version

Summary of OsREG533 (All List)

OrganismOryza sativa  
IDOsREG533  
SequenceCCCAGCCC  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count1855  

Entry Sequences (1855 entries)

LocusGene modelSequenceDescription
Os01g0100700006-066-G10CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
009-108-B10CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
AK059844CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
AK121523CCTGGGCCGGGCCCGGCCCAGCCCAACASimilar to 40S ribosomal protein S5-1. 
J023037D16CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J033028P14CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J033064M07CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J033123M01CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J065026O07CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J065082A05CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J075003I02CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J075170J15CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J100040D18CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
Os01g0102700009-009-A07GCAGCCCAGCCCAGNONE 
AK063774GCAGCCCAGCCCAGTranslocon-associated beta family protein. 
AK099081GCAGCCCAGCCCAGNONE 
AK099360GCAGCCCAGCCCAGNONE 
J013096O20GCAGCCCAGCCCAGNONE 
J023002P14GCAGCCCAGCCCAGNONE 
J033046F10GCAGCCCAGCCCAGNONE 
J033084K08GCAGCCCAGCCCAGNONE 
J065011H22GCAGCCCAGCCCAGNONE 
J090017O18GCAGCCCAGCCCAGNONE 
J090047F15GCAGCCCAGCCCAGNONE 
J090049G20GCAGCCCAGCCCAGNONE 
Os01g0138500AK073435CCCAGCCCProtein of unknown function DUF789 family protein. 
J023118K18CCCAGCCCNONE 
J033039C22CCCAGCCCNONE 
Os01g0139600AK073130CCCAGCCCATGTSimilar to Lipid phosphate phosphatase 2 (EC 3.1.3.-) (AtLPP2) (Phosphatidic acid phosphatase 2) (AtPAP2) (Prenyl diphosphate phosphatase). 
Os01g0157900AK072658CTTGGGCTGGGCCGGCTGGGCCTTProtein of unknown function Cys-rich family protein. 
Os01g0172200AK100326TGTGGGCTGGGCCGGAWW/Rsp5/WWP domain containing protein. 
Os01g0179300AB118015CCCAGCCCAGNONE 
AK066179CCCAGCCCAGConserved hypothetical protein. 
J013027I24CCCAGCCCAGNONE 
J013057C04CCCAGCCCAGNONE 
J013114A12CCCAGCCCAGNONE 
J033044D13CCCAGCCCAGNONE 
J033088C17CCCAGCCCAGNONE 
J065079P13CCCAGCCCAGNONE 
J065097I15CCCAGCCCAGNONE 
J100025A19CCCAGCCCAGNONE 
J100027L07CCCAGCCCAGNONE 
J100035E12CCCAGCCCAGNONE 
J100076G01CCCAGCCCAGNONE 
Os01g0180300AK120377GCTGGGCTGGGCCCACACLipoprotein, type 6 family protein. 
J013071N06GCTGGGCTGGGCCCACACNONE 
J023088F12GCTGGGCTGGGCCCACACNONE 
J100027H24GCTGGGCTGGGCCCACACNONE 
J100053K15GCTGGGCTGGGCCCACACNONE 
J100082M15GCTGGGCTGGGCCCACACNONE 
Os01g0224500AK109225GCAGCCCAGCCCAACTCCCACCTGTConserved hypothetical protein. 
Os01g0286600AB057749CCCAGCCCATTSimilar to Plastidal protoporphyrinogen oxidase. 
Os01g0324400AK102854ACAGCCCAGCCCACCAGGCCCACANONE 
AK111299ACAGCCCAGCCCACCAGGCCCACANONE 
J033032A11ACAGCCCAGCCCACCAGGCCCACANONE 
J033110L02ACAGCCCAGCCCACCAGGCCCACANONE 
Os01g0358300AK060388AAATGGGCTGGGNONE 
AK072081AAATGGGCTGGGTetratricopeptide-like helical domain containing protein. 
Os01g0358400006-031-B11CCCAGCCCATTTNONE 
006-083-B11CCCAGCCCATTTNONE 
006-083-C09CCCAGCCCATTTNONE 
006-088-H03CCCAGCCCATTTNONE 
006-102-H05CCCAGCCCATTTNONE 
AK061826CCCAGCCCATTTSimilar to 40S ribosomal protein S4. 
J013105M07CCCAGCCCATTTNONE 
J013155A16CCCAGCCCATTTNONE 
J033025C03CCCAGCCCATTTNONE 
J033072L20CCCAGCCCATTTNONE 
J033095I15CCCAGCCCATTTNONE 
J033105E03CCCAGCCCATTTNONE 
J033112G18CCCAGCCCATTTNONE 
J033125D09CCCAGCCCATTTNONE 
J065100L16CCCAGCCCATTTNONE 
J065176I05CCCAGCCCATTTNONE 
J090001C14CCCAGCCCATTTNONE 
J090058E15CCCAGCCCATTTNONE 
J090068F07CCCAGCCCATTTNONE 
Os01g0530300AK111105AAGGCCCAGCCCATACHypothetical protein. 
J090023M11AAGGCCCAGCCCATACNONE 
J090053G13AAGGCCCAGCCCATACNONE 
Os01g0551000006-104-A04CCCAGCCCGGCCCAACCNONE 
009-183-B08CCCAGCCCGGCCCAACCNONE 
AK071219CCCAGCCCGGCCCAACCConserved hypothetical protein. 
AK106034CCCAGCCCGGCCCAACCNONE 
Os01g0587000AK067605CCCAGCCCASimilar to Vacuolar ATP synthase subunit d (EC 3.6.3.14) (V-ATPase d subunit) (Vacuolar proton pump d subunit) (V-ATPase 41 KDa accessory protein) (DVA41). 
Os01g0661400AK073113AGCCCAGCCCAAACNucleic acid-binding, OB-fold domain containing protein. 
J023014C20AGCCCAGCCCAAACNONE 
J033022G03AGCCCAGCCCAAACNONE 
J065050H15AGCCCAGCCCAAACNONE 
J065059J19AGCCCAGCCCAAACNONE 
J065085I24AGCCCAGCCCAAACNONE 
J065166G12AGCCCAGCCCAAACNONE 
J065182C18AGCCCAGCCCAAACNONE 
Os01g0691500AK073675GGGCTGGGNONE 
AK107426GGGCTGGGCytidylyltransferase domain containing protein. 
J013055P17GGGCTGGGNONE 
J033050M21GGGCTGGGNONE 
Os01g0710000AK111794AAATGGGCCCAGCCCACASimilar to WD-repeat protein RBAP1. 
J023006D22AAATGGGCCCAGCCCACANONE 
J065106P04AAATGGGCCCAGCCCACANONE 
J100036G13AAATGGGCCCAGCCCACANONE 
Os01g0745700009-020-H03GGGCTGGGCTNONE 
AK062377GGGCTGGGCTNONE 
AK121896GGGCTGGGCTSimilar to GATA transcription factor 3 (AtGATA-3). 
J033105E11GGGCTGGGCTNONE 
J075022B21GGGCTGGGCTNONE 
J075147O07GGGCTGGGCTNONE 
Os01g0765000AK101905TCAGCCCAGCCCAACSimilar to Deoxycytidylate deaminase (EC 3.5.4.12) (dCMP deaminase). 
Os01g0785600AK111308TTGGCCCAGCCCAATAMethyltransferase type 11 domain containing protein. 
Os01g0785700AK100774TATTGGGCTGGGCCAANONE 
AK102081TATTGGGCTGGGCCAAProtein prenyltransferase domain containing protein. 
AY129829TATTGGGCTGGGCCAANONE 
J023120B17TATTGGGCTGGGCCAANONE 
J033082K10TATTGGGCTGGGCCAANONE 
Os01g0810000AK102143GTTTGGGCTGGGCTGCNONE 
AK120752GTTTGGGCTGGGCTGCUtp11 family protein. 
J023006E09GTTTGGGCTGGGCTGCNONE 
J033086A13GTTTGGGCTGGGCTGCNONE 
J033133K07GTTTGGGCTGGGCTGCNONE 
J065066L16GTTTGGGCTGGGCTGCNONE 
J065161C01GTTTGGGCTGGGCTGCNONE 
J100027D18GTTTGGGCTGGGCTGCNONE 
J100063J12GTTTGGGCTGGGCTGCNONE 
Os01g0810100AK071916ATGGCCCAGCCCAATTRibonuclease III domain containing protein. 
AK099056ATGGCCCAGCCCAATTNONE 
AK104320ATGGCCCAGCCCAATTNONE 
Os01g0813400006-025-B06TGTTGGGCTGGGCCGGGNONE 
006-030-C07TGTTGGGCTGGGCCGGGNONE 
006-068-F06TGTTGGGCTGGGCCGGGNONE 
006-096-E09TGTTGGGCTGGGCCGGGNONE 
006-097-B11TGTTGGGCTGGGCCGGGNONE 
006-104-H02TGTTGGGCTGGGCCGGGNONE 
AK062251TGTTGGGCTGGGCCGGGNONE 
AK065370TGTTGGGCTGGGCCGGGSimilar to ADP-ribosylation factor 1. 
J013022G24TGTTGGGCTGGGCCGGGNONE 
J013104C07TGTTGGGCTGGGCCGGGNONE 
J023074M17TGTTGGGCTGGGCCGGGNONE 
J043027C07TGTTGGGCTGGGCCGGGNONE 
J065026K05TGTTGGGCTGGGCCGGGNONE 
J065103I01TGTTGGGCTGGGCCGGGNONE 
J090025M17TGTTGGGCTGGGCCGGGNONE 
J100027L03TGTTGGGCTGGGCCGGGNONE 
J100054I20TGTTGGGCTGGGCCGGGNONE 
Os01g0814200AK070675CCCAGCCCNONE 
AK073107CCCAGCCCSimilar to Type I inositol-1,4,5-trisphosphate 5-phosphatase CVP2 (EC 3.1.3.56) (Cotyledon vascular pattern 2 protein). 
J023061B19CCCAGCCCNONE 
Os01g0869600AK060596TTTGGGCTGGGGCCCACATGTCAGTGTRAM, LAG1 and CLN8 homology domain containing protein. 
AK070678TTTGGGCTGGGGCCCACATGTCAGTGNONE 
Os01g0885600AK059523CAGCCCAGCCCAAGGCCCACCAEsterase/lipase/thioesterase domain containing protein. 
J065013G01CAGCCCAGCCCAAGGCCCACCANONE 
J065063D03CAGCCCAGCCCAAGGCCCACCANONE 
J065143H01CAGCCCAGCCCAAGGCCCACCANONE 
J065146F08CAGCCCAGCCCAAGGCCCACCANONE 
J065153D14CAGCCCAGCCCAAGGCCCACCANONE 
J065170E02CAGCCCAGCCCAAGGCCCACCANONE 
J065175M22CAGCCCAGCCCAAGGCCCACCANONE 
J065186E13CAGCCCAGCCCAAGGCCCACCANONE 
J075023J16CAGCCCAGCCCAAGGCCCACCANONE 
J075176J06CAGCCCAGCCCAAGGCCCACCANONE 
Os01g0921600AK071344GGTGGGCTGGGCCGGGSimilar to Mitochondrial import receptor subunit TOM20 (Translocase of outer membrane 20 kDa subunit). 
J013039J22GGTGGGCTGGGCCGGGNONE 
J013109E03GGTGGGCTGGGCCGGGNONE 
J023081J12GGTGGGCTGGGCCGGGNONE 
J023091E24GGTGGGCTGGGCCGGGNONE 
J033022A01GGTGGGCTGGGCCGGGNONE 
J033074C13GGTGGGCTGGGCCGGGNONE 
J065199E03GGTGGGCTGGGCCGGGNONE 
J075172O04GGTGGGCTGGGCCGGGNONE 
J090007G18GGTGGGCTGGGCCGGGNONE 
J090052B17GGTGGGCTGGGCCGGGNONE 
J090074H01GGTGGGCTGGGCCGGGNONE 
J100043J09GGTGGGCTGGGCCGGGNONE 
J100059J05GGTGGGCTGGGCCGGGNONE 
Os01g0929000AK073334CTGGGCTGGGConserved hypothetical protein. 
J033024D22CTGGGCTGGGNONE 
Os01g0938900006-059-H02GACGGCCCAGCCCATTTNONE 
009-074-D12GACGGCCCAGCCCATTTNONE 
AK059437GACGGCCCAGCCCATTTNONE 
AK101971GACGGCCCAGCCCATTTSimilar to Nascent polypeptide-associated complex alpha subunit-like protein 3 (NAC-alpha-like protein 3) (Alpha-NAC-like protein 3). 
AK109341GACGGCCCAGCCCATTTNONE 
J023121P08GACGGCCCAGCCCATTTNONE 
J033046G24GACGGCCCAGCCCATTTNONE 
J033048E04GACGGCCCAGCCCATTTNONE 
J033048F04GACGGCCCAGCCCATTTNONE 
J033076L24GACGGCCCAGCCCATTTNONE 
J065173H07GACGGCCCAGCCCATTTNONE 
J065184H09GACGGCCCAGCCCATTTNONE 
Os01g0942300AK063126GGCCGGGCTGGGSimilar to Beta glucanase precursor (EC 3.2.1.73) (Fragment). 
Os01g0951800AK069239TCAGGCCCAGCCCProtein prenyltransferase domain containing protein. 
Os01g0958100AK058574GCCCAGCCCNONE 
AK103090GCCCAGCCCSimilar to Chloroplast SRP receptor cpFtsY precursor. 
AK109369GCCCAGCCCNONE 
Os01g0970900011-018-A07GAGGCCCAGCCCATCTNONE 
011-022-E12GAGGCCCAGCCCATCTNONE 
AK063285GAGGCCCAGCCCATCTNONE 
AK101688GAGGCCCAGCCCATCTProtein prenyltransferase domain containing protein. 
J100042L01GAGGCCCAGCCCATCTNONE 
J100053B11GAGGCCCAGCCCATCTNONE 
Os01g0972800AK110625CTGGGCTGGGNONE 
AY341842CTGGGCTGGGWRKY1 (WRKY transcription factor 17). 
AY870605CTGGGCTGGGNONE 
Os02g0162500009-181-F03TTGGCCCAGCCCATAANONE 
AK058907TTGGCCCAGCCCATAANONE 
AK121223TTGGCCCAGCCCATAASimilar to 40S ribosomal protein S14. 
