version

Summary of OsREG536 (All List)

OrganismOryza sativa  
IDOsREG536  
SequenceCCCCCACG  
Annotation  
PPDB Motif 
PLACE Motif 
Total Entry Count1004  

Entry Sequences (1004 entries)

LocusGene modelSequenceDescription
Os01g0175100AK071289ACCCCCCACGKv1.4 voltage-gated K+ channel family protein. 
J023088B10ACCCCCCACGNONE 
J065122H15ACCCCCCACGNONE 
J065140B19ACCCCCCACGNONE 
J100031E12ACCCCCCACGNONE 
J100068J03ACCCCCCACGNONE 
J100083E12ACCCCCCACGNONE 
Os01g0180300AK120377CGCGTGGGGGLipoprotein, type 6 family protein. 
J013071N06CGCGTGGGGGNONE 
J023088F12CGCGTGGGGGNONE 
J100027H24CGCGTGGGGGNONE 
J100053K15CGCGTGGGGGNONE 
J100082M15CGCGTGGGGGNONE 
Os01g0313300AJ575219GCCCCCACGCCACNONE 
AK111775GCCCCCACGCCACSimilar to EREBP-3 protein (Fragment). 
J023075G11GCCCCCACGCCACNONE 
J065086L01GCCCCCACGCCACNONE 
J065161K09GCCCCCACGCCACNONE 
J075019P13GCCCCCACGCCACNONE 
Os01g0571000AK066090CCCCCACGTMitochondrial substrate carrier family protein. 
AK121334CCCCCACGTNONE 
Os01g0610100006-029-C12ACCCCCCACGNONE 
006-050-D02ACCCCCCACGNONE 
006-099-A06ACCCCCCACGNONE 
009-029-G03ACCCCCCACGNONE 
009-158-F07ACCCCCCACGNONE 
AK059810ACCCCCCACGSimilar to Clone ZZZ51 mRNA sequence. 
AK104951ACCCCCCACGNONE 
J065067E14ACCCCCCACGNONE 
J065073H01ACCCCCCACGNONE 
J065094E10ACCCCCCACGNONE 
J075041P17ACCCCCCACGNONE 
J075051M22ACCCCCCACGNONE 
J075089J01ACCCCCCACGNONE 
J075119L21ACCCCCCACGNONE 
J075161I08ACCCCCCACGNONE 
J090072B22ACCCCCCACGNONE 
Os01g0646300AY464568CCCCCACGSimilar to RGA2 protein. 
J080011P15CCCCCACGNONE 
J080017D01CCCCCACGNONE 
J080017H05CCCCCACGNONE 
J080027A16CCCCCACGNONE 
J080039F17CCCCCACGNONE 
J080063E23CCCCCACGNONE 
J080067L23CCCCCACGNONE 
J080068H01CCCCCACGNONE 
J080071F01CCCCCACGNONE 
J080076J05CCCCCACGNONE 
J080092L17CCCCCACGNONE 
Os01g0667900013-097-A02GCGGGCCCCCACGGTGACGTCACCNONE 
014-011-C01GCGGGCCCCCACGGTGACGTCACCNONE 
AK105335GCGGGCCCCCACGGTGACGTCACCGlutaredoxin-like, plant II family protein. 
J065156F10GCGGGCCCCCACGGTGACGTCACCNONE 
J065163D22GCGGGCCCCCACGGTGACGTCACCNONE 
J065197J04GCGGGCCCCCACGGTGACGTCACCNONE 
J075122C02GCGGGCCCCCACGGTGACGTCACCNONE 
J100047L16GCGGGCCCCCACGGTGACGTCACCNONE 
Os01g0738600AK073479CGTGGGGGENTH/VHS domain containing protein. 
