CCCACTCCCCCAConserved hypothetical protein. 
AK121480CCCACTCCCCCANONE 
J023149J02CCCACTCCCCCANONE 
Os12g0572400016-084-F04CCCACTCCGGGCCNONE 
AK065531CCCACTCCGGGCCSimilar to SC35-like splicing factor SCL30, 30 kD. 
J013025H03CCCACTCCGGGCCNONE 
J013034H02CCCACTCCGGGCCNONE 
J033117N05CCCACTCCGGGCCNONE 
J065027L09CCCACTCCGGGCCNONE 
J065037D09CCCACTCCGGGCCNONE 
J065197I09CCCACTCCGGGCCNONE 
J090045C01CCCACTCCGGGCCNONE 
J100031E11CCCACTCCGGGCCNONE 
Os12g0597500AK101904CCCACTCCTGGGCCCAGCCCATCCANONE 
AK103799CCCACTCCTGGGCCCAGCCCATCCAAmidase, hydantoinase/carbamoylase family protein. 
J065206A02CCCACTCCTGGGCCCAGCCCATCCANONE 
J100078O15CCCACTCCTGGGCCCAGCCCATCCANONE 
Os12g0605800AK121511CTGACAGGTGGGTCCCACTCCSimilar to 3-methylcrotonyl CoA carboxylase biotin-containing subunit (Fragment). 
Os12g0634900AK106811GGAGTGGGACCCTetratricopeptide-like helical domain containing protein. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.