J023090I10TTGGCCCAGCCCATAANONE 
J023136J11TTGGCCCAGCCCATAANONE 
J053097J20TTGGCCCAGCCCATAANONE 
J053098F01TTGGCCCAGCCCATAANONE 
J065065B09TTGGCCCAGCCCATAANONE 
J065082M04TTGGCCCAGCCCATAANONE 
J065188O05TTGGCCCAGCCCATAANONE 
J075057P15TTGGCCCAGCCCATAANONE 
J075061J08TTGGCCCAGCCCATAANONE 
J075061N15TTGGCCCAGCCCATAANONE 
J075131I08TTGGCCCAGCCCATAANONE 
J075141H13TTGGCCCAGCCCATAANONE 
J080062E14TTGGCCCAGCCCATAANONE 
J080062P15TTGGCCCAGCCCATAANONE 
J080318G17TTGGCCCAGCCCATAANONE 
J080319G19TTGGCCCAGCCCATAANONE 
J090001L10TTGGCCCAGCCCATAANONE 
J090024I18TTGGCCCAGCCCATAANONE 
J090033F24TTGGCCCAGCCCATAANONE 
J090036M16TTGGCCCAGCCCATAANONE 
J090040I24TTGGCCCAGCCCATAANONE 
J090048P06TTGGCCCAGCCCATAANONE 
J090049B12TTGGCCCAGCCCATAANONE 
J090068C02TTGGCCCAGCCCATAANONE 
J090069O04TTGGCCCAGCCCATAANONE 
J090084H22TTGGCCCAGCCCATAANONE 
J100022L03TTGGCCCAGCCCATAANONE 
J100028O14TTGGCCCAGCCCATAANONE 
J100028O18TTGGCCCAGCCCATAANONE 
J100032A15TTGGCCCAGCCCATAANONE 
J100033D21TTGGCCCAGCCCATAANONE 
J100034J23TTGGCCCAGCCCATAANONE 
J100043K22TTGGCCCAGCCCATAANONE 
J100052M22TTGGCCCAGCCCATAANONE 
J100053N03TTGGCCCAGCCCATAANONE 
J100074N24TTGGCCCAGCCCATAANONE 
J100082J10TTGGCCCAGCCCATAANONE 
Os02g0175800009-083-C02AGCCCAGCCCAACCNONE 
009-184-H07AGCCCAGCCCAACCNONE 
009-199-D07AGCCCAGCCCAACCNONE 
AK058292AGCCCAGCCCAACCNONE 
AK120215AGCCCAGCCCAACCConserved hypothetical protein. 
J013040G12AGCCCAGCCCAACCNONE 
J065050N21AGCCCAGCCCAACCNONE 
J065077O07AGCCCAGCCCAACCNONE 
J065102G05AGCCCAGCCCAACCNONE 
J065197A04AGCCCAGCCCAACCNONE 
J075024L24AGCCCAGCCCAACCNONE 
J075038K01AGCCCAGCCCAACCNONE 
J075044L04AGCCCAGCCCAACCNONE 
J075063D23AGCCCAGCCCAACCNONE 
J075079P13AGCCCAGCCCAACCNONE 
J075084G03AGCCCAGCCCAACCNONE 
J075135G07AGCCCAGCCCAACCNONE 
J075148D17AGCCCAGCCCAACCNONE 
J075150F13AGCCCAGCCCAACCNONE 
J075157F06AGCCCAGCCCAACCNONE 
J090054A05AGCCCAGCCCAACCNONE 
J090085O04AGCCCAGCCCAACCNONE 
J100023C04AGCCCAGCCCAACCNONE 
J100023H23AGCCCAGCCCAACCNONE 
J100026A16AGCCCAGCCCAACCNONE 
J100035K13AGCCCAGCCCAACCNONE 
Os02g0215950J090051K07GACAGGTGGGCTGGGCTConserved hypothetical protein. 
Os02g0234700009-036-B03CCCAGCCCCACANONE 
AK062439CCCAGCCCCACAConserved hypothetical protein. 
Os02g0251900AK109286AAAGCCCAGCCCSimilar to Tobacco rattle virus-induced protein variant 2. 
Os02g0280400AK111597CCCAGCCCSimilar to Dual specificity kinase 1. 
AK111701CCCAGCCCNONE 
Os02g0288100AK107019AGCCCAGCCCACGCGSimilar to Pectinesterase (EC 3.1.1.11) (Fragment). 
Os02g0321800AK067188GGGCTGGGCCGTANONE 
AK070852GGGCTGGGCCGTAB-cell receptor-associated 31-like family protein. 
J013094K24GGGCTGGGCCGTANONE 
Os02g0478700AK099723AAGGCCCAGCCCACGGGRibosomal protein S27. 
J013089A06AAGGCCCAGCCCACGGGNONE 
J065068E01AAGGCCCAGCCCACGGGNONE 
J065217F15AAGGCCCAGCCCACGGGNONE 
Os02g0618700AK070657CCCAGCCCATCAAGCCCATATLung seven transmembrane receptor family protein. 
AK070657GCCCAGCCCAAATLung seven transmembrane receptor family protein. 
J023056H15CCCAGCCCATCAAGCCCATATNONE 
J023056H15GCCCAGCCCAAATNONE 
Os02g0636300AK100670TAATGGGCTGGGCCGGGCCGGCDEAD/DEAH box helicase, N-terminal domain containing protein. 
J013149P11TAATGGGCTGGGCCGGGCCGGCNONE 
J023022F15TAATGGGCTGGGCCGGGCCGGCNONE 
J023112J15TAATGGGCTGGGCCGGGCCGGCNONE 
J023145M22TAATGGGCTGGGCCGGGCCGGCNONE 
J043017P16TAATGGGCTGGGCCGGGCCGGCNONE 
Os02g0644000AB081464TGTGGGCTGGGCTGGNONE 
AK101360TGTGGGCTGGGCTGGNONE 
AY062178TGTGGGCTGGGCTGGNONE 
J023043E22TGTGGGCTGGGCTGGNONE 
J033024F05TGTGGGCTGGGCTGGNONE 
J033035H01TGTGGGCTGGGCTGGNONE 
J033042J19TGTGGGCTGGGCTGGNONE 
J033057G18TGTGGGCTGGGCTGGNONE 
J033111F09TGTGGGCTGGGCTGGNONE 
J033115L11TGTGGGCTGGGCTGGNONE 
J033143I16TGTGGGCTGGGCTGGNONE 
J033143M21TGTGGGCTGGGCTGGNONE 
J075072B10TGTGGGCTGGGCTGGNONE 
J075072L04TGTGGGCTGGGCTGGNONE 
J075088F01TGTGGGCTGGGCTGGNONE 
J075196H23TGTGGGCTGGGCTGGNONE 
Os02g0651500AK066333CGGGTGGGCTGGGNONE 
AK121865CGGGTGGGCTGGGHypothetical protein. 
J090038J11CGGGTGGGCTGGGNONE 
Os02g0653400Os02g0653400CCCAGCCCACCTTransferase family protein. 
Os02g0670400009-189-H11TGTTGGGCCATCCCACACGGCCCAGCCCNONE 
AB079636TGTTGGGCCATCCCACACGGCCCAGCCCSimilar to HMGc1 protein. 
J090001B08TGTTGGGCCATCCCACACGGCCCAGCCCNONE 
Os02g0703900AK102115TCAGCCCAGCCCAGCCCAGCCGAGATSimilar to Nodulin-like protein. 
AK121966TCAGCCCAGCCCAGCCCAGCCGAGATNONE 
J023109K03TCAGCCCAGCCCAGCCCAGCCGAGATNONE 
J033051G23TCAGCCCAGCCCAGCCCAGCCGAGATNONE 
J033084H22TCAGCCCAGCCCAGCCCAGCCGAGATNONE 
J090056B12TCAGCCCAGCCCAGCCCAGCCGAGATNONE 
J090059L13TCAGCCCAGCCCAGCCCAGCCGAGATNONE 
J090080M03TCAGCCCAGCCCAGCCCAGCCGAGATNONE 
Os02g0709400016-046-H08GGGCTGGGNONE 
AK064381GGGCTGGGNONE 
Os02g0717500AK067050CGCGGGGGGCTGGGConserved hypothetical protein. 
J013092A12CGCGGGGGGCTGGGNONE 
J013124H24CGCGGGGGGCTGGGNONE 
J013154C11CGCGGGGGGCTGGGNONE 
J075098L15CGCGGGGGGCTGGGNONE 
J090083L24CGCGGGGGGCTGGGNONE 
J100049G21CGCGGGGGGCTGGGNONE 
J100073N20CGCGGGGGGCTGGGNONE 
Os02g0732900AK065796CTGGGCTGGGProtein of unknown function DUF794, plant family protein. 
AK104342CTGGGCTGGGNONE 
Os02g0759800012-036-G11TCGGCCCAGCCCAAATNONE 
AK067153TCGGCCCAGCCCAAATSimilar to GAMYB-binding protein (Fragment). 
AK071666TCGGCCCAGCCCAAATNONE 
J013098N03TCGGCCCAGCCCAAATNONE 
J023100L02TCGGCCCAGCCCAAATNONE 
J023106G20TCGGCCCAGCCCAAATNONE 
J033057G09TCGGCCCAGCCCAAATNONE 
J100043H19TCGGCCCAGCCCAAATNONE 
J100061H16TCGGCCCAGCCCAAATNONE 
J100079O17TCGGCCCAGCCCAAATNONE 
Os02g0767900009-154-G01TGCGGCCCAGCCCNONE 
009-172-H09TGCGGCCCAGCCCNONE 
AK099885TGCGGCCCAGCCCGlutaredoxin 2 family protein. 
Os02g0775200AB038319AAATGGGCTGGGCCCATANONE 
AK069984AAATGGGCTGGGCCCATASimilar to Activator 1 36 kDa subunit (Replication factor C 36 kDa subunit) (A1 36 kDa subunit) (RF-C 36 kDa subunit) (RFC36) (Replication factor C subunit 5). 
J065098G16AAATGGGCTGGGCCCATANONE 
Os02g0824700009-023-E06CCCAGCCCAGCCCACCTSimilar to Vacuolar ATP synthase subunit F (EC 3.6.3.14) (V-ATPase F subunit) (Vacuolar proton pump F subunit) (V-ATPase 14 kDa subunit). 
J065010L18CCCAGCCCAGCCCACCTNONE 
J065017H21CCCAGCCCAGCCCACCTNONE 
J065052N02CCCAGCCCAGCCCACCTNONE 
J065053M01CCCAGCCCAGCCCACCTNONE 
J065064B14CCCAGCCCAGCCCACCTNONE 
J065146K22CCCAGCCCAGCCCACCTNONE 
Os02g0829900009-044-G07GCCGGCCCAGCCCAACANONE 
AK120917GCCGGCCCAGCCCAACASimilar to BRICK1. 
AY224582GCCGGCCCAGCCCAACANONE 
J023034L01GCCGGCCCAGCCCAACANONE 
J023034M01GCCGGCCCAGCCCAACANONE 
J090010G06GCCGGCCCAGCCCAACANONE 
J090020D07GCCGGCCCAGCCCAACANONE 
J100041L04GCCGGCCCAGCCCAACANONE 
J100061D05GCCGGCCCAGCCCAACANONE 
J100070L18GCCGGCCCAGCCCAACANONE 
Os02g0830000011-075-D11TGTTGGGCTGGGCCGGCNONE 
AK101841TGTTGGGCTGGGCCGGCProtein prenyltransferase domain containing protein. 
J033069G13TGTTGGGCTGGGCCGGCNONE 
Os02g0832200AK108268AGCCCAGCCCConserved hypothetical protein. 
J065053F07AGCCCAGCCCNONE 
J065095B09AGCCCAGCCCNONE 
J065137I11AGCCCAGCCCNONE 
J065187O12AGCCCAGCCCNONE 
J075193O05AGCCCAGCCCNONE 
Os03g0108700003-131-E01GCAGCCCAGCCCAGCCNONE 
AK105115GCAGCCCAGCCCAGCCConserved hypothetical protein. 
AY224538GCAGCCCAGCCCAGCCNONE 
J065029A19GCAGCCCAGCCCAGCCNONE 
J065109N11GCAGCCCAGCCCAGCCNONE 
Os03g0122300AK068438GCCCAGCCCSimilar to Flavanone 3-hydroxylase-like protein. 
AK071416GCCCAGCCCNONE 
AK104414GCCCAGCCCNONE 
J023078E24GCCCAGCCCNONE 
J023141J19GCCCAGCCCNONE 
J033050K09GCCCAGCCCNONE 
Os03g0142900011-054-A05CCCAGCCCAGNONE 
AK067103CCCAGCCCAGNONE 
AK120438CCCAGCCCAGProtein of unknown function DUF946, plant family protein. 
J013097D18CCCAGCCCAGNONE 
J013098E18CCCAGCCCAGNONE 
J013099I17CCCAGCCCAGNONE 
J013108C09CCCAGCCCAGNONE 
J023045J15CCCAGCCCAGNONE 
J033034E13CCCAGCCCAGNONE 
J033095F07CCCAGCCCAGNONE 
J033102N22CCCAGCCCAGNONE 
J065016C14CCCAGCCCAGNONE 
J065034E13CCCAGCCCAGNONE 
J065065F21CCCAGCCCAGNONE 
J065159M09CCCAGCCCAGNONE 
J075012C13CCCAGCCCAGNONE 
J075017P18CCCAGCCCAGNONE 
J075018M03CCCAGCCCAGNONE 
J075021H19CCCAGCCCAGNONE 
J075070K23CCCAGCCCAGNONE 
J075077B18CCCAGCCCAGNONE 
J075085E20CCCAGCCCAGNONE 
J075090N23CCCAGCCCAGNONE 
J075137M16CCCAGCCCAGNONE 
J075151E03CCCAGCCCAGNONE 
J090042L02CCCAGCCCAGNONE 
J090060C21CCCAGCCCAGNONE 
J090089I17CCCAGCCCAGNONE 
J100024L19CCCAGCCCAGNONE 
J100025A06CCCAGCCCAGNONE 
J100033C24CCCAGCCCAGNONE 
J100052J17CCCAGCCCAGNONE 
J100063H10CCCAGCCCAGNONE 
J100073P04CCCAGCCCAGNONE 
J100075D01CCCAGCCCAGNONE 
J100077J17CCCAGCCCAGNONE 
J100087F03CCCAGCCCAGNONE 
J100087F09CCCAGCCCAGNONE 
Os03g0197400AK071413GCAGCCCAGCCCSimilar to COP9 signalosome complex subunit 4 (Signalosome subunit 4) (Constitutive photomorphogenesis protein 8) (FUSCA protein 4) (FUSCA4) (AtS4). 