AK120616CGTGGGGGNONE 
J013046M12CGTGGGGGNONE 
J013152B11CGTGGGGGNONE 
J023007A09CGTGGGGGNONE 
J023007N03CGTGGGGGNONE 
J023042A01CGTGGGGGNONE 
J023059P06CGTGGGGGNONE 
J023113A05CGTGGGGGNONE 
J033044K11CGTGGGGGNONE 
J033082E04CGTGGGGGNONE 
J090033B13CGTGGGGGNONE 
J090062H08CGTGGGGGNONE 
J100086G23CGTGGGGGNONE 
Os01g0760600011-038-B09CCCCCACGCCACNONE 
AB110193CCCCCACGCCACNONE 
AK103133CCCCCACGCCACNONE 
AK104829CCCCCACGCCACNONE 
D14673CCCCCACGCCACNONE 
J023110C16CCCCCACGCCACNONE 
J033028M22CCCCCACGCCACNONE 
J033038A21CCCCCACGCCACNONE 
J033044D24CCCCCACGCCACNONE 
J033095C16CCCCCACGCCACNONE 
J090003F07CCCCCACGCCACNONE 
J090009P10CCCCCACGCCACNONE 
J090023K01CCCCCACGCCACNONE 
J090033G02CCCCCACGCCACNONE 
J090037I22CCCCCACGCCACNONE 
J090038A17CCCCCACGCCACNONE 
J090048K09CCCCCACGCCACNONE 
J090069N01CCCCCACGCCACNONE 
J090078C19CCCCCACGCCACNONE 
J090089P15CCCCCACGCCACNONE 
J090093D07CCCCCACGCCACNONE 
J090095H01CCCCCACGCCACNONE 
J100057J03CCCCCACGCCACNONE 
Os01g0767100AK109493GCCCCCACGTSimilar to Lysosomal Pro-X carboxypeptidase. 
Os01g0772500AK109736CTCCCCCACGAAGlycosyl transferase, family 14 protein. 
Os01g0793200AK059040CCCCCACGProtein prenyltransferase domain containing protein. 
Os01g0794100009-027-B12GCCCCCACGTNONE 
AK062404GCCCCCACGTConserved hypothetical protein. 
Os01g0833200AK121629TTCGGCCCCCACGConserved hypothetical protein. 
J023093N07TTCGGCCCCCACGNONE 
J033050C20TTCGGCCCCCACGNONE 
J080302F22TTCGGCCCCCACGNONE 
J080303H06TTCGGCCCCCACGNONE 
J080306J04TTCGGCCCCCACGNONE 
J080309K06TTCGGCCCCCACGNONE 
J080311E18TTCGGCCCCCACGNONE 
J080318A20TTCGGCCCCCACGNONE 
J100031F20TTCGGCCCCCACGNONE 
J100034P21TTCGGCCCCCACGNONE 
J100042K08TTCGGCCCCCACGNONE 
J100047H24TTCGGCCCCCACGNONE 
J100065C14TTCGGCCCCCACGNONE 
J100074E23TTCGGCCCCCACGNONE 
Os01g0863300014-030-D08CCCCCACGGGNONE 
AK111571CCCCCACGGGSimilar to MCB2 protein. 
J013071A13CCCCCACGGGNONE 
J075060E09CCCCCACGGGNONE 
J075138C14CCCCCACGGGNONE 
J075150M17CCCCCACGGGNONE 
Os01g0866200009-039-E12GCCCCCACGNONE 
J065059P16GCCCCCACGNONE 
J065063E21GCCCCCACGNONE 
J065078B21GCCCCCACGNONE 
J065079A11GCCCCCACGNONE 
J065087H15GCCCCCACGNONE 
J065137M10GCCCCCACGNONE 
J065138K24GCCCCCACGNONE 
J065142E08GCCCCCACGNONE 
J065171G11GCCCCCACGNONE 
J065183K15GCCCCCACGNONE 
J065192J05GCCCCCACGNONE 
J075151P09GCCCCCACGNONE 
J090020B17GCCCCCACGNONE 
J090067F15GCCCCCACGNONE 
J090070K06GCCCCCACGNONE 
J090094G13GCCCCCACGNONE 
J100081M20GCCCCCACGHistone H3. 
