version

Summary of OsREG535 (All List)

OrganismOryza sativa  
IDOsREG535  
SequenceCCCCACAC  
Annotation  
PPDB Motif 
PLACE Motif 
Total Entry Count1957  

Entry Sequences (1957 entries)

LocusGene modelSequenceDescription
Os01g0150000006-053-H07CCCGTGGGCCCCACACNONE 
006-081-C11CCCGTGGGCCCCACACNONE 
009-050-D04CCCGTGGGCCCCACACNONE 
AK060948CCCGTGGGCCCCACAC3-oxo-5-alpha-steroid 4-dehydrogenase, C-terminal domain containing protein. 
J023058M18CCCGTGGGCCCCACACNONE 
J023112H22CCCGTGGGCCCCACACNONE 
J065048P05CCCGTGGGCCCCACACNONE 
J100068N20CCCGTGGGCCCCACACNONE 
J100073A02CCCGTGGGCCCCACACNONE 
Os01g0185300011-055-A05CGTGTGGGGCCCACGTGNONE 
015-007-B11CGTGTGGGGCCCACGTGNONE 
015-062-F05CGTGTGGGGCCCACGTGNONE 
015-078-C11CGTGTGGGGCCCACGTGNONE 
016-068-F07CGTGTGGGGCCCACGTGNONE 
016-074-F08CGTGTGGGGCCCACGTGNONE 
AK065131CGTGTGGGGCCCACGTGTransferase family protein. 
AK098922CGTGTGGGGCCCACGTGNONE 
J013000G12CGTGTGGGGCCCACGTGNONE 
J013001P14CGTGTGGGGCCCACGTGNONE 
J013002O23CGTGTGGGGCCCACGTGNONE 
J013096L23CGTGTGGGGCCCACGTGNONE 
J013097F24CGTGTGGGGCCCACGTGNONE 
J013120N24CGTGTGGGGCCCACGTGNONE 
J023007C15CGTGTGGGGCCCACGTGNONE 
J023119O12CGTGTGGGGCCCACGTGNONE 
J033039O11CGTGTGGGGCCCACGTGNONE 
J033043L11CGTGTGGGGCCCACGTGNONE 
J033061A07CGTGTGGGGCCCACGTGNONE 
J033076M13CGTGTGGGGCCCACGTGNONE 
J033082B04CGTGTGGGGCCCACGTGNONE 
J033143H15CGTGTGGGGCCCACGTGNONE 
J043013A02CGTGTGGGGCCCACGTGNONE 
J043036N21CGTGTGGGGCCCACGTGNONE 
J065013M09CGTGTGGGGCCCACGTGNONE 
J065082E22CGTGTGGGGCCCACGTGNONE 
J065093G01CGTGTGGGGCCCACGTGNONE 
J065120L06CGTGTGGGGCCCACGTGNONE 
J065135D03CGTGTGGGGCCCACGTGNONE 
J065197C10CGTGTGGGGCCCACGTGNONE 
J100024J10CGTGTGGGGCCCACGTGNONE 
J100042M22CGTGTGGGGCCCACGTGNONE 
J100077E12CGTGTGGGGCCCACGTGNONE 
J100084P03CGTGTGGGGCCCACGTGNONE 
Os01g0200700003-117-A10GTGTGGGGGAGNONE 
009-011-D05GTGTGGGGGAGNONE 
009-016-D05GTGTGGGGGAGNONE 
009-043-F05GTGTGGGGGAGNONE 
009-088-B02GTGTGGGGGAGNONE 
009-105-E05GTGTGGGGGAGNONE 
009-118-D05GTGTGGGGGAGNONE 
009-118-D11GTGTGGGGGAGNONE 
009-121-E05GTGTGGGGGAGNONE 
009-121-G02GTGTGGGGGAGNONE 
009-124-B08GTGTGGGGGAGNONE 
009-126-E04GTGTGGGGGAGNONE 
009-127-F01GTGTGGGGGAGNONE 
009-129-H11GTGTGGGGGAGNONE 
009-150-C11GTGTGGGGGAGNONE 
009-151-G09GTGTGGGGGAGNONE 
009-156-H01GTGTGGGGGAGNONE 
009-163-D12GTGTGGGGGAGNONE 
009-166-E01GTGTGGGGGAGNONE 
009-185-D03GTGTGGGGGAGNONE 
009-190-E08GTGTGGGGGAGNONE 
009-191-H01GTGTGGGGGAGNONE 
009-192-A09GTGTGGGGGAGNONE 
009-194-G03GTGTGGGGGAGNONE 
009-196-G07GTGTGGGGGAGNONE 
013-005-G02GTGTGGGGGAGNONE 
016-091-B04GTGTGGGGGAGNONE 
AF001396GTGTGGGGGAGNONE 
AF147786GTGTGGGGGAGNONE 
AK058313GTGTGGGGGAGSimilar to Metallothionein-like protein type 3 (MT-3) (MWMT3). 
AK120350GTGTGGGGGAGNONE 
J013038E17GTGTGGGGGAGNONE 
J013040L18GTGTGGGGGAGNONE 
J013051P11GTGTGGGGGAGNONE 
J013065G09GTGTGGGGGAGNONE 
J013129O19GTGTGGGGGAGNONE 
J033046N24GTGTGGGGGAGNONE 
J043010D24GTGTGGGGGAGNONE 
J065045L19GTGTGGGGGAGNONE 
J065055A05GTGTGGGGGAGNONE 
J065055A06GTGTGGGGGAGNONE 
J065068J11GTGTGGGGGAGNONE 
J065073P09GTGTGGGGGAGNONE 
J065077G01GTGTGGGGGAGNONE 
J065093O19GTGTGGGGGAGNONE 
J065094I04GTGTGGGGGAGNONE 
J065109M22GTGTGGGGGAGNONE 
J065114M11GTGTGGGGGAGNONE 
J065116H03GTGTGGGGGAGNONE 
J065128A19GTGTGGGGGAGNONE 
J065130C24GTGTGGGGGAGNONE 
J065142E10GTGTGGGGGAGNONE 
J065148K01GTGTGGGGGAGNONE 
J065159C20GTGTGGGGGAGNONE 
J065167L04GTGTGGGGGAGNONE 
J065183G24GTGTGGGGGAGNONE 
J075007A16GTGTGGGGGAGNONE 
J075007B16GTGTGGGGGAGNONE 
J075013N19GTGTGGGGGAGNONE 
J075015H14GTGTGGGGGAGNONE 
J075022I03GTGTGGGGGAGNONE 
J075030K16GTGTGGGGGAGNONE 
J075032L15GTGTGGGGGAGNONE 
J075038I11GTGTGGGGGAGNONE 
J075043D06GTGTGGGGGAGNONE 
J075043J09GTGTGGGGGAGNONE 
J075048M09GTGTGGGGGAGNONE 
J075049D16GTGTGGGGGAGNONE 
J075050F09GTGTGGGGGAGNONE 
J075052G16GTGTGGGGGAGNONE 
J075060E12GTGTGGGGGAGNONE 
J075064P13GTGTGGGGGAGNONE 
J075082N08GTGTGGGGGAGNONE 
J075082N18GTGTGGGGGAGNONE 
J075085D09GTGTGGGGGAGNONE 
J075085F18GTGTGGGGGAGNONE 
J075090L09GTGTGGGGGAGNONE 
J075097I03GTGTGGGGGAGNONE 
J075098N03GTGTGGGGGAGNONE 
J075100L09GTGTGGGGGAGNONE 
J075115B10GTGTGGGGGAGNONE 
J075127N20GTGTGGGGGAGNONE 
J075131J17GTGTGGGGGAGNONE 
J075137K04GTGTGGGGGAGNONE 
J075143E17GTGTGGGGGAGNONE 
J075146O06GTGTGGGGGAGNONE 
J075151D18GTGTGGGGGAGNONE 
J075154H23GTGTGGGGGAGNONE 
J075156B14GTGTGGGGGAGNONE 
J075156H24GTGTGGGGGAGNONE 
J075161A06GTGTGGGGGAGNONE 
J075162N01GTGTGGGGGAGNONE 
J075166K17GTGTGGGGGAGNONE 
J075172C05GTGTGGGGGAGNONE 
J075176I03GTGTGGGGGAGNONE 
J075180J22GTGTGGGGGAGNONE 
J075181F09GTGTGGGGGAGNONE 
J075183D18GTGTGGGGGAGNONE 
J075188I23GTGTGGGGGAGNONE 
J075188L16GTGTGGGGGAGNONE 
J075194G19GTGTGGGGGAGNONE 
J080001A16GTGTGGGGGAGNONE 
J080001A18GTGTGGGGGAGNONE 
J080002G19GTGTGGGGGAGNONE 
J080002M08GTGTGGGGGAGNONE 
J080003I02GTGTGGGGGAGNONE 
J080003K02GTGTGGGGGAGNONE 
J080005I12GTGTGGGGGAGNONE 
J080007H03GTGTGGGGGAGNONE 
J080008B16GTGTGGGGGAGNONE 
J080008N06GTGTGGGGGAGNONE 
J080010B17GTGTGGGGGAGNONE 
J080010F06GTGTGGGGGAGNONE 
J080010J04GTGTGGGGGAGNONE 
J080012G03GTGTGGGGGAGNONE 
J080016E16GTGTGGGGGAGNONE 
J080018H07GTGTGGGGGAGNONE 
J080018H11GTGTGGGGGAGNONE 
J080018M11GTGTGGGGGAGNONE 
J080020L10GTGTGGGGGAGNONE 
J080021F13GTGTGGGGGAGNONE 
J080021J04GTGTGGGGGAGNONE 
J080021J08GTGTGGGGGAGNONE 
J080022H19GTGTGGGGGAGNONE 
J080023C04GTGTGGGGGAGNONE 
J080023E15GTGTGGGGGAGNONE 
J080030L17GTGTGGGGGAGNONE 
J080032A12GTGTGGGGGAGNONE 
J080033A01GTGTGGGGGAGNONE 
J080033A05GTGTGGGGGAGNONE 
J080034D11GTGTGGGGGAGNONE 
J080035A09GTGTGGGGGAGNONE 
J080035O06GTGTGGGGGAGNONE 
J080040G01GTGTGGGGGAGNONE 
J080041C01GTGTGGGGGAGNONE 
J080045F24GTGTGGGGGAGNONE 
J080045J19GTGTGGGGGAGNONE 
J080045P12GTGTGGGGGAGNONE 
J080046B01GTGTGGGGGAGNONE 
J080046F01GTGTGGGGGAGNONE 
J080046F11GTGTGGGGGAGNONE 
J080047D04GTGTGGGGGAGNONE 
J080047J20GTGTGGGGGAGNONE 
J080047M23GTGTGGGGGAGNONE 
J080048D03GTGTGGGGGAGNONE 
J080050H21GTGTGGGGGAGNONE 
J080051B10GTGTGGGGGAGNONE 
J080053I23GTGTGGGGGAGNONE 
J080061A01GTGTGGGGGAGNONE 
J080064C12GTGTGGGGGAGNONE 
J080065D08GTGTGGGGGAGNONE 
J080066K10GTGTGGGGGAGNONE 
J080067C07GTGTGGGGGAGNONE 
J080068A05GTGTGGGGGAGNONE 
J080068H19GTGTGGGGGAGNONE 
J080068I09GTGTGGGGGAGNONE 
J080071H22GTGTGGGGGAGNONE 
J080072H09GTGTGGGGGAGNONE 
J080074K10GTGTGGGGGAGNONE 
J080075C10GTGTGGGGGAGNONE 
J080075H03GTGTGGGGGAGNONE 
J080079B17GTGTGGGGGAGNONE 
J080079C09GTGTGGGGGAGNONE 
J080079H01GTGTGGGGGAGNONE 
J080080A04GTGTGGGGGAGNONE 
J080080G12GTGTGGGGGAGNONE 
J080082K17GTGTGGGGGAGNONE 
J080085G21GTGTGGGGGAGNONE 
J080085J03GTGTGGGGGAGNONE 
J080086A13GTGTGGGGGAGNONE 
J080087A17GTGTGGGGGAGNONE 
J080088B04GTGTGGGGGAGNONE 
J080091F11GTGTGGGGGAGNONE 
J080092N10GTGTGGGGGAGNONE 
J080092P03GTGTGGGGGAGNONE 
J080094K23GTGTGGGGGAGNONE 
J080095C08GTGTGGGGGAGNONE 
J080096P06GTGTGGGGGAGNONE 
J080301I12GTGTGGGGGAGNONE 
J080301N10GTGTGGGGGAGNONE 
J080302L04GTGTGGGGGAGNONE 
J080303L16GTGTGGGGGAGNONE 
J080304C12GTGTGGGGGAGNONE 
J080304J22GTGTGGGGGAGNONE 
J080304K14GTGTGGGGGAGNONE 
J080305N24GTGTGGGGGAGNONE 
J080307F05GTGTGGGGGAGNONE 
J080308J07GTGTGGGGGAGNONE 
J080308O10GTGTGGGGGAGNONE 
J080312I15GTGTGGGGGAGNONE 
J080312O05GTGTGGGGGAGNONE 
J080313N01GTGTGGGGGAGNONE 
J080313N10GTGTGGGGGAGNONE 
J080315B12GTGTGGGGGAGNONE 
J080317D12GTGTGGGGGAGNONE 
J080318M08GTGTGGGGGAGNONE 
J090012C09GTGTGGGGGAGNONE 
J090023G22GTGTGGGGGAGNONE 
J100035A22GTGTGGGGGAGNONE 
J100037K23GTGTGGGGGAGNONE 
J100079J19GTGTGGGGGAGNONE 
Os01g0254900AK068204CGTGTGGGGCCCGGASimilar to Syntaxin 22 (AtSYP22) (AtVAM3). 