AK104905GCAGCCCAGCCCNONE 
J053023D18GCAGCCCAGCCCNONE 
Os03g0240500003-116-E06CAGGCCCAGCCCNONE 
AK058676CAGGCCCAGCCCSimilar to Toc34-2 protein. 
AK099032CAGGCCCAGCCCNONE 
J013128A13CAGGCCCAGCCCNONE 
J075064H17CAGGCCCAGCCCNONE 
J075075N03CAGGCCCAGCCCNONE 
J075079H24CAGGCCCAGCCCNONE 
J075127D23CAGGCCCAGCCCNONE 
J075132C09CAGGCCCAGCCCNONE 
J075159D02CAGGCCCAGCCCNONE 
J090053O11CAGGCCCAGCCCNONE 
J090062N04CAGGCCCAGCCCNONE 
Os03g0251800AK067333TCCGGCCCAGCCCAGCSimilar to Possible OmpA family member precursor. 
AK073337TCCGGCCCAGCCCAGCNONE 
Os03g0255200AK058212GGTTGGGCTGGGCCCAATTNONE 
AK071625GGTTGGGCTGGGCCCAATTHeat shock protein DnaJ, N-terminal domain containing protein. 
Os03g0266300006-027-H06GCCCAGCCCNONE 
013-051-G08GCCCAGCCCNONE 
014-002-C05GCCCAGCCCNONE 
014-002-H02GCCCAGCCCNONE 
014-005-A09GCCCAGCCCNONE 
014-008-D02GCCCAGCCCNONE 
014-008-G06GCCCAGCCCNONE 
014-009-C12GCCCAGCCCNONE 
014-010-A07GCCCAGCCCNONE 
014-012-H03GCCCAGCCCNONE 
014-013-E03GCCCAGCCCNONE 
014-014-D03GCCCAGCCCNONE 
014-028-C09GCCCAGCCCNONE 
014-037-G05GCCCAGCCCNONE 
014-038-E04GCCCAGCCCNONE 
014-041-F08GCCCAGCCCNONE 
014-049-E11GCCCAGCCCNONE 
014-050-A05GCCCAGCCCNONE 
014-053-F10GCCCAGCCCNONE 
014-054-C04GCCCAGCCCNONE 
014-056-A01GCCCAGCCCNONE 
014-060-A08GCCCAGCCCNONE 
014-072-C09GCCCAGCCCNONE 
014-072-D02GCCCAGCCCNONE 
014-077-G08GCCCAGCCCNONE 
014-080-C10GCCCAGCCCNONE 
014-098-E01GCCCAGCCCNONE 
014-100-C02GCCCAGCCCNONE 
014-100-E03GCCCAGCCCNONE 
014-100-E10GCCCAGCCCNONE 
015-061-D06GCCCAGCCCNONE 
016-033-H10GCCCAGCCCNONE 
AB110191GCCCAGCCCNONE 
AF467729GCCCAGCCCNONE 
AK073671GCCCAGCCCNONE 
AK104129GCCCAGCCCClass I low-molecular-weight heat shock protein 17.9. 
AK119239GCCCAGCCCNONE 
AK119616GCCCAGCCCNONE 
AK119664GCCCAGCCCNONE 
AK119675GCCCAGCCCNONE 
D21285GCCCAGCCCNONE 
J033051H23GCCCAGCCCNONE 
J065036L24GCCCAGCCCNONE 
J065045J20GCCCAGCCCNONE 
J065104C03GCCCAGCCCNONE 
J065109J20GCCCAGCCCNONE 
J065116F24GCCCAGCCCNONE 
J065146F06GCCCAGCCCNONE 
J065146P18GCCCAGCCCNONE 
J065167A09GCCCAGCCCNONE 
J065183K12GCCCAGCCCNONE 
J075019J15GCCCAGCCCNONE 
J075112F10GCCCAGCCCNONE 
J075150H04GCCCAGCCCNONE 
J075159N20GCCCAGCCCNONE 
J075164P19GCCCAGCCCNONE 
J075185O05GCCCAGCCCNONE 
J100030A19GCCCAGCCCNONE 
J100044E07GCCCAGCCCNONE 
Os03g0273200AK060579CCCAGCCCNONE 
AK072397CCCAGCCCSimilar to Laccase (EC 1.10.3.2). 
J023002F14CCCAGCCCNONE 
J023080D16CCCAGCCCNONE 
J023086K18CCCAGCCCNONE 
J023114H16CCCAGCCCNONE 
J023142D22CCCAGCCCNONE 
Os03g0299900AK069075TAGGCCCAGCCCATGASimilar to Plastid aminotransferase (Fragment). 
AY338235TAGGCCCAGCCCATGANONE 
J053077F07TAGGCCCAGCCCATGANONE 
Os03g0308500AK103891CCACGGCCCAGCCCDEAD/DEAH box helicase, N-terminal domain containing protein. 
Os03g0313600AK067474ATTGGGCTGGGCTGASimilar to Genes for GrpE, DnaK and DnaJ, complete and partial cds. (Fragment). 
Os03g0333000AK109811TATGGGCTGGGCCAAConserved hypothetical protein. 
J065152D04TATGGGCTGGGCCAANONE 
J090011B05TATGGGCTGGGCCAANONE 
Os03g0333100AK101050TTGGCCCAGCCCATAProtein of unknown function DUF663 domain containing protein. 
Os03g0336200AK059473CATCCCCCAGCCCAGNONE 
AK070466CATCCCCCAGCCCAGTranscription factor RF2b. 
AY466471CATCCCCCAGCCCAGNONE 
Os03g0337800AK059309TGATGGGCCGACGGCCCAGCCCAGCCSimilar to 60S ribosomal protein L19 (Fragment). 
AK102721TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J023146K24TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J033069H01TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J033105G07TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065009B17TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065010F02TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065068A06TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065085M23TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065095H02TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065118O17TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065121I06TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065138J02TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065143L09TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065146P12TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065169D03TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065181E03TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065184C13TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065188D08TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065188O16TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J075066J20TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J075081E13TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J075175B07TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J080301E05TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J080302B07TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J080316P06TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J080319C09TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J090038K21TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J090046J05TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J090098B03TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J100039N19TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J100041E17TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J100081L04TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J100089N15TGATGGGCCGACGGCCCAGCCCAGCCNONE 
Os03g0383800009-149-G01CCCAGCCCNONE 
AK062998CCCAGCCCNONE 
AK065904CCCAGCCCNONE 
Os03g0411500AK058696CCCAGCCCAGCCCAACCNONE 
AK071057CCCAGCCCAGCCCAACCPeptidase S14, ClpP family protein. 
Os03g0628900009-062-G01TTTTGGGCTGGGCTNONE 
AK103619TTTTGGGCTGGGCTPrefoldin domain containing protein. 
J033133L23TTTTGGGCTGGGCTNONE 
J100039C17TTTTGGGCTGGGCTNONE 
J100048I07TTTTGGGCTGGGCTNONE 
J100062E19TTTTGGGCTGGGCTNONE 
J100063B11TTTTGGGCTGGGCTNONE 
Os03g0647500015-025-E10AGTTGGGCTGGGCCGTANONE 
AK064308AGTTGGGCTGGGCCGTAConserved hypothetical protein. 
AK103649AGTTGGGCTGGGCCGTANONE 
J033135D01AGTTGGGCTGGGCCGTANONE 
Os03g0689300AK068765CCCAGCCCAAAAPlasma membrane H+ ATPase (EC 3.6.3.6) (H-ATPase). 
AK100996CCCAGCCCAAAANONE 
D10207CCCAGCCCAAAANONE 
J013162E15CCCAGCCCAAAANONE 
J033116I16CCCAGCCCAAAANONE 
J043027N09CCCAGCCCAAAANONE 
J075112N21CCCAGCCCAAAANONE 
J090035D23CCCAGCCCAAAANONE 
J090095G13CCCAGCCCAAAANONE 
Os03g0744800AK059983TCTCGGCCCAGCCCAAATemp24/gp25L/p24 family protein. 
J065067D01TCTCGGCCCAGCCCAAATNONE 
J065122L19TCTCGGCCCAGCCCAAATNONE 
J090041I03TCTCGGCCCAGCCCAAATNONE 
J100039H03TCTCGGCCCAGCCCAAATNONE 
Os03g0746400AK063445CCCAGCCCATACCAGCCCAGCCCATTAProtein prenyltransferase domain containing protein. 
AK070923CCCAGCCCATACCAGCCCAGCCCATTANONE 
J065008K24CCCAGCCCATACCAGCCCAGCCCATTANONE 
Os03g0757000012-094-G12CCCAGCCCCCAGGCCCNONE 
J065191P15CCCAGCCCCCAGGCCCUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
Os03g0774200AK065851AAAAGCCCAGCCCACCAACNONE 
AK119532AAAAGCCCAGCCCACCAACSimilar to NADH-ubiquinone oxidoreductase subunit 8 (EC 1.6.5.3). 
J013041L15AAAAGCCCAGCCCACCAACNONE 
J023107I03AAAAGCCCAGCCCACCAACNONE 
J065156I19AAAAGCCCAGCCCACCAACNONE 
J065176L07AAAAGCCCAGCCCACCAACNONE 
J100066F15AAAAGCCCAGCCCACCAACNONE 
Os03g0797700005-001-F11GCCCACGCGGCCCAGCCCAACCNONE 
AK061648GCCCACGCGGCCCAGCCCAACCConserved hypothetical protein. 
AK098876GCCCACGCGGCCCAGCCCAACCNONE 
J013001D18GCCCACGCGGCCCAGCCCAACCNONE 
J033070I21GCCCACGCGGCCCAGCCCAACCNONE 
J065124F13GCCCACGCGGCCCAGCCCAACCNONE 
J065218D02GCCCACGCGGCCCAGCCCAACCNONE 
J090080A22GCCCACGCGGCCCAGCCCAACCNONE 
J100032P18GCCCACGCGGCCCAGCCCAACCNONE 
Os03g0807800AK064984TATTGGGCCGAAGAGGCCCAGCCCACTTGSimilar to 40S ribosomal protein S2 (Fragment). 
J013001C14TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J065015J20TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J065122L11TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J065217E10TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J075023C02TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J075102O04TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J080024G24TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J080033F02TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J080047M13TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J080048A22TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J080056E06TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J080064O11TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
Os03g0831100AK103115TAGGCCCAGCCCATGGGCArmadillo-like helical domain containing protein. 
J033119F15TAGGCCCAGCCCATGGGCNONE 
J065011M19TAGGCCCAGCCCATGGGCNONE 
J075019I08TAGGCCCAGCCCATGGGCNONE 
J075047A01TAGGCCCAGCCCATGGGCNONE 
J075096P21TAGGCCCAGCCCATGGGCNONE 
J075121I05TAGGCCCAGCCCATGGGCNONE 
J075121I07TAGGCCCAGCCCATGGGCNONE 
J090063F13TAGGCCCAGCCCATGGGCNONE 
J090068F16TAGGCCCAGCCCATGGGCNONE 
J090094E14TAGGCCCAGCCCATGGGCNONE 
Os03g0843500AK067985CGGGCCCAGCCCACGCNONE 
AK101661CGGGCCCAGCCCACGCSimilar to Sarcoplasmic reticulum protein (With alternative splicing). 
AY224454CGGGCCCAGCCCACGCNONE 
J080302L23CGGGCCCAGCCCACGCNONE 
Os03g0848100J013028M09TGTTGGGCTGGGCTTCNONE 
J065080L17TGTTGGGCTGGGCTTCNONE 
J065083C11TGTTGGGCTGGGCTTCNONE 
Os03g0852600009-174-G04ATATGGGCCCAGCCCAAGNONE 
AK063101ATATGGGCCCAGCCCAAGProtein of unknown function DUF565 family protein. 
J065131H12ATATGGGCCCAGCCCAAGNONE 
J090046K24ATATGGGCCCAGCCCAAGNONE 
Os03g0858700006-024-D11GGTGGGGCTGGGCCGTCNONE 
AK061723GGTGGGGCTGGGCCGTCProtein of unknown function DUF1499 family protein. 
AK064976GGTGGGGCTGGGCCGTCNONE 
J013001B23GGTGGGGCTGGGCCGTCNONE 
Os04g0107900013-017-E10CAAGGCCCAGCCCAAGNONE 
014-025-A02CAAGGCCCAGCCCAAGNONE 
014-100-C01CAAGGCCCAGCCCAAGNONE 
AK063568CAAGGCCCAGCCCAAGNONE 
AK063698CAAGGCCCAGCCCAAGNONE 
AK063751CAAGGCCCAGCCCAAGSimilar to Heat shock protein 80. 
J013118G22CAAGGCCCAGCCCAAGNONE 
J033131C17CAAGGCCCAGCCCAAGNONE 
J065036G05CAAGGCCCAGCCCAAGNONE 
J065106E24CAAGGCCCAGCCCAAGNONE 
J065171K16CAAGGCCCAGCCCAAGNONE 
J065213C11CAAGGCCCAGCCCAAGNONE 
J065218L17CAAGGCCCAGCCCAAGNONE 
Os04g0117100009-025-D02AGCCCAGCCCANONE 
009-056-D03AGCCCAGCCCANONE 
009-145-F01AGCCCAGCCCANONE 
009-146-C06AGCCCAGCCCANONE 
009-186-C05AGCCCAGCCCANONE 
AK060395AGCCCAGCCCANONE 
AK121763AGCCCAGCCCAConserved hypothetical protein. 
J033090J17AGCCCAGCCCANONE 
J065058O06AGCCCAGCCCANONE 
J065058P05AGCCCAGCCCANONE 
J065141C14AGCCCAGCCCANONE 
J065162F07AGCCCAGCCCANONE 
J065199N16AGCCCAGCCCANONE 
J065214I05AGCCCAGCCCANONE 
J075003L04AGCCCAGCCCANONE 
J075014C14AGCCCAGCCCANONE 
J075063K14AGCCCAGCCCANONE 
J075111N19AGCCCAGCCCANONE 
J075138E13AGCCCAGCCCANONE 
J075189E23AGCCCAGCCCANONE 
J080304J23AGCCCAGCCCANONE 
J080310L07AGCCCAGCCCANONE 
J080318A16AGCCCAGCCCANONE 
J100054P14AGCCCAGCCCANONE 
Os04g0118100006-100-G08CCAGCCCAGCCCAGCCCAGCCCAGCNONE 
AK058463CCAGCCCAGCCCAGCCCAGCCCAGCNONE 
J065078C03CCAGCCCAGCCCAGCCCAGCCCAGCNONE 
Os04g0259200AK119366CGGGCCCAGCCCAAATHypothetical protein. 
