version

Summary of OsREG534 (All List)

OrganismOryza sativa  
IDOsREG534  
SequenceCCCATCCA  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count2405  

Entry Sequences (2405 entries)

LocusGene modelSequenceDescription
Os01g0102600AK064812CCCATCCAShikimate kinase domain containing protein. 
J013000E05CCCATCCANONE 
J013027D08CCCATCCANONE 
J013045K12CCCATCCANONE 
J023119M03CCCATCCANONE 
J065081F02CCCATCCANONE 
J065180C08CCCATCCANONE 
J065211M06CCCATCCANONE 
J075073J06CCCATCCANONE 
J075123A18CCCATCCANONE 
J075124A07CCCATCCANONE 
J075187B05CCCATCCANONE 
Os01g0150200006-072-A05CCCATCCACCNONE 
AK060935CCCATCCACCNONE 
AK099465CCCATCCACCProtein tyrosine phosphatase-like protein, PTPLA family protein. 
J013023K19CCCATCCACCNONE 
J065009G18CCCATCCACCNONE 
J065054L02CCCATCCACCNONE 
J065139N21CCCATCCACCNONE 
J065191G16CCCATCCACCNONE 
J075157K23CCCATCCACCNONE 
J100025C13CCCATCCACCNONE 
J100032B09CCCATCCACCNONE 
J100053I22CCCATCCACCNONE 
J100072P11CCCATCCACCNONE 
Os01g0203300015-045-F03TAGGCCCATCCANONE 
AK106329TAGGCCCATCCAConserved hypothetical protein. 
Os01g0212100AK065467AGCCCATCCAAGGTGGGCCCAAATNONE 
AK101456AGCCCATCCAAGGTGGGCCCAAATATP-dependent helicase, DEAH-box family protein. 
Os01g0224100011-010-A11CCCATCCANONE 
011-034-B03CCCATCCANONE 
011-067-G07CCCATCCANONE 
015-017-C02CCCATCCANONE 
015-090-E01CCCATCCANONE 
AK101054CCCATCCANONE 
AK106517CCCATCCASimilar to DNA binding protein-like protein. 
Os01g0239700AK067723CCCATCCASimilar to Leucine-rich receptor-like protein kinase. 
AK122130CCCATCCANONE 
Os01g0246100AK120732TCTGGCCCATCCACTGACProtein of unknown function DUF902, CREBbp domain containing protein. 
Os01g0303300J053035N19AGCCCATCCANONE 
J075042F02AGCCCATCCANONE 
J075068E10AGCCCATCCANONE 
J075116E19AGCCCATCCANONE 
J075131C10AGCCCATCCANONE 
J075145J11AGCCCATCCANONE 
J075157P20AGCCCATCCAMitochondrial import inner membrane translocase, subunit Tim17/22 family protein. 
J075164G12AGCCCATCCANONE 
Os01g0335700AK068195TGGATGGGDisease resistance protein family protein. 
J013146B15TGGATGGGNONE 
Os01g0350900AK070217CCCATCCASimilar to VIP2 protein. 
J065165D23CCCATCCANONE 
Os01g0548000AK100868TGGATGGGConserved hypothetical protein. 
AK108360TGGATGGGNONE 
Os01g0580800J100083G23CCCATCCAConserved hypothetical protein. 
Os01g0582400AK069484TGGATGGGCCGGASimilar to Multidomain cyclophilin type peptidyl-prolyl cis-trans isomerase. 
J023019D12TGGATGGGCCGGANONE 
J023036F15TGGATGGGCCGGANONE 
J023095O16TGGATGGGCCGGANONE 
J033102M15TGGATGGGCCGGANONE 
J043013I06TGGATGGGCCGGANONE 
J065083M21TGGATGGGCCGGANONE 
J065176A17TGGATGGGCCGGANONE 
Os01g0600000014-098-H06CCCATCCACCNONE 
AK121212CCCATCCACCSimilar to Copia-like retroelement pol polyprotein. 
J023089H03CCCATCCACCNONE 
J033140E12CCCATCCACCNONE 
J033142E12CCCATCCACCNONE 
J043040N09CCCATCCACCNONE 
J065014M23CCCATCCACCNONE 
J065017B07CCCATCCACCNONE 
J065019E11CCCATCCACCNONE 
J065049F16CCCATCCACCNONE 
J065053P17CCCATCCACCNONE 
J065083C04CCCATCCACCNONE 
J065093P06CCCATCCACCNONE 
J065146L22CCCATCCACCNONE 
J065203F18CCCATCCACCNONE 
J065217E22CCCATCCACCNONE 
J075003E06CCCATCCACCNONE 
J075005I23CCCATCCACCNONE 
J075020P07CCCATCCACCNONE 
J075049I18CCCATCCACCNONE 
J075086G02CCCATCCACCNONE 
J075101C05CCCATCCACCNONE 
J075110G23CCCATCCACCNONE 
J075144E01CCCATCCACCNONE 
J090061N03CCCATCCACCNONE 
J090068M03CCCATCCACCNONE 
J100084N22CCCATCCACCNONE 
Os01g0649100006-045-H02CCCATCCANONE 
AF444195CCCATCCANONE 
AK071699CCCATCCAMalate dehydrogenase. 
AK104770CCCATCCANONE 
J013052P12CCCATCCANONE 
J023055I04CCCATCCANONE 
J023103H18CCCATCCANONE 
J023108E15CCCATCCANONE 
J033058P22CCCATCCANONE 
J065107D08CCCATCCANONE 
J065146H22CCCATCCANONE 
J080302E04CCCATCCANONE 
J080308G10CCCATCCANONE 
J080315H15CCCATCCANONE 
J090009M02CCCATCCANONE 
J090017P15CCCATCCANONE 
J090041K18CCCATCCANONE 
J090059D24CCCATCCANONE 
J090088P15CCCATCCANONE 
J100025I08CCCATCCANONE 
J100039H05CCCATCCANONE 
J100047P07CCCATCCANONE 
J100053D11CCCATCCANONE 
J100061E15CCCATCCANONE 
J100071G12CCCATCCANONE 
J100076G22CCCATCCANONE 
J100076O09CCCATCCANONE 
J100077G03CCCATCCANONE 
J100082M11CCCATCCANONE 
J100089C05CCCATCCANONE 
Os01g0696000AK066735TGGATGGGCCGAAATTTCGGCCCATCANONE 
AK110917TGGATGGGCCGAAATTTCGGCCCATCASimilar to Calcium-activated outward-rectifying potassium channel 1 (AtKCO1). 
J013088G11TGGATGGGCCGAAATTTCGGCCCATCANONE 
J013102H08TGGATGGGCCGAAATTTCGGCCCATCANONE 
J033126F08TGGATGGGCCGAAATTTCGGCCCATCANONE 
J065053G13TGGATGGGCCGAAATTTCGGCCCATCANONE 
J075109I06TGGATGGGCCGAAATTTCGGCCCATCANONE 
J100073H07TGGATGGGCCGAAATTTCGGCCCATCANONE 
Os01g0700200AK100961TAGGCCCAAGCCCATCCASimilar to Chromosome condensation regulator protein (Fragment). 
J023141C11TAGGCCCAAGCCCATCCANONE 
Os01g0749900AK103588TGGATGGGCCGGTProtein of unknown function DUF250 domain containing protein. 
J033090O22TGGATGGGCCGGTNONE 
J033133C05TGGATGGGCCGGTNONE 
J065122N01TGGATGGGCCGGTNONE 
J065188K04TGGATGGGCCGGTNONE 
J090012D18TGGATGGGCCGGTNONE 
J100074N02TGGATGGGCCGGTNONE 
Os01g0763600AK061563GCCCATCCANONE 
AK066596GCCCATCCAGlycerophosphoryl diester phosphodiesterase family protein. 
J023057P15GCCCATCCANONE 
J065016A16GCCCATCCANONE 
J065039L06GCCCATCCANONE 
J090001E03GCCCATCCANONE 
J090012J18GCCCATCCANONE 
J090085E15GCCCATCCANONE 
Os01g0765000J065061M19TGGATGGGNONE 
Os01g0765400015-011-F09CCCATCCACGCGACGCGNONE 
AK106246CCCATCCACGCGACGCGProteinase inhibitor I4, serpin family protein. 
J100034N10CCCATCCACGCGACGCGNONE 
J100054I23CCCATCCACGCGACGCGNONE 
J100055K02CCCATCCACGCGACGCGNONE 
J100082D02CCCATCCACGCGACGCGNONE 
Os01g0780900J033069J11TGGATGGGNONE 
J065054P18TGGATGGGNONE 
J065163O05TGGATGGGNONE 
J065165B05TGGATGGGNONE 
J075097O22TGGATGGGNONE 
J080029E07TGGATGGGNONE 
J080093M08TGGATGGGNONE 
J100025J07TGGATGGGNONE 
J100029N22TGGATGGGNONE 
J100041C23TGGATGGGConserved hypothetical protein. 
J100041M22TGGATGGGNONE 
J100058D11TGGATGGGNONE 
J100064E15TGGATGGGNONE 
J100066M09TGGATGGGNONE 
J100067H14TGGATGGGNONE 
Os01g0800300006-097-C12CCCATCCANONE 
014-070-C12CCCATCCANONE 
AK072549CCCATCCANONE 
AK100942CCCATCCANONE 
AK100951CCCATCCAConserved hypothetical protein. 
AK106023CCCATCCANONE 
J023138D05CCCATCCANONE 
J075097P16CCCATCCANONE 
J075099F23CCCATCCANONE 
Os01g0810100AK071916TGGATGGGTGGGCRibonuclease III domain containing protein. 
AK099056TGGATGGGTGGGCNONE 
AK104320TGGATGGGTGGGCNONE 
Os01g0814400006-047-D09TGGATGGGCNONE 
006-077-D12TGGATGGGCNONE 
AK061117TGGATGGGCNONE 
AK104661TGGATGGGCNONE 
Os01g0827500AK111814CCCATCCACCExo70 exocyst complex subunit family protein. 
Os01g0829100AK060644GCCCATCCAMajor sperm protein domain containing protein. 
J065045E13GCCCATCCANONE 
J100032N13GCCCATCCANONE 
Os01g0841800AK111196CCCATCCARibonuclease II and R domain containing protein. 
Os01g0850400AJ575220TGGATGGGCTGANONE 
AK108582TGGATGGGCTGASimilar to MYBY1 protein (Fragment). 
Os01g0852900J033066K09GCCCATCCACCNONE 
Os01g0856500AK103981TGGATGGGCTACTGGGCCCGNONE 
Os01g0873200AK109463TGGATGGGSimilar to Amidophosphoribosyltransferase, chloroplast precursor (EC 2.4.2.14) (Glutamine phosphoribosylpyrophosphate amidotransferase) (ATASE) (GPAT) (Fragment). 
Os01g0897800AF140489CATCCCCCATCCAACGGCNONE 
AK072409CATCCCCCATCCAACGGCNONE 
AK072812CATCCCCCATCCAACGGCRad21/Rec8 like protein, N-terminal domain containing protein. 
AK099099CATCCCCCATCCAACGGCNONE 
AY288943CATCCCCCATCCAACGGCNONE 
AY318757CATCCCCCATCCAACGGCNONE 
J013021C23CATCCCCCATCCAACGGCNONE 
J013027H03CATCCCCCATCCAACGGCNONE 
J013032C02CATCCCCCATCCAACGGCNONE 
J013068G13CATCCCCCATCCAACGGCNONE 
J013070K16CATCCCCCATCCAACGGCNONE 
J013070L02CATCCCCCATCCAACGGCNONE 
J013091E15CATCCCCCATCCAACGGCNONE 
J013109D04CATCCCCCATCCAACGGCNONE 
J013118B04CATCCCCCATCCAACGGCNONE 
J013129E08CATCCCCCATCCAACGGCNONE 
J013134I15CATCCCCCATCCAACGGCNONE 
J013146N16CATCCCCCATCCAACGGCNONE 
J023083F05CATCCCCCATCCAACGGCNONE 
J023107E17CATCCCCCATCCAACGGCNONE 
J023113D21CATCCCCCATCCAACGGCNONE 
J023123A22CATCCCCCATCCAACGGCNONE 
J023133I24CATCCCCCATCCAACGGCNONE 
J023134L21CATCCCCCATCCAACGGCNONE 
J023142N24CATCCCCCATCCAACGGCNONE 
J033051B12CATCCCCCATCCAACGGCNONE 
J033058B04CATCCCCCATCCAACGGCNONE 
J033068E24CATCCCCCATCCAACGGCNONE 
J033076D01CATCCCCCATCCAACGGCNONE 
J033088O06CATCCCCCATCCAACGGCNONE 
J033093K15CATCCCCCATCCAACGGCNONE 
J033101G18CATCCCCCATCCAACGGCNONE 
J033130A01CATCCCCCATCCAACGGCNONE 
J043027I17CATCCCCCATCCAACGGCNONE 
J043027L17CATCCCCCATCCAACGGCNONE 
J090001N13CATCCCCCATCCAACGGCNONE 
J090004L10CATCCCCCATCCAACGGCNONE 
J090027D08CATCCCCCATCCAACGGCNONE 
J090027H18CATCCCCCATCCAACGGCNONE 
J090031F16CATCCCCCATCCAACGGCNONE 
J090048L18CATCCCCCATCCAACGGCNONE 
J090050N08CATCCCCCATCCAACGGCNONE 
J090051G05CATCCCCCATCCAACGGCNONE 
J090063G03CATCCCCCATCCAACGGCNONE 
J090068P21CATCCCCCATCCAACGGCNONE 
J090072P21CATCCCCCATCCAACGGCNONE 
J090079A14CATCCCCCATCCAACGGCNONE 
J090086I20CATCCCCCATCCAACGGCNONE 
J090087D19CATCCCCCATCCAACGGCNONE 
J090099B06CATCCCCCATCCAACGGCNONE 
J100047J19CATCCCCCATCCAACGGCNONE 
J100058I06CATCCCCCATCCAACGGCNONE 
Os01g0945300003-104-D07CCCATCCANONE 
AK065371CCCATCCAAmino acid/polyamine transporter I family protein. 
AK072189CCCATCCANONE 
J013023D09CCCATCCANONE 
J013055J18CCCATCCANONE 
J013146P21CCCATCCANONE 
J075109G14CCCATCCANONE 
J075158O19CCCATCCANONE 
Os01g0952000004-004-H08CCCATCCANONE 
006-039-E03CCCATCCANONE 
006-053-G01CCCATCCANONE 
006-081-D03CCCATCCANONE 
AF072695CCCATCCANONE 
AK060864CCCATCCAGermin family protein. 
AK099691CCCATCCANONE 
J013073E02CCCATCCANONE 
J075048H05CCCATCCANONE 
J075139F11CCCATCCANONE 
J075145H16CCCATCCANONE 
J075163H02CCCATCCANONE 
J075173F16CCCATCCANONE 
J075176H09CCCATCCANONE 
J075189N15CCCATCCANONE 
Os01g0958200AK107370GCCCATCCAQuinonprotein alcohol dehydrogenase-like domain containing protein. 
J075001H07GCCCATCCANONE 
Os01g0974200003-131-G05CCCATCCANONE 
009-056-A07CCCATCCANONE 
009-084-A06CCCATCCANONE 
009-118-C05CCCATCCANONE 
009-138-C12CCCATCCANONE 
009-163-F05CCCATCCANONE 
009-175-F12CCCATCCANONE 
009-192-F01CCCATCCANONE 
AB002820CCCATCCANONE 
AF017365CCCATCCANONE 
AK059392CCCATCCANONE 
AK062796CCCATCCARicMT (Metallothionein-like protein). 