AY789530CGTGTGGGGCCCGGANONE 
Os01g0272600015-046-G06CTCGGCCCCACACNONE 
AK067786CTCGGCCCCACACConserved hypothetical protein. 
Os01g0295700AK070333CCCCACACSimilar to Protein phosphatase-2C. 
AK070333CCCCACACGSimilar to Protein phosphatase-2C. 
Os01g0303300J053035N19GCCCCCACACACGTGGCNONE 
J075042F02GCCCCCACACACGTGGCNONE 
J075068E10GCCCCCACACACGTGGCNONE 
J075116E19GCCCCCACACACGTGGCNONE 
J075131C10GCCCCCACACACGTGGCNONE 
J075145J11GCCCCCACACACGTGGCNONE 
J075157P20GCCCCCACACACGTGGCMitochondrial import inner membrane translocase, subunit Tim17/22 family protein. 
J075164G12GCCCCCACACACGTGGCNONE 
Os01g0331900013-026-D04GTGTGGGGCCCACGTGGGTCCCANONE 
AK064784GTGTGGGGCCCACGTGGGTCCCANONE 
AK121761GTGTGGGGCCCACGTGGGTCCCAProtein of unknown function DUF846, eukaryotic family protein. 
J013000B15GTGTGGGGCCCACGTGGGTCCCANONE 
J033090D07GTGTGGGGCCCACGTGGGTCCCANONE 
J090006L21GTGTGGGGCCCACGTGGGTCCCANONE 
Os01g0342800J065046B02GCCCCCACACNONE 
J065059I08GCCCCCACACNONE 
J065074A14GCCCCCACACNONE 
J065147C02GCCCCCACACNONE 
J065176F09GCCCCCACACNONE 
J065199J12GCCCCCACACConserved hypothetical protein. 
Os01g0343100J065039P06CCCCACACGProtein of unknown function DUF594 family protein. 
Os01g0369700009-013-D06ATCCCCCACACNONE 
009-046-G07ATCCCCCACACNONE 
AF309382ATCCCCCACACNONE 
AK063796ATCCCCCACACSimilar to Glutathione S-transferase GST 8 (EC 2.5.1.18). 
AK101436ATCCCCCACACNONE 
AK120046ATCCCCCACACNONE 
J033039A11ATCCCCCACACNONE 
J033124G11ATCCCCCACACNONE 
J065005L17ATCCCCCACACNONE 
J065007P13ATCCCCCACACNONE 
J065027O07ATCCCCCACACNONE 
J065035K05ATCCCCCACACNONE 
J065063K13ATCCCCCACACNONE 
J065097E04ATCCCCCACACNONE 
J065153H06ATCCCCCACACNONE 
J065170G15ATCCCCCACACNONE 
J065189H21ATCCCCCACACNONE 
J065194B21ATCCCCCACACNONE 
J065212M19ATCCCCCACACNONE 
J100043I21ATCCCCCACACNONE 
J100044M16ATCCCCCACACNONE 
J100071K22ATCCCCCACACNONE 
J100083O14ATCCCCCACACNONE 
J100090K11ATCCCCCACACNONE 
Os01g0541900AK069784GGGTGGGCCCCACACGProtein kinase-like domain containing protein. 
J013033M01GGGTGGGCCCCACACGNONE 
J013159H24GGGTGGGCCCCACACGNONE 
J023008E13GGGTGGGCCCCACACGNONE 
J023030I11GGGTGGGCCCCACACGNONE 
J065137G08GGGTGGGCCCCACACGNONE 
J065139H16GGGTGGGCCCCACACGNONE 
J065154K13GGGTGGGCCCCACACGNONE 
J075176C02GGGTGGGCCCCACACGNONE 
Os01g0543100014-039-E10GCCCCACACNONE 
AK105363GCCCCACACSimilar to Peroxidase 72 precursor (EC 1.11.1.7) (Atperox P72) (PRXR8) (ATP6a). 
Os01g0571000AK066090CCCCACACMitochondrial substrate carrier family protein. 
AK121334CCCCACACNONE 
Os01g0577600Os01g0577600CCCCACACProtein kinase-like domain containing protein. 
Os01g0607300AK109289CTCCCCCACACGConserved hypothetical protein. 
Os01g0681900AB008845GTGTGGGGACGCGACGCGNADH dependent Glutamate Synthase precursor (EC 1.4.1.14). 
AK105755GTGTGGGGACGCGACGCGNONE 
Os01g0764000006-021-G03GGCCCCACACNONE 
006-025-C07GGCCCCACACNONE 
006-029-G11GGCCCCACACNONE 
006-030-C04GGCCCCACACNONE 
006-035-E05GGCCCCACACNONE 
006-037-G01GGCCCCACACNONE 
006-038-C01GGCCCCACACNONE 
006-039-G05GGCCCCACACNONE 
006-042-E11GGCCCCACACNONE 
006-044-H04GGCCCCACACNONE 
006-045-A10GGCCCCACACNONE 
006-045-C05GGCCCCACACNONE 
006-047-A11GGCCCCACACNONE 
006-048-H10GGCCCCACACNONE 
006-050-C01GGCCCCACACNONE 
006-050-H11GGCCCCACACNONE 
006-051-G10GGCCCCACACNONE 
006-051-G11GGCCCCACACNONE 
006-056-B04GGCCCCACACNONE 
006-063-F04GGCCCCACACNONE 
006-063-H12GGCCCCACACNONE 
006-065-G09GGCCCCACACNONE 
006-067-F11GGCCCCACACNONE 
006-073-D10GGCCCCACACNONE 
006-074-G09GGCCCCACACNONE 
006-075-D04GGCCCCACACNONE 
006-077-C10GGCCCCACACNONE 
006-082-A10GGCCCCACACNONE 
006-084-C12GGCCCCACACNONE 
006-085-F05GGCCCCACACNONE 
006-087-H12GGCCCCACACNONE 
006-092-E10GGCCCCACACNONE 
006-094-C06GGCCCCACACNONE 
006-096-G11GGCCCCACACNONE 
006-097-H11GGCCCCACACNONE 
006-101-A07GGCCCCACACNONE 
006-101-G08GGCCCCACACNONE 
006-110-E08GGCCCCACACNONE 
006-111-D04GGCCCCACACNONE 
006-116-H04GGCCCCACACNONE 
AK058894GGCCCCACACNONE 
AK059818GGCCCCACACSimilar to Glutathione S-transferase I (EC 2.5.1.18) (GST-I) (GST-29) (GST class- phi). 
AK099142GGCCCCACACNONE 
J013119N15GGCCCCACACNONE 
J013123P15GGCCCCACACNONE 
J023055F24GGCCCCACACNONE 
J023125K17GGCCCCACACNONE 
J053050A20GGCCCCACACNONE 
J053056P10GGCCCCACACNONE 
J053074D19GGCCCCACACNONE 
J053078A14GGCCCCACACNONE 
J053086P10GGCCCCACACNONE 
J053094N23GGCCCCACACNONE 
J053095M23GGCCCCACACNONE 
J065006D02GGCCCCACACNONE 
J065030A17GGCCCCACACNONE 
J065030K04GGCCCCACACNONE 
J065035L12GGCCCCACACNONE 
J065046E12GGCCCCACACNONE 
J065065H19GGCCCCACACNONE 
J065073C01GGCCCCACACNONE 
J065105F01GGCCCCACACNONE 
J065131N16GGCCCCACACNONE 
J065144O13GGCCCCACACNONE 
J065160E12GGCCCCACACNONE 
J065160K02GGCCCCACACNONE 
J065163F09GGCCCCACACNONE 
J065165E18GGCCCCACACNONE 
J065174E04GGCCCCACACNONE 
J065175O08GGCCCCACACNONE 
J065191N24GGCCCCACACNONE 
J065193D19GGCCCCACACNONE 
J065198D04GGCCCCACACNONE 
J065200G09GGCCCCACACNONE 
J075016L06GGCCCCACACNONE 
J075017J11GGCCCCACACNONE 
J075019L08GGCCCCACACNONE 
J075028M08GGCCCCACACNONE 
J075029K05GGCCCCACACNONE 
J075039K04GGCCCCACACNONE 
J075047J22GGCCCCACACNONE 
J075079H13GGCCCCACACNONE 
J075095K14GGCCCCACACNONE 
J075111D21GGCCCCACACNONE 
J075131A19GGCCCCACACNONE 
J075147G20GGCCCCACACNONE 
J075158F11GGCCCCACACNONE 
J075166N10GGCCCCACACNONE 
J075196G09GGCCCCACACNONE 
J075198I24GGCCCCACACNONE 
J090001L08GGCCCCACACNONE 
J090026G07GGCCCCACACNONE 
J090050M15GGCCCCACACNONE 
J090071A01GGCCCCACACNONE 
J090072P16GGCCCCACACNONE 
J090078D22GGCCCCACACNONE 
J090089C18GGCCCCACACNONE 
J100019B07GGCCCCACACNONE 
J100019H15GGCCCCACACNONE 
J100019P09GGCCCCACACNONE 
J100023A16GGCCCCACACNONE 
J100023B09GGCCCCACACNONE 
J100026O18GGCCCCACACNONE 
J100027E09GGCCCCACACNONE 
J100028F22GGCCCCACACNONE 
J100029P05GGCCCCACACNONE 
J100031M19GGCCCCACACNONE 
J100032A11GGCCCCACACNONE 
J100036G19GGCCCCACACNONE 
J100038E22GGCCCCACACNONE 
J100040A12GGCCCCACACNONE 
J100040L02GGCCCCACACNONE 
J100043O13GGCCCCACACNONE 
J100045E20GGCCCCACACNONE 
J100046H18GGCCCCACACNONE 
J100047E08GGCCCCACACNONE 
J100050E08GGCCCCACACNONE 
J100050P14GGCCCCACACNONE 
J100051G10GGCCCCACACNONE 
J100052L12GGCCCCACACNONE 
J100056G24GGCCCCACACNONE 
J100066B15GGCCCCACACNONE 
J100068O15GGCCCCACACNONE 
J100070J16GGCCCCACACNONE 
J100074I22GGCCCCACACNONE 
J100075M12GGCCCCACACNONE 
J100077M09GGCCCCACACNONE 
J100077O14GGCCCCACACNONE 
J100079J08GGCCCCACACNONE 
J100080I16GGCCCCACACNONE 
Os01g0767900AK067198CCCCACACSimilar to Ankyrin repeat BTB/POZ domain-containing protein. 
Os01g0776700J065046N20CATCCCCCGGCCCCACACGConserved hypothetical protein. 
J100086L02CATCCCCCGGCCCCACACGNONE 
Os01g0864000AK106759ACCCCCCACACConserved hypothetical protein. 
J065124C16ACCCCCCACACNONE 
J065136J17ACCCCCCACACNONE 
J065171D20ACCCCCCACACNONE 
Os01g0867300AK067919GCCCCCACACSimilar to OSE2-like protein (Fragment). 
J013123H12GCCCCCACACNONE 
J033046C11GCCCCCACACNONE 
J033051I17GCCCCCACACNONE 
U25283GCCCCCACACNONE 
Os01g0924900AK067886CCCCACACGGTP-binding signal recognition particle SRP54, G-domain containing protein. 
Os01g0934000AK060679CCCCACACCCGCGCNONE 
AK072525CCCCACACCCGCGCWD40-like domain containing protein. 
J065097G12CCCCACACCCGCGCNONE 
Os01g0961200011-099-H06GGCCCCACACNONE 
AK105424GGCCCCACACCBS domain containing protein. 
J065169J18GGCCCCACACNONE 
J075109H12GGCCCCACACNONE 
Os01g0973500AK069546CCCCACACCGCACSimilar to Protein kinase APK1A, chloroplast precursor (EC 2.7.1.-). 
Os02g0192300Os02g0192300GCCCCACACZinc finger, FYVE/PHD-type domain containing protein. 
Os02g0196800AK070521GTGTGGGGGCSimilar to Fumarylacetoacetase (Fragment). 
AK105018GTGTGGGGGCNONE 
J080301A13GTGTGGGGGCNONE 
J080307M08GTGTGGGGGCNONE 
Os02g0202400AK107368GTGTGGGGGGCTTTTSimilar to Plastidial ADP-glucose transporter. 
J075147G14GTGTGGGGGGCTTTTNONE 
J090009K03GTGTGGGGGGCTTTTNONE 
Os02g0208900003-126-D10TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
AK066171TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
AK070031TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
AK121183TGTGGGCCCCACACACCCCAGGCCCCACCAACSimilar to ZIGA2 protein (Fragment). 
J013031N09TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
J013045O19TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
J023102A14TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
J023145E14TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
J033033E15TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
J033041H19TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
J033050E09TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
J065191H21TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
J065193C21TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
J075068F07TGTGGGCCCCACACACCCCAGGCCCCACCAACNONE 
Os02g0219900004-018-E11CCGTGGGCCCCACCCCCCACACNONE 
AK060915CCGTGGGCCCCACCCCCCACACNONE 
AK099194CCGTGGGCCCCACCCCCCACACNONE 
AK104206CCGTGGGCCCCACCCCCCACACNONE 
AK104393CCGTGGGCCCCACCCCCCACACSimilar to Epstein-Barr nuclear antigen-1 (EBNA-1). 