Os04g0343900AK107841GCCCAGCCCAConserved hypothetical protein. 
Os04g0376600J033065H17GGCTGGGCTGGGNONE 
Os04g0388900AK063224CCCAGCCCSimilar to U6 snRNA-associated Sm-like protein LSm6 (Sm protein F). 
J065037N19CCCAGCCCNONE 
J065148P22CCCAGCCCNONE 
J075040G12CCCAGCCCNONE 
Os04g0406600AK103609CCCAGCCCACGCPrephenate dehydratase domain containing protein. 
J033133I10CCCAGCCCACGCNONE 
J075092D11CCCAGCCCACGCNONE 
J100031M09CCCAGCCCACGCNONE 
Os04g0416000J065041L09TCATGGGCTGGGCTTCNONE 
J065050F15TCATGGGCTGGGCTTCNONE 
J065053M14TCATGGGCTGGGCTTCProtein of unknown function DUF1279 domain containing protein. 
J065057I09TCATGGGCTGGGCTTCNONE 
J065132E14TCATGGGCTGGGCTTCNONE 
J065144L23TCATGGGCTGGGCTTCNONE 
J065154N13TCATGGGCTGGGCTTCNONE 
J065158P16TCATGGGCTGGGCTTCNONE 
J080302F01TCATGGGCTGGGCTTCNONE 
J080308G20TCATGGGCTGGGCTTCNONE 
Os04g0430100009-125-A01AACTGGGCCTGAAAAGCCCAGCCCNONE 
AK102190AACTGGGCCTGAAAAGCCCAGCCCSimilar to 40S ribosomal protein S10-1. 
J033087A06AACTGGGCCTGAAAAGCCCAGCCCNONE 
J053032M06AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065033D05AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065045D15AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065045K10AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065049N05AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065064N09AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065068F17AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065088F17AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065104N22AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065117B19AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065119O12AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065134G24AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065150G16AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065176C03AACTGGGCCTGAAAAGCCCAGCCCNONE 
J065212M23AACTGGGCCTGAAAAGCCCAGCCCNONE 
J075009P18AACTGGGCCTGAAAAGCCCAGCCCNONE 
J075019G06AACTGGGCCTGAAAAGCCCAGCCCNONE 
J075037H14AACTGGGCCTGAAAAGCCCAGCCCNONE 
J075057C13AACTGGGCCTGAAAAGCCCAGCCCNONE 
J075100E14AACTGGGCCTGAAAAGCCCAGCCCNONE 
J075120I16AACTGGGCCTGAAAAGCCCAGCCCNONE 
J075130F07AACTGGGCCTGAAAAGCCCAGCCCNONE 
J075156M16AACTGGGCCTGAAAAGCCCAGCCCNONE 
J100043J03AACTGGGCCTGAAAAGCCCAGCCCNONE 
Os04g0503800J065116G03GCCGGCCCAGCCCAGTANONE 
Os04g0513100AK067841GGGCTGGGCTGCGGTGGGCTGTSimilar to Beta-glucosidase. 
J075105F14GGGCTGGGCTGCGGTGGGCTGTNONE 
Os04g0525000AK067753TCAGGCCCAGCCCATCTConserved hypothetical protein. 
J013118G14TCAGGCCCAGCCCATCTNONE 
J065026J15TCAGGCCCAGCCCATCTNONE 
J065184H21TCAGGCCCAGCCCATCTNONE 
J065186H22TCAGGCCCAGCCCATCTNONE 
J065193D20TCAGGCCCAGCCCATCTNONE 
J075060D12TCAGGCCCAGCCCATCTNONE 
J075179L24TCAGGCCCAGCCCATCTNONE 
Os04g0551800016-049-G12TAATGGGCTGGGCTNONE 
AK121568TAATGGGCTGGGCTSimilar to T-complex protein 1, alpha subunit (TCP-1-alpha) (CCT-alpha). 
J013073O06TAATGGGCTGGGCTNONE 
J013111B11TAATGGGCTGGGCTNONE 
J013121H23TAATGGGCTGGGCTNONE 
J023012A17TAATGGGCTGGGCTNONE 
J023092M05TAATGGGCTGGGCTNONE 
J033026P14TAATGGGCTGGGCTNONE 
J033033C10TAATGGGCTGGGCTNONE 
J033033M10TAATGGGCTGGGCTNONE 
J033035C24TAATGGGCTGGGCTNONE 
J033052E19TAATGGGCTGGGCTNONE 
J033140K19TAATGGGCTGGGCTNONE 
J065036F18TAATGGGCTGGGCTNONE 
J065067L12TAATGGGCTGGGCTNONE 
J065095G09TAATGGGCTGGGCTNONE 
J065115B08TAATGGGCTGGGCTNONE 
J065218E24TAATGGGCTGGGCTNONE 
J090002N13TAATGGGCTGGGCTNONE 
J090008B12TAATGGGCTGGGCTNONE 
J090016F24TAATGGGCTGGGCTNONE 
J090019H14TAATGGGCTGGGCTNONE 
J090020G20TAATGGGCTGGGCTNONE 
J090029L18TAATGGGCTGGGCTNONE 
J090057C23TAATGGGCTGGGCTNONE 
J090073H23TAATGGGCTGGGCTNONE 
J090081C16TAATGGGCTGGGCTNONE 
J090081E21TAATGGGCTGGGCTNONE 
J090084L14TAATGGGCTGGGCTNONE 
J090086M01TAATGGGCTGGGCTNONE 
J090089E16TAATGGGCTGGGCTNONE 
J100031P12TAATGGGCTGGGCTNONE 
J100090N23TAATGGGCTGGGCTNONE 
Os04g0587300AK119483GCCCAGCCCSimilar to Purine permease-like protein. 
Os04g0589200AK068571AGCCCAGCCCAGCCConserved hypothetical protein. 
AK102463AGCCCAGCCCAGCCNONE 
J075083K10AGCCCAGCCCAGCCNONE 
Os04g0636000015-046-E08AGCCCAGCCCNONE 
AK065639AGCCCAGCCCSPla/RYanodine receptor SPRY domain containing protein. 
AK099615AGCCCAGCCCNONE 
Os04g0650500AK066690AATGGGCTGGGCCTGAConserved hypothetical protein. 
AK104273AATGGGCTGGGCCTGANONE 
Os04g0663800013-021-G09CCCAGCCCNONE 
AK105321CCCAGCCCSimilar to Peptidyl-prolyl cis-trans isomerase 1 (EC 5.2.1.8) (Rotamase Pin1) (PPIase Pin1) (PIN1At). 
Os04g0678300AK102779CCCAGCCCWD40-like domain containing protein. 
J033107J24CCCAGCCCNONE 
J065165H03CCCAGCCCNONE 
J065186I23CCCAGCCCNONE 
J065194C13CCCAGCCCNONE 
J090039O08CCCAGCCCNONE 
J100029O21CCCAGCCCNONE 
Os04g0682800AK121846CCAGCCCAGCCCAGCSodium/hydrogen exchanger family protein. 
Os04g0683900004-009-A11GCCCACCCAGCCCATCCNONE 
014-076-H12GCCCACCCAGCCCATCCNONE 
AK060880GCCCACCCAGCCCATCCNONE 
AK099749GCCCACCCAGCCCATCCHMG-I and HMG-Y, DNA-binding domain containing protein. 
AK100309GCCCACCCAGCCCATCCNONE 
J013050K21GCCCACCCAGCCCATCCNONE 
J013092E09GCCCACCCAGCCCATCCNONE 
J013095N06GCCCACCCAGCCCATCCNONE 
J013095P07GCCCACCCAGCCCATCCNONE 
J013130D22GCCCACCCAGCCCATCCNONE 
J013134O15GCCCACCCAGCCCATCCNONE 
J023022I06GCCCACCCAGCCCATCCNONE 
J023062L11GCCCACCCAGCCCATCCNONE 
J023078J11GCCCACCCAGCCCATCCNONE 
J023086J01GCCCACCCAGCCCATCCNONE 
J033125A20GCCCACCCAGCCCATCCNONE 
J065023K13GCCCACCCAGCCCATCCNONE 
J065045N02GCCCACCCAGCCCATCCNONE 
J065129F01GCCCACCCAGCCCATCCNONE 
J065164H14GCCCACCCAGCCCATCCNONE 
J065192H09GCCCACCCAGCCCATCCNONE 
J075064P15GCCCACCCAGCCCATCCNONE 
J075088G17GCCCACCCAGCCCATCCNONE 
J075199D20GCCCACCCAGCCCATCCNONE 
Os04g0686600AK068427GTTTGGGCTGGGCCTGGCCCAGTTProtein kinase domain containing protein. 
J013155F22GTTTGGGCTGGGCCTGGCCCAGTTNONE 
J023020E07GTTTGGGCTGGGCCTGGCCCAGTTNONE 
Os05g0102900006-056-A01AGGTGGGCTGGGNONE 
AK061764AGGTGGGCTGGGNONE 
AK065749AGGTGGGCTGGGSnf7 family protein. 
AK104101AGGTGGGCTGGGNONE 
J013042C01AGGTGGGCTGGGNONE 
J033038P15AGGTGGGCTGGGNONE 
J065032F16AGGTGGGCTGGGNONE 
J065039I22AGGTGGGCTGGGNONE 
J065150F19AGGTGGGCTGGGNONE 
J075079I21AGGTGGGCTGGGNONE 
J075082F14AGGTGGGCTGGGNONE 
J075098G16AGGTGGGCTGGGNONE 
J075167I08AGGTGGGCTGGGNONE 
Os05g0148300009-031-A08CCCAGCCCAACCNONE 
AK062421CCCAGCCCAACCRibosomal protein S27, mitochondrial family protein. 
Os05g0220900AK109172CCCAGCCCAATTNONE 
AK109456CCCAGCCCAATTPrefoldin domain containing protein. 
Os05g0223200015-037-E09CCCAGCCCAAGNONE 
AK106308CCCAGCCCAAGSimilar to Glycine-rich RNA-binding protein GRP2A. 
J065013L17CCCAGCCCAAGNONE 
J065056N06CCCAGCCCAAGNONE 
J065080I11CCCAGCCCAAGNONE 
J065104F11CCCAGCCCAAGNONE 
J065183L10CCCAGCCCAAGNONE 
J065185H12CCCAGCCCAAGNONE 
J065186N17CCCAGCCCAAGNONE 
Os05g0255600AK073067CTTGGGCTGGGCCCTThioredoxin domain 2 containing protein. 
J033022A04CTTGGGCTGGGCCCTNONE 
J033022B03CTTGGGCTGGGCCCTNONE 
J033116F22CTTGGGCTGGGCCCTNONE 
J065017H13CTTGGGCTGGGCCCTNONE 
J065038G20CTTGGGCTGGGCCCTNONE 
J065076J16CTTGGGCTGGGCCCTNONE 
J065135D06CTTGGGCTGGGCCCTNONE 
J065168P22CTTGGGCTGGGCCCTNONE 
J065188G21CTTGGGCTGGGCCCTNONE 
J065207C14CTTGGGCTGGGCCCTNONE 
J080014C23CTTGGGCTGGGCCCTNONE 
J080018G12CTTGGGCTGGGCCCTNONE 
J080021F03CTTGGGCTGGGCCCTNONE 
J100068C14CTTGGGCTGGGCCCTNONE 
Os05g0325200J090038J19GGGCTGGGCGGCCCATTTGGGCCyclin-like domain containing protein. 
Os05g0348100006-028-F04CGCGACGCCCCAGCCCAAGNONE 
009-036-C03CGCGACGCCCCAGCCCAAGNONE 
009-040-H02CGCGACGCCCCAGCCCAAGNONE 
009-173-H12CGCGACGCCCCAGCCCAAGNONE 
AK061434CGCGACGCCCCAGCCCAAGConserved hypothetical protein. 
J065137N04CGCGACGCCCCAGCCCAAGNONE 
J065164C10CGCGACGCCCCAGCCCAAGNONE 
J065210H22CGCGACGCCCCAGCCCAAGNONE 
Os05g0361900006-033-D04ACTGACAGGTGGGCCCAGCCCNONE 
AK060107ACTGACAGGTGGGCCCAGCCCMitochondrial substrate carrier family protein. 
AK104602ACTGACAGGTGGGCCCAGCCCNONE 
AK104747ACTGACAGGTGGGCCCAGCCCNONE 
J033133L03ACTGACAGGTGGGCCCAGCCCNONE 
J080001O06ACTGACAGGTGGGCCCAGCCCNONE 
J080004F05ACTGACAGGTGGGCCCAGCCCNONE 
J080005D12ACTGACAGGTGGGCCCAGCCCNONE 
J080008G19ACTGACAGGTGGGCCCAGCCCNONE 
J080015D10ACTGACAGGTGGGCCCAGCCCNONE 
J080015H22ACTGACAGGTGGGCCCAGCCCNONE 
J080016K15ACTGACAGGTGGGCCCAGCCCNONE 
J080018D12ACTGACAGGTGGGCCCAGCCCNONE 
J080020A01ACTGACAGGTGGGCCCAGCCCNONE 
J080027A09ACTGACAGGTGGGCCCAGCCCNONE 
J080032F05ACTGACAGGTGGGCCCAGCCCNONE 
J080039D09ACTGACAGGTGGGCCCAGCCCNONE 
J080043J19ACTGACAGGTGGGCCCAGCCCNONE 
J080052G22ACTGACAGGTGGGCCCAGCCCNONE 
J080052M15ACTGACAGGTGGGCCCAGCCCNONE 
J080053D22ACTGACAGGTGGGCCCAGCCCNONE 
J080061I18ACTGACAGGTGGGCCCAGCCCNONE 
J080064O14ACTGACAGGTGGGCCCAGCCCNONE 
J080075K01ACTGACAGGTGGGCCCAGCCCNONE 
J080082I02ACTGACAGGTGGGCCCAGCCCNONE 
J080095C14ACTGACAGGTGGGCCCAGCCCNONE 
J100028N14ACTGACAGGTGGGCCCAGCCCNONE 
Os05g0459900AK058918AAGGCCCATTTAGCCCAGCCCSimilar to 60S ribosomal protein L36-1. 
AK111268AAGGCCCATTTAGCCCAGCCCNONE 
J013129N08AAGGCCCATTTAGCCCAGCCCNONE 
J065191E01AAGGCCCATTTAGCCCAGCCCNONE 
J065216P03AAGGCCCATTTAGCCCAGCCCNONE 
J075089K21AAGGCCCATTTAGCCCAGCCCNONE 
Os05g0469900AK109700AAATGGGCTGGGConserved hypothetical protein. 