AK104075CCCATCCANONE 
J023079A11CCCATCCANONE 
J023084P04CCCATCCANONE 
J065060A20CCCATCCANONE 
J065065L16CCCATCCANONE 
J065086F04CCCATCCANONE 
J065103H07CCCATCCANONE 
J065104O09CCCATCCANONE 
J065108C08CCCATCCANONE 
J065121B18CCCATCCANONE 
J065213D20CCCATCCANONE 
J075005A13CCCATCCANONE 
J075012P06CCCATCCANONE 
J075097C23CCCATCCANONE 
J075105E16CCCATCCANONE 
J075114O15CCCATCCANONE 
J075120G07CCCATCCANONE 
J075177K02CCCATCCANONE 
J080002D04CCCATCCANONE 
J080013A10CCCATCCANONE 
J080023H15CCCATCCANONE 
J080025I06CCCATCCANONE 
J080028G07CCCATCCANONE 
J080028P13CCCATCCANONE 
J080029E04CCCATCCANONE 
J080030B21CCCATCCANONE 
J080034N04CCCATCCANONE 
J080036A19CCCATCCANONE 
J080036F12CCCATCCANONE 
J080036P20CCCATCCANONE 
J080042M13CCCATCCANONE 
J080043N01CCCATCCANONE 
J080049M13CCCATCCANONE 
J080059A01CCCATCCANONE 
J080059I24CCCATCCANONE 
J080059J18CCCATCCANONE 
J080066D21CCCATCCANONE 
J080077B12CCCATCCANONE 
J080079I11CCCATCCANONE 
J080083M24CCCATCCANONE 
J080083P12CCCATCCANONE 
J080087D01CCCATCCANONE 
J080092I01CCCATCCANONE 
J080310J19CCCATCCANONE 
J080315B15CCCATCCANONE 
J090075D21CCCATCCANONE 
J100027F23CCCATCCANONE 
J100031B07CCCATCCANONE 
J100034A13CCCATCCANONE 
J100041O19CCCATCCANONE 
J100045A01CCCATCCANONE 
J100065I02CCCATCCANONE 
J100069G24CCCATCCANONE 
J100072E11CCCATCCANONE 
J100082O08CCCATCCANONE 
Os02g0103700009-031-C12ATTGGGCCCATCCANONE 
AK062502ATTGGGCCCATCCANONE 
AK102186ATTGGGCCCATCCASimilar to 60S ribosomal protein L9 (Gibberellin-regulated protein GA). 
J033086N17ATTGGGCCCATCCANONE 
J065161I07ATTGGGCCCATCCANONE 
J065184G15ATTGGGCCCATCCANONE 
J075123E02ATTGGGCCCATCCANONE 
Os02g0121200AK070123TGGATGGGCCGTGNONE 
AK121751TGGATGGGCCGTGProtein of unknown function DUF890 family protein. 
Os02g0122800AK062255CCCATCCANONE 
AK121372CCCATCCANucleotide-binding, alpha-beta plait domain containing protein. 
J013056N24CCCATCCANONE 
J023037M12CCCATCCANONE 
J023099B21CCCATCCANONE 
J023126J16CCCATCCANONE 
J033031J05CCCATCCANONE 
J033048L07CCCATCCANONE 
J033052J23CCCATCCANONE 
J033076F24CCCATCCANONE 
J033085F01CCCATCCANONE 
J033101I11CCCATCCANONE 
J033128E01CCCATCCANONE 
J100070N12CCCATCCANONE 
Os02g0127900AK102783AGCCCATCCAHypothetical protein. 
J065042F15AGCCCATCCANONE 
J075005J10AGCCCATCCANONE 
J075038F02AGCCCATCCANONE 
J075048K10AGCCCATCCANONE 
J075064D21AGCCCATCCANONE 
J075074M07AGCCCATCCANONE 
J075078D20AGCCCATCCANONE 
J075109P15AGCCCATCCANONE 
J075115K24AGCCCATCCANONE 
J075135G01AGCCCATCCANONE 
J075156B07AGCCCATCCANONE 
Os02g0167700AK069128CCCATCCAArmadillo-like helical domain containing protein. 
Os02g0226900AK064279TGGATGGGProtein prenyltransferase domain containing protein. 
Os02g0229200Os02g0229200TGGATGGGNONE 
Os02g0235600009-009-H04AATTGGGCCCATCCANONE 
009-165-G06AATTGGGCCCATCCANONE 
AK120417AATTGGGCCCATCCASimilar to 60S ribosomal protein L11-2 (L16). Splice isoform 2. 
J013093C14AATTGGGCCCATCCANONE 
J023106P11AATTGGGCCCATCCANONE 
J033080L09AATTGGGCCCATCCANONE 
J033123O05AATTGGGCCCATCCANONE 
J065197A18AATTGGGCCCATCCANONE 
J065216P16AATTGGGCCCATCCANONE 
J075017F02AATTGGGCCCATCCANONE 
J075025L16AATTGGGCCCATCCANONE 
J075027P04AATTGGGCCCATCCANONE 
J075039N01AATTGGGCCCATCCANONE 
J075101F24AATTGGGCCCATCCANONE 
J075132J15AATTGGGCCCATCCANONE 
J075164K16AATTGGGCCCATCCANONE 
J075174E19AATTGGGCCCATCCANONE 
J100043C23AATTGGGCCCATCCANONE 
J100067B11AATTGGGCCCATCCANONE 
Os02g0255100AK060458CCCATCCANONE 
AK060458CCCATCCANONE 
Os02g0272600AK060159CCCATCCAAph-1 family protein. 
AK104758CCCATCCANONE 
Os02g0290400AK101872CCCATCCASuppressor Mra1 family protein. 
J033070F10CCCATCCANONE 
Os02g0308400006-022-B03CCCATCCACCNONE 
006-023-H07CCCATCCACCNONE 
006-026-F01CCCATCCACCNONE 
006-026-G09CCCATCCACCNONE 
006-031-A06CCCATCCACCNONE 
006-033-B03CCCATCCACCNONE 
006-035-F03CCCATCCACCNONE 
006-046-D08CCCATCCACCNONE 
006-048-E07CCCATCCACCNONE 
006-048-F12CCCATCCACCNONE 
006-049-F11CCCATCCACCNONE 
006-051-A12CCCATCCACCNONE 
006-055-H04CCCATCCACCNONE 
006-061-B09CCCATCCACCNONE 
006-066-E12CCCATCCACCNONE 
006-068-D11CCCATCCACCNONE 
006-072-H02CCCATCCACCNONE 
006-079-D02CCCATCCACCNONE 
006-083-B08CCCATCCACCNONE 
006-083-F10CCCATCCACCNONE 
006-093-D11CCCATCCACCNONE 
006-097-C09CCCATCCACCNONE 
006-100-C09CCCATCCACCNONE 
006-107-A04CCCATCCACCNONE 
006-110-D02CCCATCCACCNONE 
006-116-E06CCCATCCACCNONE 
006-117-H10CCCATCCACCNONE 
006-120-H10CCCATCCACCNONE 
009-033-D01CCCATCCACCNONE 
009-106-A02CCCATCCACCNONE 
009-111-B04CCCATCCACCNONE 
009-129-G10CCCATCCACCNONE 
013-036-E08CCCATCCACCNONE 
013-039-G02CCCATCCACCNONE 
014-023-A11CCCATCCACCNONE 
014-100-A04CCCATCCACCNONE 
AK061195CCCATCCACCNONE 
AK061421CCCATCCACCNONE 
AK104181CCCATCCACCNONE 
AK104630CCCATCCACCNONE 
AK104655CCCATCCACCBeta-Ig-H3/fasciclin domain containing protein. 
Os02g0465400AK100199CCCATCCASimilar to 7-dehydrocholesterol reductase (EC 1.3.1.21) (7-DHC reductase) (Sterol delta-7-reductase) (Dwarf5 protein). 
J090036B02CCCATCCANONE 
Os02g0468400AK120593GCCCATCCALipid-binding START domain containing protein. 
Os02g0471100AK121179TGGATGGGConserved hypothetical protein. 
J023083J24TGGATGGGNONE 
Os02g0519900006-057-B12TGGATGGGNONE 
006-113-G04TGGATGGGNONE 
006-119-D01TGGATGGGNONE 
AK060953TGGATGGGNONE 
AK068869TGGATGGGNONE 
AK099493TGGATGGGNONE 
J013027E04TGGATGGGNONE 
J023002E06TGGATGGGNONE 
J023106L15TGGATGGGNONE 
J080303F06TGGATGGGNONE 
J090065E08TGGATGGGNONE 
Os02g0582600006-041-F11TGGATGGGCCTTNONE 
AK059791TGGATGGGCCTTNONE 
AK102380TGGATGGGCCTTHeavy metal transport/detoxification protein domain containing protein. 
J033092A09TGGATGGGCCTTNONE 
Os02g0605600016-017-B02AGCCCATCCAGCCCATCTGGACCNONE 
AK066104AGCCCATCCAGCCCATCTGGACCLUC7 related family protein. 
J013052G16AGCCCATCCAGCCCATCTGGACCNONE 
J043022E03AGCCCATCCAGCCCATCTGGACCNONE 
J065105P10AGCCCATCCAGCCCATCTGGACCNONE 
Os02g0640800AK061368TGGATGGGNONE 
Os02g0665400AK073914TGGATGGGCCGANONE 
AK109787TGGATGGGCCGANONE 
AK120141TGGATGGGCCGASimilar to Interleukin-1 receptor-associated kinase 1 (EC 2.7.1.37) (IRAK-1). Splice isoform 2. 
J065021I19TGGATGGGCCGANONE 
J075165B08TGGATGGGCCGANONE 
J075177B03TGGATGGGCCGANONE 
J075191K02TGGATGGGCCGANONE 
J090051I12TGGATGGGCCGANONE 
J090057E21TGGATGGGCCGANONE 
J090058E01TGGATGGGCCGANONE 
J090087C06TGGATGGGCCGANONE 
J100025K07TGGATGGGCCGANONE 
J100026I21TGGATGGGCCGANONE 
J100041E12TGGATGGGCCGANONE 
J100083B01TGGATGGGCCGANONE 
Os02g0733900AK111335CCCATCCAConserved hypothetical protein. 
J065092J17CCCATCCANONE 
J065140P16CCCATCCANONE 
J065191N21CCCATCCANONE 
Os02g0757700AK069370TGGATGGGNONE 
J023012P08TGGATGGGNONE 
Os02g0767900009-154-G01TGGATGGGGGAGNONE 
009-172-H09TGGATGGGGGAGNONE 
AK099885TGGATGGGGGAGGlutaredoxin 2 family protein. 
Os02g0776800AB042415CCAGCCCATCCANONE 
AK072308CCAGCCCATCCAReplication protein A 70kDa. 
AK101212CCAGCCCATCCANONE 
J033031B02CCAGCCCATCCANONE 
J090004E18CCAGCCCATCCANONE 
J090084C24CCAGCCCATCCANONE 
Os02g0785800005-017-E01TGGATGGGCTTTNONE 
009-104-F05TGGATGGGCTTTNONE 
009-149-A09TGGATGGGCTTTNONE 
009-192-D08TGGATGGGCTTTNONE 
AK063859TGGATGGGCTTTNONE 
AK121768TGGATGGGCTTTSimilar to Ribosomal protein L35A. 
J013037M21TGGATGGGCTTTNONE 
J023009A11TGGATGGGCTTTNONE 
J023010P14TGGATGGGCTTTNONE 
J033092B03TGGATGGGCTTTNONE 
J065009O06TGGATGGGCTTTNONE 
J065024K14TGGATGGGCTTTNONE 
J065053F16TGGATGGGCTTTNONE 
J065056D18TGGATGGGCTTTNONE 
J065056N12TGGATGGGCTTTNONE 
J065071L21TGGATGGGCTTTNONE 
J065075M21TGGATGGGCTTTNONE 
J065087D19TGGATGGGCTTTNONE 
J065111N01TGGATGGGCTTTNONE 
J065172M05TGGATGGGCTTTNONE 
J065176E03TGGATGGGCTTTNONE 
J065184D08TGGATGGGCTTTNONE 
J065188K21TGGATGGGCTTTNONE 
J065194I05TGGATGGGCTTTNONE 
J065196E09TGGATGGGCTTTNONE 
J065196O21TGGATGGGCTTTNONE 
J065204O06TGGATGGGCTTTNONE 
J065212J02TGGATGGGCTTTNONE 
J075066H03TGGATGGGCTTTNONE 
J075067C04TGGATGGGCTTTNONE 
J075070I09TGGATGGGCTTTNONE 
J075081J03TGGATGGGCTTTNONE 
J075086I05TGGATGGGCTTTNONE 
J075092E09TGGATGGGCTTTNONE 
J075096D13TGGATGGGCTTTNONE 
J075098A12TGGATGGGCTTTNONE 
J075110B18TGGATGGGCTTTNONE 
J075116E14TGGATGGGCTTTNONE 
J075117J23TGGATGGGCTTTNONE 
J075117O16TGGATGGGCTTTNONE 
J075130H10TGGATGGGCTTTNONE 
J075151B07TGGATGGGCTTTNONE 
J075156C02TGGATGGGCTTTNONE 
J075159C07TGGATGGGCTTTNONE 
J075172O12TGGATGGGCTTTNONE 
J075181K16TGGATGGGCTTTNONE 
J075185J05TGGATGGGCTTTNONE 
J075186D14TGGATGGGCTTTNONE 
J075187F23TGGATGGGCTTTNONE 
J075193B15TGGATGGGCTTTNONE 
J075194P20TGGATGGGCTTTNONE 
J090002B21TGGATGGGCTTTNONE 
J090018E03TGGATGGGCTTTNONE 
J090029I04TGGATGGGCTTTNONE 
J090065F12TGGATGGGCTTTNONE 
J090066M05TGGATGGGCTTTNONE 
J090078A20TGGATGGGCTTTNONE 
J090084O15TGGATGGGCTTTNONE 
J090088P20TGGATGGGCTTTNONE 
J090098L20TGGATGGGCTTTNONE 
J100025B19TGGATGGGCTTTNONE 
J100038H15TGGATGGGCTTTNONE 
J100045H17TGGATGGGCTTTNONE 
J100058E17TGGATGGGCTTTNONE 
J100060O16TGGATGGGCTTTNONE 
J100067I10TGGATGGGCTTTNONE 
J100082N24TGGATGGGCTTTNONE 
J100083C17TGGATGGGCTTTNONE 
J100085I24TGGATGGGCTTTNONE 
J100087K20TGGATGGGCTTTNONE 
Os02g0813600AK107210GCCCATCCAVery-long-chain 3-ketoacyl-CoA synthase family protein. 
Os02g0819700AK067374TGGATGGGCTGTATTGGGCCTCZinc finger, Zim17-type family protein. 
AK099160TGGATGGGCTGTATTGGGCCTCNONE 
J100086K17TGGATGGGCTGTATTGGGCCTCNONE 
Os02g0828800AK062497CCCATCCAConserved hypothetical protein. 
Os02g0831800009-150-D09TGGATGGGNONE 
AK060519TGGATGGGSimilar to 3-hydroxy-3-methylglutaryl-coenzyme A reductase 2. 