J023109D07CCGTGGGCCCCACCCCCCACACNONE 
Os02g0282600AK070262GTGTGGGGCCCACAConserved hypothetical protein. 
J023041L18GTGTGGGGCCCACANONE 
Os02g0316200AK073932GTGTGGGGGCCCGCACyclin-like F-box domain containing protein. 
AK105757GTGTGGGGGCCCGCANONE 
J023039G03GTGTGGGGGCCCGCANONE 
J033076K03GTGTGGGGGCCCGCANONE 
J075157J22GTGTGGGGGCCCGCANONE 
J090097K02GTGTGGGGGCCCGCANONE 
J100053F10GTGTGGGGGCCCGCANONE 
Os02g0438700012-040-C07GCGGGCCCCACACNONE 
AK062610GCGGGCCCCACACNONE 
AK105276GCGGGCCCCACACConserved hypothetical protein. 
J065104J01GCGGGCCCCACACNONE 
Os02g0510100AK058487CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
AK058487GTGTGGGGNONE 
AK122107CGTGTGGGGCCACGTCACAGTGGGCCCCASimilar to U6 snRNA-associated Sm-like protein LSm6 (Sm protein F). 
AK122107GTGTGGGGSimilar to U6 snRNA-associated Sm-like protein LSm6 (Sm protein F). 
J033126F06CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J033126F06GTGTGGGGNONE 
J053077L04CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J053077L04GTGTGGGGNONE 
J065010C11CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J065010C11GTGTGGGGNONE 
J075104O14CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J075104O14GTGTGGGGNONE 
J080003G03CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080003G03GTGTGGGGNONE 
J080014K05CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080014K05GTGTGGGGNONE 
J080026F03CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080026F03GTGTGGGGNONE 
J080027O05CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080027O05GTGTGGGGNONE 
J080037K15CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080037K15GTGTGGGGNONE 
J080039D24CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080039D24GTGTGGGGNONE 
J080043G19CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080043G19GTGTGGGGNONE 
J080047P05CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080047P05GTGTGGGGNONE 
J080048D22CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080048D22GTGTGGGGNONE 
J080049F23CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080049F23GTGTGGGGNONE 
J080062A21CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080062A21GTGTGGGGNONE 
J080063H20CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080063H20GTGTGGGGNONE 
J080067P15CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080067P15GTGTGGGGNONE 
J080068P19CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080068P19GTGTGGGGNONE 
J080079J15CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080079J15GTGTGGGGNONE 
J080092K19CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080092K19GTGTGGGGNONE 
J080096M04CGTGTGGGGCCACGTCACAGTGGGCCCCANONE 
J080096M04GTGTGGGGNONE 
Os02g0580400AK103053CCCCACACDynein light chain, type 1 family protein. 
Os02g0595800Os02g0595800CCCCACACSimilar to Eukaryotic initiation factor 4B (Fragment). 
Os02g0596900AK101163CCCCACACActin/actin-like family protein. 
Os02g0601800AB060276GGCCCCACACGNONE 
AK099539GGCCCCACACGNONE 
AK101873GGCCCCACACGBromodomain containing protein. 
AK106801GGCCCCACACGNONE 
AK121758GGCCCCACACGNONE 
AK121891GGCCCCACACGNONE 
J013059H01GGCCCCACACGNONE 
J013092F08GGCCCCACACGNONE 
J013146J04GGCCCCACACGNONE 
J023001K12GGCCCCACACGNONE 
J023002H16GGCCCCACACGNONE 
J023013B10GGCCCCACACGNONE 
J023081I22GGCCCCACACGNONE 
J023084K19GGCCCCACACGNONE 
J023150E24GGCCCCACACGNONE 
J033023B18GGCCCCACACGNONE 
J033025F18GGCCCCACACGNONE 
J033048P08GGCCCCACACGNONE 
J033060M24GGCCCCACACGNONE 
J033070G06GGCCCCACACGNONE 
J033088P12GGCCCCACACGNONE 
J033105C13GGCCCCACACGNONE 
J043009N18GGCCCCACACGNONE 
J065103G21GGCCCCACACGNONE 
J075039H15GGCCCCACACGNONE 
J090014K10GGCCCCACACGNONE 
J090022N02GGCCCCACACGNONE 
J090033F18GGCCCCACACGNONE 
J090033I04GGCCCCACACGNONE 
J090041F11GGCCCCACACGNONE 
J090045P20GGCCCCACACGNONE 
J090054B01GGCCCCACACGNONE 
J090055M12GGCCCCACACGNONE 
J090071K09GGCCCCACACGNONE 
J090098O16GGCCCCACACGNONE 
J090099P15GGCCCCACACGNONE 
J100050I16GGCCCCACACGNONE 
Os02g0603800AK105762CCCCACACGNONE 
AK120769CCCCACACGSimilar to Isoprenoid biosynthesis-like protein (Fragment). 
Os02g0605600016-017-B02GGTGTGTGGGGNONE 
AK066104GGTGTGTGGGGLUC7 related family protein. 
J013052G16GGTGTGTGGGGNONE 
J043022E03GGTGTGTGGGGNONE 
J065105P10GGTGTGTGGGGNONE 
Os02g0608500AK071922CCCCACACNONE 
AK099756CCCCACACSimilar to Ankyrin-kinase protein (Fragment). 
Os02g0626100003-107-B06CCCCACACNONE 
AK120127CCCCACACNONE 
Os02g0630300AK108598CACACACCCCCACACNONE 
Os02g0640000AK120841CGTGTGGGGC2 calcium/lipid-binding region, CaLB domain containing protein. 
J023022G19CGTGTGGGGNONE 
J023081F22CGTGTGGGGNONE 
Os02g0649300014-043-A05GTGTGGGGGCNONE 
AK063685GTGTGGGGGCSimilar to Short highly repeated, interspersed DNA (Fragment). 
Os02g0671200J065152N20CCCCACACGNONE 
J075053E22CCCCACACGConserved hypothetical protein. 
Os02g0744700AF395537GACACGTGGGCCCCACACNONE 
AJ308110GACACGTGGGCCCCACACNONE 
AK066446GACACGTGGGCCCCACACSimilar to Starch synthase isoform zSTSII-2 (EC 2.4.1.21). 
Os02g0766700AK072062ATCCCCCACACCACTGACASimilar to Abscisic acid responsive elements-binding factor (ABA-responsive element binding protein 2) (AREB2). 
J100073F09ATCCCCCACACCACTGACANONE 
Os02g0767500005-017-F10AACGGGCCCCACACGNONE 
AB016065AACGGGCCCCACACGNONE 
AK069611AACGGGCCCCACACGMitochondrial phosphate transporter. 
J013020K11AACGGGCCCCACACGNONE 
J013066I18AACGGGCCCCACACGNONE 
J023012D02AACGGGCCCCACACGNONE 
J023020J16AACGGGCCCCACACGNONE 
J023022H13AACGGGCCCCACACGNONE 
J023044N15AACGGGCCCCACACGNONE 
J023067E15AACGGGCCCCACACGNONE 
J023079C06AACGGGCCCCACACGNONE 
J023080B07AACGGGCCCCACACGNONE 
J023081G11AACGGGCCCCACACGNONE 
J023091H22AACGGGCCCCACACGNONE 
J023092J03AACGGGCCCCACACGNONE 
J023114D02AACGGGCCCCACACGNONE 
J023121J15AACGGGCCCCACACGNONE 
J023128G10AACGGGCCCCACACGNONE 
J023132B15AACGGGCCCCACACGNONE 
J023140G10AACGGGCCCCACACGNONE 
J023142B10AACGGGCCCCACACGNONE 
J033026C15AACGGGCCCCACACGNONE 
J033029F21AACGGGCCCCACACGNONE 
J033037I09AACGGGCCCCACACGNONE 
J033046D11AACGGGCCCCACACGNONE 
J033081L20AACGGGCCCCACACGNONE 
J033097J19AACGGGCCCCACACGNONE 
J033125D19AACGGGCCCCACACGNONE 
J033125I04AACGGGCCCCACACGNONE 
J033141M21AACGGGCCCCACACGNONE 
J033143K08AACGGGCCCCACACGNONE 
J053091N01AACGGGCCCCACACGNONE 
J065093C20AACGGGCCCCACACGNONE 
J065104K11AACGGGCCCCACACGNONE 
J065143L16AACGGGCCCCACACGNONE 
J065205I23AACGGGCCCCACACGNONE 
J090057C12AACGGGCCCCACACGNONE 
J090075P11AACGGGCCCCACACGNONE 
Os02g0773800006-058-D05CCCCACACNONE 
J033117N07CCCCACACNONE 
J065083B19CCCCACACNONE 
Os02g0777800AK066978ACCCCCCACACGCCTCSimilar to Avr9/Cf-9 induced kinase 1. 
Os02g0781700006-066-G01GTGTGGGGCCNONE 
009-034-D03GTGTGGGGCCNONE 
009-194-D04GTGTGGGGCCNONE 
AK061791GTGTGGGGCCConserved hypothetical protein. 
AK063223GTGTGGGGCCNONE 
AY224477GTGTGGGGCCNONE 
J013045H09GTGTGGGGCCNONE 
J013061I22GTGTGGGGCCNONE 
J013071F11GTGTGGGGCCNONE 
J023130H07GTGTGGGGCCNONE 
J043036K23GTGTGGGGCCNONE 
J065010N07GTGTGGGGCCNONE 
J065219I01GTGTGGGGCCNONE 
J090073I15GTGTGGGGCCNONE 
Os02g0793900AK102581CCCCACACConserved hypothetical protein. 
J065140P17CCCCACACNONE 
J075096H16CCCCACACNONE 
J075158G22CCCCACACNONE 
J075174L22CCCCACACNONE 
J075177J02CCCCACACNONE 
Os02g0804900J065051L05CGTGTGGGGCCNONE 
J065069D19CGTGTGGGGCCNONE 
J065073L01CGTGTGGGGCCNONE 
J065147K04CGTGTGGGGCCNONE 
J065166D17CGTGTGGGGCCNONE 
Os02g0805900AK073740GCCCCCACACDcp2, box A domain containing protein. 
J013068E03GCCCCCACACNONE 
J033066K03GCCCCCACACNONE 
J033092C14GCCCCCACACNONE 
J065020G11GCCCCCACACNONE 
J065098E16GCCCCCACACNONE 
J065124L06GCCCCCACACNONE 
J065134M23GCCCCCACACNONE 
J065187M23GCCCCCACACNONE 
J065208G07GCCCCCACACNONE 
J075002G10GCCCCCACACNONE 
J075004L01GCCCCCACACNONE 
J075051K23GCCCCCACACNONE 
J090063C03GCCCCCACACNONE 
J090071J21GCCCCCACACNONE 
J100078K12GCCCCCACACNONE 
Os02g0806000AK072745GTGTGGGGGCGCN5-related N-acetyltransferase domain containing protein. 
J013130C06GTGTGGGGGCNONE 
J013154L12GTGTGGGGGCNONE 
J023135J07GTGTGGGGGCNONE 
J065038E23GTGTGGGGGCNONE 
J065042C10GTGTGGGGGCNONE 
J090075B11GTGTGGGGGCNONE 
J100033J17GTGTGGGGGCNONE 
Os02g0817500AK072707CCCCACACKCNAB voltage-gated K+ channel, beta subunit family protein. 
AK104135CCCCACACNONE 
U46758CCCCACACNONE 
Os02g0820600AK066549GTGTGGGGCConserved hypothetical protein. 
J013070F02GTGTGGGGCNONE 
Os03g0126800J075039C05CCCCACACNONE 
J075172P07CCCCACACNONE 
J075176L13CCCCACACNONE 
J075180L10CCCCACACNONE 
J090019H18CCCCACACNONE 
J090024P22CCCCACACNONE 
Os03g0130100AK110783CCCCACACSimilar to Acyl-activating enzyme 11. 
J065172I17CCCCACACNONE 
Os03g0132200003-010-G06CGTGTGGGGNONE 
012-006-B11CGTGTGGGGNONE 
AK061453CGTGTGGGGNONE 
AK067081CGTGTGGGGNONE 
AK099870CGTGTGGGGExpansin-like protein A. 
AY100693CGTGTGGGGNONE 
J013094I23CGTGTGGGGNONE 
J023105E16CGTGTGGGGNONE 
J065002A13CGTGTGGGGNONE 
J065152P15CGTGTGGGGNONE 
J065161P09CGTGTGGGGNONE 
J065185B14CGTGTGGGGNONE 
J075058K03CGTGTGGGGNONE 
J075175A03CGTGTGGGGNONE 
J075178B06CGTGTGGGGNONE 
J090078H10CGTGTGGGGNONE 
J100029B14CGTGTGGGGNONE 
J100039A19CGTGTGGGGNONE 
J100053K07CGTGTGGGGNONE 
J100082F12CGTGTGGGGNONE 
Os03g0156500011-075-F02CGCGGGGGGGTGGGCCCCACACNONE 
012-077-G10CGCGGGGGGGTGGGCCCCACACNONE 
AK103466CGCGGGGGGGTGGGCCCCACACLupus La protein family protein. 