J100089D06GCCCCCACGNONE 
Os01g0866300006-087-C06GCCCCCACGNONE 
006-114-E01GCCCCCACGNONE 
J065202L13GCCCCCACGNONE 
Os01g0885600AK059523GCCCCCACGCGTEsterase/lipase/thioesterase domain containing protein. 
J065013G01GCCCCCACGCGTNONE 
J065063D03GCCCCCACGCGTNONE 
J065143H01GCCCCCACGCGTNONE 
J065146F08GCCCCCACGCGTNONE 
J065153D14GCCCCCACGCGTNONE 
J065170E02GCCCCCACGCGTNONE 
J065175M22GCCCCCACGCGTNONE 
J065186E13GCCCCCACGCGTNONE 
J075023J16GCCCCCACGCGTNONE 
J075176J06GCCCCCACGCGTNONE 
Os01g0891300AK063674CATCCCCCCACGTSimilar to Allyl alcohol dehydrogenase. 
AK063674GCCCCCACGSimilar to Allyl alcohol dehydrogenase. 
AK099151CATCCCCCCACGTNONE 
AK099151GCCCCCACGNONE 
Os01g0897600J065120F23CGTGGGGGCNONE 
Os01g0916300011-018-B12CCCCCACGTNONE 
AK063922CCCCCACGTSimilar to PQBP-1 protein (Nuclear protein containing a WW domain) (Npw38) (JM26 protein). 
AK103107CCCCCACGTNONE 
AK121061CCCCCACGTNONE 
AK121997CCCCCACGTNONE 
J033118P14CCCCCACGTNONE 
J065002N16CCCCCACGTNONE 
J065079B04CCCCCACGTNONE 
J065102J07CCCCCACGTNONE 
J065128F16CCCCCACGTNONE 
J065184D11CCCCCACGTNONE 
J065186A07CCCCCACGTNONE 
J075115C07CCCCCACGTNONE 
J075147C04CCCCCACGTNONE 
Os02g0121100012-035-F06CAAGGCCCACTCCCCCACGNONE 
013-031-H05CAAGGCCCACTCCCCCACGNONE 
013-058-E11CAAGGCCCACTCCCCCACGNONE 
014-010-D01CAAGGCCCACTCCCCCACGNONE 
AK070711CAAGGCCCACTCCCCCACGConserved hypothetical protein. 
AK119758CAAGGCCCACTCCCCCACGNONE 
J013033G12CAAGGCCCACTCCCCCACGNONE 
J023007M16CAAGGCCCACTCCCCCACGNONE 
J023020K20CAAGGCCCACTCCCCCACGNONE 
J023061H10CAAGGCCCACTCCCCCACGNONE 
J033027H20CAAGGCCCACTCCCCCACGNONE 
J033051E18CAAGGCCCACTCCCCCACGNONE 
J090005F12CAAGGCCCACTCCCCCACGNONE 
J090017A20CAAGGCCCACTCCCCCACGNONE 
J090018G11CAAGGCCCACTCCCCCACGNONE 
J090062C18CAAGGCCCACTCCCCCACGNONE 
J100027N10CAAGGCCCACTCCCCCACGNONE 
J100032L14CAAGGCCCACTCCCCCACGNONE 
J100045C14CAAGGCCCACTCCCCCACGNONE 
J100061M09CAAGGCCCACTCCCCCACGNONE 
J100062K11CAAGGCCCACTCCCCCACGNONE 
J100064H11CAAGGCCCACTCCCCCACGNONE 
J100074H16CAAGGCCCACTCCCCCACGNONE 
J100082N01CAAGGCCCACTCCCCCACGNONE 
Os02g0125300006-047-E06GCCCCCACGCGCGGGTNONE 
006-088-F09GCCCCCACGCGCGGGTNONE 
006-106-F10GCCCCCACGCGCGGGTNONE 
AB025926GCCCCCACGCGCGGGTNONE 
AK061564GCCCCCACGCGCGGGTNONE 
AK061953GCCCCCACGCGCGGGTNONE 
AK101060GCCCCCACGCGCGGGTBax inhibitor-1 (BI-1) (OsBI-1). 