Os05g0490900AK111382TTCGGCCCAGCCCAAAConserved hypothetical protein. 
Os05g0495100AK108028GGGCTGGGCTTTTConserved hypothetical protein. 
Os05g0511500AK101807CCCAGCCCSimilar to Lipoic acid synthase-like protein. 
Os05g0540100AB021666CCCAGCCCAGCCNONE 
AK060623CCCAGCCCAGCCNONE 
AK103819CCCAGCCCAGCCFlap endonuclease-1a (EC 3.-.-.-) (OsFEN-1a). 
Os05g0541900009-130-F05AACTGGGCTGGGCCTCCGTGGGCCGCNONE 
009-200-E07AACTGGGCTGGGCCTCCGTGGGCCGCNONE 
013-057-G09AACTGGGCTGGGCCTCCGTGGGCCGCNONE 
Os05g0551700AK071216CCCAGCCCAGCCtRNA isopentenyltransferase family protein. 
Os05g0554100AK073023GCCCAGCCCATCARibosomal protein L7/L12 family protein. 
AK101756GCCCAGCCCATCANONE 
Os05g0577700AK107217GCTGGGCTGGGCCCCTCGCGCGCGACGCGACSimilar to Protein kinase. 
AY224453GCTGGGCTGGGCCCCTCGCGCGCGACGCGACNONE 
Os05g0592400AB037144GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
AK065508GTTTGGGCTGGGCTGGGCTGGGCTGGUV-damaged DNA binding protein. 
J013069J24GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
J013075H15GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
J013095H04GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
J013105L19GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
J013152P13GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
J023072O05GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
J033024J22GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
J033030D07GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
J033041D09GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
J033051M16GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
J033126M01GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
J033145H24GTTTGGGCTGGGCTGGGCTGGGCTGGNONE 
Os05g0594800AK058332GAAGCCCAGCCCACCAAdhesion regulating molecule family protein. 
AK068013GAAGCCCAGCCCACCANONE 
J013129L24GAAGCCCAGCCCACCANONE 
Os06g0113900AK067430CCCAGCCCAACCNONE 
AK102259CCCAGCCCAACCNONE 
AK120464CCCAGCCCAACCConserved hypothetical protein. 
J065144I06CCCAGCCCAACCNONE 
Os06g0131100AK112079CCAGGCCCAGCCCTCCGGCCCACTWD40-like domain containing protein. 
J033066L01CCAGGCCCAGCCCTCCGGCCCACTNONE 
J100044P22CCAGGCCCAGCCCTCCGGCCCACTNONE 
Os06g0134000AK102796GCCCAGCCCACCTNONE 
Os06g0136900AK107405ACAGCCCAGCCCAGGGCCCGCProtein of unknown function DUF296 domain containing protein. 
Os06g0156700AK107226GCCGGCCCAGCCCLipolytic enzyme, G-D-S-L family protein. 
J075021O05GCCGGCCCAGCCCNONE 
J075023M12GCCGGCCCAGCCCNONE 
J075041C14GCCGGCCCAGCCCNONE 
J075041C19GCCGGCCCAGCCCNONE 
J075064F08GCCGGCCCAGCCCNONE 
J075116I03GCCGGCCCAGCCCNONE 
J075123I02GCCGGCCCAGCCCNONE 
Os06g0163000AK069245CCCAGCCCACCTGNONE 
AK069675CCCAGCCCACCTGSimilar to Heat shock protein STI (Stress inducible protein) (GmSTI). 
AK072504CCCAGCCCACCTGNONE 
Os06g0319700AK120884GGCCCGGCCCAACGCCCAGCCCSimilar to 60S ribosomal protein L31. 
J013089A14GGCCCGGCCCAACGCCCAGCCCNONE 
J023028N24GGCCCGGCCCAACGCCCAGCCCNONE 
J033098H21GGCCCGGCCCAACGCCCAGCCCNONE 
J033118G04GGCCCGGCCCAACGCCCAGCCCNONE 
J090056P15GGCCCGGCCCAACGCCCAGCCCNONE 
J090062B02GGCCCGGCCCAACGCCCAGCCCNONE 
J100024B09GGCCCGGCCCAACGCCCAGCCCNONE 
J100060I04GGCCCGGCCCAACGCCCAGCCCNONE 
J100078H11GGCCCGGCCCAACGCCCAGCCCNONE 
J100080A14GGCCCGGCCCAACGCCCAGCCCNONE 
J100086F18GGCCCGGCCCAACGCCCAGCCCNONE 
Os06g0367500013-096-F01CCCAGCCCNONE 
AK063619CCCAGCCCPrefoldin domain containing protein. 
Os06g0556300AK063985CCCAGCCCAAGCyclin-like F-box domain containing protein. 
AK101552CCCAGCCCAAGNONE 
Os06g0569900AK100964CCCAGCCCSimilar to Ent-kaurene oxidase 1 (Fragment). 
AY660666CCCAGCCCNONE 
Os06g0589500AK073322CCCAGCCCConserved hypothetical protein. 
J033030G15CCCAGCCCNONE 
J033148N18CCCAGCCCNONE 
Os06g0598900AK100386TACGGCCCAGCCCAACASimilar to Serine-threonine kinase receptor-associated protein (UNR-interacting protein) (WD-40 repeat protein PT-WD) (MAP activator with WD repeats). 
J013088O05TACGGCCCAGCCCAACANONE 
J090043L20TACGGCCCAGCCCAACANONE 
Os06g0673500J100018J12ATATGGGCTCAGCCCAGCCCATCANONE 
J100072F13ATATGGGCTCAGCCCAGCCCATCASimilar to Ubiquitin. 
Os06g0714100AK121079AAAGCCCAGCCCAComplex 1 LYR protein family protein. 
J023062M13AAAGCCCAGCCCANONE 
J043020D18AAAGCCCAGCCCANONE 
J065073A17AAAGCCCAGCCCANONE 
J065158D09AAAGCCCAGCCCANONE 
J065195H04AAAGCCCAGCCCANONE 
J065214P13AAAGCCCAGCCCANONE 
J080079I22AAAGCCCAGCCCANONE 
J100031M06AAAGCCCAGCCCANONE 
J100036I12AAAGCCCAGCCCANONE 
Os06g0715000AK107114GGGCTGGGCCGGCConserved hypothetical protein. 
Os06g0716700AB037681CCCAGCCCSimilar to Endoplasmin homolog precursor (GRP94 homolog). 
AK063385CCCAGCCCNONE 
AK102478CCCAGCCCNONE 
J013030D18CCCAGCCCNONE 
J090091L06CCCAGCCCNONE 
Os06g0731700J065089G16CTGGGCTGGGNONE 
J065157E16CTGGGCTGGGNONE 
Os07g0130500AK066085TCATGGGCCTAAAATGGGCTGGGCTGGAGCCCAAANONE 
AK068045TCATGGGCCTAAAATGGGCTGGGCTGGAGCCCAAANONE 
J013050A21TCATGGGCCTAAAATGGGCTGGGCTGGAGCCCAAANONE 
Os07g0133700J065005A21TCAGCCCAGCCCAGCCCAAGHypothetical protein. 
J065096D02TCAGCCCAGCCCAGCCCAAGNONE 
J065097G13TCAGCCCAGCCCAGCCCAAGNONE 
Os07g0154300009-070-E08CCCAGCCCAACTNONE 
009-077-E01CCCAGCCCAACTNONE 
009-196-F05CCCAGCCCAACTNONE 
AK105386CCCAGCCCAACTConserved hypothetical protein. 
AK122093CCCAGCCCAACTNONE 
J033124K14CCCAGCCCAACTNONE 
J075006I22CCCAGCCCAACTNONE 
J075185G02CCCAGCCCAACTNONE 
J090039C02CCCAGCCCAACTNONE 
Os07g0180900006-055-B11CAAGGCCCAGCCCANONE 
006-103-F09CAAGGCCCAGCCCANONE 
011-009-E03CAAGGCCCAGCCCANONE 
011-035-H08CAAGGCCCAGCCCANONE 
014-043-F08CAAGGCCCAGCCCANONE 
AK060711CAAGGCCCAGCCCARibosomal protein L4/L1e family protein. 
AK060963CAAGGCCCAGCCCANONE 
AK104447CAAGGCCCAGCCCANONE 
AK104504CAAGGCCCAGCCCANONE 
AK104629CAAGGCCCAGCCCANONE 
J023003P15CAAGGCCCAGCCCANONE 
J023075H14CAAGGCCCAGCCCANONE 
J033101N17CAAGGCCCAGCCCANONE 
J033132M11CAAGGCCCAGCCCANONE 
J065081C24CAAGGCCCAGCCCANONE 
J080004L10CAAGGCCCAGCCCANONE 
J080009H21CAAGGCCCAGCCCANONE 
J080013F01CAAGGCCCAGCCCANONE 
J080022K24CAAGGCCCAGCCCANONE 
J080023C22CAAGGCCCAGCCCANONE 
J080024M16CAAGGCCCAGCCCANONE 
J080026K06CAAGGCCCAGCCCANONE 
J080030J23CAAGGCCCAGCCCANONE 
J080030L05CAAGGCCCAGCCCANONE 
J080031G03CAAGGCCCAGCCCANONE 
J080033C03CAAGGCCCAGCCCANONE 
J080033D02CAAGGCCCAGCCCANONE 
J080035A11CAAGGCCCAGCCCANONE 
J080035A14CAAGGCCCAGCCCANONE 
J080039E08CAAGGCCCAGCCCANONE 
J080040L15CAAGGCCCAGCCCANONE 
J080040M03CAAGGCCCAGCCCANONE 
J080041L21CAAGGCCCAGCCCANONE 
J080043E09CAAGGCCCAGCCCANONE 
J080048B14CAAGGCCCAGCCCANONE 
J080048O09CAAGGCCCAGCCCANONE 
J080051H01CAAGGCCCAGCCCANONE 
J080052H06CAAGGCCCAGCCCANONE 
J080065K05CAAGGCCCAGCCCANONE 
J080066D10CAAGGCCCAGCCCANONE 
J080066E23CAAGGCCCAGCCCANONE 
J080069F10CAAGGCCCAGCCCANONE 
J080074M06CAAGGCCCAGCCCANONE 
J080075D13CAAGGCCCAGCCCANONE 
J080076G02CAAGGCCCAGCCCANONE 
J080082G15CAAGGCCCAGCCCANONE 
J080082K06CAAGGCCCAGCCCANONE 
J080082P12CAAGGCCCAGCCCANONE 
J080085F01CAAGGCCCAGCCCANONE 
J080090H22CAAGGCCCAGCCCANONE 
J080092D07CAAGGCCCAGCCCANONE 
J080094M03CAAGGCCCAGCCCANONE 
J080094O10CAAGGCCCAGCCCANONE 
J090008I06CAAGGCCCAGCCCANONE 
J100058N20CAAGGCCCAGCCCANONE 
J100060M07CAAGGCCCAGCCCANONE 
J100062M08CAAGGCCCAGCCCANONE 
J100064L07CAAGGCCCAGCCCANONE 
J100073H16CAAGGCCCAGCCCANONE 
J100074C10CAAGGCCCAGCCCANONE 
J100075N06CAAGGCCCAGCCCANONE 
J100087P11CAAGGCCCAGCCCANONE 
J100088B13CAAGGCCCAGCCCANONE 
J100088J16CAAGGCCCAGCCCANONE 
J100088L17CAAGGCCCAGCCCANONE 
J100088O12CAAGGCCCAGCCCANONE 
Os07g0185900009-023-G07CCCAGCCCAAGNONE 
009-105-E06CCCAGCCCAAGNONE 
009-125-B01CCCAGCCCAAGNONE 
009-169-A01CCCAGCCCAAGNONE 
AK070315CCCAGCCCAAGConserved hypothetical protein. 
J065140H13CCCAGCCCAAGNONE 
J100024L12CCCAGCCCAAGNONE 
Os07g0191700AK066389GCGGCCCAGCCCAAGSimilar to AT.I.24-9 protein (Fragment). 
AK103768GCGGCCCAGCCCAAGNONE 
Os07g0242000AK107347GGCCCCAGCCCConserved hypothetical protein. 
Os07g0242600AK065752CCCAGCCCATATCyclin-like F-box domain containing protein. 
AK065752GTTTGGGCCCAGCCCATAACyclin-like F-box domain containing protein. 
J013037K22CCCAGCCCATATNONE 
J013037K22GTTTGGGCCCAGCCCATAANONE 
Os07g0256200AK072904GCTGGGCTGGGCTRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J023148I23GCTGGGCTGGGCTNONE 
Os07g0296000AK073416GCCCAGCCCConserved hypothetical protein. 
AK121178GCCCAGCCCNONE 
J033040D17GCCCAGCCCNONE 
Os07g0300200AK120733CCCAGCCCAGProtein prenyltransferase domain containing protein. 
Os07g0438300AK106732GGGCTGGGCConserved hypothetical protein. 
Os07g0498900AK073263CTTGGGCCCAGCCCACCAACProtein of unknown function DUF231, plant domain containing protein. 
J033024K20CTTGGGCCCAGCCCACCAACNONE 
J065207I19CTTGGGCCCAGCCCACCAACNONE 
Os07g0501100AK110924CCCAGCCCSimilar to Chalcone synthase 2 (EC 2.3.1.74) (Naringenin-chalcone synthase 2). 
Os07g0539950J065152C18CCCAGCCCNONE 
J065166J23CCCAGCCCHypothetical protein. 
Os07g0545400009-136-E03CCCAGCCCCCACGNONE 
013-015-G08CCCAGCCCCCACGNONE 
AK059228CCCAGCCCCCACGNONE 
J065040D09CCCAGCCCCCACGNONE 
J065051C19CCCAGCCCCCACGNONE 
J065139B05CCCAGCCCCCACGNONE 
J065160E20CCCAGCCCCCACGNONE 
J065207I17CCCAGCCCCCACGNONE 
J080319M24CCCAGCCCCCACGNONE 
Os07g0546700009-110-H10CCCAGCCCNONE 
AK058262CCCAGCCCNONE 
J065154I05CCCAGCCCNONE 
J065175P09CCCAGCCCNONE 
J065187F11CCCAGCCCNONE 
J075114K16CCCAGCCCNONE 
J090031L21CCCAGCCCNONE 
U86017CCCAGCCCSimilar to 60S ribosomal protein L38. 