J013088H17CGCGGGGGGGTGGGCCCCACACNONE 
J013135G21CGCGGGGGGGTGGGCCCCACACNONE 
J033050E10CGCGGGGGGGTGGGCCCCACACNONE 
J033050J01CGCGGGGGGGTGGGCCCCACACNONE 
J033129N23CGCGGGGGGGTGGGCCCCACACNONE 
J065085L16CGCGGGGGGGTGGGCCCCACACNONE 
J065101B19CGCGGGGGGGTGGGCCCCACACNONE 
J065167N03CGCGGGGGGGTGGGCCCCACACNONE 
J090009O21CGCGGGGGGGTGGGCCCCACACNONE 
J090049D11CGCGGGGGGGTGGGCCCCACACNONE 
J100017F23CGCGGGGGGGTGGGCCCCACACNONE 
J100040E12CGCGGGGGGGTGGGCCCCACACNONE 
J100055O18CGCGGGGGGGTGGGCCCCACACNONE 
J100061K08CGCGGGGGGGTGGGCCCCACACNONE 
J100072M05CGCGGGGGGGTGGGCCCCACACNONE 
J100077B08CGCGGGGGGGTGGGCCCCACACNONE 
J100086G03CGCGGGGGGGTGGGCCCCACACNONE 
Os03g0157800AK067375GCCCCCACAC3'-5' exonuclease domain containing protein. 
AK070248GCCCCCACACNONE 
Os03g0163100AK065571CTCCCCCACACProtein of unknown function DUF1012 family protein. 
Os03g0167000AK107307GCCCCCACACCCCCCAConserved hypothetical protein. 
J100070K07GCCCCCACACCCCCCANONE 
Os03g0194600009-115-B11CCCCACACGCGCGGGTNONE 
AK062839CCCCACACGCGCGGGTDOMON related domain containing protein. 
Os03g0222600J065048C01GTGTGGGGGCNONE 
J065117L06GTGTGGGGGCNONE 
J065183E14GTGTGGGGGCNONE 
J075074N18GTGTGGGGGCNONE 
J075197B12GTGTGGGGGCNONE 
J090049N05GTGTGGGGGCNONE 
J100029D23GTGTGGGGGCNONE 
J100068E06GTGTGGGGGCNONE 
Os03g0244200003-114-A11CGTGTGGGGNONE 
015-089-B03CGTGTGGGGNONE 
016-048-G01CGTGTGGGGNONE 
AK101837CGTGTGGGGSimilar to Thaumatin-like protein. 
AK105771CGTGTGGGGNONE 
AK107182CGTGTGGGGNONE 
J065054I12CGTGTGGGGNONE 
J065208F20CGTGTGGGGNONE 
J075088F18CGTGTGGGGNONE 
J075092G13CGTGTGGGGNONE 
J075120G01CGTGTGGGGNONE 
J075147M20CGTGTGGGGNONE 
J075151J03CGTGTGGGGNONE 
J100064H21CGTGTGGGGNONE 
Os03g0261800AK060717GGTGTGTGTGTGGGGGGTNONE 
Os03g0294200AK069285CGTGTGGGGCCCSimilar to Fructose-6-phosphate-2-kinase/fructose-2, 6-bisphosphatase. 
Os03g0307900AK072469CCCCACACGConserved hypothetical protein. 
Os03g0327600014-081-C01CCCCACACNONE 
014-081-C01TCTGGACCCCACACGNONE 
AK069815CCCCACACRicin B-related lectin domain containing protein. 
AK069815TCTGGACCCCACACGRicin B-related lectin domain containing protein. 
X95402CCCCACACNONE 
X95402TCTGGACCCCACACGNONE 
Os03g0338000AK121399GTGTGGGGGCCGGGSimilar to Alanine:glyoxylate aminotransferase-like protein (Fragment). 
Os03g0341000AK111414CCCCACACSimilar to AP2 domain containing protein RAP2.2 (Fragment). 
Os03g0374100AK066002CCCCACACGCGTCCHepatocellular carcinoma-associated antigen 59 family protein. 
AK099328CCCCACACGCGTCCNONE 
AK104845CCCCACACGCGTCCNONE 
Os03g0386000AK072984CCCCACACSimilar to WD domain protein-like. 
J065009K18CCCCACACNONE 
J065165P09CCCCACACNONE 
Os03g0566500AK070576GCCCCACACLupus La protein family protein. 
Os03g0581600J065037H09GGTCCACGTGGGCCCCACACNONE 
J065183O12GGTCCACGTGGGCCCCACACNONE 
Os03g0588700Os03g0588700GCGGGCCCCACACConserved hypothetical protein. 
Os03g0633800AK073044GGGCTTGGGCCGTGGTGGGTGGGCCCCACACSimilar to IAA6 (Fragment). 
J065038L22GGGCTTGGGCCGTGGTGGGTGGGCCCCACACNONE 
J065185C13GGGCTTGGGCCGTGGTGGGTGGGCCCCACACNONE 
Os03g0655400009-090-G04CCCCACACNONE 
009-133-B12CCCCACACNONE 
009-136-A10CCCCACACNONE 
009-156-C02CCCCACACNONE 
009-157-C04CCCCACACNONE 
009-159-F06CCCCACACNONE 
009-192-A07CCCCACACNONE 
009-192-B05CCCCACACNONE 
011-082-F01CCCCACACNONE 
013-041-G11CCCCACACNONE 
013-077-E04CCCCACACNONE 
014-001-A12CCCCACACNONE 
015-039-A12CCCCACACNONE 
016-094-G11CCCCACACNONE 
AB011368CCCCACACNONE 
AF010584CCCCACACSimilar to Water stress induced protein. 
AK059150CCCCACACNONE 
D26538CCCCACACNONE 
J065013M08CCCCACACNONE 
J065021G11CCCCACACNONE 
J065027K20CCCCACACNONE 
J065034A02CCCCACACNONE 
J065040F23CCCCACACNONE 
J065098G21CCCCACACNONE 
J065153J21CCCCACACNONE 
J065163C13CCCCACACNONE 
J065173C23CCCCACACNONE 
J065178I22CCCCACACNONE 
J065198K21CCCCACACNONE 
J065201H19CCCCACACNONE 
J065205F11CCCCACACNONE 
J100080E05CCCCACACNONE 
Os03g0667100012-045-B01CACTGACACGTGGGCCCCACACGCCACACACCNONE 
AK065363CACTGACACGTGGGCCCCACACGCCACACACCBTB domain containing protein. 
AK065952CACTGACACGTGGGCCCCACACGCCACACACCNONE 
J013045I05CACTGACACGTGGGCCCCACACGCCACACACCNONE 
J013129F20CACTGACACGTGGGCCCCACACGCCACACACCNONE 
Os03g0673600009-011-C08CCCCACACNONE 
009-033-C05CCCCACACNONE 
AK062334CCCCACACNONE 
AK068539CCCCACACConserved hypothetical protein. 
Os03g0676400AK109228GCCCCCACACVQ domain containing protein. 
Os03g0708100006-038-C06GTGTGGGGNONE 
006-068-H06GTGTGGGGNONE 
AK103821GTGTGGGGNONE 
J013025B09GTGTGGGGNONE 
J023134F07GTGTGGGGNONE 
J033147H12GTGTGGGGNONE 
J065033B01GTGTGGGGNONE 
J065046E24GTGTGGGGNONE 
J065099G12GTGTGGGGNONE 
J065119J01GTGTGGGGNONE 
J075179C02GTGTGGGGNONE 
Os03g0723000011-021-G07CCCCACACNONE 
012-075-F08CCCCACACNONE 
012-077-F05CCCCACACNONE 
AK064022CCCCACACNONE 
AK101603CCCCACACGRAS transcription factor domain containing protein. 
AK102857CCCCACACNONE 
J100032K06CCCCACACNONE 
J100075D20CCCCACACNONE 
Os03g0752700011-093-A02GCCCCACACNONE 
AK122157GCCCCACACHeat shock protein DnaJ, N-terminal domain containing protein. 
J013135C03GCCCCACACNONE 
J033096O19GCCCCACACNONE 
J033145P19GCCCCACACNONE 
J065008K09GCCCCACACNONE 
J065027J08GCCCCACACNONE 
J065073H12GCCCCACACNONE 
J065078G14GCCCCACACNONE 
J065092L12GCCCCACACNONE 
J065108D11GCCCCACACNONE 
J065140G10GCCCCACACNONE 
J065161D24GCCCCACACNONE 
J065170F04GCCCCACACNONE 
J075004K20GCCCCACACNONE 
J075069F16GCCCCACACNONE 
J075085B12GCCCCACACNONE 
J075087D24GCCCCACACNONE 
J075102G15GCCCCACACNONE 
J075123M06GCCCCACACNONE 
J090058D24GCCCCACACNONE 
J090068I12GCCCCACACNONE 
J090094A19GCCCCACACNONE 
Os03g0788800AK071670GCCCCCACACZinc finger, RING-type domain containing protein. 
J013090J22GCCCCCACACNONE 
J023050M06GCCCCCACACNONE 
J023073A12GCCCCCACACNONE 
J023075P21GCCCCCACACNONE 
J023106F04GCCCCCACACNONE 
J075181H19GCCCCCACACNONE 
J090009C24GCCCCCACACNONE 
J100027L24GCCCCCACACNONE 
J100055F06GCCCCCACACNONE 
J100081C22GCCCCCACACNONE 
J100084I21GCCCCCACACNONE 
Os03g0825300AK072216ACCCCCCACCCCACACACGCCACNONE 
AK102693ACCCCCCACCCCACACACGCCACNONE 
AK105593ACCCCCCACCCCACACACGCCACProtein kinase-like domain containing protein. 
BT014687ACCCCCCACCCCACACACGCCACNONE 
Os03g0825900AK109694GCCCCACACConserved hypothetical protein. 
Os04g0116200AK064677CCCCACACProtein of unknown function DUF827, plant family protein. 
J065017D03CCCCACACNONE 
J065095C04CCCCACACNONE 
J065211O18CCCCACACNONE 
J065219H18CCCCACACNONE 
Os04g0119500AJ698084CCCCACACGNONE 
AK061898CCCCACACGNONE 
AK065035CCCCACACGSimilar to Membrane related protein-like. 
J013001H07CCCCACACGNONE 
J013128B11CCCCACACGNONE 
J013153L13CCCCACACGNONE 
J013157F08CCCCACACGNONE 
J065140L14CCCCACACGNONE 
J075147J12CCCCACACGNONE 
J090087C14CCCCACACGNONE 
J100048O09CCCCACACGNONE 
J100051O16CCCCACACGNONE 
J100083H22CCCCACACGNONE 
Os04g0122000AK065510GTGTGGGGLeucine rich repeat, N-terminal domain containing protein. 
AK072577GTGTGGGGNONE 
AK099773GTGTGGGGNONE 
J013030L03GTGTGGGGNONE 
J013042D23GTGTGGGGNONE 
J013050E17GTGTGGGGNONE 
J013051J21GTGTGGGGNONE 
J013055L09GTGTGGGGNONE 
J013064A03GTGTGGGGNONE 
J013095E06GTGTGGGGNONE 
J013111A06GTGTGGGGNONE 
J013118K01GTGTGGGGNONE 
J013119A03GTGTGGGGNONE 
J013134F07GTGTGGGGNONE 
J033132N23GTGTGGGGNONE 
Os04g0282400AK120187CCCGGGCCCCACACSimilar to FPF1 protein-like (RAA1). 
J013034O10CCCGGGCCCCACACNONE 
J013071G20CCCGGGCCCCACACNONE 
Os04g0337500AK061807TACGGCCCCCACACNONE 
Os04g0385600Os04g0385600GTGTGGGGGAGZinc finger, MYND-type domain containing protein. 
Os04g0395600011-002-A05GTGTGGGGNONE 
011-009-C09GTGTGGGGNONE 
AK072338GTGTGGGGSimilar to TRANSPORT INHIBITOR RESPONSE 1 protein (F-box/LRR-repeat protein 1). 
AK100862GTGTGGGGNONE 
J023123O09GTGTGGGGNONE 
Os04g0399300AK105282ATATGGGCCCCACACSimilar to Nudix hydrolase 13, mitochondrial precursor (EC 3.6.1.-) (AtNUDT13). 
Os04g0412100AK108223CCCCACACGConserved hypothetical protein. 
Os04g0429450009-073-H08GTGTGGGGCNONE 
J065161L02GTGTGGGGCConserved hypothetical protein. 
Os04g0430600009-014-G12CCCCACACGNONE 
015-019-A08CCCCACACGNONE 
015-048-C08CCCCACACGNONE 
015-085-E11CCCCACACGNONE 
AK072050CCCCACACGNONE 
AK106337CCCCACACGConserved hypothetical protein. 
J065037C09CCCCACACGNONE 
J075125G18CCCCACACGNONE 
Os04g0444900AK063657ACCGGGCCCCACACSimilar to Alfin-1. 
AK098960ACCGGGCCCCACACNONE 
J065037L14ACCGGGCCCCACACNONE 
J065037P22ACCGGGCCCCACACNONE 
J065173O15ACCGGGCCCCACACNONE 
Os04g0476000Os04g0476000TTCGTGGGCCCCACACGTetratricopeptide-like helical domain containing protein. 