J075143E03TGGATGGGNONE 
J100077H12TGGATGGGNONE 
Os03g0111600AK101020GGTGGATGGGProtein of unknown function DUF1618 domain containing protein. 
J023149K08GGTGGATGGGNONE 
J033042K17GGTGGATGGGNONE 
J033073E05GGTGGATGGGNONE 
J043032K02GGTGGATGGGNONE 
J090009D04GGTGGATGGGNONE 
J090037M16GGTGGATGGGNONE 
Os03g0122300AK068438TGGATGGGSimilar to Flavanone 3-hydroxylase-like protein. 
AK071416TGGATGGGNONE 
AK104414TGGATGGGNONE 
J023078E24TGGATGGGNONE 
J023141J19TGGATGGGNONE 
J033050K09TGGATGGGNONE 
Os03g0124850Os03g0124850CCCATCCAACGNONE 
Os03g0131200AB020502CCCATCCACCNONE 
AK062174CCCATCCACCNONE 
AK066378CCCATCCACCSimilar to Catalase isozyme 2 (EC 1.11.1.6). 
AY339372CCCATCCACCNONE 
J013060B21CCCATCCACCNONE 
J013149P20CCCATCCACCNONE 
J023060E16CCCATCCACCNONE 
J043004A19CCCATCCACCNONE 
J053029N09CCCATCCACCNONE 
J053072I10CCCATCCACCNONE 
J065016G02CCCATCCACCNONE 
J065022E22CCCATCCACCNONE 
J065024K17CCCATCCACCNONE 
J065035E10CCCATCCACCNONE 
J065036D13CCCATCCACCNONE 
J065041E06CCCATCCACCNONE 
J065064H14CCCATCCACCNONE 
J065067I06CCCATCCACCNONE 
J065080C01CCCATCCACCNONE 
J065086K23CCCATCCACCNONE 
J065087L12CCCATCCACCNONE 
J065090I05CCCATCCACCNONE 
J065117E23CCCATCCACCNONE 
J065120A10CCCATCCACCNONE 
J065120L22CCCATCCACCNONE 
J065123F02CCCATCCACCNONE 
J065128G02CCCATCCACCNONE 
J065142B04CCCATCCACCNONE 
J065143K12CCCATCCACCNONE 
J065148B18CCCATCCACCNONE 
J065153C16CCCATCCACCNONE 
J065163J11CCCATCCACCNONE 
J065168L24CCCATCCACCNONE 
J065181J11CCCATCCACCNONE 
J065190F19CCCATCCACCNONE 
J065209E24CCCATCCACCNONE 
J065210G04CCCATCCACCNONE 
J065217H17CCCATCCACCNONE 
J065219I20CCCATCCACCNONE 
J075001M13CCCATCCACCNONE 
J075007B08CCCATCCACCNONE 
J075009I01CCCATCCACCNONE 
J075014C11CCCATCCACCNONE 
J075014L02CCCATCCACCNONE 
J075016E07CCCATCCACCNONE 
J075017J02CCCATCCACCNONE 
J075018F07CCCATCCACCNONE 
J075018N07CCCATCCACCNONE 
J075019B06CCCATCCACCNONE 
J075024F21CCCATCCACCNONE 
J075026B18CCCATCCACCNONE 
J075026M12CCCATCCACCNONE 
J075032B13CCCATCCACCNONE 
J075033O09CCCATCCACCNONE 
J075041A09CCCATCCACCNONE 
J075045L13CCCATCCACCNONE 
J075048N11CCCATCCACCNONE 
J075052A14CCCATCCACCNONE 
J075061B17CCCATCCACCNONE 
J075061I05CCCATCCACCNONE 
J075066I11CCCATCCACCNONE 
J075066P09CCCATCCACCNONE 
J075068F03CCCATCCACCNONE 
J075068P22CCCATCCACCNONE 
J075080I15CCCATCCACCNONE 
J075081I07CCCATCCACCNONE 
J075082K01CCCATCCACCNONE 
J075083A18CCCATCCACCNONE 
J075086O11CCCATCCACCNONE 
J075087E02CCCATCCACCNONE 
J075087M19CCCATCCACCNONE 
J075088G23CCCATCCACCNONE 
J075092K18CCCATCCACCNONE 
J075095H15CCCATCCACCNONE 
J075095K12CCCATCCACCNONE 
J075096L06CCCATCCACCNONE 
J075100H23CCCATCCACCNONE 
J075100K01CCCATCCACCNONE 
J075102K21CCCATCCACCNONE 
J075104F24CCCATCCACCNONE 
J075106C17CCCATCCACCNONE 
J075106E06CCCATCCACCNONE 
J075106M19CCCATCCACCNONE 
J075106O12CCCATCCACCNONE 
J075108I09CCCATCCACCNONE 
J075111M06CCCATCCACCNONE 
J075112E12CCCATCCACCNONE 
J075114C04CCCATCCACCNONE 
J075120A06CCCATCCACCNONE 
J075120D14CCCATCCACCNONE 
J075122P15CCCATCCACCNONE 
J075123A11CCCATCCACCNONE 
J075123L12CCCATCCACCNONE 
J075127G14CCCATCCACCNONE 
J075127H09CCCATCCACCNONE 
J075128M04CCCATCCACCNONE 
J075129J04CCCATCCACCNONE 
J075130J01CCCATCCACCNONE 
J075137N02CCCATCCACCNONE 
J075137O14CCCATCCACCNONE 
J075138H22CCCATCCACCNONE 
J075139P16CCCATCCACCNONE 
J075141G08CCCATCCACCNONE 
J075142C17CCCATCCACCNONE 
J075143B09CCCATCCACCNONE 
J075156I11CCCATCCACCNONE 
J075158M03CCCATCCACCNONE 
J075166I21CCCATCCACCNONE 
J075167C08CCCATCCACCNONE 
J075170C12CCCATCCACCNONE 
J075170F08CCCATCCACCNONE 
J075170G04CCCATCCACCNONE 
J075172N16CCCATCCACCNONE 
J075172P13CCCATCCACCNONE 
J075173G24CCCATCCACCNONE 
J075175D01CCCATCCACCNONE 
J075175K01CCCATCCACCNONE 
J075181O04CCCATCCACCNONE 
J075186A04CCCATCCACCNONE 
J075190B08CCCATCCACCNONE 
J075190M24CCCATCCACCNONE 
J075193D18CCCATCCACCNONE 
J075193H03CCCATCCACCNONE 
J075195N18CCCATCCACCNONE 
J080001N20CCCATCCACCNONE 
J080006K17CCCATCCACCNONE 
J080012I16CCCATCCACCNONE 
J080013K20CCCATCCACCNONE 
J080018N01CCCATCCACCNONE 
J080041G15CCCATCCACCNONE 
J080048L15CCCATCCACCNONE 
J080049A21CCCATCCACCNONE 
J080075G12CCCATCCACCNONE 
J080076O09CCCATCCACCNONE 
J080078P10CCCATCCACCNONE 
J080084D10CCCATCCACCNONE 
J090005N07CCCATCCACCNONE 
Os03g0172200AK069130CCCATCCAArmadillo-like helical domain containing protein. 
Os03g0212300AK070861TGGATGGGTranscriptional factor B3 family protein. 
Os03g0218200AK073971TGGATGGGCyclin-like F-box domain containing protein. 
Os03g0225300AK067384CCCATCCAProtein prenyltransferase domain containing protein. 
J013102E15CCCATCCANONE 
J023106H20CCCATCCANONE 
Os03g0278500AK070850CCCATCCAACGGPolyadenylate binding protein, human types 1, 2, 3, 4 family protein. 
J023031B16CCCATCCAACGGNONE 
Os03g0278900006-049-H12TGGATGGGCTAATGGGCCCAACTNONE 
006-082-A07TGGATGGGCTAATGGGCCCAACTNONE 
009-169-C04TGGATGGGCTAATGGGCCCAACTNONE 
AK066019TGGATGGGCTAATGGGCCCAACTATPase, F0 complex, subunit B/B', bacterial and chloroplast family protein. 
AK105925TGGATGGGCTAATGGGCCCAACTNONE 
AY224460TGGATGGGCTAATGGGCCCAACTNONE 
J065021K17TGGATGGGCTAATGGGCCCAACTNONE 
J065141H24TGGATGGGCTAATGGGCCCAACTNONE 
J065142J20TGGATGGGCTAATGGGCCCAACTNONE 
J065152J03TGGATGGGCTAATGGGCCCAACTNONE 
J065163A13TGGATGGGCTAATGGGCCCAACTNONE 
J065191I21TGGATGGGCTAATGGGCCCAACTNONE 
J065193K12TGGATGGGCTAATGGGCCCAACTNONE 
J075003D01TGGATGGGCTAATGGGCCCAACTNONE 
J075017D24TGGATGGGCTAATGGGCCCAACTNONE 
J075060F20TGGATGGGCTAATGGGCCCAACTNONE 
J075154C11TGGATGGGCTAATGGGCCCAACTNONE 
J075173F04TGGATGGGCTAATGGGCCCAACTNONE 
Os03g0297100006-113-D12CCCATCCANONE 
AK061276CCCATCCASimilar to 40S ribosomal protein S7. 
J033119B03CCCATCCANONE 
J065205G10CCCATCCANONE 
J080069C17CCCATCCANONE 
J100069E15CCCATCCANONE 
J100081D07CCCATCCANONE 
Os03g0303100015-002-B09CCCATCCANONE 
015-005-B02CCCATCCANONE 
015-017-E10CCCATCCANONE 
AK071041CCCATCCAProtein of unknown function DUF1645 family protein. 
J065140F05CCCATCCANONE 
Os03g0304800009-082-C07TGGATGGGNONE 
AK062656TGGATGGGLg106-like family protein. 
J065137I19TGGATGGGNONE 
J075056G22TGGATGGGNONE 
J075179O16TGGATGGGNONE 
J075188O11TGGATGGGNONE 
Os03g0305500AK070638TCCGGCCCATCCAArgininosuccinate lyase domain containing protein. 
Os03g0308000016-023-H09AGCCCATCCANONE 
AK100355AGCCCATCCAUbiquitin-conjugating enzyme, E2 domain containing protein. 
J023013H05AGCCCATCCANONE 
J023043K04AGCCCATCCANONE 
J023083I20AGCCCATCCANONE 
J033068F22AGCCCATCCANONE 
J033125P21AGCCCATCCANONE 
J065207A22AGCCCATCCANONE 
J100018D20AGCCCATCCANONE 
J100026L17AGCCCATCCANONE 
J100055D14AGCCCATCCANONE 
J100060P03AGCCCATCCANONE 
J100078A20AGCCCATCCANONE 
Os03g0308900AK064183CCCATCCAConserved hypothetical protein. 
Os03g0320400AK100673CCCATCCASRA-YDG domain containing protein. 
AK100673CCCATCCASRA-YDG domain containing protein. 
Os03g0356400009-148-D02CCCATCCAGlutaredoxin domain containing protein. 
Os03g0376000AK059565TGGATGGGCCCACGAemp24/gp25L/p24 family protein. 
Os03g0415500AK108435GCGGCCCATCCAMitochondrial import inner membrane translocase, subunit Tim17/22 family protein. 
J065182P12GCGGCCCATCCANONE 
Os03g0565500AB040051GCCCATCCANONE 
AK102744GCCCATCCANONE 
AK122133GCCCATCCASimilar to Elongation factor G 1, mitochondrial precursor (mEF-G-1) (EFGM). 
D21121GCCCATCCANONE 
Os03g0568600AK102228TGGATGGGDTW domain containing protein. 
Os03g0569800AK070080CCCATCCAGCCCATTAProtein prenyltransferase domain containing protein. 
AK120873CCCATCCAGCCCATTANONE 
Os03g0577200006-030-H11CCCATCCACCNONE 
AK061735CCCATCCACCSimilar to Mps one binder kinase activator-like 1A (Mob1 homolog 1A) (Mob1A) (Mob1B) (Protein Mob4A). 
AK098953CCCATCCACCNONE 
AK099558CCCATCCACCNONE 
AK104547CCCATCCACCNONE 
J013034B14CCCATCCACCNONE 
J013066J17CCCATCCACCNONE 
J090033N14CCCATCCACCNONE 
Os03g0583800AK064786CCCATCCAMpv17/PMP22 family protein. 
AK064786GCCCACCCCATCCAMpv17/PMP22 family protein. 
AK099233CCCATCCANONE 
AK099233GCCCACCCCATCCANONE 
J013000B17CCCATCCANONE 
J013000B17GCCCACCCCATCCANONE 
J013071N13CCCATCCANONE 
J013071N13GCCCACCCCATCCANONE 
J013095M11CCCATCCANONE 
J013095M11GCCCACCCCATCCANONE 
J080068F05CCCATCCANONE 
J080068F05GCCCACCCCATCCANONE 
J080069C02CCCATCCANONE 
J080069C02GCCCACCCCATCCANONE 
J080072E22CCCATCCANONE 
J080072E22GCCCACCCCATCCANONE 
J100052H10CCCATCCANONE 
J100052H10GCCCACCCCATCCANONE 
J100053H09CCCATCCANONE 
J100053H09GCCCACCCCATCCANONE 
J100056G03CCCATCCANONE 
J100056G03GCCCACCCCATCCANONE 
Os03g0618300011-009-E08CCCATCCANONE 
AK073307CCCATCCAIsopenicillin N synthase family protein. 
Os03g0719100AK065127TAGGCCCATCCAAGCCCAACADNA-binding SAP domain containing protein. 
J013001P07TAGGCCCATCCAAGCCCAACANONE 
J065102J01TAGGCCCATCCAAGCCCAACANONE 
J065205K05TAGGCCCATCCAAGCCCAACANONE 
Os03g0722000AK069866GCAGCCCATCCANONE 
Os03g0743900AK099593CCCATCCASimilar to ATP sulfurylase. 
Os03g0769700014-079-G01CCCATCCANONE 
AK063727CCCATCCAConserved hypothetical protein. 
Os03g0791700AK103914CCCATCCANONE 
J075003P20CCCATCCANONE 
J075096M17CCCATCCANONE 
J075115D10CCCATCCANONE 
J075118I02CCCATCCANONE 
J075124K07CCCATCCANONE 
J075127J06CCCATCCANONE 
J075149A18CCCATCCANONE 
J075152H23CCCATCCANONE 
J075179C01CCCATCCANONE 
J075187K20CCCATCCANONE 
J090067P16CCCATCCANONE 
J090079I02CCCATCCANONE 
Os03g0793700AK121667CCCATCCATCTCGGCCCCupin 1 domain containing protein. 
AY098743CCCATCCATCTCGGCCCNONE 
Os03g0796800J065024O22CACGTGGGCCCCATCCAConserved hypothetical protein. 
Os03g0799000013-010-A07GACCGTTGGATGGGNONE 
013-010-A07TGGATGGGNONE 
013-081-H02GACCGTTGGATGGGNONE 
013-081-H02TGGATGGGNONE 
AK067840GACCGTTGGATGGGSimilar to Histone H1. 
AK067840TGGATGGGSimilar to Histone H1. 