Os07g0558400003-103-C02CCCAGCCCNONE 
003-115-G05CCCAGCCCNONE 
006-025-B09CCCAGCCCNONE 
006-025-G10CCCAGCCCNONE 
006-027-E03CCCAGCCCNONE 
006-036-C06CCCAGCCCNONE 
006-045-B10CCCAGCCCNONE 
006-051-H11CCCAGCCCNONE 
006-053-H03CCCAGCCCNONE 
006-057-B09CCCAGCCCNONE 
006-062-C10CCCAGCCCNONE 
006-075-B12CCCAGCCCNONE 
006-079-F01CCCAGCCCNONE 
006-082-D08CCCAGCCCNONE 
006-087-F04CCCAGCCCNONE 
006-089-E09CCCAGCCCNONE 
006-090-C04CCCAGCCCNONE 
006-091-H05CCCAGCCCNONE 
006-093-E02CCCAGCCCNONE 
006-093-E06CCCAGCCCNONE 
006-093-H05CCCAGCCCNONE 
006-095-C05CCCAGCCCNONE 
006-097-B04CCCAGCCCNONE 
006-097-C07CCCAGCCCNONE 
006-097-D02CCCAGCCCNONE 
006-097-H10CCCAGCCCNONE 
006-098-C05CCCAGCCCNONE 
006-099-H09CCCAGCCCNONE 
006-104-B06CCCAGCCCNONE 
006-105-B11CCCAGCCCNONE 
006-106-E12CCCAGCCCNONE 
006-107-B06CCCAGCCCNONE 
006-109-A09CCCAGCCCNONE 
006-112-D05CCCAGCCCNONE 
006-118-C12CCCAGCCCNONE 
006-118-E10CCCAGCCCNONE 
006-120-D05CCCAGCCCNONE 
006-120-E08CCCAGCCCNONE 
009-055-D12CCCAGCCCNONE 
009-108-E05CCCAGCCCNONE 
009-125-H05CCCAGCCCNONE 
009-150-A07CCCAGCCCNONE 
009-198-C07CCCAGCCCNONE 
AF058796CCCAGCCCNONE 
AK058293CCCAGCCCNONE 
AK098992CCCAGCCCNONE 
AK103924CCCAGCCCNONE 
AK104309CCCAGCCCNONE 
AK104619CCCAGCCCNONE 
AK119534CCCAGCCCSimilar to Chlorophyll a/b-binding protein CP29 precursor. 
J013098H13CCCAGCCCNONE 
J043039O11CCCAGCCCNONE 
J065176D03CCCAGCCCNONE 
J075022K10CCCAGCCCNONE 
J075065A02CCCAGCCCNONE 
J075077D23CCCAGCCCNONE 
J075088P15CCCAGCCCNONE 
J075125D24CCCAGCCCNONE 
J075125H11CCCAGCCCNONE 
J075192H21CCCAGCCCNONE 
J090080H18CCCAGCCCNONE 
Os07g0570300AK100076TCCGGCCCAGCCCATCTPeptidase M16, C-terminal domain containing protein. 
J100033J04TCCGGCCCAGCCCATCTNONE 
J100065L10TCCGGCCCAGCCCATCTNONE 
Os07g0571100AK119301CCCAGCCCAGCConserved hypothetical protein. 
Os07g0574800006-097-G09CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
013-077-E02CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
014-010-B04CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
AK067721CCAGCCCAGCCCAGCCCACGGGCCGTGGTubulin alpha-1 chain. 
AK069140CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
AK104900CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J013037J23CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J013045O05CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J013056A21CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J013119N24CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J023036H19CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J023036K16CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J023067J23CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J023075H08CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J023084K13CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J023097O10CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J033093K22CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J033105L08CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J065219H05CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J075010N07CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J075130I08CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090014E16CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090025K17CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090030L19CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090035J05CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090036B17CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090037A15CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090064C17CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090069L18CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090073N11CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090077F23CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090099F02CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J100029N06CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J100056I04CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J100061A13CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J100062B10CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J100062J17CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J100072F22CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J100072J22CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J100076C03CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
X91808CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
Z11931CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
Os07g0583700AK070537CCCAGCCCACGCWRKY transcription factor 78. 
AY341850CCCAGCCCACGCNONE 
J013089A12CCCAGCCCACGCNONE 
J013118N13CCCAGCCCACGCNONE 
J023039L18CCCAGCCCACGCNONE 
J023062H03CCCAGCCCACGCNONE 
J100029J20CCCAGCCCACGCNONE 
Os07g0586700AK102792CACGGCCCAAACCCAGCCCAAAAConserved hypothetical protein. 
Os07g0589000AK069813GCCCAGCCCLateral organ boundaries, LOB domain containing protein. 
J023030F23GCCCAGCCCNONE 
J065165H21GCCCAGCCCNONE 
J065193G01GCCCAGCCCNONE 
J075093F03GCCCAGCCCNONE 
Os07g0634300AK109879TTTCGGCCCAGCCCATConserved hypothetical protein. 
J100035O13TTTCGGCCCAGCCCATNONE 
J100039D07TTTCGGCCCAGCCCATNONE 
J100039F13TTTCGGCCCAGCCCATNONE 
Os07g0668200AK059051AAAGCCCAGCCCAATNONE 
AK101682AAAGCCCAGCCCAATConserved hypothetical protein. 
AK102839AAAGCCCAGCCCAATNONE 
Os07g0673700AK071934TCGGCCCAGCCCACCCCyclin-like F-box domain containing protein. 
AK107556TCGGCCCAGCCCACCCNONE 
Os07g0695100AK059514GGGCTGGGNONE 
Os08g0102000009-020-B12CCCAGCCCAATNONE 
009-068-H05CCCAGCCCAATNONE 
009-119-F03CCCAGCCCAATNONE 
009-166-A06CCCAGCCCAATNONE 
009-176-G12CCCAGCCCAATNONE 
AK068156CCCAGCCCAATGCN5-related N-acetyltransferase domain containing protein. 
Os08g0107900014-055-C03GGCCCCAGCCCNONE 
J065062G20GGCCCCAGCCCNONE 
Os08g0134900012-044-H02AGCCCAGCCCATCANONE 
015-040-D07AGCCCAGCCCATCANONE 
AK066009AGCCCAGCCCATCAConserved hypothetical protein. 
J013047E17AGCCCAGCCCATCANONE 
J065064A15AGCCCAGCCCATCANONE 
J065116E14AGCCCAGCCCATCANONE 
J090067O03AGCCCAGCCCATCANONE 
Os08g0151400AK059440CCCAGCCCATCGSimilar to Small nuclear ribonucleoprotein homolog. 
Os08g0236900AK109597GAAGCCCAGCCCConserved hypothetical protein. 
Os08g0260600AK108529CCCAGCCCATGCCCATGTCD9/CD37/CD63 antigen family protein. 
Os08g0359500003-107-F09CCAAGCCCAGCCCATCCCCCNONE 
006-091-E08CCAAGCCCAGCCCATCCCCCNONE 
006-096-E12CCAAGCCCAGCCCATCCCCCNONE 
006-111-F11CCAAGCCCAGCCCATCCCCCNONE 
009-090-H10CCAAGCCCAGCCCATCCCCCNONE 
014-013-B02CCAAGCCCAGCCCATCCCCCNONE 
014-083-E03CCAAGCCCAGCCCATCCCCCNONE 
014-100-F05CCAAGCCCAGCCCATCCCCCNONE 
AK104798CCAAGCCCAGCCCATCCCCCNONE 
AK112034CCAAGCCCAGCCCATCCCCCHSP20-like chaperone domain containing protein. 
J013060J18CCAAGCCCAGCCCATCCCCCNONE 
J033042C22CCAAGCCCAGCCCATCCCCCNONE 
J065168I06CCAAGCCCAGCCCATCCCCCNONE 
J075077E12CCAAGCCCAGCCCATCCCCCNONE 
J075094M21CCAAGCCCAGCCCATCCCCCNONE 
J090068D17CCAAGCCCAGCCCATCCCCCNONE 
J100027E21CCAAGCCCAGCCCATCCCCCNONE 
J100058D21CCAAGCCCAGCCCATCCCCCNONE 
J100067B02CCAAGCCCAGCCCATCCCCCNONE 
Os08g0390700009-094-H10GGGCTGGGCCTCNONE 
AK062714GGGCTGGGCCTCSimilar to 2-oxoglutarate-dependent oxygenase. 
Os08g0427900AK103217GGGCTGGGCCGTASimilar to Hin19 (Fragment). 
AK109208GGGCTGGGCCGTANONE 
J080005C08GGGCTGGGCCGTANONE 
J080010B10GGGCTGGGCCGTANONE 
J080013C21GGGCTGGGCCGTANONE 
J080022L12GGGCTGGGCCGTANONE 
J080029C08GGGCTGGGCCGTANONE 
J080029G09GGGCTGGGCCGTANONE 
J080035L14GGGCTGGGCCGTANONE 
J080040M20GGGCTGGGCCGTANONE 
J080043M18GGGCTGGGCCGTANONE 
J080045K15GGGCTGGGCCGTANONE 
J080048I17GGGCTGGGCCGTANONE 
J080051P16GGGCTGGGCCGTANONE 
J080053L16GGGCTGGGCCGTANONE 
J080059P14GGGCTGGGCCGTANONE 
J080063E13GGGCTGGGCCGTANONE 
J080075N18GGGCTGGGCCGTANONE 
J080077E05GGGCTGGGCCGTANONE 
J080080H23GGGCTGGGCCGTANONE 
J080081L16GGGCTGGGCCGTANONE 
J080083F17GGGCTGGGCCGTANONE 
J080085C23GGGCTGGGCCGTANONE 
J080086A12GGGCTGGGCCGTANONE 
J080088N06GGGCTGGGCCGTANONE 
J080092G10GGGCTGGGCCGTANONE 
J080093F04GGGCTGGGCCGTANONE 
J080094C03GGGCTGGGCCGTANONE 
J090032L12GGGCTGGGCCGTANONE 
Os08g0435800AK121712CCAGCCCAGCCCAGATSimilar to Lipoate protein ligase-like protein. 
J065121P15CCAGCCCAGCCCAGATNONE 
Os08g0442300006-067-F05GCTGGGCTGGGCTTTNONE 
AK059843GCTGGGCTGGGCTTTNONE 
AK071719GCTGGGCTGGGCTTTSimilar to Calcineurin-like protein. 
AK102411GCTGGGCTGGGCTTTNONE 
J023108H11GCTGGGCTGGGCTTTNONE 
J033092P05GCTGGGCTGGGCTTTNONE 
J075109C09GCTGGGCTGGGCTTTNONE 
J090070B02GCTGGGCTGGGCTTTNONE 
J090076M14GCTGGGCTGGGCTTTNONE 
J100064B16GCTGGGCTGGGCTTTNONE 
Os08g0471900015-099-E10TAAGCCCAGCCCATTTNONE 
AK069434TAAGCCCAGCCCATTTZinc finger, ZPR1-type domain containing protein. 
Os08g0539700AB013451GGGCTGGGCTGANONE 
AK065693GGGCTGGGCTGADisease resistance protein family protein. 
AK099855GGGCTGGGCTGANONE 
J013022K17GGGCTGGGCTGANONE 
J013035D04GGGCTGGGCTGANONE 
J013037A20GGGCTGGGCTGANONE 
J013043I01GGGCTGGGCTGANONE 
J013051J07GGGCTGGGCTGANONE 
J013056G09GGGCTGGGCTGANONE 
J013067C09GGGCTGGGCTGANONE 
J013067M22GGGCTGGGCTGANONE 
J013089C05GGGCTGGGCTGANONE 
J013106J08GGGCTGGGCTGANONE 
J013110K12GGGCTGGGCTGANONE 
J013114K06GGGCTGGGCTGANONE 
J013135N19GGGCTGGGCTGANONE 
J013149H06GGGCTGGGCTGANONE 
J075111G14GGGCTGGGCTGANONE 
Os08g0548300AK073266CCCAGCCCACCACZinc finger, RING-type domain containing protein. 
J013030C19CCCAGCCCACCACNONE 
J033029A20CCCAGCCCACCACNONE 
J033050L14CCCAGCCCACCACNONE 
J033058F03CCCAGCCCACCACNONE 
J033110K01CCCAGCCCACCACNONE 
J033123D21CCCAGCCCACCACNONE 
Os08g0565800009-034-G02AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCANONE 
009-111-D12AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCANONE 
AK062431AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCASimilar to Glutaredoxin. 
AK062820AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCANONE 
J075022E05AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCANONE 
J075066F07AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCANONE 
J075146B21AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCANONE 
Os09g0101800AK102345ATTTGGGCTGGGWD40-like domain containing protein. 
J090030C23ATTTGGGCTGGGNONE 
Os09g0112400AK109186CAAGCCCATAAGCCCAATTGGCCCAGCCCAACCSimilar to DCL protein, chloroplast precursor (Defective chloroplasts and leaves protein). 
Os09g0133600006-034-E08CCCAGCCCATCANONE 
AK061477CCCAGCCCATCAPAP fibrillin family protein. 
AK099394CCCAGCCCATCANONE 
AK104742CCCAGCCCATCANONE 
AY224474CCCAGCCCATCANONE 
Os09g0243200AK107718CCCAGCCCAACAZinc finger, RING-type domain containing protein. 
Os09g0293900Os09g0293900AAAGCCCAGCCCACGAAPeptidylprolyl isomerase, FKBP-type domain containing protein. 
Os09g0458400AK070055ACTGACAGCCCAGCCCATTAConserved hypothetical protein. 
AK120321ACTGACAGCCCAGCCCATTANONE 
J065064N11ACTGACAGCCCAGCCCATTANONE 
J065083J06ACTGACAGCCCAGCCCATTANONE 
J065121D24ACTGACAGCCCAGCCCATTANONE 
J065156I22ACTGACAGCCCAGCCCATTANONE 
J065163J24ACTGACAGCCCAGCCCATTANONE 
J075001I02ACTGACAGCCCAGCCCATTANONE 
J090088O06ACTGACAGCCCAGCCCATTANONE 
Os09g0465800009-106-E01GCCGGCCCAGCCCAAAANONE 
AK062785GCCGGCCCAGCCCAAAAConserved hypothetical protein. 
J065122K21GCCGGCCCAGCCCAAAANONE 
Os09g0487500AK108131AAAGCCCAGCCCATTTConserved hypothetical protein. 
J080062L16AAAGCCCAGCCCATTTNONE 
Os09g0516800009-017-A01TAAGCCCAGCCCAACCConserved hypothetical protein. 
Os09g0535300AK071211AAGGCCCAGCCCAAGXAP5 protein family protein. 