Os04g0491500AK068089CCCCACACNONE 
AK101116CCCCACACTGF-beta receptor, type I/II extracellular region family protein. 
Os04g0492300AK120935GTGTGGGGGCSimilar to DNA-directed RNA polymerase II largest chain. 
Os04g0516200J100043C17CCCCACACProtein of unknown function DUF640 domain containing protein. 
J100055K05CCCCACACNONE 
Os04g0561200AK107862CCCCACACCGCACCellular retinaldehyde-binding/triple function, C-terminal domain containing protein. 
J065028J03CCCCACACCGCACNONE 
J065042H13CCCCACACCGCACNONE 
J065079N01CCCCACACCGCACNONE 
J065190N16CCCCACACCGCACNONE 
J065191H22CCCCACACCGCACNONE 
Os04g0608300AK111353AGGTGGGCCCCACACGalactokinase family protein. 
Os04g0673400Os04g0673400CCCCACACSimilar to Uracil-DNA glycosylase (EC 3.2.2.-) (UDG). 
Os04g0687800AK107360CCCCACACProtein of unknown function DUF6, transmembrane domain containing protein. 
Os05g0102500009-183-E08CGTGTGGGGCNONE 
AK063894CGTGTGGGGCNONE 
AK073341CGTGTGGGGCConserved hypothetical protein. 
J023022C11CGTGTGGGGCNONE 
J065095B14CGTGTGGGGCNONE 
J065130O12CGTGTGGGGCNONE 
J065142P07CGTGTGGGGCNONE 
J065155L18CGTGTGGGGCNONE 
Os05g0108300AK070061GTGTGGGGSimilar to MAP kinase-like protein. 
AY336987GTGTGGGGNONE 
J023042N03GTGTGGGGNONE 
J023127L24GTGTGGGGNONE 
J033060M16GTGTGGGGNONE 
J033072H17GTGTGGGGNONE 
J065051F19GTGTGGGGNONE 
J065159C04GTGTGGGGNONE 
J075041L16GTGTGGGGNONE 
J075091C19GTGTGGGGNONE 
J075144N02GTGTGGGGNONE 
J075154F04GTGTGGGGNONE 
J075162J11GTGTGGGGNONE 
J075166K18GTGTGGGGNONE 
J075182L17GTGTGGGGNONE 
J075186K20GTGTGGGGNONE 
J090053H09GTGTGGGGNONE 
Os05g0148600003-016-C11CGGGTGGGCCCCACACACACCNONE 
AK066168CGGGTGGGCCCCACACACACCNONE 
AK104336CGGGTGGGCCCCACACACACCSimilar to Na+/H+ antiporter. 
AY360145CGGGTGGGCCCCACACACACCNONE 
J013055J22CGGGTGGGCCCCACACACACCNONE 
J013057M24CGGGTGGGCCCCACACACACCNONE 
J013074N03CGGGTGGGCCCCACACACACCNONE 
J013158A22CGGGTGGGCCCCACACACACCNONE 
J075118H09CGGGTGGGCCCCACACACACCNONE 
Os05g0150300AK100732CCCCACACGSimilar to Possible global transcription activator SNF2L1 (SWI/SNF related matrix associated actin dependent regulator of chromatin subfamily A member 1). 
Os05g0161200AB042936GTGTGGGGCNONE 
AK121808GTGTGGGGCDNA polymerase III clamp loader subunit, C-terminal domain containing protein. 
Os05g0176300J100059O08CCCCACACConserved hypothetical protein. 
Os05g0296800AK108441ACCCCCCACACHypothetical protein. 
AK108511ACCCCCCACACNONE 
Os05g0320700AK100598TGTGGGCCCCACATCCCCCACACSimilar to Cytochrome P450. 
AK104994TGTGGGCCCCACATCCCCCACACNONE 
Os05g0354400AK065144CCCCACACProtein of unknown function DUF231, plant domain containing protein. 
AK065144CCCCACACProtein of unknown function DUF231, plant domain containing protein. 
Os05g0361700AJ575218GTGTGGGGGAGNONE 
J075074A07GTGTGGGGGAGNONE 
Os05g0367400AK108439CCCCACACACCThiamine pyrophosphokinase family protein. 
Os05g0412800AF402803CTCGGCCCCACACSimilar to Glutathione S-transferase GST 41 (EC 2.5.1.18). 
Os05g0510100Os05g0510100GGCCCCACACProtein of unknown function DUF567 family protein. 
Os05g0527700AK111246CCCCACACUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
Os05g0535900AK101539CAAGGCCCCACACGTCACNONE 
AK101555CAAGGCCCCACACGTCACIQ calmodulin-binding region domain containing protein. 
J013047J05CAAGGCCCCACACGTCACNONE 
Os05g0548100AK060333CGTGTGGGGCCGTGConserved hypothetical protein. 
AK100682CGTGTGGGGCCGTGNONE 
J013151E01CGTGTGGGGCCGTGNONE 
J023113L22CGTGTGGGGCCGTGNONE 
J043027A19CGTGTGGGGCCGTGNONE 
J075093E06CGTGTGGGGCCGTGNONE 
J090060D15CGTGTGGGGCCGTGNONE 
J090082J03CGTGTGGGGCCGTGNONE 
J100050E01CGTGTGGGGCCGTGNONE 
Os05g0553000015-052-H09CCCCACACGNONE 
AK061681CCCCACACGATP synthase beta chain, mitochondrial precursor (EC 3.6.3.14). 
AK071143CCCCACACGNONE 
J013068H04CCCCACACGNONE 
J013124C06CCCCACACGNONE 
J033127N11CCCCACACGNONE 
J100056O04CCCCACACGNONE 
Os05g0557200AK062090CGTGTGGGGCCCACGCGNONE 
AK102111CGTGTGGGGCCCACGCGArmadillo-like helical domain containing protein. 
J013047E13CGTGTGGGGCCCACGCGNONE 
J013089P04CGTGTGGGGCCCACGCGNONE 
J013130H17CGTGTGGGGCCCACGCGNONE 
J013132C20CGTGTGGGGCCCACGCGNONE 
J023001E06CGTGTGGGGCCCACGCGNONE 
J023108C09CGTGTGGGGCCCACGCGNONE 
J023125C12CGTGTGGGGCCCACGCGNONE 
J033023O10CGTGTGGGGCCCACGCGNONE 
J033033K16CGTGTGGGGCCCACGCGNONE 
J033064C11CGTGTGGGGCCCACGCGNONE 
J033071P07CGTGTGGGGCCCACGCGNONE 
J033072H14CGTGTGGGGCCCACGCGNONE 
J033084F06CGTGTGGGGCCCACGCGNONE 
J033084H11CGTGTGGGGCCCACGCGNONE 
J033097C05CGTGTGGGGCCCACGCGNONE 
J043009E20CGTGTGGGGCCCACGCGNONE 
J053035M10CGTGTGGGGCCCACGCGNONE 
J053043J22CGTGTGGGGCCCACGCGNONE 
J053082K10CGTGTGGGGCCCACGCGNONE 
J053094N13CGTGTGGGGCCCACGCGNONE 
Os05g0565500J100058A22CGTGTGGGG6-phosphogluconate dehydrogenase family protein. 
Os05g0573700AK065295GGCCCCACACGCCTCSimilar to Ketol-acid reductoisomerase, chloroplast precursor (EC 1.1.1.86) (Acetohydroxy-acid reductoisomerase) (Alpha-keto-beta-hydroxylacil reductoisomerase). 
J065100L13GGCCCCACACGCCTCNONE 
J100062P20GGCCCCACACGCCTCNONE 
Os05g0576700013-062-H04GCCCCACACNONE 
AK063599GCCCCACACNONE 
AK108377GCCCCACACOleosin family protein. 
Os06g0101600AF093636GTGTGGGGGTGGGCCCACCTNONE 
AK070447GTGTGGGGGTGGGCCCACCTPlastocyanin, chloroplast precursor. 
J065001A20GTGTGGGGGTGGGCCCACCTNONE 
J065019M17GTGTGGGGGTGGGCCCACCTNONE 
J065021H18GTGTGGGGGTGGGCCCACCTNONE 
J065061A17GTGTGGGGGTGGGCCCACCTNONE 
J065073L02GTGTGGGGGTGGGCCCACCTNONE 
J065099F17GTGTGGGGGTGGGCCCACCTNONE 
J065101C23GTGTGGGGGTGGGCCCACCTNONE 
J065121E23GTGTGGGGGTGGGCCCACCTNONE 
J065122N04GTGTGGGGGTGGGCCCACCTNONE 
J065141N05GTGTGGGGGTGGGCCCACCTNONE 
J065143N21GTGTGGGGGTGGGCCCACCTNONE 
J065161H09GTGTGGGGGTGGGCCCACCTNONE 
J065161J04GTGTGGGGGTGGGCCCACCTNONE 
J065162P20GTGTGGGGGTGGGCCCACCTNONE 
J065182K10GTGTGGGGGTGGGCCCACCTNONE 
J065184M05GTGTGGGGGTGGGCCCACCTNONE 
J065186H24GTGTGGGGGTGGGCCCACCTNONE 
J065189G21GTGTGGGGGTGGGCCCACCTNONE 
J065190N14GTGTGGGGGTGGGCCCACCTNONE 
J065191H08GTGTGGGGGTGGGCCCACCTNONE 
J065205H17GTGTGGGGGTGGGCCCACCTNONE 
J075001E03GTGTGGGGGTGGGCCCACCTNONE 
J075001H21GTGTGGGGGTGGGCCCACCTNONE 
J075003J23GTGTGGGGGTGGGCCCACCTNONE 
J075003K01GTGTGGGGGTGGGCCCACCTNONE 
J075005I11GTGTGGGGGTGGGCCCACCTNONE 
J075007F16GTGTGGGGGTGGGCCCACCTNONE 
J075017I11GTGTGGGGGTGGGCCCACCTNONE 
J075018O05GTGTGGGGGTGGGCCCACCTNONE 
J075019G24GTGTGGGGGTGGGCCCACCTNONE 
J075032D04GTGTGGGGGTGGGCCCACCTNONE 
J075032N13GTGTGGGGGTGGGCCCACCTNONE 
J075033C09GTGTGGGGGTGGGCCCACCTNONE 
J075033D11GTGTGGGGGTGGGCCCACCTNONE 
J075039A20GTGTGGGGGTGGGCCCACCTNONE 
J075058P12GTGTGGGGGTGGGCCCACCTNONE 
J075062E10GTGTGGGGGTGGGCCCACCTNONE 
J075062P16GTGTGGGGGTGGGCCCACCTNONE 
J075063C17GTGTGGGGGTGGGCCCACCTNONE 
J075066E07GTGTGGGGGTGGGCCCACCTNONE 
J075066I20GTGTGGGGGTGGGCCCACCTNONE 
J075075K21GTGTGGGGGTGGGCCCACCTNONE 
J075078F03GTGTGGGGGTGGGCCCACCTNONE 
J075082F10GTGTGGGGGTGGGCCCACCTNONE 
J075086G16GTGTGGGGGTGGGCCCACCTNONE 
J075087E07GTGTGGGGGTGGGCCCACCTNONE 
J075087K06GTGTGGGGGTGGGCCCACCTNONE 
J075087L04GTGTGGGGGTGGGCCCACCTNONE 
J075088B16GTGTGGGGGTGGGCCCACCTNONE 
J075088D02GTGTGGGGGTGGGCCCACCTNONE 
J075094H21GTGTGGGGGTGGGCCCACCTNONE 
J075094I24GTGTGGGGGTGGGCCCACCTNONE 
J075094K10GTGTGGGGGTGGGCCCACCTNONE 
J075095C18GTGTGGGGGTGGGCCCACCTNONE 
J075097B05GTGTGGGGGTGGGCCCACCTNONE 
J075099C13GTGTGGGGGTGGGCCCACCTNONE 
J075099H22GTGTGGGGGTGGGCCCACCTNONE 
J075099L16GTGTGGGGGTGGGCCCACCTNONE 
J075104K08GTGTGGGGGTGGGCCCACCTNONE 
J075118O06GTGTGGGGGTGGGCCCACCTNONE 
J075119E15GTGTGGGGGTGGGCCCACCTNONE 
J075124N06GTGTGGGGGTGGGCCCACCTNONE 
J075126G02GTGTGGGGGTGGGCCCACCTNONE 
J075127L24GTGTGGGGGTGGGCCCACCTNONE 
J075131E23GTGTGGGGGTGGGCCCACCTNONE 
J075140H06GTGTGGGGGTGGGCCCACCTNONE 
J075146I20GTGTGGGGGTGGGCCCACCTNONE 
J075146N24GTGTGGGGGTGGGCCCACCTNONE 
J075147I19GTGTGGGGGTGGGCCCACCTNONE 
J075155K07GTGTGGGGGTGGGCCCACCTNONE 
J075156C05GTGTGGGGGTGGGCCCACCTNONE 
J075161G07GTGTGGGGGTGGGCCCACCTNONE 
J075164G01GTGTGGGGGTGGGCCCACCTNONE 
J075170J18GTGTGGGGGTGGGCCCACCTNONE 
J075172G17GTGTGGGGGTGGGCCCACCTNONE 
J075176G10GTGTGGGGGTGGGCCCACCTNONE 
J075178C05GTGTGGGGGTGGGCCCACCTNONE 
J075179G01GTGTGGGGGTGGGCCCACCTNONE 
J075181E24GTGTGGGGGTGGGCCCACCTNONE 
J080029D19GTGTGGGGGTGGGCCCACCTNONE 
J080034L11GTGTGGGGGTGGGCCCACCTNONE 
J080039G07GTGTGGGGGTGGGCCCACCTNONE 
J080062M23GTGTGGGGGTGGGCCCACCTNONE 
J080302A01GTGTGGGGGTGGGCCCACCTNONE 
J100042I15GTGTGGGGGTGGGCCCACCTNONE 
J100043G22GTGTGGGGGTGGGCCCACCTNONE 
J100056L12GTGTGGGGGTGGGCCCACCTNONE 
J100061A12GTGTGGGGGTGGGCCCACCTNONE 
J100073O20GTGTGGGGGTGGGCCCACCTNONE 
J100082I08GTGTGGGGGTGGGCCCACCTNONE 
Os06g0103800012-001-F10CCCCACACNONE 
AK067892CCCCACACProtein of unknown function DUF125, transmembrane family protein. 