J013072O21GCCCCCACGCGCGGGTNONE 
J023097A08GCCCCCACGCGCGGGTNONE 
J023133F03GCCCCCACGCGCGGGTNONE 
J033022C21GCCCCCACGCGCGGGTNONE 
J033073C21GCCCCCACGCGCGGGTNONE 
J033116O09GCCCCCACGCGCGGGTNONE 
J033120E01GCCCCCACGCGCGGGTNONE 
J065088M19GCCCCCACGCGCGGGTNONE 
J065135O04GCCCCCACGCGCGGGTNONE 
J080304J03GCCCCCACGCGCGGGTNONE 
J090001K14GCCCCCACGCGCGGGTNONE 
J090038D04GCCCCCACGCGCGGGTNONE 
J090045G09GCCCCCACGCGCGGGTNONE 
J090076E12GCCCCCACGCGCGGGTNONE 
J090077D21GCCCCCACGCGCGGGTNONE 
J100018J19GCCCCCACGCGCGGGTNONE 
J100029M12GCCCCCACGCGCGGGTNONE 
J100049D07GCCCCCACGCGCGGGTNONE 
J100067G21GCCCCCACGCGCGGGTNONE 
J100090D05GCCCCCACGCGCGGGTNONE 
Os02g0135600AK069843GACACGTGGGGGConserved hypothetical protein. 
J023034H09GACACGTGGGGGNONE 
J033090D08GACACGTGGGGGNONE 
J100025N07GACACGTGGGGGNONE 
J100075G18GACACGTGGGGGNONE 
Os02g0135700AK100570CCCCCACGTGTCDNA polymerase V family protein. 
Os02g0148400AK070451GGCCGTGGGGGCCCACTNONE 
AK072039GGCCGTGGGGGCCCACTPyridoxamine 5'-phosphate oxidase-related, FMN-binding domain containing protein. 
J075148J10GGCCGTGGGGGCCCACTNONE 
Os02g0193900AK069578CGCGTGGGGGAGConserved hypothetical protein. 
AK104014CGCGTGGGGGAGNONE 
J080308C08CGCGTGGGGGAGNONE 
J090043C09CGCGTGGGGGAGNONE 
Os02g0195500AK062207CTCCCCCACGGCCACGGCCNONE 
Os02g0198200J075078L15GCCCCACGTGTCATCCACCCCCACGNONE 
J075097G10GCCCCACGTGTCATCCACCCCCACGNONE 
J075099N12GCCCCACGTGTCATCCACCCCCACGNONE 
J075142K24GCCCCACGTGTCATCCACCCCCACGNONE 
J075199K14GCCCCACGTGTCATCCACCCCCACGNONE 
Os02g0208900003-126-D10ACCCCCCACGNONE 
AK066171ACCCCCCACGNONE 
AK070031ACCCCCCACGNONE 
AK121183ACCCCCCACGSimilar to ZIGA2 protein (Fragment). 
J013031N09ACCCCCCACGNONE 
J013045O19ACCCCCCACGNONE 
J023102A14ACCCCCCACGNONE 
J023145E14ACCCCCCACGNONE 
J033033E15ACCCCCCACGNONE 
J033041H19ACCCCCCACGNONE 
J033050E09ACCCCCCACGNONE 
J065191H21ACCCCCCACGNONE 
J065193C21ACCCCCCACGNONE 
J075068F07ACCCCCCACGNONE 
Os02g0232400AK120755CCCCCACGSimilar to Citrate synthase, glyoxysomal precursor (EC 2.3.3.1) (GCS). 
Os02g0282900AK121560CCCCCACGSimilar to 68 kDa protein HP68. 