Os09g0568000AK068829TACTGGGCTGGGCTTGNONE 
Os09g0571400AK103109AAATGGGCTGGGCTTGCyclophilin 1. 
J023011A12AAATGGGCTGGGCTTGNONE 
J033119A20AAATGGGCTGGGCTTGNONE 
J053034N16AAATGGGCTGGGCTTGNONE 
J053045N23AAATGGGCTGGGCTTGNONE 
J053052J12AAATGGGCTGGGCTTGNONE 
J053052K04AAATGGGCTGGGCTTGNONE 
J053099M15AAATGGGCTGGGCTTGNONE 
J065071H23AAATGGGCTGGGCTTGNONE 
J065131B16AAATGGGCTGGGCTTGNONE 
J075003F19AAATGGGCTGGGCTTGNONE 
J075116F02AAATGGGCTGGGCTTGNONE 
J075126G05AAATGGGCTGGGCTTGNONE 
J075145E09AAATGGGCTGGGCTTGNONE 
J075149O22AAATGGGCTGGGCTTGNONE 
J075163A09AAATGGGCTGGGCTTGNONE 
J075194A09AAATGGGCTGGGCTTGNONE 
L29471AAATGGGCTGGGCTTGNONE 
Os11g0100100009-122-C12ACATGGGCTGGGCTSimilar to Gamma-aminobutyric acid receptor-associated protein-like 2 (GABA(A) receptor-associated protein-like 2) (Ganglioside expression factor 2) (GEF-2) (General protein transport factor p16) (MAP1 light chain 3 related protein). 
Os11g0168200005-010-H01CCCAGCCCAGCCCAGNONE 
009-156-F07CCCAGCCCAGCCCAGNONE 
012-025-F01CCCAGCCCAGCCCAGNONE 
012-089-A02CCCAGCCCAGCCCAGNONE 
016-016-E08CCCAGCCCAGCCCAGNONE 
AK073392CCCAGCCCAGCCCAG60S ribosomal protein L3. 
AK099225CCCAGCCCAGCCCAGNONE 
AK101469CCCAGCCCAGCCCAGNONE 
AY236158CCCAGCCCAGCCCAGNONE 
J013152M22CCCAGCCCAGCCCAGNONE 
J023013N11CCCAGCCCAGCCCAGNONE 
J023038J11CCCAGCCCAGCCCAGNONE 
J023054N21CCCAGCCCAGCCCAGNONE 
J033041E13CCCAGCCCAGCCCAGNONE 
J033050O09CCCAGCCCAGCCCAGNONE 
J033093G05CCCAGCCCAGCCCAGNONE 
J033094J17CCCAGCCCAGCCCAGNONE 
J033112J24CCCAGCCCAGCCCAGNONE 
J033113D05CCCAGCCCAGCCCAGNONE 
J033120K10CCCAGCCCAGCCCAGNONE 
J033121H19CCCAGCCCAGCCCAGNONE 
J033129C08CCCAGCCCAGCCCAGNONE 
J033140H24CCCAGCCCAGCCCAGNONE 
J065020I18CCCAGCCCAGCCCAGNONE 
J065058L01CCCAGCCCAGCCCAGNONE 
J065059G22CCCAGCCCAGCCCAGNONE 
J065212L09CCCAGCCCAGCCCAGNONE 
J075047P09CCCAGCCCAGCCCAGNONE 
J075063C18CCCAGCCCAGCCCAGNONE 
J075076E07CCCAGCCCAGCCCAGNONE 
J075077F14CCCAGCCCAGCCCAGNONE 
J075086C22CCCAGCCCAGCCCAGNONE 
J075161L09CCCAGCCCAGCCCAGNONE 
J075177K20CCCAGCCCAGCCCAGNONE 
J090007L06CCCAGCCCAGCCCAGNONE 
J090010M02CCCAGCCCAGCCCAGNONE 
J090013M20CCCAGCCCAGCCCAGNONE 
J090044I15CCCAGCCCAGCCCAGNONE 
J090045O06CCCAGCCCAGCCCAGNONE 
J090060L04CCCAGCCCAGCCCAGNONE 
J090061C17CCCAGCCCAGCCCAGNONE 
J090062F10CCCAGCCCAGCCCAGNONE 
J090066L03CCCAGCCCAGCCCAGNONE 
J090089E13CCCAGCCCAGCCCAGNONE 
J090096D21CCCAGCCCAGCCCAGNONE 
J100039F12CCCAGCCCAGCCCAGNONE 
J100053N06CCCAGCCCAGCCCAGNONE 
Os11g0184900011-088-C07GCGGCCCAGCCCAGCNONE 
015-036-B03GCGGCCCAGCCCAGCNONE 
016-087-F07GCGGCCCAGCCCAGCNONE 
AB028184GCGGCCCAGCCCAGCNONE 
AK063399GCGGCCCAGCCCAGCSimilar to NAC-domain protein 5-7. 
AK064292GCGGCCCAGCCCAGCNONE 
AK102475GCGGCCCAGCCCAGCNONE 
J033094I01GCGGCCCAGCCCAGCNONE 
J090087J16GCGGCCCAGCCCAGCNONE 
Os11g0425300AK065810CCACGGCCCAGCCCACACConserved hypothetical protein. 
AK067248CCACGGCCCAGCCCACACNONE 
J013038F05CCACGGCCCAGCCCACACNONE 
J013039B05CCACGGCCCAGCCCACACNONE 
J013060P13CCACGGCCCAGCCCACACNONE 
J013099D01CCACGGCCCAGCCCACACNONE 
J023023L06CCACGGCCCAGCCCACACNONE 
J023061G18CCACGGCCCAGCCCACACNONE 
J023099E11CCACGGCCCAGCCCACACNONE 
J065002A08CCACGGCCCAGCCCACACNONE 
J065046L21CCACGGCCCAGCCCACACNONE 
J065122K11CCACGGCCCAGCCCACACNONE 
J090071I21CCACGGCCCAGCCCACACNONE 
J090077P13CCACGGCCCAGCCCACACNONE 
Os11g0488600AK111309CACGGCCCAGCCCACGAConserved hypothetical protein. 
J075011H20CACGGCCCAGCCCACGANONE 
J075068E17CACGGCCCAGCCCACGANONE 
J075102G16CACGGCCCAGCCCACGANONE 
Os11g0513900AK101049GGCTGGGCTGGGCCTTGConserved hypothetical protein. 
Os11g0545800AK073687CCAGCCCAGCCCRegulator of chromosome condensation/beta-lactamase-inhibitor protein II domain containing protein. 
J090050C14CCAGCCCAGCCCNONE 
Os11g0568300016-075-B02TGGGCTGGGNONE 
AK064398TGGGCTGGGHMG-I and HMG-Y, DNA-binding domain containing protein. 
AK103282TGGGCTGGGNONE 
J033124M10TGGGCTGGGNONE 
J065120I21TGGGCTGGGNONE 
J065144H16TGGGCTGGGNONE 
Os11g0586900AK058229ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
AK071632ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTSimilar to ADP-ribosylation factor-like protein 5. 
J023049H24ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J023101B18ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J023104M08ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J065113K16ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J065129H17ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J065209I03ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J075027I19ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J075056M03ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J075119L16ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
J075148G16ACAGCCCAAGCCCATGGAAGGCCCAGCCCAACTNONE 
Os11g0592500AK067078GAGGCCCAGCCCAAAANONE 
Os11g0642100AK107010TAATGGGCCCAGCCCCyclin-like F-box domain containing protein. 
Os12g0100050Os12g0100050ACATGGGCTGGGCTGGGCTGGGCTLight chain 3 (LC3) family protein. 
Os12g0100100006-036-G03AGCCCAGCCCAGCCCAGCCCATGTNONE 
AK061492AGCCCAGCCCAGCCCAGCCCATGTSimilar to ALY protein. 
AK068452AGCCCAGCCCAGCCCAGCCCATGTNONE 
J013153E18AGCCCAGCCCAGCCCAGCCCATGTNONE 
J033140D06AGCCCAGCCCAGCCCAGCCCATGTNONE 
J065046A19AGCCCAGCCCAGCCCAGCCCATGTNONE 
J065061F08AGCCCAGCCCAGCCCAGCCCATGTNONE 
J065101I03AGCCCAGCCCAGCCCAGCCCATGTNONE 
J065158B05AGCCCAGCCCAGCCCAGCCCATGTNONE 
J065162H06AGCCCAGCCCAGCCCAGCCCATGTNONE 
J065195I23AGCCCAGCCCAGCCCAGCCCATGTNONE 
J065218E07AGCCCAGCCCAGCCCAGCCCATGTNONE 
Os12g0164300AK120100GCCCAGCCCAAGCyclin-like F-box domain containing protein. 
J013022J17GCCCAGCCCAAGNONE 
J013040L22GCCCAGCCCAAGNONE 
J013041G05GCCCAGCCCAAGNONE 
J013096I02GCCCAGCCCAAGNONE 
J013156F05GCCCAGCCCAAGNONE 
J023122E20GCCCAGCCCAAGNONE 
J065008K06GCCCAGCCCAAGNONE 
J065073G14GCCCAGCCCAAGNONE 
J065105H07GCCCAGCCCAAGNONE 
J065117A15GCCCAGCCCAAGNONE 
J075025K21GCCCAGCCCAAGNONE 
J075051A13GCCCAGCCCAAGNONE 
J075119C17GCCCAGCCCAAGNONE 
J075143A02GCCCAGCCCAAGNONE 
J075149K04GCCCAGCCCAAGNONE 
J080304A20GCCCAGCCCAAGNONE 
J080305H17GCCCAGCCCAAGNONE 
J080306D14GCCCAGCCCAAGNONE 
J080306N01GCCCAGCCCAAGNONE 
J080308P13GCCCAGCCCAAGNONE 
J080310C04GCCCAGCCCAAGNONE 
J090048B12GCCCAGCCCAAGNONE 
J090092A18GCCCAGCCCAAGNONE 
J090099G20GCCCAGCCCAAGNONE 
Os12g0189300AK068710GTGGCGTGGGCCCCACTCCCGGCCCACCAGGCCCAGCCCIsocitrate lyase and phosphorylmutase family protein. 
Os12g0193800AK111754CCATGGGCTGGGCConserved hypothetical protein. 
Os12g0479400AK065254AAAGCCCAAGCCCAGCCCAACCNONE 
AK067061AAAGCCCAAGCCCAGCCCAACCSimilar to Auxin response factor 1. 
Os12g0527500AK109836CCCAGCCCAAGCyclin-like F-box domain containing protein. 
Os12g0527850Os12g0527850GGGCTGGGProtein prenyltransferase domain containing protein. 
Os12g0533500AK068646GGGCTGGGCCGCGTGGGCCAAConserved hypothetical protein. 
J013158L10GGGCTGGGCCGCGTGGGCCAANONE 
J065083J02GGGCTGGGCCGCGTGGGCCAANONE 
J075079D02GGGCTGGGCCGCGTGGGCCAANONE 
J100037H16GGGCTGGGCCGCGTGGGCCAANONE 
J100075P13GGGCTGGGCCGCGTGGGCCAANONE 
Os12g0538500006-077-B08AGTGGGCCCAGCCCNONE 
AK059316AGTGGGCCCAGCCCSimilar to PGPD14 protein. 
AK069502AGTGGGCCCAGCCCNONE 
AK104170AGTGGGCCCAGCCCNONE 
AK104287AGTGGGCCCAGCCCNONE 
J023020D18AGTGGGCCCAGCCCNONE 
J090079P08AGTGGGCCCAGCCCNONE 
Os12g0554400AK072345CCCAGCCCATCCTetratricopeptide-like helical domain containing protein. 
Os12g0564800AK103886GCGGCCCAGCCCAAATDisease resistance protein family protein. 
Os12g0573200AK111522AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
AK121943AGCCCAAGCCCAGCCCAGCCCAGCCCAAACGRAS transcription factor domain containing protein. 
J013002M11AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J013151M11AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J013159J22AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J023087F18AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J033107F03AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J033125L09AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J033126E12AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J043022I15AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J065176F05AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J090034D17AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J090075J06AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J100058D22AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
J100058P04AGCCCAAGCCCAGCCCAGCCCAGCCCAAACNONE 
Os12g0578500AK065485TGGGCTGGGGlycosyl transferase, family 8 protein. 
J043027D21TGGGCTGGGNONE 
J075120F12TGGGCTGGGNONE 
J080010J21TGGGCTGGGNONE 
J080015L10TGGGCTGGGNONE 
J080016C19TGGGCTGGGNONE 
J080016F10TGGGCTGGGNONE 
J080022A12TGGGCTGGGNONE 
J080024B10TGGGCTGGGNONE 
J080025C16TGGGCTGGGNONE 
J080026B03TGGGCTGGGNONE 
J080028B11TGGGCTGGGNONE 
J080028M19TGGGCTGGGNONE 
J080030I02TGGGCTGGGNONE 
J080032F18TGGGCTGGGNONE 
J080038O16TGGGCTGGGNONE 
J080040D01TGGGCTGGGNONE 
J080043H19TGGGCTGGGNONE 
J080045N21TGGGCTGGGNONE 
J080046H14TGGGCTGGGNONE 
J080053B20TGGGCTGGGNONE 
J080053P14TGGGCTGGGNONE 
J080056L15TGGGCTGGGNONE 
J080057F14TGGGCTGGGNONE 
J080060C10TGGGCTGGGNONE 
J080061D20TGGGCTGGGNONE 
J080061J12TGGGCTGGGNONE 
J080062F17TGGGCTGGGNONE 
J080065M15TGGGCTGGGNONE 
J080066N15TGGGCTGGGNONE 
J080069K21TGGGCTGGGNONE 
J080070L14TGGGCTGGGNONE 
J080072L05TGGGCTGGGNONE 
J080072L16TGGGCTGGGNONE 
J080075D08TGGGCTGGGNONE 
J080075I19TGGGCTGGGNONE 
J080076M24TGGGCTGGGNONE 
J080077M11TGGGCTGGGNONE 
J080078O10TGGGCTGGGNONE 
J080081K24TGGGCTGGGNONE 
J080082J02TGGGCTGGGNONE 
J080083N20TGGGCTGGGNONE 
J080085M09TGGGCTGGGNONE 
J080093K05TGGGCTGGGNONE 
J080094J19TGGGCTGGGNONE 
J080095E06TGGGCTGGGNONE 
J080096B04TGGGCTGGGNONE 
J080096H08TGGGCTGGGNONE 
J090034I21TGGGCTGGGNONE 
J090045J19TGGGCTGGGNONE 
J090065F20TGGGCTGGGNONE 
J100077M24TGGGCTGGGNONE 
Os12g0584100006-083-C12TAGGCCCAGCCCACCCNONE 
006-104-C06TAGGCCCAGCCCACCCNONE 
AK066829TAGGCCCAGCCCACCCNONE 
AK071424TAGGCCCAGCCCACCCConserved hypothetical protein. 