J013123L02CCCCACACNONE 
J023054N05CCCCACACNONE 
J033071B21CCCCACACNONE 
J033114D13CCCCACACNONE 
Os06g0105900AK072638ACTGGGCCCCACACConserved hypothetical protein. 
Os06g0113900AK067430CCCCACACNONE 
AK102259CCCCACACNONE 
AK120464CCCCACACConserved hypothetical protein. 
J065144I06CCCCACACNONE 
Os06g0133600AK068474GCCCCCACACGNONE 
AK105690GCCCCCACACGPhosphate-induced protein 1 conserved region family protein. 
J013155H19GCCCCCACACGNONE 
J023054J01GCCCCCACACGNONE 
J065013N23GCCCCCACACGNONE 
Os06g0163300006-112-F11CCCCACACNONE 
006-115-G04CCCCACACNONE 
012-079-D09CCCCACACNONE 
AK058295CCCCACACHarpin-induced 1 domain containing protein. 
AK060328CCCCACACNONE 
AK073824CCCCACACNONE 
AK106071CCCCACACNONE 
J023025D10CCCCACACNONE 
J033070N04CCCCACACNONE 
J065016B01CCCCACACNONE 
J065030K12CCCCACACNONE 
J065076I03CCCCACACNONE 
J065084L24CCCCACACNONE 
J065179O03CCCCACACNONE 
J090025I06CCCCACACNONE 
Os06g0166500016-094-H06GCCCCACACNONE 
AK102541GCCCCACACSimilar to Auxin-responsive protein IAA20 (Indoleacetic acid-induced protein 20). 
Os06g0178900011-082-D06CCCCACACNONE 
AK066933CCCCACACVacuolar H+-pyrophosphatase (EC 3.6.1.1) (Ovp2). 
D45384CCCCACACNONE 
J013025O19CCCCACACNONE 
J013067J23CCCCACACNONE 
J013119G12CCCCACACNONE 
J013119I17CCCCACACNONE 
J013132B18CCCCACACNONE 
J023108D14CCCCACACNONE 
J033034C17CCCCACACNONE 
J033088E10CCCCACACNONE 
J065013C19CCCCACACNONE 
J065047E17CCCCACACNONE 
J090004E24CCCCACACNONE 
J090008I11CCCCACACNONE 
J090011F12CCCCACACNONE 
J090014D19CCCCACACNONE 
J090030B11CCCCACACNONE 
J090038J24CCCCACACNONE 
J090045I05CCCCACACNONE 
J090046C11CCCCACACNONE 
J090046F19CCCCACACNONE 
J090048G03CCCCACACNONE 
J090050A14CCCCACACNONE 
J090051B15CCCCACACNONE 
J090052E04CCCCACACNONE 
J090052L10CCCCACACNONE 
J090071O13CCCCACACNONE 
J090075F03CCCCACACNONE 
J090080I15CCCCACACNONE 
J090088B04CCCCACACNONE 
J100029D12CCCCACACNONE 
J100032D14CCCCACACNONE 
J100037J15CCCCACACNONE 
J100045D01CCCCACACNONE 
J100045K04CCCCACACNONE 
J100053M07CCCCACACNONE 
J100056F04CCCCACACNONE 
J100056L21CCCCACACNONE 
J100073N11CCCCACACNONE 
J100076O13CCCCACACNONE 
Os06g0215900011-006-B01CCCCACACGNONE 
011-088-G08CCCCACACGNONE 
AK072596CCCCACACGSimilar to Oxo-phytodienoic acid reductase. 
AK105590CCCCACACGNONE 
J023125E21CCCCACACGNONE 
J033051F13CCCCACACGNONE 
J033091L21CCCCACACGNONE 
J033107E18CCCCACACGNONE 
J043034N06CCCCACACGNONE 
J065021A14CCCCACACGNONE 
J065136F10CCCCACACGNONE 
J065142G20CCCCACACGNONE 
J065166I12CCCCACACGNONE 
J065171G17CCCCACACGNONE 
J065179A21CCCCACACGNONE 
J065190J04CCCCACACGNONE 
J065214E03CCCCACACGNONE 
J100022N12CCCCACACGNONE 
J100025A03CCCCACACGNONE 
J100034H20CCCCACACGNONE 
J100054C23CCCCACACGNONE 
J100057K17CCCCACACGNONE 
J100061L01CCCCACACGNONE 
J100077K16CCCCACACGNONE 
J100078D16CCCCACACGNONE 
J100084G04CCCCACACGNONE 
Os06g0245800AK066714CCCCACACSimilar to Alanyl-tRNA synthetase. 
Os06g0258000AK107483CTCCCCCACACSimilar to Typical P-type R2R3 Myb protein (Fragment). 
Os06g0268800AK120796CCCGGCCCCACACGProtein of unknown function UPF0005 family protein. 
Os06g0319700AK120884CCCCACACSimilar to 60S ribosomal protein L31. 
J013089A14CCCCACACNONE 
J023028N24CCCCACACNONE 
J033098H21CCCCACACNONE 
J033118G04CCCCACACNONE 
J090056P15CCCCACACNONE 
J090062B02CCCCACACNONE 
J100024B09CCCCACACNONE 
J100060I04CCCCACACNONE 
J100078H11CCCCACACNONE 
J100080A14CCCCACACNONE 
J100086F18CCCCACACNONE 
Os06g0498800AK107056CCCCACACSimilar to MOTHER of FT and TF1 protein. 
J075147L06CCCCACACNONE 
Os06g0503400AK073583CCCCACACReticulon family protein. 
J033051P18CCCCACACNONE 
J065136I21CCCCACACNONE 
J065205M01CCCCACACNONE 
J100057K19CCCCACACNONE 
J100086N09CCCCACACNONE 
Os06g0568600AK071743CCCCACACSimilar to Ent-kaurene oxidase 1 (Fragment). 
AY660664CCCCACACNONE 
J023111A19CCCCACACNONE 
Os06g0573600AK102756AGTGGGCCCCACACGTCTCSimilar to Beta-galactosidase precursor (EC 3.2.1.23) (Lactase). 
J023001F23AGTGGGCCCCACACGTCTCNONE 
J033107B05AGTGGGCCCCACACGTCTCNONE 
J090078G02AGTGGGCCCCACACGTCTCNONE 
J090099E09AGTGGGCCCCACACGTCTCNONE 
Os06g0574200Os06g0574200GTGGGTCCCACACGTGTGGGCCCACCCCCACACAGCCGTTGUspA domain containing protein. 
Os06g0608700005-001-A05GTGTGGGGNONE 
005-019-A07GTGTGGGGNONE 
006-036-A06GTGTGGGGNONE 
AK058288GTGTGGGGNONE 
AK058302GTGTGGGGNONE 
AK064989GTGTGGGGSimilar to Fructose-bisphosphate aldolase, cytoplasmic isozyme (EC 4.1.2.13). 
AK104381GTGTGGGGNONE 
J013001D08GTGTGGGGNONE 
J013029A21GTGTGGGGNONE 
J013045K06GTGTGGGGNONE 
J013060N12GTGTGGGGNONE 
J013066O09GTGTGGGGNONE 
J013073A17GTGTGGGGNONE 
J013095B08GTGTGGGGNONE 
J013105B15GTGTGGGGNONE 
J013124E11GTGTGGGGNONE 
J013153O07GTGTGGGGNONE 
J013157H19GTGTGGGGNONE 
J023007I10GTGTGGGGNONE 
J023028A13GTGTGGGGNONE 
J023052D09GTGTGGGGNONE 
J023067K10GTGTGGGGNONE 
J023087A18GTGTGGGGNONE 
J023087E22GTGTGGGGNONE 
J065023D07GTGTGGGGNONE 
J065084F21GTGTGGGGNONE 
J065116B13GTGTGGGGNONE 
J065188G18GTGTGGGGNONE 
J080001F22GTGTGGGGNONE 
J080001H04GTGTGGGGNONE 
J080013D13GTGTGGGGNONE 
J080025B20GTGTGGGGNONE 
J080025N19GTGTGGGGNONE 
J080029C09GTGTGGGGNONE 
J080029D04GTGTGGGGNONE 
J080038P07GTGTGGGGNONE 
J080053I03GTGTGGGGNONE 
J080054B02GTGTGGGGNONE 
J080057B13GTGTGGGGNONE 
J080059O09GTGTGGGGNONE 
J080064K18GTGTGGGGNONE 
J080072F14GTGTGGGGNONE 
J080074H03GTGTGGGGNONE 
J080074O15GTGTGGGGNONE 
J080079A02GTGTGGGGNONE 
J080079I05GTGTGGGGNONE 
J080080D11GTGTGGGGNONE 
Os06g0609600AK072533CCCCACACEF-Hand type domain containing protein. 
AK099872CCCCACACNONE 
BT014680CCCCACACNONE 
J023008M02CCCCACACNONE 
J023127M12CCCCACACNONE 
J065049L24CCCCACACNONE 
J065102K24CCCCACACNONE 
J065205O14CCCCACACNONE 
J075127F01CCCCACACNONE 
J080033F07CCCCACACNONE 
Os06g0618000AK110866CACTGACACGTGGGCCCACCCGGTGTGGGGCCCACGCGTConserved hypothetical protein. 
Os06g0643000AK067701CCCCACACGPhox-like domain containing protein. 
J013032G04CCCCACACGNONE 
J013044B17CCCCACACGNONE 
J013114M13CCCCACACGNONE 
J023133A02CCCCACACGNONE 
J043022A07CCCCACACGNONE 
J075046O21CCCCACACGNONE 
J075142L01CCCCACACGNONE 
J090076I16CCCCACACGNONE 
J100056O17CCCCACACGNONE 
Os06g0643300006-021-C08CCCCACACGNONE 
006-027-G09CCCCACACGNONE 
006-029-D11CCCCACACGNONE 
006-036-A08CCCCACACGNONE 
006-039-G11CCCCACACGNONE 
006-043-H02CCCCACACGNONE 
006-085-G12CCCCACACGNONE 
006-087-C11CCCCACACGNONE 
AK061733CCCCACACGDevelopment protein-like protein. 
AK099061CCCCACACGNONE 
AK104266CCCCACACGNONE 
AY224520CCCCACACGNONE 
J013026N10CCCCACACGNONE 
J013155P17CCCCACACGNONE 
J013159N19CCCCACACGNONE 
J065041K15CCCCACACGNONE 
J065064A17CCCCACACGNONE 
J065172F08CCCCACACGNONE 
J065199P22CCCCACACGNONE 
J090017A13CCCCACACGNONE 
J090030A21CCCCACACGNONE 
J100028G08CCCCACACGNONE 
J100064K11CCCCACACGNONE 
Os06g0696400011-019-C01CCCCCGCGTCTCTGGCCCCCACACNONE 
011-027-D04CCCCCGCGTCTCTGGCCCCCACACNONE 
013-051-H10CCCCCGCGTCTCTGGCCCCCACACNONE 
013-054-A06CCCCCGCGTCTCTGGCCCCCACACNONE 
013-061-D06CCCCCGCGTCTCTGGCCCCCACACNONE 
013-088-F04CCCCCGCGTCTCTGGCCCCCACACNONE 
014-018-C07CCCCCGCGTCTCTGGCCCCCACACNONE 
014-026-E10CCCCCGCGTCTCTGGCCCCCACACNONE 
AK058291CCCCCGCGTCTCTGGCCCCCACACNONE 
AK066125CCCCCGCGTCTCTGGCCCCCACACNONE 
AK104912CCCCCGCGTCTCTGGCCCCCACACNONE 
BT014685CCCCCGCGTCTCTGGCCCCCACACSimilar to Xyloglucan endotransglucosylase/hydrolase protein 24 precursor (EC 2.4.1.207) (At-XTH24) (XTH-24) (Meristem protein 5) (MERI-5 protein) (MERI5 protein) (Endo-xyloglucan transferase) (Xyloglucan endo-1,4-beta-D-glucanase). 