AK099211GACCGTTGGATGGGNONE 
AK099211TGGATGGGNONE 
J065066F23GACCGTTGGATGGGNONE 
J065066F23TGGATGGGNONE 
J065138O20GACCGTTGGATGGGNONE 
J065138O20TGGATGGGNONE 
J065163G22GACCGTTGGATGGGNONE 
J065163G22TGGATGGGNONE 
J065211J01GACCGTTGGATGGGNONE 
J065211J01TGGATGGGNONE 
J080027D02GACCGTTGGATGGGNONE 
J080027D02TGGATGGGNONE 
J080029E20GACCGTTGGATGGGNONE 
J080029E20TGGATGGGNONE 
J080045D03GACCGTTGGATGGGNONE 
J080045D03TGGATGGGNONE 
J080060G13GACCGTTGGATGGGNONE 
J080060G13TGGATGGGNONE 
J080067E14GACCGTTGGATGGGNONE 
J080067E14TGGATGGGNONE 
J080067J04GACCGTTGGATGGGNONE 
J080067J04TGGATGGGNONE 
J080067J21GACCGTTGGATGGGNONE 
J080067J21TGGATGGGNONE 
J080068L09GACCGTTGGATGGGNONE 
J080068L09TGGATGGGNONE 
J080077E15GACCGTTGGATGGGNONE 
J080077E15TGGATGGGNONE 
J080078B03GACCGTTGGATGGGNONE 
J080078B03TGGATGGGNONE 
J080086H09GACCGTTGGATGGGNONE 
J080086H09TGGATGGGNONE 
J090095G02GACCGTTGGATGGGNONE 
J090095G02TGGATGGGNONE 
J100058H04GACCGTTGGATGGGNONE 
J100058H04TGGATGGGNONE 
Os03g0829100AK072669TCGGCCCATCCASimilar to Soluble epoxide hydrolase. 
J013073C22TCGGCCCATCCANONE 
J033067O15TCGGCCCATCCANONE 
J065021D04TCGGCCCATCCANONE 
J065102E20TCGGCCCATCCANONE 
Os03g0832600AK120137GCCCATCCASimilar to Galactokinase (EC 2.7.1.6) (Galactose kinase). 
Os03g0854500012-067-H08TGGATGGGNONE 
AK100430TGGATGGGSimilar to Heat shock transcription factor 31 (Fragment). 
AK106118TGGATGGGNONE 
AY344485TGGATGGGNONE 
J023088F14TGGATGGGNONE 
J100041G01TGGATGGGNONE 
J100046N19TGGATGGGNONE 
J100052O08TGGATGGGNONE 
Os03g0855600006-029-G09GGTGGATGGGNONE 
006-033-E02GGTGGATGGGNONE 
006-069-G07GGTGGATGGGNONE 
006-083-A02GGTGGATGGGNONE 
006-098-H04GGTGGATGGGNONE 
009-054-C04GGTGGATGGGNONE 
AK060030GGTGGATGGGNONE 
AK061467GGTGGATGGGConserved hypothetical protein. 
AK067858GGTGGATGGGNONE 
AK106030GGTGGATGGGNONE 
J013123A10GGTGGATGGGNONE 
J065001I24GGTGGATGGGNONE 
J065015N21GGTGGATGGGNONE 
J065016H07GGTGGATGGGNONE 
J065040A05GGTGGATGGGNONE 
J065040F01GGTGGATGGGNONE 
J065066G17GGTGGATGGGNONE 
J065077I09GGTGGATGGGNONE 
J065099M22GGTGGATGGGNONE 
J065135B13GGTGGATGGGNONE 
J065144H19GGTGGATGGGNONE 
J065146I03GGTGGATGGGNONE 
J065169E02GGTGGATGGGNONE 
J065177D21GGTGGATGGGNONE 
J065189L20GGTGGATGGGNONE 
J065207H13GGTGGATGGGNONE 
J065210D24GGTGGATGGGNONE 
J065212I03GGTGGATGGGNONE 
J075007E21GGTGGATGGGNONE 
J075013H07GGTGGATGGGNONE 
J075023K06GGTGGATGGGNONE 
J075031D23GGTGGATGGGNONE 
J075038K09GGTGGATGGGNONE 
J075084C08GGTGGATGGGNONE 
J075098K20GGTGGATGGGNONE 
J090028E04GGTGGATGGGNONE 
J090031E20GGTGGATGGGNONE 
J090042F06GGTGGATGGGNONE 
J090049L05GGTGGATGGGNONE 
J090086G03GGTGGATGGGNONE 
J090096J04GGTGGATGGGNONE 
J100035O03GGTGGATGGGNONE 
J100053H24GGTGGATGGGNONE 
J100056L17GGTGGATGGGNONE 
J100058K06GGTGGATGGGNONE 
J100059G09GGTGGATGGGNONE 
J100081C15GGTGGATGGGNONE 
Os03g0860050J075036N04CCCATCCAConserved hypothetical protein. 
J075094H20CCCATCCANONE 
Os04g0118400AK062196TGGATGGGNONE 
J090004F04TGGATGGGNONE 
J090036N24TGGATGGGNONE 
J090082A04TGGATGGGNONE 
Os04g0122000AK065510CCCATCCALeucine rich repeat, N-terminal domain containing protein. 
AK072577CCCATCCANONE 
AK099773CCCATCCANONE 
J013030L03CCCATCCANONE 
J013042D23CCCATCCANONE 
J013050E17CCCATCCANONE 
J013051J21CCCATCCANONE 
J013055L09CCCATCCANONE 
J013064A03CCCATCCANONE 
J013095E06CCCATCCANONE 
J013111A06CCCATCCANONE 
J013118K01CCCATCCANONE 
J013119A03CCCATCCANONE 
J013134F07CCCATCCANONE 
J033132N23CCCATCCANONE 
Os04g0271200AK060035CCCATCCATCCACCSilent information regulator protein Sir2 family protein. 
J053065P14CCCATCCATCCACCNONE 
J065030K14CCCATCCATCCACCNONE 
J090008K24CCCATCCATCCACCNONE 
J090047J16CCCATCCATCCACCNONE 
Os04g0390000AK067777CCCATCCANONE 
AK068713CCCATCCANONE 
AK098921CCCATCCASimilar to 2-oxoglutarate dehydrogenase, E1 component. 
Os04g0421700AK072998CCCATCCAFAR1 domain containing protein. 
J023143C23CCCATCCANONE 
Os04g0481100AK099817CCCATCCASimilar to Seed imbibition protein (Fragment). 
AK100197CCCATCCANONE 
AK111421CCCATCCANONE 
Os04g0500700AK072528CCCATCCASimilar to Hydroxyanthranilate hydroxycinnamoyltransferase 3. 
AK104637CCCATCCANONE 
AK119237CCCATCCANONE 
Os04g0525000AK067753TGGATGGGCCCATCGConserved hypothetical protein. 
J013118G14TGGATGGGCCCATCGNONE 
J065026J15TGGATGGGCCCATCGNONE 
J065184H21TGGATGGGCCCATCGNONE 
J065186H22TGGATGGGCCCATCGNONE 
J065193D20TGGATGGGCCCATCGNONE 
J075060D12TGGATGGGCCCATCGNONE 
J075179L24TGGATGGGCCCATCGNONE 
Os04g0555700AK069329GGTGGATGGGSimilar to Actin-depolymerizing factor (ADF). 
Os04g0563700015-005-B06CGCGTCGCCCATCCANONE 
AB024987CGCGTCGCCCATCCANONE 
AK070211CGCGTCGCCCATCCACyclin. 
Os04g0583600AK059019CCCATCCAhistone H4 [Oryza sativa (japonica cultivar-group)]. 
J023047G03CCCATCCANONE 
J075118B22CCCATCCANONE 
J090035A11CCCATCCANONE 
J090067I05CCCATCCANONE 
J100017K09CCCATCCANONE 
Os04g0611300009-006-G08TTGGCCCATCCANONE 
009-011-C01TTGGCCCATCCANONE 
009-036-B09TTGGCCCATCCANONE 
009-116-G09TTGGCCCATCCANONE 
009-126-E09TTGGCCCATCCANONE 
009-132-F09TTGGCCCATCCANONE 
009-151-G07TTGGCCCATCCANONE 
009-155-C07TTGGCCCATCCANONE 
009-163-G01TTGGCCCATCCANONE 
009-169-G08TTGGCCCATCCANONE 
009-191-B02TTGGCCCATCCANONE 
009-196-A08TTGGCCCATCCANONE 
009-198-E07TTGGCCCATCCANONE 
014-015-F04TTGGCCCATCCANONE 
015-087-H04TTGGCCCATCCANONE 
AK062605TTGGCCCATCCANONE 
AK063022TTGGCCCATCCAConserved hypothetical protein. 
AK066749TTGGCCCATCCANONE 
AK104924TTGGCCCATCCANONE 
J065002M20TTGGCCCATCCANONE 
J065045L23TTGGCCCATCCANONE 
J065101E05TTGGCCCATCCANONE 
J065140J23TTGGCCCATCCANONE 
J065179G11TTGGCCCATCCANONE 
J065191B18TTGGCCCATCCANONE 
J065192E03TTGGCCCATCCANONE 
J065199H21TTGGCCCATCCANONE 
J075067F01TTGGCCCATCCANONE 
J075089L01TTGGCCCATCCANONE 
J075147K22TTGGCCCATCCANONE 
J080069G23TTGGCCCATCCANONE 
J100053D10TTGGCCCATCCANONE 
J100078C10TTGGCCCATCCANONE 
Os04g0612800016-010-G05TGGATGGGCCGAGCACGGCCCAAANONE 
AK071230TGGATGGGCCGAGCACGGCCCAAAProtein prenyltransferase domain containing protein. 
Os04g0625000J065157C10CCCATCCANONE 
Os04g0636100003-115-H08GTCAGTGGATGGGNONE 
AK067760GTCAGTGGATGGGGlycosyl transferase, family 8 protein. 
J013119I03GTCAGTGGATGGGNONE 
J075092K10GTCAGTGGATGGGNONE 
Os04g0652400AK072809CCCATCCASimilar to Sulphate transporter protein. 
AK104831CCCATCCANONE 
AK107225CCCATCCANONE 
Os04g0671300AK072414GACAGGTGCCCATCCASimilar to Suppressor of presenilin 5 (P110b homolog). 
Os05g0121500006-117-B10TCAGGCCCATCCANONE 
009-059-D04TCAGGCCCATCCANONE 
J065066C12TCAGGCCCATCCAConserved hypothetical protein. 
J075013I12TCAGGCCCATCCANONE 
J090046D18TCAGGCCCATCCANONE 
Os05g0127200AK064924CCCATCCANONE 
AK119748CCCATCCASimilar to Phospholipase C (Fragment). 
Os05g0139100Os05g0139100GCCCATCCABasic helix-loop-helix dimerisation region bHLH domain containing protein. 
Os05g0149900AK072901CCCATCCANONE 
AK101105CCCATCCANONE 
AK105677CCCATCCANONE 
J023145E04CCCATCCANONE 
Os05g0210100AK122049AGCCCATAGCCCATCCALipolytic enzyme, G-D-S-L family protein. 
Os05g0220900AK109172TGGATGGGNONE 
AK109456TGGATGGGPrefoldin domain containing protein. 
Os05g0227100009-045-C06TGGATGGGCNONE 
009-109-A08TGGATGGGCNONE 
J075072D22TGGATGGGCHypothetical protein. 
Os05g0227300Os05g0227300TGGATGGGCNONE 
Os05g0227700AK067567AATTGGGCCGGCCCATTAGGTGGATGGGCCCACTConserved hypothetical protein. 
AK068760AATTGGGCCGGCCCATTAGGTGGATGGGCCCACTNONE 
J013108C14AATTGGGCCGGCCCATTAGGTGGATGGGCCCACTNONE 
Os05g0227800AK110997AGTGGGCCCATCCACCTAATGGGCCGGCCCAATTHomeodomain-like containing protein. 
Os05g0316200AK060608CCAGCCCATCCANONE 
AK101705CCAGCCCATCCAConserved hypothetical protein. 
AK111481CCAGCCCATCCANONE 
Os05g0344200006-022-E04CATCCCCCCATCCACCNONE 
006-080-D01CATCCCCCCATCCACCNONE 
009-021-D03CATCCCCCCATCCACCNONE 
009-026-A10CATCCCCCCATCCACCNONE 
009-054-B12CATCCCCCCATCCACCNONE 
009-059-H03CATCCCCCCATCCACCNONE 
009-077-C02CATCCCCCCATCCACCNONE 
009-095-H12CATCCCCCCATCCACCNONE 
009-106-B08CATCCCCCCATCCACCNONE 
009-138-D10CATCCCCCCATCCACCNONE 
009-140-G06CATCCCCCCATCCACCNONE 
009-146-E09CATCCCCCCATCCACCNONE 
009-161-F04CATCCCCCCATCCACCNONE 
009-176-F05CATCCCCCCATCCACCNONE 
013-047-C03CATCCCCCCATCCACCNONE 
013-052-E07CATCCCCCCATCCACCNONE 
013-054-G04CATCCCCCCATCCACCNONE 
013-095-D10CATCCCCCCATCCACCNONE 
014-003-D06CATCCCCCCATCCACCNONE 
014-020-C09CATCCCCCCATCCACCNONE 
014-043-E01CATCCCCCCATCCACCNONE 
014-080-G09CATCCCCCCATCCACCNONE 
014-081-H05CATCCCCCCATCCACCNONE 
AK060058CATCCCCCCATCCACCConserved hypothetical protein. 
AK098850CATCCCCCCATCCACCNONE 
AK104716CATCCCCCCATCCACCNONE 
AK119727CATCCCCCCATCCACCNONE 
J013000G04CATCCCCCCATCCACCNONE 
J013155L11CATCCCCCCATCCACCNONE 
J033138J22CATCCCCCCATCCACCNONE 
J065112E22CATCCCCCCATCCACCNONE 
J065124M06CATCCCCCCATCCACCNONE 
J065130M01CATCCCCCCATCCACCNONE 
J065137I03CATCCCCCCATCCACCNONE 
J065157O12CATCCCCCCATCCACCNONE 
J065171B12CATCCCCCCATCCACCNONE 
J075003O16CATCCCCCCATCCACCNONE 
J075026G12CATCCCCCCATCCACCNONE 
J075032K07CATCCCCCCATCCACCNONE 
J075070I11CATCCCCCCATCCACCNONE 
J075093K06CATCCCCCCATCCACCNONE 
J075148C12CATCCCCCCATCCACCNONE 
J075148L08CATCCCCCCATCCACCNONE 
J075152G13CATCCCCCCATCCACCNONE 
J075177G07CATCCCCCCATCCACCNONE 
J100026I09CATCCCCCCATCCACCNONE 
J100083L11CATCCCCCCATCCACCNONE 
J100086F04CATCCCCCCATCCACCNONE 
Os05g0345100J080009K03TGGATGGGNONE 
J080010M09TGGATGGGNONE 
J080026I12TGGATGGGNONE 
J080027B20TGGATGGGNONE 
J080028M09TGGATGGGNONE 
J080035J19TGGATGGGNONE 
J080039I02TGGATGGGNONE 
J080040I10TGGATGGGNONE 
J080041L14TGGATGGGNONE 
J080046P10TGGATGGGNONE 
J080050C20TGGATGGGNONE 
J080057M06TGGATGGGNONE 
J080070G20TGGATGGGNONE 
J080070M23TGGATGGGNONE 
J080083K11TGGATGGGNONE 
J080092M23TGGATGGGNONE 
Os05g0381400014-036-H12CCCATCCACCCACACGTGTCNONE 
014-085-H12CCCATCCACCCACACGTGTCNONE 
AK102039CCCATCCACCCACACGTGTCSimilar to ABA induced plasma membrane protein PM 19. 