J013075O22TAGGCCCAGCCCACCCNONE 
J023091J20TAGGCCCAGCCCACCCNONE 
J065167K15TAGGCCCAGCCCACCCNONE 
J065213C02TAGGCCCAGCCCACCCNONE 
J075001B17TAGGCCCAGCCCACCCNONE 
J075165D13TAGGCCCAGCCCACCCNONE 
J075195C24TAGGCCCAGCCCACCCNONE 
Os12g0597500AK101904CCCACTCCTGGGCCCAGCCCATCCANONE 
AK103799CCCACTCCTGGGCCCAGCCCATCCAAmidase, hydantoinase/carbamoylase family protein. 
J065206A02CCCACTCCTGGGCCCAGCCCATCCANONE 
J100078O15CCCACTCCTGGGCCCAGCCCATCCANONE 
Os12g0605400009-005-G05CTCGGCCCAACCCAGCCCACCTNONE 
016-024-B01CTCGGCCCAACCCAGCCCACCTNONE 
016-043-A11CTCGGCCCAACCCAGCCCACCTNONE 
AK068060CTCGGCCCAACCCAGCCCACCTSimilar to CROC-1-like protein (Fragment). 
J013130B07CTCGGCCCAACCCAGCCCACCTNONE 
J023141C14CTCGGCCCAACCCAGCCCACCTNONE 
J033037O04CTCGGCCCAACCCAGCCCACCTNONE 
J033081L17CTCGGCCCAACCCAGCCCACCTNONE 
J033108C03CTCGGCCCAACCCAGCCCACCTNONE 
J065079G22CTCGGCCCAACCCAGCCCACCTNONE 
J065082D03CTCGGCCCAACCCAGCCCACCTNONE 
J065207O15CTCGGCCCAACCCAGCCCACCTNONE 
J075027C23CTCGGCCCAACCCAGCCCACCTNONE 
J075037A17CTCGGCCCAACCCAGCCCACCTNONE 
J075056D17CTCGGCCCAACCCAGCCCACCTNONE 
J075064O21CTCGGCCCAACCCAGCCCACCTNONE 
J075096E08CTCGGCCCAACCCAGCCCACCTNONE 
J090036I15CTCGGCCCAACCCAGCCCACCTNONE 
J100018P15CTCGGCCCAACCCAGCCCACCTNONE 
J100074O06CTCGGCCCAACCCAGCCCACCTNONE 
Os12g0609800AK101303AGATGGGCTGGGCytochrome cd1-nitrite reductase-like, C-terminal haem d1 domain containing protein. 
J033032I01AGATGGGCTGGGNONE 
J033033K21AGATGGGCTGGGNONE 
J033082L13AGATGGGCTGGGNONE 
J043034M20AGATGGGCTGGGNONE 
J065137J24AGATGGGCTGGGNONE 
J065141A11AGATGGGCTGGGNONE 
J065217H09AGATGGGCTGGGNONE 
Os12g0624000AK067726CCCACCACTTTGGGCTGGGNONE 
AK067757CCCACCACTTTGGGCTGGGSimilar to Methionine synthase protein. 
J013039E03CCCACCACTTTGGGCTGGGNONE 
J013040D22CCCACCACTTTGGGCTGGGNONE 
J013047K12CCCACCACTTTGGGCTGGGNONE 
J013056C04CCCACCACTTTGGGCTGGGNONE 
J013062K01CCCACCACTTTGGGCTGGGNONE 
J013108K09CCCACCACTTTGGGCTGGGNONE 
J013126I24CCCACCACTTTGGGCTGGGNONE 
J013128D18CCCACCACTTTGGGCTGGGNONE 
J013147D23CCCACCACTTTGGGCTGGGNONE 
J013154N13CCCACCACTTTGGGCTGGGNONE 
J023003C20CCCACCACTTTGGGCTGGGNONE 
J023003N19CCCACCACTTTGGGCTGGGNONE 
J023007B09CCCACCACTTTGGGCTGGGNONE 
J023008L12CCCACCACTTTGGGCTGGGNONE 
J023037O10CCCACCACTTTGGGCTGGGNONE 
J023044F11CCCACCACTTTGGGCTGGGNONE 
J023062H22CCCACCACTTTGGGCTGGGNONE 
J023064O07CCCACCACTTTGGGCTGGGNONE 
J023067D16CCCACCACTTTGGGCTGGGNONE 
J023082C19CCCACCACTTTGGGCTGGGNONE 
J023090A08CCCACCACTTTGGGCTGGGNONE 
J023102P21CCCACCACTTTGGGCTGGGNONE 
J023122G15CCCACCACTTTGGGCTGGGNONE 
J023123I24CCCACCACTTTGGGCTGGGNONE 
J023134N07CCCACCACTTTGGGCTGGGNONE 
J023140M21CCCACCACTTTGGGCTGGGNONE 
J033023G06CCCACCACTTTGGGCTGGGNONE 
J033025J02CCCACCACTTTGGGCTGGGNONE 
J033025L06CCCACCACTTTGGGCTGGGNONE 
J033026I21CCCACCACTTTGGGCTGGGNONE 
J033028G20CCCACCACTTTGGGCTGGGNONE 
J033028L03CCCACCACTTTGGGCTGGGNONE 
J033030P14CCCACCACTTTGGGCTGGGNONE 
J033031C02CCCACCACTTTGGGCTGGGNONE 
J033031I06CCCACCACTTTGGGCTGGGNONE 
J033037D21CCCACCACTTTGGGCTGGGNONE 
J033037M24CCCACCACTTTGGGCTGGGNONE 
J033040P06CCCACCACTTTGGGCTGGGNONE 
J033046J18CCCACCACTTTGGGCTGGGNONE 
J033048A14CCCACCACTTTGGGCTGGGNONE 
J033048B14CCCACCACTTTGGGCTGGGNONE 
J033051N03CCCACCACTTTGGGCTGGGNONE 
J033060A19CCCACCACTTTGGGCTGGGNONE 
J033060K19CCCACCACTTTGGGCTGGGNONE 
J033065O13CCCACCACTTTGGGCTGGGNONE 
J033067I23CCCACCACTTTGGGCTGGGNONE 
J033068N13CCCACCACTTTGGGCTGGGNONE 
J033070N02CCCACCACTTTGGGCTGGGNONE 
J033072K15CCCACCACTTTGGGCTGGGNONE 
J033073D09CCCACCACTTTGGGCTGGGNONE 
J033075H17CCCACCACTTTGGGCTGGGNONE 
J033076O22CCCACCACTTTGGGCTGGGNONE 
J033086K06CCCACCACTTTGGGCTGGGNONE 
J033086L03CCCACCACTTTGGGCTGGGNONE 
J033088J09CCCACCACTTTGGGCTGGGNONE 
J033091D17CCCACCACTTTGGGCTGGGNONE 
J033096B11CCCACCACTTTGGGCTGGGNONE 
J033099A05CCCACCACTTTGGGCTGGGNONE 
J033101B15CCCACCACTTTGGGCTGGGNONE 
J033101D20CCCACCACTTTGGGCTGGGNONE 
J033105D22CCCACCACTTTGGGCTGGGNONE 
J033106J20CCCACCACTTTGGGCTGGGNONE 
J033107J01CCCACCACTTTGGGCTGGGNONE 
J033111N08CCCACCACTTTGGGCTGGGNONE 
J033112B18CCCACCACTTTGGGCTGGGNONE 
J033113L04CCCACCACTTTGGGCTGGGNONE 
J033114F02CCCACCACTTTGGGCTGGGNONE 
J033118A22CCCACCACTTTGGGCTGGGNONE 
J033119J02CCCACCACTTTGGGCTGGGNONE 
J033120F22CCCACCACTTTGGGCTGGGNONE 
J033120O16CCCACCACTTTGGGCTGGGNONE 
J033127A12CCCACCACTTTGGGCTGGGNONE 
J033127J08CCCACCACTTTGGGCTGGGNONE 
J033127N13CCCACCACTTTGGGCTGGGNONE 
J033131N09CCCACCACTTTGGGCTGGGNONE 
J033135I05CCCACCACTTTGGGCTGGGNONE 
J033140D04CCCACCACTTTGGGCTGGGNONE 
J033142D04CCCACCACTTTGGGCTGGGNONE 
J033145B14CCCACCACTTTGGGCTGGGNONE 
J043007I15CCCACCACTTTGGGCTGGGNONE 
J043021N20CCCACCACTTTGGGCTGGGNONE 
J043037I05CCCACCACTTTGGGCTGGGNONE 
J065008P22CCCACCACTTTGGGCTGGGNONE 
J065038C05CCCACCACTTTGGGCTGGGNONE 
J065060A16CCCACCACTTTGGGCTGGGNONE 
J065111M10CCCACCACTTTGGGCTGGGNONE 
J065112L11CCCACCACTTTGGGCTGGGNONE 
J065114B07CCCACCACTTTGGGCTGGGNONE 
J065116M04CCCACCACTTTGGGCTGGGNONE 
J065152D15CCCACCACTTTGGGCTGGGNONE 
J065171C15CCCACCACTTTGGGCTGGGNONE 
J065173N07CCCACCACTTTGGGCTGGGNONE 
J065185N18CCCACCACTTTGGGCTGGGNONE 
J065187F09CCCACCACTTTGGGCTGGGNONE 
J065188L15CCCACCACTTTGGGCTGGGNONE 
J065190K15CCCACCACTTTGGGCTGGGNONE 
J065214C16CCCACCACTTTGGGCTGGGNONE 
J065215F05CCCACCACTTTGGGCTGGGNONE 
J075108J08CCCACCACTTTGGGCTGGGNONE 
J090002C16CCCACCACTTTGGGCTGGGNONE 
J090002K12CCCACCACTTTGGGCTGGGNONE 
J090003M10CCCACCACTTTGGGCTGGGNONE 
J090007J12CCCACCACTTTGGGCTGGGNONE 
J090010D06CCCACCACTTTGGGCTGGGNONE 
J090010F21CCCACCACTTTGGGCTGGGNONE 
J090014E20CCCACCACTTTGGGCTGGGNONE 
J090014J03CCCACCACTTTGGGCTGGGNONE 
J090017E15CCCACCACTTTGGGCTGGGNONE 
J090019J18CCCACCACTTTGGGCTGGGNONE 
J090021B21CCCACCACTTTGGGCTGGGNONE 
J090021H21CCCACCACTTTGGGCTGGGNONE 
J090021J12CCCACCACTTTGGGCTGGGNONE 
J090022K10CCCACCACTTTGGGCTGGGNONE 
J090024C24CCCACCACTTTGGGCTGGGNONE 
J090026D12CCCACCACTTTGGGCTGGGNONE 
J090034F08CCCACCACTTTGGGCTGGGNONE 
J090036H24CCCACCACTTTGGGCTGGGNONE 
J090036L04CCCACCACTTTGGGCTGGGNONE 
J090040C21CCCACCACTTTGGGCTGGGNONE 
J090045J21CCCACCACTTTGGGCTGGGNONE 
J090052D21CCCACCACTTTGGGCTGGGNONE 
J090053A01CCCACCACTTTGGGCTGGGNONE 
J090057E01CCCACCACTTTGGGCTGGGNONE 
J090059A01CCCACCACTTTGGGCTGGGNONE 
J090059M24CCCACCACTTTGGGCTGGGNONE 
J090062A08CCCACCACTTTGGGCTGGGNONE 
J090065H17CCCACCACTTTGGGCTGGGNONE 
J090073M22CCCACCACTTTGGGCTGGGNONE 
J090074J05CCCACCACTTTGGGCTGGGNONE 
J090074L22CCCACCACTTTGGGCTGGGNONE 
J090077E04CCCACCACTTTGGGCTGGGNONE 
J090077K10CCCACCACTTTGGGCTGGGNONE 
J090088E21CCCACCACTTTGGGCTGGGNONE 
J090088L13CCCACCACTTTGGGCTGGGNONE 
J090089M05CCCACCACTTTGGGCTGGGNONE 
J090092E18CCCACCACTTTGGGCTGGGNONE 
J090092P07CCCACCACTTTGGGCTGGGNONE 
J090096M04CCCACCACTTTGGGCTGGGNONE 
J090099I04CCCACCACTTTGGGCTGGGNONE 
J100023P11CCCACCACTTTGGGCTGGGNONE 
J100024K13CCCACCACTTTGGGCTGGGNONE 
J100026P20CCCACCACTTTGGGCTGGGNONE 
J100027I15CCCACCACTTTGGGCTGGGNONE 
J100027M21CCCACCACTTTGGGCTGGGNONE 
J100029H05CCCACCACTTTGGGCTGGGNONE 
J100030E10CCCACCACTTTGGGCTGGGNONE 
J100030F11CCCACCACTTTGGGCTGGGNONE 
J100031C13CCCACCACTTTGGGCTGGGNONE 
J100032P16CCCACCACTTTGGGCTGGGNONE 
J100034G02CCCACCACTTTGGGCTGGGNONE 
J100037D06CCCACCACTTTGGGCTGGGNONE 
J100050D08CCCACCACTTTGGGCTGGGNONE 
J100051J22CCCACCACTTTGGGCTGGGNONE 
J100055G12CCCACCACTTTGGGCTGGGNONE 
J100056O15CCCACCACTTTGGGCTGGGNONE 
J100057E06CCCACCACTTTGGGCTGGGNONE 
J100061P11CCCACCACTTTGGGCTGGGNONE 
J100064H05CCCACCACTTTGGGCTGGGNONE 
J100066D14CCCACCACTTTGGGCTGGGNONE 
J100067D10CCCACCACTTTGGGCTGGGNONE 
J100070L11CCCACCACTTTGGGCTGGGNONE 
J100071N11CCCACCACTTTGGGCTGGGNONE 
J100073D21CCCACCACTTTGGGCTGGGNONE 
J100074L06CCCACCACTTTGGGCTGGGNONE 
J100081I01CCCACCACTTTGGGCTGGGNONE 
J100083F08CCCACCACTTTGGGCTGGGNONE 
J100083I15CCCACCACTTTGGGCTGGGNONE 
J100084P13CCCACCACTTTGGGCTGGGNONE 
J100086N12CCCACCACTTTGGGCTGGGNONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.