J013059H08CCCCCGCGTCTCTGGCCCCCACACNONE 
J065065L22CCCCCGCGTCTCTGGCCCCCACACNONE 
J065084O06CCCCCGCGTCTCTGGCCCCCACACNONE 
J075006O13CCCCCGCGTCTCTGGCCCCCACACNONE 
J075013J18CCCCCGCGTCTCTGGCCCCCACACNONE 
J075018L23CCCCCGCGTCTCTGGCCCCCACACNONE 
J075036E14CCCCCGCGTCTCTGGCCCCCACACNONE 
J075039K21CCCCCGCGTCTCTGGCCCCCACACNONE 
J075075H13CCCCCGCGTCTCTGGCCCCCACACNONE 
J075091A14CCCCCGCGTCTCTGGCCCCCACACNONE 
J075093I09CCCCCGCGTCTCTGGCCCCCACACNONE 
J075136L17CCCCCGCGTCTCTGGCCCCCACACNONE 
J075156M24CCCCCGCGTCTCTGGCCCCCACACNONE 
J075174J01CCCCCGCGTCTCTGGCCCCCACACNONE 
J075179P15CCCCCGCGTCTCTGGCCCCCACACNONE 
J075181F02CCCCCGCGTCTCTGGCCCCCACACNONE 
J075194L24CCCCCGCGTCTCTGGCCCCCACACNONE 
J080302J02CCCCCGCGTCTCTGGCCCCCACACNONE 
J080304J11CCCCCGCGTCTCTGGCCCCCACACNONE 
J080308A15CCCCCGCGTCTCTGGCCCCCACACNONE 
J100041B09CCCCCGCGTCTCTGGCCCCCACACNONE 
Os06g0711600016-047-G09GTGTGGGGNONE 
AK064384GTGTGGGGmRNA splicing factor SYF2 family protein. 
AK102831GTGTGGGGNONE 
J013072P18GTGTGGGGNONE 
J023049G01GTGTGGGGNONE 
J023088I01GTGTGGGGNONE 
J033023I22GTGTGGGGNONE 
J033106I12GTGTGGGGNONE 
J033109G07GTGTGGGGNONE 
J065030F22GTGTGGGGNONE 
J065132H19GTGTGGGGNONE 
J080301D07GTGTGGGGNONE 
J080305C09GTGTGGGGNONE 
J080312C03GTGTGGGGNONE 
J080313I15GTGTGGGGNONE 
J080315B09GTGTGGGGNONE 
J090056N21GTGTGGGGNONE 
J100027B07GTGTGGGGNONE 
Os06g0717400AK072887GTGTGGGGGGTPseudouridine synthase, Rlu family protein. 
Os07g0154300009-070-E08GGCCCCACACNONE 
009-077-E01GGCCCCACACNONE 
009-196-F05GGCCCCACACNONE 
AK105386GGCCCCACACConserved hypothetical protein. 
AK122093GGCCCCACACNONE 
J033124K14GGCCCCACACNONE 
J075006I22GGCCCCACACNONE 
J075185G02GGCCCCACACNONE 
J090039C02GGCCCCACACNONE 
Os07g0229200AK058412GAGGCGTGGTGTGGGGGCCyclin-like F-box domain containing protein. 
Os07g0413800006-021-H08CCCCACACNONE 
006-030-D01CCCCACACNONE 
006-034-B05CCCCACACNONE 
006-034-G03CCCCACACNONE 
006-040-B11CCCCACACNONE 
006-043-D03CCCCACACNONE 
006-052-B04CCCCACACNONE 
006-054-H11CCCCACACNONE 
006-081-A04CCCCACACNONE 
006-095-D10CCCCACACNONE 
006-102-A01CCCCACACNONE 
006-111-E02CCCCACACNONE 
009-136-D03CCCCACACNONE 
009-163-H08CCCCACACNONE 
009-164-D03CCCCACACNONE 
AK060411CCCCACACNONE 
AK061478CCCCACACConserved hypothetical protein. 
AK104124CCCCACACNONE 
AK104173CCCCACACNONE 
AK120684CCCCACACNONE 
J065112P06CCCCACACNONE 
Os07g0475400AK102489CCCCACACSimilar to Expansin-like protein A (Fragment). 
AY100694CCCCACACNONE 
Os07g0475700006-025-E06GCCCCACACACACCNONE 
AK060076GCCCCACACACACCAuxin responsive SAUR protein family protein. 
Os07g0498300009-045-C02TCGTGGGCCCCACACNONE 
009-060-A09TCGTGGGCCCCACACNONE 
009-121-C04TCGTGGGCCCCACACNONE 
009-157-G09TCGTGGGCCCCACACNONE 
009-197-B02TCGTGGGCCCCACACNONE 
AK059124TCGTGGGCCCCACACConserved hypothetical protein. 
AK119800TCGTGGGCCCCACACNONE 
J065184M18TCGTGGGCCCCACACNONE 
J075009G21TCGTGGGCCCCACACNONE 
J075013O03TCGTGGGCCCCACACNONE 
J075061C22TCGTGGGCCCCACACNONE 
J075094E12TCGTGGGCCCCACACNONE 
J075148C01TCGTGGGCCCCACACNONE 
Os07g0524200AK108285CCCCACACHarpin-induced 1 domain containing protein. 
Os07g0556200006-026-F07GTGTGGGGGCGTGGGCGTGTGGCNONE 
006-042-H11GTGTGGGGGCGTGGGCGTGTGGCNONE 
006-048-D01GTGTGGGGGCGTGGGCGTGTGGCNONE 
006-051-E02GTGTGGGGGCGTGGGCGTGTGGCNONE 
006-061-E07GTGTGGGGGCGTGGGCGTGTGGCNONE 
006-075-H06GTGTGGGGGCGTGGGCGTGTGGCNONE 
006-110-E10GTGTGGGGGCGTGGGCGTGTGGCNONE 
006-112-C09GTGTGGGGGCGTGGGCGTGTGGCNONE 
006-116-E10GTGTGGGGGCGTGGGCGTGTGGCNONE 
AF093631GTGTGGGGGCGTGGGCGTGTGGCNONE 
AK071634GTGTGGGGGCGTGGGCGTGTGGCRieske iron-sulfur protein family protein. 
J013022H19GTGTGGGGGCGTGGGCGTGTGGCNONE 
J013057E06GTGTGGGGGCGTGGGCGTGTGGCNONE 
J013151C13GTGTGGGGGCGTGGGCGTGTGGCNONE 
J023080E08GTGTGGGGGCGTGGGCGTGTGGCNONE 
J023100K03GTGTGGGGGCGTGGGCGTGTGGCNONE 
J023105H15GTGTGGGGGCGTGGGCGTGTGGCNONE 
J023114I15GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065002C09GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065037K17GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065038K18GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065039D16GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065040D18GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065042O04GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065046J20GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065046L02GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065046L03GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065053H02GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065063A22GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065066C08GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065077J23GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065081N04GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065085O08GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065087H09GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065093M05GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065094C01GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065102I04GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065103C05GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065104O06GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065108H03GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065121I10GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065123E14GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065128E14GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065129G16GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065131I07GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065135F13GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065137K23GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065143A11GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065143I04GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065154N18GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065170L23GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065179D21GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065180C18GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065190F03GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065205C02GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065208A12GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065209B05GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065211C03GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065212L24GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065216I06GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065217O06GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065218A02GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075007M16GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075013H23GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075013O14GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075015K10GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075022G20GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075023H23GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075037I08GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075038C06GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075042B14GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075063D13GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075064O11GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075067D07GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075071G15GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075072F15GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075073D09GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075083M23GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075084J12GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075088I06GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075089C10GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075093K09GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075095P15GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075098P08GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075103A15GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075108G23GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075116G03GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075118O21GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075127H14GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075129H07GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075138J20GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075142F12GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075143F18GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075143L11GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075145N09GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075146N05GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075147P21GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075154C18GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075154N24GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075155D22GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075159C14GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075161E14GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075168K20GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075170E13GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075170M24GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075175E08GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075176C15GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075176H16GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075177M01GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075178F18GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075179C03GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075179E16GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075183D09GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075188O16GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075193J05GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080001M22GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080013N04GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080031E11GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080034E09GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080034L17GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080037F06GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080038M04GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080040F10GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080042P19GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080045B11GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080048E07GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080048I09GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080050J17GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080051G02GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080062E19GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080063E12GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080079A22GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080079C15GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080080D08GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080096L22GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080302E06GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080302G12GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080303B02GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080303M06GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080304I06GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080306N10GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080308D09GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080308J23GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080317I16GTGTGGGGGCGTGGGCGTGTGGCNONE 
J100038H16GTGTGGGGGCGTGGGCGTGTGGCNONE 
J100043C14GTGTGGGGGCGTGGGCGTGTGGCNONE 
J100045N09GTGTGGGGGCGTGGGCGTGTGGCNONE 
J100073D03GTGTGGGGGCGTGGGCGTGTGGCNONE 
Os07g0561300AK072982ACCGGGCCCCACACGCyclin-like F-box domain containing protein. 
J023149I22ACCGGGCCCCACACGNONE 
J065149C18ACCGGGCCCCACACGNONE 
J065166N15ACCGGGCCCCACACGNONE 
J075011J01ACCGGGCCCCACACGNONE 
J075013I05ACCGGGCCCCACACGNONE 
J075039H11ACCGGGCCCCACACGNONE 
J075067J09ACCGGGCCCCACACGNONE 
J075084E08ACCGGGCCCCACACGNONE 
J075085E12ACCGGGCCCCACACGNONE 
J075090D11ACCGGGCCCCACACGNONE 
J075092D12ACCGGGCCCCACACGNONE 
J075126N17ACCGGGCCCCACACGNONE 
J075179F01ACCGGGCCCCACACGNONE 
J075184P21ACCGGGCCCCACACGNONE 
Os07g0584500003-129-F05TGGTGGGCCCCCACACNONE 
006-119-H08TGGTGGGCCCCCACACNONE 
011-022-G03TGGTGGGCCCCCACACNONE 
AK067725TGGTGGGCCCCCACACRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
AK121109TGGTGGGCCCCCACACNONE 
J013055C05TGGTGGGCCCCCACACNONE 
J013062F12TGGTGGGCCCCCACACNONE 
J013069J22TGGTGGGCCCCCACACNONE 
J013114I11TGGTGGGCCCCCACACNONE 
J023072P12TGGTGGGCCCCCACACNONE 
Os07g0615900AK066317CCCCACACGZinc finger, GATA-type domain containing protein. 
AK073803CCCCACACGNONE 
J013026A07CCCCACACGNONE 
J013064I12CCCCACACGNONE 
J033068D01CCCCACACGNONE 
J033074A10CCCCACACGNONE 
J033129C06CCCCACACGNONE 
J100035K20CCCCACACGNONE 
J100044G13CCCCACACGNONE 
J100050K01CCCCACACGNONE 
J100069P20CCCCACACGNONE 
J100071O09CCCCACACGNONE 
J100086K01CCCCACACGNONE 
J100089G11CCCCACACGNONE 
Os07g0661400006-083-E05CCCGGCCCCACACGNONE 
006-084-B12CCCGGCCCCACACGNONE 
006-096-B03CCCGGCCCCACACGNONE 
009-013-C12CCCGGCCCCACACGNONE 
009-017-C10CCCGGCCCCACACGNONE 
009-027-A02CCCGGCCCCACACGNONE 
009-035-A06CCCGGCCCCACACGNONE 
009-047-H11CCCGGCCCCACACGNONE 
009-050-B11CCCGGCCCCACACGNONE 
009-051-C02CCCGGCCCCACACGNONE 
009-089-G06CCCGGCCCCACACGNONE 
009-091-C05CCCGGCCCCACACGNONE 
009-095-B11CCCGGCCCCACACGNONE 
009-151-C01CCCGGCCCCACACGNONE 
009-154-F06CCCGGCCCCACACGNONE 
009-169-F02CCCGGCCCCACACGNONE 
009-171-G01CCCGGCCCCACACGNONE 
009-179-F07CCCGGCCCCACACGNONE 
013-018-H06CCCGGCCCCACACGNONE 
013-024-E05CCCGGCCCCACACGNONE 
013-038-F09CCCGGCCCCACACGNONE 
013-099-F06CCCGGCCCCACACGNONE 
014-042-E09CCCGGCCCCACACGNONE 
014-086-C02CCCGGCCCCACACGNONE 
014-093-B08CCCGGCCCCACACGNONE 
015-039-G11CCCGGCCCCACACGNONE 
016-036-E05CCCGGCCCCACACGNONE 
AK068814CCCGGCCCCACACGNONE 
AK102682CCCGGCCCCACACGNONE 
AK105973CCCGGCCCCACACGNONE 
AK107202CCCGGCCCCACACGConserved hypothetical protein. 
J053035N21CCCGGCCCCACACGNONE 
J053099D11CCCGGCCCCACACGNONE 
J065023B18CCCGGCCCCACACGNONE 
J065031M15CCCGGCCCCACACGNONE 
J065035G23CCCGGCCCCACACGNONE 
J065060M18CCCGGCCCCACACGNONE 
J065073J18CCCGGCCCCACACGNONE 
J065103E20CCCGGCCCCACACGNONE 
J065105N19CCCGGCCCCACACGNONE 
J065137A08CCCGGCCCCACACGNONE 
J065152K09CCCGGCCCCACACGNONE 
J065156M12CCCGGCCCCACACGNONE 
J065162G23CCCGGCCCCACACGNONE 
J065162L13CCCGGCCCCACACGNONE 
J065163H16CCCGGCCCCACACGNONE 
J065165E06CCCGGCCCCACACGNONE 
J065171J04CCCGGCCCCACACGNONE 
J065180L23CCCGGCCCCACACGNONE 
J065183K23CCCGGCCCCACACGNONE 
J065186H13CCCGGCCCCACACGNONE 
J065195D10CCCGGCCCCACACGNONE 
J065209G11CCCGGCCCCACACGNONE 
J075006J08CCCGGCCCCACACGNONE 
J075112O07CCCGGCCCCACACGNONE 
J080301H14CCCGGCCCCACACGNONE 
J100058C17CCCGGCCCCACACGNONE 
J100077I23CCCGGCCCCACACGNONE 
J100080I24CCCGGCCCCACACGNONE 
Os07g0675400015-072-G04GTGTGGGGNONE 
AK065735GTGTGGGGAminoacyl-tRNA synthetase, class Ib domain containing protein. 