J075011E17CCCATCCACCCACACGTGTCNONE 
J075057P04CCCATCCACCCACACGTGTCNONE 
J075066K19CCCATCCACCCACACGTGTCNONE 
J075068L13CCCATCCACCCACACGTGTCNONE 
J075074J21CCCATCCACCCACACGTGTCNONE 
J075076N10CCCATCCACCCACACGTGTCNONE 
J075078L14CCCATCCACCCACACGTGTCNONE 
J075099O16CCCATCCACCCACACGTGTCNONE 
J075120C05CCCATCCACCCACACGTGTCNONE 
J075140I24CCCATCCACCCACACGTGTCNONE 
J075148F21CCCATCCACCCACACGTGTCNONE 
J075151F01CCCATCCACCCACACGTGTCNONE 
J075151I10CCCATCCACCCACACGTGTCNONE 
J075156M15CCCATCCACCCACACGTGTCNONE 
J075191F07CCCATCCACCCACACGTGTCNONE 
J075192K20CCCATCCACCCACACGTGTCNONE 
J075195M22CCCATCCACCCACACGTGTCNONE 
Os05g0397300009-051-E02TGGATGGGNONE 
009-060-E03TGGATGGGNONE 
009-075-B01TGGATGGGNONE 
009-082-B11TGGATGGGNONE 
009-136-D05TGGATGGGNONE 
AK062621TGGATGGGNONE 
AK066003TGGATGGGNONE 
AK070832TGGATGGGConserved hypothetical protein. 
J023066C05TGGATGGGNONE 
Os05g0401100009-037-F05CCCATCCACCNONE 
009-147-G03CCCATCCACCNONE 
AK058790CCCATCCACCNONE 
AK067179CCCATCCACCProtein of unknown function DUF477 family protein. 
Os05g0413200006-067-C03CCCATCCAACGGCCNONE 
006-080-C03CCCATCCAACGGCCNONE 
006-095-G10CCCATCCAACGGCCNONE 
006-115-G11CCCATCCAACGGCCNONE 
013-040-E05CCCATCCAACGGCCNONE 
AB104732CCCATCCAACGGCCNONE 
AK122099CCCATCCAACGGCCBeta-tubulin. 
J033087H20CCCATCCAACGGCCNONE 
J033117C18CCCATCCAACGGCCNONE 
J033125G10CCCATCCAACGGCCNONE 
Os05g0429700AK069203CGTTGGATGGGGATCCGACGGNONE 
AK103559CGTTGGATGGGGATCCGACGGC2 calcium/lipid-binding region, CaLB domain containing protein. 
Os05g0453700009-171-G06GCCCATCCANONE 
015-019-F02GCCCATCCANONE 
AB110169GCCCATCCANONE 
AK063881GCCCATCCASimilar to ENOD18 protein (Fragment). 
AK073600GCCCATCCANONE 
J033048I03GCCCATCCANONE 
J065026A09GCCCATCCANONE 
J065028M08GCCCATCCANONE 
J075140N01GCCCATCCANONE 
Os05g0456000AK058420TCCGGCCCAACATGGATGGGCCTAMitochondrial glycoprotein family protein. 
AK102036TCCGGCCCAACATGGATGGGCCTANONE 
J065066F02TCCGGCCCAACATGGATGGGCCTANONE 
Os05g0466600009-088-F09CTCCCCCATCCAACGGCNONE 
009-105-C11CTCCCCCATCCAACGGCNONE 
009-156-C06CTCCCCCATCCAACGGCNONE 
AK119240CTCCCCCATCCAACGGChistone H4 [Oryza sativa (japonica cultivar-group)]. 
Os05g0481600009-067-H08CACGGCCCATCCAAGGCCCAGANONE 
009-085-H10CACGGCCCATCCAAGGCCCAGANONE 
009-147-F04CACGGCCCATCCAAGGCCCAGANONE 
AK063820CACGGCCCATCCAAGGCCCAGAConserved hypothetical protein. 
AK121540CACGGCCCATCCAAGGCCCAGANONE 
J023027H12CACGGCCCATCCAAGGCCCAGANONE 
J033031M01CACGGCCCATCCAAGGCCCAGANONE 
J053031M02CACGGCCCATCCAAGGCCCAGANONE 
Os05g0498500009-169-B12TGGATGGGNONE 
AK063878TGGATGGGHypothetical protein. 
Os05g0502800016-060-H05CCCATCCACCGGCCCGCANONE 
AK064242CCCATCCACCGGCCCGCANONE 
AK065486CCCATCCACCGGCCCGCANAF1 domain containing protein. 
Os05g0526300AK099438CCCATCCANONE 
Os05g0542200AK071306AGCCCATCCAEpoxide hydrolase family protein. 
AK071703AGCCCATCCANONE 
Os05g0578600AK108477CCCATCCASimilar to Polygalacturonase PG2. 
Os05g0595200AK070317TGGATGGGAllergen V5/Tpx-1 related family protein. 
AK100748TGGATGGGNONE 
J023052A08TGGATGGGNONE 
J023118J22TGGATGGGNONE 
Os06g0101000J023143D21TCTGGCCCATCCANONE 
J033027A19TCTGGCCCATCCANONE 
J033131O18TCTGGCCCATCCANONE 
J043040N17TCTGGCCCATCCANONE 
J090007I16TCTGGCCCATCCANONE 
Os06g0132300AK107873CCCATCCAConserved hypothetical protein. 
Os06g0139700006-052-C07TAAGCCCATCCACCNONE 
009-009-A08TAAGCCCATCCACCNONE 
015-020-D09TAAGCCCATCCACCNONE 
015-087-H06TAAGCCCATCCACCNONE 
016-078-A03TAAGCCCATCCACCNONE 
AK067884TAAGCCCATCCACCNONE 
AK103245TAAGCCCATCCACCConserved hypothetical protein. 
AK106116TAAGCCCATCCACCNONE 
AK106220TAAGCCCATCCACCNONE 
Os06g0168700011-054-F04GCCCATCCANONE 
012-001-G03GCCCATCCANONE 
AK101305GCCCATCCANONE 
AK103637GCCCATCCASimilar to Prolin rich protein. 
J075082N06GCCCATCCANONE 
J100086I19GCCCATCCANONE 
Os06g0184300AK102933CCCATCCAPeptidase C19, ubiquitin carboxyl-terminal hydrolase 2 family protein. 
Os06g0317600009-006-B02CCCATCCANONE 
009-020-A08CCCATCCANONE 
009-090-B02CCCATCCANONE 
009-114-G05CCCATCCANONE 
009-123-E11CCCATCCANONE 
009-153-D06CCCATCCANONE 
009-160-H02CCCATCCANONE 
009-182-D07CCCATCCANONE 
009-190-F06CCCATCCANONE 
AK120680CCCATCCASimilar to Similarity. 
J013162K23CCCATCCANONE 
Os06g0329350009-021-B05TGGATGGGCCCACANONE 
009-043-A04TGGATGGGCCCACANONE 
009-051-G06TGGATGGGCCCACANONE 
009-107-D02TGGATGGGCCCACANONE 
009-111-B11TGGATGGGCCCACANONE 
009-118-B02TGGATGGGCCCACANONE 
009-132-A11TGGATGGGCCCACANONE 
009-186-B06TGGATGGGCCCACANONE 
J065044N12TGGATGGGCCCACANONE 
J065097L15TGGATGGGCCCACANONE 
J065219N02TGGATGGGCCCACANONE 
J080009E03TGGATGGGCCCACANONE 
J080020P03TGGATGGGCCCACANONE 
J080024O15TGGATGGGCCCACANONE 
J080030B22TGGATGGGCCCACANONE 
J080032G04TGGATGGGCCCACANONE 
J080045B12TGGATGGGCCCACANONE 
J080048M05TGGATGGGCCCACANONE 
J080051M16TGGATGGGCCCACANONE 
J080053K12TGGATGGGCCCACANONE 
J080056G17TGGATGGGCCCACANONE 
J080068O22TGGATGGGCCCACANONE 
J080074K04TGGATGGGCCCACANONE 
J080075B20TGGATGGGCCCACANONE 
J080077I03TGGATGGGCCCACANONE 
J080081E17TGGATGGGCCCACANONE 
J080082B08TGGATGGGCCCACANONE 
J080084I03TGGATGGGCCCACANONE 
J080092F08TGGATGGGCCCACANONE 
J090086C01TGGATGGGCCCACAConserved hypothetical protein. 
Os06g0362100AK121132TGGATGGGConserved hypothetical protein. 
J023075J24TGGATGGGNONE 
J023108F22TGGATGGGNONE 
Os06g0552300011-011-G12CCCATCCANONE 
AK101229CCCATCCABZR1, transcriptional repressor family protein. 
J023061O03CCCATCCANONE 
J033031H19CCCATCCANONE 
J075103K14CCCATCCANONE 
J075108I16CCCATCCANONE 
J075194I23CCCATCCANONE 
J090008K01CCCATCCANONE 
J100062P15CCCATCCANONE 
Os06g0559400014-010-E06TGGATGGGNONE 
014-100-E08TGGATGGGNONE 
AK068350TGGATGGGConserved hypothetical protein. 
AK068719TGGATGGGNONE 
J090056B03TGGATGGGNONE 
Os06g0573700015-015-F02TTATGGGCCCATCCANONE 
AK106254TTATGGGCCCATCCAConserved hypothetical protein. 
J065172G24TTATGGGCCCATCCANONE 
Os06g0648200009-150-E06TGGATGGGCCGAGNONE 
014-034-H10TGGATGGGCCGAGNONE 
015-035-E11TGGATGGGCCGAGNONE 
AK063001TGGATGGGCCGAGNONE 
AK063675TGGATGGGCCGAGNONE 
AK106303TGGATGGGCCGAGConserved hypothetical protein. 
Os06g0687900003-115-E01CCCATCCACGCACGCGNONE 
AB054003CCCATCCACGCACGCGGlycosyl transferase, family 43 protein. 
J065212N07CCCATCCACGCACGCGNONE 
Os06g0691200AK108191CCCATCCASimilar to Thaumatin-like protein precursor. 
Os06g0705000J075046P19CCCACTCCCATCCACCACGGCCCCAGConserved hypothetical protein. 
J075169H23CCCACTCCCATCCACCACGGCCCCAGNONE 
Os06g0705400009-033-D03GCCCATCCANONE 
009-056-H04GCCCATCCANONE 
009-085-B10GCCCATCCANONE 
009-121-F03GCCCATCCANONE 
009-146-H05GCCCATCCANONE 
009-155-E09GCCCATCCANONE 
009-164-H02GCCCATCCANONE 
009-168-G05GCCCATCCANONE 
009-181-B05GCCCATCCANONE 
AK062493GCCCATCCANONE 
AK062667GCCCATCCASimilar to Nonspecific lipid-transfer protein 2P (LTP2P) (Lipid transfer protein 2 isoform 2) (LTP2-2) (7 kDa lipid transfer protein 2). 
J065070I09GCCCATCCANONE 
Os06g0716200J100070M15CCCATCCAThaumatin, pathogenesis-related family protein. 
J100082O07CCCATCCANONE 
Os07g0206700013-093-G04CCCATCCANONE 
AK072893CCCATCCACycloartenol-C-24-methyltransferase 1 (EC 2.1.1.41) (24-sterol C- methyltransferase 1) (Sterol C-methyltransferase 1). 
AK100653CCCATCCANONE 
J013092K05CCCATCCANONE 
J023030D07CCCATCCANONE 
J023101M14CCCATCCANONE 
J023111D19CCCATCCANONE 
J023121P10CCCATCCANONE 
J023149L23CCCATCCANONE 
J033080A22CCCATCCANONE 
J033088A07CCCATCCANONE 
J100027J01CCCATCCANONE 
J100035B02CCCATCCANONE 
J100035G22CCCATCCANONE 
J100078D10CCCATCCANONE 
Os07g0413700AK103479CCCATCCASimilar to Poly(ADP)-ribose polymerase (EC 2.4.2.30). 
Os07g0424400AK067386CCCATCCANONE 
J013043M21CCCATCCANONE 
Os07g0448800003-112-B05AAGGCCCATCCANONE 
003-118-A02AAGGCCCATCCANONE 
006-029-E09AAGGCCCATCCANONE 
006-056-F11AAGGCCCATCCANONE 
006-081-F01AAGGCCCATCCANONE 
006-084-H12AAGGCCCATCCANONE 
006-094-A12AAGGCCCATCCANONE 
006-095-C01AAGGCCCATCCANONE 
006-098-F09AAGGCCCATCCANONE 
009-151-B09AAGGCCCATCCANONE 
009-169-C08AAGGCCCATCCANONE 
009-172-F09AAGGCCCATCCANONE 
009-200-H03AAGGCCCATCCANONE 
011-008-B03AAGGCCCATCCANONE 
011-035-C10AAGGCCCATCCANONE 
011-041-G11AAGGCCCATCCANONE 
011-059-H01AAGGCCCATCCANONE 
011-071-D12AAGGCCCATCCANONE 
013-010-E11AAGGCCCATCCANONE 
013-015-B06AAGGCCCATCCANONE 
013-028-A11AAGGCCCATCCANONE 
013-037-A04AAGGCCCATCCANONE 
013-057-B07AAGGCCCATCCANONE 
014-041-D03AAGGCCCATCCANONE 
014-073-G04AAGGCCCATCCANONE 
014-093-D10AAGGCCCATCCANONE 
016-030-F03AAGGCCCATCCANONE 
016-034-B08AAGGCCCATCCANONE 
016-064-D05AAGGCCCATCCANONE 
AB029446AAGGCCCATCCANONE 
AF062393AAGGCCCATCCANONE 
AK072519AAGGCCCATCCAAquaporin. 
AK103938AAGGCCCATCCANONE 
AK103970AAGGCCCATCCANONE 
AK119656AAGGCCCATCCANONE 
J023026N01AAGGCCCATCCANONE 
J023055M16AAGGCCCATCCANONE 
J023063J21AAGGCCCATCCANONE 
J023128K12AAGGCCCATCCANONE 
J065041P10AAGGCCCATCCANONE 
J065134L07AAGGCCCATCCANONE 
J075198L17AAGGCCCATCCANONE 
J090031G17AAGGCCCATCCANONE 
J090032B21AAGGCCCATCCANONE 
J090032D13AAGGCCCATCCANONE 
J090057J22AAGGCCCATCCANONE 
J090062J02AAGGCCCATCCANONE 
J100028J09AAGGCCCATCCANONE 
J100053C06AAGGCCCATCCANONE 
J100056I11AAGGCCCATCCANONE 
J100067E10AAGGCCCATCCANONE 
Os07g0496300AK119387CCCATCCAPleckstrin homology-type domain containing protein. 