J013042C04GTGTGGGGNONE 
Os07g0679500AK102562GCCCCACACSimilar to Transcription factor RF2b. 
Os08g0128200AK120428GGCCCCACACConserved hypothetical protein. 
Os08g0133100AK109905GTGTGGGGSimilar to Tpv2-1c protein (Fragment). 
Os08g0138500AK102951GCCCCCACACGCCCACCTSimilar to Helix-loop-helix-like protein (Fragment). 
AY224458GCCCCCACACGCCCACCTNONE 
J033115D14GCCCCCACACGCCCACCTNONE 
J065013F04GCCCCCACACGCCCACCTNONE 
J065050P11GCCCCCACACGCCCACCTNONE 
J065063K18GCCCCCACACGCCCACCTNONE 
J090054H10GCCCCCACACGCCCACCTNONE 
J100083F11GCCCCCACACGCCCACCTNONE 
Os08g0141300AK058337GTGTGGGGCCCACCANONE 
AK067917GTGTGGGGCCCACCAMajor sperm protein domain containing protein. 
J100039I03GTGTGGGGCCCACCANONE 
Os08g0191900AK067587CGTGTGGGGCCCATGTGGGGCCCATTProtein prenyltransferase domain containing protein. 
AK099016CGTGTGGGGCCCATGTGGGGCCCATTNONE 
J013032I08CGTGTGGGGCCCATGTGGGGCCCATTNONE 
J013050I24CGTGTGGGGCCCATGTGGGGCCCATTNONE 
J013128E05CGTGTGGGGCCCATGTGGGGCCCATTNONE 
Os08g0320100011-088-D10CGTGTGGGGNONE 
AK121802CGTGTGGGGRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os08g0414300AK072217CCCCACACACCConserved hypothetical protein. 
J065039C07CCCCACACACCNONE 
J065098N11CCCCACACACCNONE 
J065120J15CCCCACACACCNONE 
J075076H12CCCCACACACCNONE 
J075101N16CCCCACACACCNONE 
J080010A07CCCCACACACCNONE 
J080023C16CCCCACACACCNONE 
J080027G22CCCCACACACCNONE 
J080053D02CCCCACACACCNONE 
J080065E17CCCCACACACCNONE 
J080068C15CCCCACACACCNONE 
J090061J10CCCCACACACCNONE 
Os08g0442300006-067-F05CATCCCCCACACNONE 
006-067-F05GCCCCACACNONE 
AK059843CATCCCCCACACNONE 
AK059843GCCCCACACNONE 
AK071719CATCCCCCACACSimilar to Calcineurin-like protein. 
AK071719GCCCCACACSimilar to Calcineurin-like protein. 
AK102411CATCCCCCACACNONE 
AK102411GCCCCACACNONE 
J023108H11CATCCCCCACACNONE 
J023108H11GCCCCACACNONE 
J033092P05CATCCCCCACACNONE 
J033092P05GCCCCACACNONE 
J075109C09CATCCCCCACACNONE 
J075109C09GCCCCACACNONE 
J090070B02CATCCCCCACACNONE 
J090070B02GCCCCACACNONE 
J090076M14CATCCCCCACACNONE 
J090076M14GCCCCACACNONE 
J100064B16CATCCCCCACACNONE 
J100064B16GCCCCACACNONE 
Os08g0452500AK102438TGTGGGCCCCACACNONE 
AK106714TGTGGGCCCCACACAuxin responsive SAUR protein family protein. 
Os08g0459600AK071203GCGGGCCCCACACSimilar to 12-oxophytodienoate reductase 3 (EC 1.3.1.42) (12-oxophytodienoate- 10,11-reductase 3) (OPDA-reductase 3) (LeOPR3). 
AK104843GCGGGCCCCACACNONE 
Os08g0492500AK065316CCCCACACRINGv domain containing protein. 
J013002P08CCCCACACNONE 
Os08g0537900AK119425GTGTGGGGGCNONE 
AY341827GTGTGGGGGCSimilar to Ethylene-responsive transcription factor 3 (Ethylene-responsive element binding factor 3) (EREBP-3) (AtERF3). 
Os08g0544700AK111366CCCCACACConserved hypothetical protein. 
Os08g0544800009-168-G01GTGTGGGGCCCACGCGNONE 
011-046-D09GTGTGGGGCCCACGCGNONE 
012-003-C08GTGTGGGGCCCACGCGNONE 
012-042-B06GTGTGGGGCCCACGCGNONE 
013-035-H12GTGTGGGGCCCACGCGNONE 
013-072-A10GTGTGGGGCCCACGCGNONE 
014-010-B11GTGTGGGGCCCACGCGNONE 
014-097-E06GTGTGGGGCCCACGCGNONE 
015-003-E12GTGTGGGGCCCACGCGNONE 
015-040-B04GTGTGGGGCCCACGCGNONE 
AK060536GTGTGGGGCCCACGCGNONE 
AK102666GTGTGGGGCCCACGCGNONE 
AK119660GTGTGGGGCCCACGCGPCF2. 
D87261GTGTGGGGCCCACGCGNONE 
J090049N23GTGTGGGGCCCACGCGNONE 
J090084G06GTGTGGGGCCCACGCGNONE 
Os08g0547800006-110-B11CCCCACACTGACANONE 
AK106054CCCCACACTGACAEsterase/lipase/thioesterase domain containing protein. 
Os09g0111800004-013-C09GTGTGGGGNONE 
006-085-E01GTGTGGGGNONE 
016-037-E02GTGTGGGGNONE 
AK060898GTGTGGGGNONE 
AK069338GTGTGGGGRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J013039A09GTGTGGGGNONE 
J023012N03GTGTGGGGNONE 
J033029N15GTGTGGGGNONE 
J033064E17GTGTGGGGNONE 
J080305G19GTGTGGGGNONE 
J080305N02GTGTGGGGNONE 
J080306B09GTGTGGGGNONE 
J080310C20GTGTGGGGNONE 
J080311A20GTGTGGGGNONE 
J080311G17GTGTGGGGNONE 
J080316J11GTGTGGGGNONE 
J090054J05GTGTGGGGNONE 
J090055M10GTGTGGGGNONE 
J090059H08GTGTGGGGNONE 
Os09g0280600AK070961CGTGTGGGGCTTTTMnd1 family protein. 
J023066B13CGTGTGGGGCTTTTNONE 
Os09g0309500J100027L22CTCCCCCACACConserved hypothetical protein. 
Os09g0402100009-119-F11CCCCACACNONE 
009-166-C09CCCCACACNONE 
AK068506CCCCACACPF1 protein. 
J065130I01CCCCACACNONE 
L24390CCCCACACNONE 
Os09g0427800J090021D12CCCCACACNONE 
J090040B21CCCCACACGlycosyl transferase, family 20 domain containing protein. 
J090049G09CCCCACACNONE 
J090050G02CCCCACACNONE 
Os09g0447900AK111436CCCCACACGConserved hypothetical protein. 
Os09g0455200J065041I12CCCCACACACCWinged helix repressor DNA-binding domain containing protein. 
J065120N14CCCCACACACCNONE 
Os09g0486500006-062-H11GCCCCCACCCCCACACNONE 
009-049-A11GCCCCCACCCCCACACNONE 
009-070-D06GCCCCCACCCCCACACNONE 
009-089-A10GCCCCCACCCCCACACNONE 
009-107-D06GCCCCCACCCCCACACNONE 
009-133-F02GCCCCCACCCCCACACNONE 
009-142-A05GCCCCCACCCCCACACNONE 
009-175-G07GCCCCCACCCCCACACNONE 
013-044-C05GCCCCCACCCCCACACNONE 
014-044-D10GCCCCCACCCCCACACNONE 
AF140722GCCCCCACCCCCACACNONE 
AK061067GCCCCCACCCCCACACNONE 
AK070140GCCCCCACCCCCACACNONE 
AK106128GCCCCCACCCCCACACMultiple stress-responsive zinc-finger protein ISAP1 (Stress- associated protein 1) (OsISAP1). 
AK119793GCCCCCACCCCCACACNONE 
J023042G11GCCCCCACCCCCACACNONE 
J053043H07GCCCCCACCCCCACACNONE 
J053046N13GCCCCCACCCCCACACNONE 
J053091K15GCCCCCACCCCCACACNONE 
J053094I21GCCCCCACCCCCACACNONE 
J053094N04GCCCCCACCCCCACACNONE 
J053100D12GCCCCCACCCCCACACNONE 
J053101K11GCCCCCACCCCCACACNONE 
J065079H06GCCCCCACCCCCACACNONE 
J100028D11GCCCCCACCCCCACACNONE 
J100033A20GCCCCCACCCCCACACNONE 
J100033F15GCCCCCACCCCCACACNONE 
Os09g0526700011-075-B12CCCCACACNONE 
AB097460CCCCACACNONE 
AK073610CCCCACACSimilar to UDP-glucose 4-epimerase (EC 5.1.3.2) (Galactowaldenase) (UDP-galactose 4-epimerase). 
AK104977CCCCACACNONE 
Os09g0560600AK070937ACATGGGCCCCACACProtein of unknown function DUF284, transmembrane eukaryotic family protein. 
J013112M13ACATGGGCCCCACACNONE 
J013151P14ACATGGGCCCCACACNONE 
J023022E01ACATGGGCCCCACACNONE 
J023068C02ACATGGGCCCCACACNONE 
J023107O13ACATGGGCCCCACACNONE 
Os11g0150400006-104-E01GTGTGGGGGCNONE 
009-067-G02GTGTGGGGGCNONE 
AK058243GTGTGGGGGCDimeric alpha-beta barrel domain containing protein. 
AK061232GTGTGGGGGCNONE 
AK099186GTGTGGGGGCNONE 
Os11g0163500AK101154GTGTGGGGHomeodomain-like containing protein. 
Os11g0421800015-041-B05CCCGTGGGCCCCCACACNONE 
AK106317CCCGTGGGCCCCCACACConserved hypothetical protein. 
Os11g0456200AK060974GTGTGGGGCCCATGConserved hypothetical protein. 
J065010F10GTGTGGGGCCCATGNONE 
J090079O04GTGTGGGGCCCATGNONE 
Os11g0549620006-091-C11GTGTGGGGCCCACCTGNONE 
AK061321GTGTGGGGCCCACCTGSimilar to Purple acid phosphatase. 
AK106004GTGTGGGGCCCACCTGNONE 
Os11g0586300AK072257TGTGGGCCCCACACCCCCCACGConserved hypothetical protein. 
Os11g0704600015-027-B02CCCCACACNONE 
015-071-C03CCCCACACNONE 
AK059271CCCCACACNONE 
AK100931CCCCACACNONE 
AK102883CCCCACACSimilar to Beta-1,3 glucanase precursor (EC 3.2.1.39). 
J065117H11CCCCACACNONE 
J090003L01CCCCACACNONE 
Os12g0116900J023029P11CCCCACACNONE 
J023150B17CCCCACACNONE 
J075053O04CCCCACACNONE 
J075152K05CCCCACACNONE 
J075168M02CCCCACACNONE 
Os12g0160500AK120813GTGTGGGGNONE 
Os12g0188500Os12g0188500CCCCACACConserved hypothetical protein. 
Os12g0407100J075130F11GCCCCACACNONE 
J075150G14GCCCCACACConserved hypothetical protein. 
J090089B20GCCCCACACNONE 
J100042D22GCCCCACACNONE 
Os12g0479400AK065254CACACACCCCCACACCCACCACCCCACACNONE 
AK067061CACACACCCCCACACCCACCACCCCACACSimilar to Auxin response factor 1. 
Os12g0480000AK061316AGATGGGCCCCACACZinc finger, DHHC-type domain containing protein. 
Os12g0547500AK065586ACCCCCCACACGCalponin-like actin-binding domain containing protein. 
Os12g0554400AK072345GACACGTGGGCCCCACACGTetratricopeptide-like helical domain containing protein. 
Os12g0560300AK060332GGCCCCACACSimilar to NTGB2 (Fragment). 
AK099125GGCCCCACACNONE 
AK099149GGCCCCACACNONE 
J023044P12GGCCCCACACNONE 
J023063C05GGCCCCACACNONE 
J043006H11GGCCCCACACNONE 
J065055C21GGCCCCACACNONE 
J065104A14GGCCCCACACNONE 
J075156I06GGCCCCACACNONE 
J090083J19GGCCCCACACNONE 
J100069A17GGCCCCACACNONE 
Os12g0621100AK070737GCCCCCACACGSimilar to Filamentous flower-like yabby protein (Fragment). 
AK104918GCCCCCACACGNONE 
J013057J22GCCCCCACACGNONE 
J023025C05GCCCCCACACGNONE 
J023060E23GCCCCCACACGNONE 
J090041I07GCCCCCACACGNONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.