Os07g0558400003-103-C02CCCATCCANONE 
003-103-C02TGGGGCCCATCCACCNONE 
003-115-G05CCCATCCANONE 
003-115-G05TGGGGCCCATCCACCNONE 
006-025-B09CCCATCCANONE 
006-025-B09TGGGGCCCATCCACCNONE 
006-025-G10CCCATCCANONE 
006-025-G10TGGGGCCCATCCACCNONE 
006-027-E03CCCATCCANONE 
006-027-E03TGGGGCCCATCCACCNONE 
006-036-C06CCCATCCANONE 
006-036-C06TGGGGCCCATCCACCNONE 
006-045-B10CCCATCCANONE 
006-045-B10TGGGGCCCATCCACCNONE 
006-051-H11CCCATCCANONE 
006-051-H11TGGGGCCCATCCACCNONE 
006-053-H03CCCATCCANONE 
006-053-H03TGGGGCCCATCCACCNONE 
006-057-B09CCCATCCANONE 
006-057-B09TGGGGCCCATCCACCNONE 
006-062-C10CCCATCCANONE 
006-062-C10TGGGGCCCATCCACCNONE 
006-075-B12CCCATCCANONE 
006-075-B12TGGGGCCCATCCACCNONE 
006-079-F01CCCATCCANONE 
006-079-F01TGGGGCCCATCCACCNONE 
006-082-D08CCCATCCANONE 
006-082-D08TGGGGCCCATCCACCNONE 
006-087-F04CCCATCCANONE 
006-087-F04TGGGGCCCATCCACCNONE 
006-089-E09CCCATCCANONE 
006-089-E09TGGGGCCCATCCACCNONE 
006-090-C04CCCATCCANONE 
006-090-C04TGGGGCCCATCCACCNONE 
006-091-H05CCCATCCANONE 
006-091-H05TGGGGCCCATCCACCNONE 
006-093-E02CCCATCCANONE 
006-093-E02TGGGGCCCATCCACCNONE 
006-093-E06CCCATCCANONE 
006-093-E06TGGGGCCCATCCACCNONE 
006-093-H05CCCATCCANONE 
006-093-H05TGGGGCCCATCCACCNONE 
006-095-C05CCCATCCANONE 
006-095-C05TGGGGCCCATCCACCNONE 
006-097-B04CCCATCCANONE 
006-097-B04TGGGGCCCATCCACCNONE 
006-097-C07CCCATCCANONE 
006-097-C07TGGGGCCCATCCACCNONE 
006-097-D02CCCATCCANONE 
006-097-D02TGGGGCCCATCCACCNONE 
006-097-H10CCCATCCANONE 
006-097-H10TGGGGCCCATCCACCNONE 
006-098-C05CCCATCCANONE 
006-098-C05TGGGGCCCATCCACCNONE 
006-099-H09CCCATCCANONE 
006-099-H09TGGGGCCCATCCACCNONE 
006-104-B06CCCATCCANONE 
006-104-B06TGGGGCCCATCCACCNONE 
006-105-B11CCCATCCANONE 
006-105-B11TGGGGCCCATCCACCNONE 
006-106-E12CCCATCCANONE 
006-106-E12TGGGGCCCATCCACCNONE 
006-107-B06CCCATCCANONE 
006-107-B06TGGGGCCCATCCACCNONE 
006-109-A09CCCATCCANONE 
006-109-A09TGGGGCCCATCCACCNONE 
006-112-D05CCCATCCANONE 
006-112-D05TGGGGCCCATCCACCNONE 
006-118-C12CCCATCCANONE 
006-118-C12TGGGGCCCATCCACCNONE 
006-118-E10CCCATCCANONE 
006-118-E10TGGGGCCCATCCACCNONE 
006-120-D05CCCATCCANONE 
006-120-D05TGGGGCCCATCCACCNONE 
006-120-E08CCCATCCANONE 
006-120-E08TGGGGCCCATCCACCNONE 
009-055-D12CCCATCCANONE 
009-055-D12TGGGGCCCATCCACCNONE 
009-108-E05CCCATCCANONE 
009-108-E05TGGGGCCCATCCACCNONE 
009-125-H05CCCATCCANONE 
009-125-H05TGGGGCCCATCCACCNONE 
009-150-A07CCCATCCANONE 
009-150-A07TGGGGCCCATCCACCNONE 
009-198-C07CCCATCCANONE 
009-198-C07TGGGGCCCATCCACCNONE 
AF058796CCCATCCANONE 
AF058796TGGGGCCCATCCACCNONE 
AK058293CCCATCCANONE 
AK058293TGGGGCCCATCCACCNONE 
AK098992CCCATCCANONE 
AK098992TGGGGCCCATCCACCNONE 
AK103924CCCATCCANONE 
AK103924TGGGGCCCATCCACCNONE 
AK104309CCCATCCANONE 
AK104309TGGGGCCCATCCACCNONE 
AK104619CCCATCCANONE 
AK104619TGGGGCCCATCCACCNONE 
AK119534CCCATCCASimilar to Chlorophyll a/b-binding protein CP29 precursor. 
AK119534TGGGGCCCATCCACCSimilar to Chlorophyll a/b-binding protein CP29 precursor. 
J013098H13CCCATCCANONE 
J013098H13TGGGGCCCATCCACCNONE 
J043039O11CCCATCCANONE 
J043039O11TGGGGCCCATCCACCNONE 
J065176D03CCCATCCANONE 
J065176D03TGGGGCCCATCCACCNONE 
J075022K10CCCATCCANONE 
J075022K10TGGGGCCCATCCACCNONE 
J075065A02CCCATCCANONE 
J075065A02TGGGGCCCATCCACCNONE 
J075077D23CCCATCCANONE 
J075077D23TGGGGCCCATCCACCNONE 
J075088P15CCCATCCANONE 
J075088P15TGGGGCCCATCCACCNONE 
J075125D24CCCATCCANONE 
J075125D24TGGGGCCCATCCACCNONE 
J075125H11CCCATCCANONE 
J075125H11TGGGGCCCATCCACCNONE 
J075192H21CCCATCCANONE 
J075192H21TGGGGCCCATCCACCNONE 
J090080H18CCCATCCANONE 
J090080H18TGGGGCCCATCCACCNONE 
Os07g0616900AK071047TGGATGGGCCAAProtein of unknown function DUF500 family protein. 
J013106G03TGGATGGGCCAANONE 
J013124C20TGGATGGGCCAANONE 
J033096D16TGGATGGGCCAANONE 
J043005E08TGGATGGGCCAANONE 
J065197K12TGGATGGGCCAANONE 
J065211I03TGGATGGGCCAANONE 
Os07g0622200AB122058CCCATCCACCAACNONE 
AK069968CCCATCCACCAACNONE 
AK105687CCCATCCACCAACSimilar to M-160-u1_1 (Fragment). 
J075095A10CCCATCCACCAACNONE 
Os07g0623200AK058506TGGATGGGCNONE 
AK069142TGGATGGGCHeavy metal transport/detoxification protein domain containing protein. 
AK103285TGGATGGGCNONE 
Os07g0658400AK120896CCCATCCANONE 
Os07g0659500AK073537GAGGCCCATCCANon-SMC condensin subunit, XCAP-D2/Cnd1 family protein. 
AK073537TGGATGGGCCTANon-SMC condensin subunit, XCAP-D2/Cnd1 family protein. 
Os08g0104600005-006-A07CCCATCCANONE 
006-083-A08CCCATCCANONE 
009-022-C08CCCATCCANONE 
009-027-A01CCCATCCANONE 
009-030-E07CCCATCCANONE 
009-042-H08CCCATCCANONE 
009-048-E08CCCATCCANONE 
009-051-F07CCCATCCANONE 
009-051-H06CCCATCCANONE 
009-054-E02CCCATCCANONE 
009-084-D01CCCATCCANONE 
009-089-A03CCCATCCANONE 
009-105-H12CCCATCCANONE 
009-109-D02CCCATCCANONE 
009-110-H12CCCATCCANONE 
009-117-A05CCCATCCANONE 
009-117-C08CCCATCCANONE 
009-118-F09CCCATCCANONE 
009-119-E03CCCATCCANONE 
009-122-G10CCCATCCANONE 
009-125-H06CCCATCCANONE 
009-126-A06CCCATCCANONE 
009-127-H02CCCATCCANONE 
009-128-B09CCCATCCANONE 
009-129-B09CCCATCCANONE 
009-130-D05CCCATCCANONE 
009-130-D08CCCATCCANONE 
009-139-D08CCCATCCANONE 
009-149-D07CCCATCCANONE 
009-150-C04CCCATCCANONE 
009-154-E03CCCATCCANONE 
009-155-C06CCCATCCANONE 
009-165-B08CCCATCCANONE 
009-167-C06CCCATCCANONE 
009-181-H11CCCATCCANONE 
009-191-F03CCCATCCANONE 
009-192-C06CCCATCCANONE 
009-195-F03CCCATCCANONE 
009-196-G08CCCATCCANONE 
009-197-D08CCCATCCANONE 
014-052-E10CCCATCCANONE 
AF010320CCCATCCANONE 
AK061654CCCATCCANONE 
AK119206CCCATCCANONE 
AK119709CCCATCCANONE 
AK120393CCCATCCAFerredoxin I, chloroplast precursor (Anti-disease protein 1). 
AY072818CCCATCCANONE 
D30763CCCATCCANONE 
J013043A04CCCATCCANONE 
J013058K06CCCATCCANONE 
J013059G01CCCATCCANONE 
J013067N20CCCATCCANONE 
J013074D04CCCATCCANONE 
J013075A06CCCATCCANONE 
J013093N12CCCATCCANONE 
J013094P22CCCATCCANONE 
J013119N05CCCATCCANONE 
J013120G18CCCATCCANONE 
J013129G02CCCATCCANONE 
J013129P10CCCATCCANONE 
J013159F22CCCATCCANONE 
J013160D20CCCATCCANONE 
J013160E23CCCATCCANONE 
J023034F18CCCATCCANONE 
J023048F04CCCATCCANONE 
J023048O08CCCATCCANONE 
J023049B18CCCATCCANONE 
J023061A17CCCATCCANONE 
J023072A03CCCATCCANONE 
J023085A16CCCATCCANONE 
J023087L09CCCATCCANONE 
J043012O13CCCATCCANONE 
J065038A14CCCATCCANONE 
J065187M18CCCATCCANONE 
J065205M17CCCATCCANONE 
J080301G10CCCATCCANONE 
J080311I12CCCATCCANONE 
J080311O19CCCATCCANONE 
J080312C16CCCATCCANONE 
J080317L04CCCATCCANONE 
J090027H09CCCATCCANONE 
J090053F07CCCATCCANONE 
J090055C23CCCATCCANONE 
J090071A18CCCATCCANONE 
J090084O10CCCATCCANONE 
J090091C23CCCATCCANONE 
J090093J04CCCATCCANONE 
J100061N06CCCATCCANONE 
J100070P06CCCATCCANONE 
J100074K15CCCATCCANONE 
Os08g0136500006-092-G03CCCATCCANONE 
AK061187CCCATCCAProtein of unknown function DUF26 domain containing protein. 
J065057C18CCCATCCANONE 
Os08g0137250J075030L12AAAAGCCCATTTAGCCCATCCANONE 
J075037O21AAAAGCCCATTTAGCCCATCCANONE 
J075078E23AAAAGCCCATTTAGCCCATCCANONE 
J075079C23AAAAGCCCATTTAGCCCATCCANONE 
J075092K02AAAAGCCCATTTAGCCCATCCANONE 
J075108M04AAAAGCCCATTTAGCCCATCCANONE 
J075112N13AAAAGCCCATTTAGCCCATCCANONE 
J075132M13AAAAGCCCATTTAGCCCATCCANONE 
J075146E07AAAAGCCCATTTAGCCCATCCANONE 
J075159F16AAAAGCCCATTTAGCCCATCCANONE 
J075166M12AAAAGCCCATTTAGCCCATCCANONE 
J075185B10AAAAGCCCATTTAGCCCATCCANONE 
J075193J10AAAAGCCCATTTAGCCCATCCANONE 
Os08g0138500AK102951CCCATCCASimilar to Helix-loop-helix-like protein (Fragment). 
AY224458CCCATCCANONE 
J033115D14CCCATCCANONE 
J065013F04CCCATCCANONE 
J065050P11CCCATCCANONE 
J065063K18CCCATCCANONE 
J090054H10CCCATCCANONE 
J100083F11CCCATCCANONE 
Os08g0175200AK072367GGACCCACCCCATCCACCProtein of unknown function DUF292, eukaryotic domain containing protein. 
J013149H16GGACCCACCCCATCCACCNONE 
J023075K04GGACCCACCCCATCCACCNONE 
J023082L15GGACCCACCCCATCCACCNONE 
J043015G07GGACCCACCCCATCCACCNONE 
J065052L17GGACCCACCCCATCCACCNONE 
J065202P07GGACCCACCCCATCCACCNONE 
J075061D17GGACCCACCCCATCCACCNONE 
J100088P13GGACCCACCCCATCCACCNONE 
Os08g0200300005-007-C01CCCATCCACCNONE 
009-041-H05CCCATCCACCNONE 
009-055-G10CCCATCCACCNONE 
009-101-E05CCCATCCACCNONE 
009-110-H11CCCATCCACCNONE 
009-114-D06CCCATCCACCNONE 
009-116-B08CCCATCCACCNONE 
009-117-G06CCCATCCACCNONE 
009-125-H04CCCATCCACCNONE 
009-131-H10CCCATCCACCNONE 
009-136-F02CCCATCCACCNONE 
009-144-C04CCCATCCACCNONE 
009-149-E10CCCATCCACCNONE 
009-166-E04CCCATCCACCNONE 
009-189-G08CCCATCCACCNONE 
AK105055CCCATCCACCNONE 
AK121083CCCATCCACCSimilar to Photosystem II 10 kDa polypeptide (Fragment). 
J013051F20CCCATCCACCNONE 
J013060E15CCCATCCACCNONE 
J013070F24CCCATCCACCNONE 
J013071K15CCCATCCACCNONE 
J013091E11CCCATCCACCNONE 
J013134L03CCCATCCACCNONE 
J023063I15CCCATCCACCNONE 
J023084E22CCCATCCACCNONE 
J023084J06CCCATCCACCNONE 
J033090D12CCCATCCACCNONE 
J065001D08CCCATCCACCNONE 
J065007K04CCCATCCACCNONE 
J065040H06CCCATCCACCNONE 
J065078N14CCCATCCACCNONE 
J065093B19CCCATCCACCNONE 
J065103D10CCCATCCACCNONE 
J065107E16CCCATCCACCNONE 
J065116E01CCCATCCACCNONE 
J065129B10CCCATCCACCNONE 
J065132F08CCCATCCACCNONE 
J065135M15CCCATCCACCNONE 
J065149C13CCCATCCACCNONE 
J065155H23CCCATCCACCNONE 
J065162P16CCCATCCACCNONE 
J065169P09CCCATCCACCNONE 
J065176B09CCCATCCACCNONE 
J065187F07CCCATCCACCNONE 
J065194H08CCCATCCACCNONE 
J065197G22CCCATCCACCNONE 
J065208D12CCCATCCACCNONE 
J065210B17CCCATCCACCNONE 
J065219D24CCCATCCACCNONE 
J075009C14CCCATCCACCNONE 
J075009O22CCCATCCACCNONE 
J075012J06CCCATCCACCNONE 
J075014G03CCCATCCACCNONE 
J075015A03CCCATCCACCNONE 
J075022B09CCCATCCACCNONE 
J075023H11CCCATCCACCNONE 
J075025J07CCCATCCACCNONE 
J075026K15CCCATCCACCNONE 
J075029D06CCCATCCACCNONE 
J075038G19CCCATCCACCNONE 
J075041N03CCCATCCACCNONE 
J075048P22CCCATCCACCNONE 
J075051J23CCCATCCACCNONE 
J075051L15CCCATCCACCNONE 
J075052P04CCCATCCACCNONE 
J075058O21CCCATCCACCNONE 
J075062E03CCCATCCACCNONE 
J075063K18CCCATCCACCNONE 
J075064K01CCCATCCACCNONE 
J075067B03CCCATCCACCNONE 
J075070I20CCCATCCACCNONE 
J075071J04CCCATCCACCNONE 
J075074F17CCCATCCACCNONE 
J075076H02CCCATCCACCNONE 
J075080E17CCCATCCACCNONE 
J075081F04CCCATCCACCNONE 
J075086K17CCCATCCACCNONE 
J075090I07CCCATCCACCNONE 
J075092F21CCCATCCACCNONE 
J075096P11CCCATCCACCNONE 
J075099K15CCCATCCACCNONE 
J075102M12CCCATCCACCNONE 
J075105B03CCCATCCACCNONE 
J075110I07CCCATCCACCNONE 
J075111C15CCCATCCACCNONE 
J075111M09CCCATCCACCNONE 
J075114I06CCCATCCACCNONE 
J075115E15CCCATCCACCNONE 
J075123K17CCCATCCACCNONE 
J075125B03CCCATCCACCNONE 
J075126A12CCCATCCACCNONE 
J075129L20CCCATCCACCNONE 
J075130B11CCCATCCACCNONE 
J075137J12CCCATCCACCNONE 
J075141G10CCCATCCACCNONE 
J075141I06CCCATCCACCNONE 
J075143A22CCCATCCACCNONE 
J075148E07CCCATCCACCNONE 
J075158D09CCCATCCACCNONE 
J075168G18CCCATCCACCNONE 
J075169K08CCCATCCACCNONE 
J075170A10CCCATCCACCNONE 
J075170E18CCCATCCACCNONE 
J075179C15CCCATCCACCNONE 
J075180L24CCCATCCACCNONE 
J075181A22CCCATCCACCNONE 
J075185C20CCCATCCACCNONE 
J075191B07CCCATCCACCNONE 
J075192D03CCCATCCACCNONE 
J075192L04CCCATCCACCNONE 
J075193G10CCCATCCACCNONE 
J075193M18CCCATCCACCNONE 
J075198F05CCCATCCACCNONE 
J080001F14CCCATCCACCNONE 
J080001J20CCCATCCACCNONE 
J080002N10CCCATCCACCNONE 
J080003I15CCCATCCACCNONE 
J080004H05CCCATCCACCNONE 
J080006J08CCCATCCACCNONE 
J080007D08CCCATCCACCNONE 
J080008B21CCCATCCACCNONE 
J080009P16CCCATCCACCNONE 
J080010F24CCCATCCACCNONE 
J080011F18CCCATCCACCNONE 
J080012J03CCCATCCACCNONE 
J080013B21CCCATCCACCNONE 
J080013N24CCCATCCACCNONE 
J080017D22CCCATCCACCNONE 
J080017E04CCCATCCACCNONE 
J080018G06CCCATCCACCNONE 
J080020M24CCCATCCACCNONE 
J080021C22CCCATCCACCNONE 
J080021E21CCCATCCACCNONE 
J080021G12CCCATCCACCNONE 
J080021N20CCCATCCACCNONE 
J080022B02CCCATCCACCNONE 
J080022D19CCCATCCACCNONE 
J080024J07CCCATCCACCNONE 
J080026M20CCCATCCACCNONE 
J080028D11CCCATCCACCNONE 
J080029E08CCCATCCACCNONE 
J080030F06CCCATCCACCNONE 
J080030J09CCCATCCACCNONE 
J080032F19CCCATCCACCNONE 
J080032L09CCCATCCACCNONE 
J080032O15CCCATCCACCNONE 
J080034J07CCCATCCACCNONE 
J080035A04CCCATCCACCNONE 
J080035A12CCCATCCACCNONE 
J080037P21CCCATCCACCNONE 
J080040F18CCCATCCACCNONE 
J080040N13CCCATCCACCNONE 
J080040P12CCCATCCACCNONE 
J080041E09CCCATCCACCNONE 
J080044A04CCCATCCACCNONE 
J080044F21CCCATCCACCNONE 
J080044P20CCCATCCACCNONE 
J080045N06CCCATCCACCNONE 
J080046H12CCCATCCACCNONE 
J080047A12CCCATCCACCNONE 
J080047O03CCCATCCACCNONE 
J080047O20CCCATCCACCNONE 
J080048G24CCCATCCACCNONE 
J080049H08CCCATCCACCNONE 
J080050G23CCCATCCACCNONE 
J080050P05CCCATCCACCNONE 
J080052J24CCCATCCACCNONE 
J080056N20CCCATCCACCNONE 
J080056O04CCCATCCACCNONE 
J080058D10CCCATCCACCNONE 
J080058G13CCCATCCACCNONE 
J080059H10CCCATCCACCNONE 
J080062G11CCCATCCACCNONE 
J080064A12CCCATCCACCNONE 
J080064E18CCCATCCACCNONE 
J080064O19CCCATCCACCNONE 
J080065F09CCCATCCACCNONE 
J080065P22CCCATCCACCNONE 
J080067A17CCCATCCACCNONE 
J080067E09CCCATCCACCNONE 
J080069M22CCCATCCACCNONE 
J080070E21CCCATCCACCNONE 
J080070K18CCCATCCACCNONE 
J080071L21CCCATCCACCNONE 
J080071P04CCCATCCACCNONE 
J080072M02CCCATCCACCNONE 
J080075K15CCCATCCACCNONE 
J080075K19CCCATCCACCNONE 
J080076L03CCCATCCACCNONE 
J080079L23CCCATCCACCNONE 
J080080O08CCCATCCACCNONE 
J080081H06CCCATCCACCNONE 
J080082L22CCCATCCACCNONE 
J080083N23CCCATCCACCNONE 
J080084J09CCCATCCACCNONE 
J080085B01CCCATCCACCNONE 
J080087M23CCCATCCACCNONE 
J080088P08CCCATCCACCNONE 
J080090A20CCCATCCACCNONE 
J080092J18CCCATCCACCNONE 
J080095G03CCCATCCACCNONE 
J080097C14CCCATCCACCNONE 
J080097P20CCCATCCACCNONE 
J080301E13CCCATCCACCNONE 
J080301G11CCCATCCACCNONE 
J080301I11CCCATCCACCNONE 
J080301O21CCCATCCACCNONE 
J080302L09CCCATCCACCNONE 
J080303E17CCCATCCACCNONE 
J080304C05CCCATCCACCNONE 
J080305E22CCCATCCACCNONE 
J080305F22CCCATCCACCNONE 
J080307B14CCCATCCACCNONE 
J080310B22CCCATCCACCNONE 
J080310J02CCCATCCACCNONE 
J080312N01CCCATCCACCNONE 
J080313I10CCCATCCACCNONE 
J080315K16CCCATCCACCNONE 
J080317B08CCCATCCACCNONE 
J080317H10CCCATCCACCNONE 
J080317M14CCCATCCACCNONE 
J080317P17CCCATCCACCNONE 
J080319M22CCCATCCACCNONE 
J090052E23CCCATCCACCNONE 
J090071I04CCCATCCACCNONE 
J100045L08CCCATCCACCNONE 
J100068N19CCCATCCACCNONE 
U86018CCCATCCACCNONE 
Os08g0243500AK068915CCCATCCACCSimilar to NADPH-cytochrome P450 oxydoreductase isoform 2. 
AK099083CCCATCCACCNONE 
Os08g0285200J065142I21CCCATCCANONE 
Os08g0327400AK070992CCCATCCASimilar to Enoyl-ACP reductase (Fragment). 
J023077K10CCCATCCANONE 
J065075F06CCCATCCANONE 
J065112N14CCCATCCANONE 
J090028K07CCCATCCANONE 
J090039C15CCCATCCANONE 
J090048I11CCCATCCANONE 
J090083M10CCCATCCANONE 
Os08g0410300J023099O05CCCATCCANONE 
J065103A10CCCATCCANONE 
J065104A12CCCATCCANONE 
J065122N03CCCATCCANONE 
J065137K12CCCATCCANONE 
J065142I10CCCATCCANONE 
J065191C12CCCATCCANONE 
J100026P19CCCATCCAMajor facilitator superfamily protein. 
J100049A01CCCATCCANONE 
Os08g0422000AK067163CCCATCCAConserved hypothetical protein. 
J013096B06CCCATCCANONE 
Os08g0485700AK068131CCCATCCANONE 
AK069097CCCATCCAMethyl-CpG binding domain containing protein. 
J013130L03CCCATCCANONE 
Os08g0494300AK066150AGTGGGCCCATCCAvon Willebrand factor, type A domain containing protein. 
Os08g0531900AY177701CCCATCCASimilar to MADS box transcription factor-like protein (MADS-box protein AGL72). 
J090094F15CCCATCCANONE 
Os08g0557100AK070743CCCATCCANONE 
AK101214CCCATCCASimilar to Nucleic acid-binding protein precursor. 
AK105901CCCATCCANONE 
J033031B04CCCATCCANONE 
J080004F08CCCATCCANONE 
J080004H12CCCATCCANONE 
J080005H08CCCATCCANONE 
J080005I02CCCATCCANONE 
J080008N16CCCATCCANONE 
J080009H23CCCATCCANONE 
J080012H17CCCATCCANONE 
J080012J21CCCATCCANONE 
J080013I20CCCATCCANONE 
J080016E07CCCATCCANONE 
J080018O04CCCATCCANONE 
J080020B18CCCATCCANONE 
J080021I16CCCATCCANONE 
J080022N01CCCATCCANONE 
J080023G08CCCATCCANONE 
J080023N09CCCATCCANONE 
J080024J24CCCATCCANONE 
J080025M12CCCATCCANONE 
J080028A22CCCATCCANONE 
J080028I01CCCATCCANONE 
J080029D22CCCATCCANONE 
J080030M02CCCATCCANONE 
J080031B06CCCATCCANONE 
J080035G08CCCATCCANONE 
J080036F19CCCATCCANONE 
J080038P14CCCATCCANONE 
J080039C17CCCATCCANONE 
J080043A10CCCATCCANONE 
J080044H02CCCATCCANONE 
J080044P12CCCATCCANONE 
J080047L06CCCATCCANONE 
J080050L06CCCATCCANONE 
J080052J11CCCATCCANONE 
J080052M10CCCATCCANONE 
J080053E20CCCATCCANONE 
J080054J01CCCATCCANONE 
J080059N09CCCATCCANONE 
J080064F19CCCATCCANONE 
J080064N22CCCATCCANONE 
J080065K14CCCATCCANONE 
J080065M12CCCATCCANONE 
J080068O07CCCATCCANONE 
J080076P20CCCATCCANONE 
J080087D08CCCATCCANONE 
J080087H16CCCATCCANONE 
J080090N23CCCATCCANONE 
J080091H04CCCATCCANONE 
J080091P13CCCATCCANONE 
J080094O15CCCATCCANONE 
J080094P14CCCATCCANONE 
J080095I07CCCATCCANONE 
J080097E22CCCATCCANONE 
Os08g0566100AK107465CCCATCCAProtein of unknown function DUF239, plant domain containing protein. 
Os09g0130901J075104L08CCCATCCAConserved hypothetical protein. 
Os09g0459200AK110733AGCCCATCCAConserved hypothetical protein. 
J065131C07AGCCCATCCANONE 
Os09g0516200AF005492CCCATCCATranscription factor RF2a. Splice isoform 2. 
AK102795CCCATCCANONE 
J033108B13CCCATCCANONE 
J065066F17CCCATCCANONE 
Os09g0516600AK070780CCCATCCANONE 
AK103563CCCATCCANONE 
AY054407CCCATCCAGlyoxalase II. 
J013058P06CCCATCCANONE 
J013093G04CCCATCCANONE 
J023007G05CCCATCCANONE 
J023091A08CCCATCCANONE 
J023136K23CCCATCCANONE 
J023138D20CCCATCCANONE 
J033022N20CCCATCCANONE 
J033065N15CCCATCCANONE 
J033109L23CCCATCCANONE 
J053073C08CCCATCCANONE 
J075094J24CCCATCCANONE 
J075106P21CCCATCCANONE 
Os09g0517800012-034-H10CCACGGCCTGGATGGGCCCACGTNONE 
AK121391CCACGGCCTGGATGGGCCCACGTCyclin-like F-box domain containing protein. 
J023129D04CCACGGCCTGGATGGGCCCACGTNONE 
J043012D11CCACGGCCTGGATGGGCCCACGTNONE 
Os09g0538200009-076-A07TCGGCCCATCCANONE 
AB032061TCGGCCCATCCAProteasome subunit alpha type 7 (EC 3.4.25.1) (20S proteasome alpha subunit D) (20S proteasome subunit alpha-4). 
J065184D10TCGGCCCATCCANONE 
J075134I16TCGGCCCATCCANONE 
J100031G24TCGGCCCATCCANONE 
Os09g0572600AK070226CCCATCCASimilar to Receptor protein kinase-like protein. 
J023006G12CCCATCCANONE 
J023042D11CCCATCCANONE 
Os11g0104400D78505TGCGGCCCATCCASimilar to W-3 fatty acid desaturase (Fragment). 
J013109G14TGCGGCCCATCCANONE 
J075027J03TGCGGCCCATCCANONE 
J090006L16TGCGGCCCATCCANONE 
J090021A01TGCGGCCCATCCANONE 
J090049M01TGCGGCCCATCCANONE 
J090084O20TGCGGCCCATCCANONE 
Os11g0139500AK121845GAGGCCCATCCAGGCCCAACANONE 
Os11g0202000AK063427GTATGGGCCTAGGCCCATCCACyclin-like F-box domain containing protein. 
AK122020GTATGGGCCTAGGCCCATCCANONE 
J033111N03GTATGGGCCTAGGCCCATCCANONE 
Os11g0264600J100079I22CCCGGCCCATCCANONE 
Os11g0267000006-024-H12CCCATCCANONE 
006-039-A12CCCATCCANONE 
006-039-B09CCCATCCANONE 
006-044-F05CCCATCCANONE 
006-069-C12CCCATCCANONE 
006-098-E01CCCATCCANONE 
006-099-H05CCCATCCANONE 
006-103-B11CCCATCCANONE 
006-107-A02CCCATCCANONE 
006-109-C12CCCATCCANONE 
009-123-C09CCCATCCANONE 
AK060022CCCATCCANONE 
AK061014CCCATCCAGUN4-like domain containing protein. 
AK100815CCCATCCANONE 
AK104559CCCATCCANONE 
J023122C05CCCATCCANONE 
Os11g0271000AK110686TGGATGGGCNONE 
Os11g0302700AK073931TGGATGGGRecA bacterial DNA recombination family protein. 
Os11g0429000AK067370CCCATCCACCConserved hypothetical protein. 
Os11g0448400AB095094TGGATGGGCCCGSimilar to Sigma factor SIG2A. 
J075053H03TGGATGGGCCCGNONE 
J075062F23TGGATGGGCCCGNONE 
J090029D08TGGATGGGCCCGNONE 
Os11g0481600AK109900TGGATGGGCConserved hypothetical protein. 
Os11g0512000AK107369GCCCATCCANo apical meristem (NAM) protein domain containing protein. 
J075006M23GCCCATCCANONE 
J075069E01GCCCATCCANONE 
J075073J15GCCCATCCANONE 
J075081H21GCCCATCCANONE 
J075081I24GCCCATCCANONE 
J075098E10GCCCATCCANONE 
J075109B07GCCCATCCANONE 
J075109B09GCCCATCCANONE 
J075109K23GCCCATCCANONE 
J075120F18GCCCATCCANONE 
J075121H03GCCCATCCANONE 
J075174O18GCCCATCCANONE 
J075177G19GCCCATCCANONE 
J075179P19GCCCATCCANONE 
J075195P18GCCCATCCANONE 
J075196B20GCCCATCCANONE 
J090068H20GCCCATCCANONE 
Os11g0542100J065162B12CCCATCCAZinc finger, RING-type domain containing protein. 
Os11g0545800AK073687CCACGGCCCACCAAGCCCATCCARegulator of chromosome condensation/beta-lactamase-inhibitor protein II domain containing protein. 
J090050C14CCACGGCCCACCAAGCCCATCCANONE 
Os11g0549655J065008P04CCCATCCANONE 
J065148G18CCCATCCAMaf-like protein family protein. 
Os11g0557900009-196-H11CAAGGCCCATCCANONE 
AK063232CAAGGCCCATCCAARP2/3 complex 16 kDa subunit (p16-Arc) family protein. 
Os11g0614900AK072924CCCATCCAProtein of unknown function DUF829, eukaryotic family protein. 
Os12g0115700009-031-E01CCCATCCANONE 
009-179-D01CCCATCCANONE 
AK099443CCCATCCAChalcone-flavanone isomerase family protein. 
J013021E03CCCATCCANONE 
J023044K15CCCATCCANONE 
Os12g0122450Os12g0122450TGGATGGGNONE 
Os12g0145700AK071391CCCATCCAPyruvate kinase family protein. 
J023013N02CCCATCCANONE 
J033085D15CCCATCCANONE 
J043021I09CCCATCCANONE 
J100055L05CCCATCCANONE 
Os12g0158700J065021C04CCCATCCANONE 
J090082H20CCCATCCAConserved hypothetical protein. 
Os12g0180100AK058227GGTGGATGGGCNONE 
Os12g0203000AK100360CCCATCCASimilar to Cyclin-dependent protein kinase-like protein. 
Os12g0204500011-012-A10CCCATCCANONE 
011-044-C12CCCATCCANONE 
AK069867CCCATCCAProtein of unknown function DUF579, plant family protein. 
J013039L02CCCATCCANONE 
J023038F14CCCATCCANONE 
J075123I24CCCATCCANONE 
Os12g0228900J033132F01CCCATCCANONE 
J043003P05CCCATCCANONE 
J065079N16CCCATCCANONE 
J065141L03CCCATCCANONE 
J075001I21CCCATCCANONE 
J075032L11CCCATCCANONE 
J075126O12CCCATCCANONE 
J100079E06CCCATCCANONE 
Os12g0269200J075029I20CCCATCCANONE 
J075036I09CCCATCCANONE 
J075045C02CCCATCCANONE 
J075160B15CCCATCCANONE 
Os12g0269600J075023G16CCCATCCANONE 
J075153J11CCCATCCANONE 
J075163C05CCCATCCASimilar to 13 kDa prolamin precursor. 
Os12g0274700003-008-G09CCCATCCANONE 
006-028-B09CCCATCCANONE 
006-029-D12CCCATCCANONE 
006-034-G05CCCATCCANONE 
006-036-A02CCCATCCANONE 
006-039-A08CCCATCCANONE 
006-057-H10CCCATCCANONE 
006-064-D08CCCATCCANONE 
006-064-G03CCCATCCANONE 
006-071-B05CCCATCCANONE 
006-089-D01CCCATCCANONE 
006-095-G02CCCATCCANONE 
006-098-H02CCCATCCANONE 
006-109-H01CCCATCCANONE 
006-115-H09CCCATCCANONE 
006-120-B02CCCATCCANONE 
009-005-E08CCCATCCANONE 
009-027-E04CCCATCCANONE 
009-028-A10CCCATCCANONE 
009-050-G03CCCATCCANONE 
009-070-E05CCCATCCANONE 
009-095-D10CCCATCCANONE 
009-103-A05CCCATCCANONE 
009-113-G09CCCATCCANONE 
009-116-E08CCCATCCANONE 
009-125-F02CCCATCCANONE 
009-125-F09CCCATCCANONE 
009-129-F03CCCATCCANONE 
009-130-F01CCCATCCANONE 
009-140-F07CCCATCCANONE 
009-151-F07CCCATCCANONE 
009-153-D04CCCATCCANONE 
009-165-D08CCCATCCANONE 
009-170-E11CCCATCCANONE 
009-171-C01CCCATCCANONE 
009-171-G05CCCATCCANONE 
009-189-F07CCCATCCANONE 
009-193-H05CCCATCCANONE 
009-194-D08CCCATCCANONE 
AF017364CCCATCCANONE 
AF052305CCCATCCANONE 
AK061611CCCATCCANONE 
AK119219CCCATCCANONE 
AK121444CCCATCCASimilar to Petunia ribulose 1,5-bisphosphate carboxylase small subunit mRNA (clone pSSU 51), partial cds. (Fragment). 
D00643CCCATCCANONE 
J013031F15CCCATCCANONE 
J013037P20CCCATCCANONE 
J013050D13CCCATCCANONE 
J013056J24CCCATCCANONE 
J013063C09CCCATCCANONE 
J013071M01CCCATCCANONE 
J013074G12CCCATCCANONE 
J013120E19CCCATCCANONE 
J013124M17CCCATCCANONE 
J013127I18CCCATCCANONE 
J013129G13CCCATCCANONE 
J013132L16CCCATCCANONE 
J013146M05CCCATCCANONE 
J023044F05CCCATCCANONE 
J023056E16CCCATCCANONE 
J023141B14CCCATCCANONE 
J065008E12CCCATCCANONE 
J065010I24CCCATCCANONE 
J065013B01CCCATCCANONE 
J065019L16CCCATCCANONE 
J065021E19CCCATCCANONE 
J065027G11CCCATCCANONE 
J065039B19CCCATCCANONE 
J065039K03CCCATCCANONE 
J065044I07CCCATCCANONE 
J065047B10CCCATCCANONE 
J065050A16CCCATCCANONE 
J065050B15CCCATCCANONE 
J065052H09CCCATCCANONE 
J065053K05CCCATCCANONE 
J065061H12CCCATCCANONE 
J065061M13CCCATCCANONE 
J065078M16CCCATCCANONE 
J065083L13CCCATCCANONE 
J065084L01CCCATCCANONE 
J065091O21CCCATCCANONE 
J065095D06CCCATCCANONE 
J065095J12CCCATCCANONE 
J065097I18CCCATCCANONE 
J065114N19CCCATCCANONE 
J065118P09CCCATCCANONE 
J065123D11CCCATCCANONE 
J065123F08CCCATCCANONE 
J065124B04CCCATCCANONE 
J065128C04CCCATCCANONE 
J065137J07CCCATCCANONE 
J065165K23CCCATCCANONE 
J065183D22CCCATCCANONE 
J065195B17CCCATCCANONE 
J065201N18CCCATCCANONE 
J065204K15CCCATCCANONE 
J065208F08CCCATCCANONE 
J075011P21CCCATCCANONE 
J075020D18CCCATCCANONE 
J075028H08CCCATCCANONE 
J075065H14CCCATCCANONE 
J075069O11CCCATCCANONE 
J075071P10CCCATCCANONE 
J075177C11CCCATCCANONE 
J080002E12CCCATCCANONE 
J080002F23CCCATCCANONE 
J080002J09CCCATCCANONE 
J080003L11CCCATCCANONE 
J080004C05CCCATCCANONE 
J080004E12CCCATCCANONE 
J080004L13CCCATCCANONE 
J080006E06CCCATCCANONE 
J080006H14CCCATCCANONE 
J080008B07CCCATCCANONE 
J080008C21CCCATCCANONE 
J080008G01CCCATCCANONE 
J080008I09CCCATCCANONE 
J080008J10CCCATCCANONE 
J080008O08CCCATCCANONE 
J080009C10CCCATCCANONE 
J080009M22CCCATCCANONE 
J080009O11CCCATCCANONE 
J080009P22CCCATCCANONE 
J080010B11CCCATCCANONE 
J080010K04CCCATCCANONE 
J080011F13CCCATCCANONE 
J080013K07CCCATCCANONE 
J080014H24CCCATCCANONE 
J080015A13CCCATCCANONE 
J080015G11CCCATCCANONE 
J080015N21CCCATCCANONE 
J080016N04CCCATCCANONE 
J080018I15CCCATCCANONE 
J080018O22CCCATCCANONE 
J080020N07CCCATCCANONE 
J080021F19CCCATCCANONE 
J080021K02CCCATCCANONE 
J080023E20CCCATCCANONE 
J080025M08CCCATCCANONE 
J080026E10CCCATCCANONE 
J080027M18CCCATCCANONE 
J080029C04CCCATCCANONE 
J080030A07CCCATCCANONE 
J080030A13CCCATCCANONE 
J080030D14CCCATCCANONE 
J080030D18CCCATCCANONE 
J080031H14CCCATCCANONE 
J080031N07CCCATCCANONE 
J080032B12CCCATCCANONE 
J080036N19CCCATCCANONE 
J080036O03CCCATCCANONE 
J080038J23CCCATCCANONE 
J080040D10CCCATCCANONE 
J080040E08CCCATCCANONE 
J080041K04CCCATCCANONE 
J080042F24CCCATCCANONE 
J080042H22CCCATCCANONE 
J080042H23CCCATCCANONE 
J080044N24CCCATCCANONE 
J080045F16CCCATCCANONE 
J080046C04CCCATCCANONE 
J080046C19CCCATCCANONE 
J080046L07CCCATCCANONE 
J080046M19CCCATCCANONE 
J080048N16CCCATCCANONE 
J080048P05CCCATCCANONE 
J080049N15CCCATCCANONE 
J080050G22CCCATCCANONE 
J080052A09CCCATCCANONE 
J080052J01CCCATCCANONE 
J080053N04CCCATCCANONE 
J080055K09CCCATCCANONE 
J080056N06CCCATCCANONE 
J080057G09CCCATCCANONE 
J080058E22CCCATCCANONE 
J080059E04CCCATCCANONE 
J080061F19CCCATCCANONE 
J080062C19CCCATCCANONE 
J080062E15CCCATCCANONE 
J080063M12CCCATCCANONE 
J080063P12CCCATCCANONE 
J080064F02CCCATCCANONE 
J080064O16CCCATCCANONE 
J080065E22CCCATCCANONE 
J080066C18CCCATCCANONE 
J080068E10CCCATCCANONE 
J080068O13CCCATCCANONE 
J080069A09CCCATCCANONE 
J080069M24CCCATCCANONE 
J080071B21CCCATCCANONE 
J080071C23CCCATCCANONE 
J080072H01CCCATCCANONE 
J080072I16CCCATCCANONE 
J080074D12CCCATCCANONE 
J080075F18CCCATCCANONE 
J080075J08CCCATCCANONE 
J080075N24CCCATCCANONE 
J080076L02CCCATCCANONE 
J080076L21CCCATCCANONE 
J080077E23CCCATCCANONE 
J080079M18CCCATCCANONE 
J080080B19CCCATCCANONE 
J080080H19CCCATCCANONE 
J080080L11CCCATCCANONE 
J080081L18CCCATCCANONE 
J080082N16CCCATCCANONE 
J080083M19CCCATCCANONE 
J080084C20CCCATCCANONE 
J080084M05CCCATCCANONE 
J080085O19CCCATCCANONE 
J080086E02CCCATCCANONE 
J080087B17CCCATCCANONE 
J080088G21CCCATCCANONE 
J080088M20CCCATCCANONE 
J080089H02CCCATCCANONE 
J080090F01CCCATCCANONE 
J080090O03CCCATCCANONE 
J080091F10CCCATCCANONE 
J080091F21CCCATCCANONE 
J080091G07CCCATCCANONE 
J080091H02CCCATCCANONE 
J080092C01CCCATCCANONE 
J080092C08CCCATCCANONE 
J080092H03CCCATCCANONE 
J080092L08CCCATCCANONE 
J080094F04CCCATCCANONE 
J080094H13CCCATCCANONE 
J080095B19CCCATCCANONE 
J080096G21CCCATCCANONE 
J080096M14CCCATCCANONE 
J080097M21CCCATCCANONE 
J080308I23CCCATCCANONE 
J080319A21CCCATCCANONE 
J090009G07CCCATCCANONE 
J090015E19CCCATCCANONE 
L22155CCCATCCANONE 
Os12g0287200009-067-B11CCCATCCANONE 
009-130-F06CCCATCCANONE 
009-185-H10CCCATCCANONE 
AF338343CCCATCCANONE 
AK063847CCCATCCASimilar to Mago nashi protein. 
AK121477CCCATCCANONE 
J023149H05CCCATCCANONE 
J065019G18CCCATCCANONE 
J065049J18CCCATCCANONE 
J065143C22CCCATCCANONE 
J075130D23CCCATCCANONE 
J090014I22CCCATCCANONE 
J090018A06CCCATCCANONE 
J090053H11CCCATCCANONE 
J090080N13CCCATCCANONE 
J100019H19CCCATCCANONE 
Os12g0480000AK061316CCCATCCAZinc finger, DHHC-type domain containing protein. 
Os12g0517100012-071-A03AGCCCATCCAGCCCAATTNONE 
AK073020AGCCCATCCAGCCCAATTCyclin-like F-box domain containing protein. 
J023149K21AGCCCATCCAGCCCAATTNONE 
Os12g0533500AK068646ACCGGCCCATCCACCCACTTGConserved hypothetical protein. 
J013158L10ACCGGCCCATCCACCCACTTGNONE 
J065083J02ACCGGCCCATCCACCCACTTGNONE 
J075079D02ACCGGCCCATCCACCCACTTGNONE 
J100037H16ACCGGCCCATCCACCCACTTGNONE 
J100075P13ACCGGCCCATCCACCCACTTGNONE 
Os12g0564400009-069-F12CCCATCCANONE 
AK059949CCCATCCASimilar to Thylakoid lumenal 21.5 kDa protein, chloroplast precursor. 
AK104548CCCATCCANONE 
Os12g0566300AK062236CCCATCCANONE 
AK071114CCCATCCASimilar to ATP citrate lyase beta (Fragment). 
Os12g0597500AK101904CCCACTCCTGGGCCCAGCCCATCCANONE 
AK103799CCCACTCCTGGGCCCAGCCCATCCAAmidase, hydantoinase/carbamoylase family protein. 
J065206A02CCCACTCCTGGGCCCAGCCCATCCANONE 
J100078O15CCCACTCCTGGGCCCAGCCCATCCANONE 
Os12g0602200AK119494TGGATGGGHypothetical protein. 
Os12g0613500009-028-C05CATCCACCCATCCACCNONE 
011-081-E10CATCCACCCATCCACCNONE 
AB118018CATCCACCCATCCACCNONE 
AK058205CATCCACCCATCCACCNONE 
AK101273CATCCACCCATCCACCLissencephaly type-1-like homology motif domain containing protein. 
J033033A11CATCCACCCATCCACCNONE 
Os12g0615300AK119448CCCATCCAEGF-like calcium-binding domain containing protein. 
Os12g0616200006-055-C11TGGATGGGGGGTNONE 
006-077-F07TGGATGGGGGGTNONE 
006-095-B06TGGATGGGGGGTNONE 
006-117-E04TGGATGGGGGGTNONE 
AK059735TGGATGGGGGGTHUELLENLOS-like protein. 
AK098937TGGATGGGGGGTNONE 
AK104805TGGATGGGGGGTNONE 
J013036H15TGGATGGGGGGTNONE 
J033052K05TGGATGGGGGGTNONE 
J033105K08TGGATGGGGGGTNONE 
J090075C15TGGATGGGGGGTNONE 
J100045O09TGGATGGGGGGTNONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.