Os02g0301100006-029-F04CCCCCACGAANONE 
012-005-F07CCCCCACGAANONE 
013-093-H10CCCCCACGAANONE 
015-042-B01CCCCCACGAANONE 
016-017-F09CCCCCACGAANONE 
016-079-B07CCCCCACGAANONE 
016-079-G03CCCCCACGAANONE 
016-087-F11CCCCCACGAANONE 
AK071676CCCCCACGAANONE 
AK100174CCCCCACGAAMtN3 and saliva related transmembrane protein family protein. 
AK104411CCCCCACGAANONE 
AK104467CCCCCACGAANONE 
J023069G02CCCCCACGAANONE 
J023108F17CCCCCACGAANONE 
J033042B04CCCCCACGAANONE 
J033128D06CCCCCACGAANONE 
J033138I12CCCCCACGAANONE 
J053064K16CCCCCACGAANONE 
J065088A12CCCCCACGAANONE 
J065102L08CCCCCACGAANONE 
J065104L14CCCCCACGAANONE 
J065117M20CCCCCACGAANONE 
J065117N14CCCCCACGAANONE 
J065120H23CCCCCACGAANONE 
J065135F06CCCCCACGAANONE 
J065138J17CCCCCACGAANONE 
J065138P06CCCCCACGAANONE 
J065156G16CCCCCACGAANONE 
J065163M20CCCCCACGAANONE 
J065176A14CCCCCACGAANONE 
J065182C02CCCCCACGAANONE 
J065200C05CCCCCACGAANONE 
J065213J22CCCCCACGAANONE 
J065217D24CCCCCACGAANONE 
J075009H03CCCCCACGAANONE 
J075020D10CCCCCACGAANONE 
J075026L24CCCCCACGAANONE 
J075028L01CCCCCACGAANONE 
J075057O09CCCCCACGAANONE 
J075089A20CCCCCACGAANONE 
J075094J15CCCCCACGAANONE 
J075103B11CCCCCACGAANONE 
J075143L13CCCCCACGAANONE 
J075153K15CCCCCACGAANONE 
J075161P22CCCCCACGAANONE 
J075166J06CCCCCACGAANONE 
J075177G06CCCCCACGAANONE 
J075198N06CCCCCACGAANONE 
Os02g0462800AK110587CCCCCACGCGWRKY transcription factor 42 (Transcription factor WRKY02). 
AY676923CCCCCACGCGNONE 
Os02g0513100AK103266CCCGTGGGGGGCCCACASimilar to MtN3 protein precursor. 
Os02g0530600AK102681CCCCCACGTCTCGCGTCTCBRCT domain containing protein. 
AK102681GTCCCACCCCCACGBRCT domain containing protein. 
Os02g0566700AK102754CCCCCACGConserved hypothetical protein. 
Os02g0613200AK064869GCCCCCACGTGGCNONE 
AK065051GCCCCCACGTGGCNONE 
AK098853GCCCCCACGTGGCConserved hypothetical protein. 
AK098974GCCCCCACGTGGCNONE 
J013000H15GCCCCCACGTGGCNONE 
J013001I18GCCCCCACGTGGCNONE 
J013022I18GCCCCCACGTGGCNONE 
J013025D06GCCCCCACGTGGCNONE 
J013037H17GCCCCCACGTGGCNONE 
J013043F22GCCCCCACGTGGCNONE 
J013075E01GCCCCCACGTGGCNONE 
J013088D09GCCCCCACGTGGCNONE 
J013088E19GCCCCCACGTGGCNONE 
J013102O18GCCCCCACGTGGCNONE 
J013110C08GCCCCCACGTGGCNONE 
J013118C06GCCCCCACGTGGCNONE 
J013119F22GCCCCCACGTGGCNONE 
J013128K14GCCCCCACGTGGCNONE 
J013158C17GCCCCCACGTGGCNONE 
J023013P15GCCCCCACGTGGCNONE 
J023044L21GCCCCCACGTGGCNONE 
J033023I04GCCCCCACGTGGCNONE 
J033038I22GCCCCCACGTGGCNONE 
J033095M02GCCCCCACGTGGCNONE 
J043022F05GCCCCCACGTGGCNONE 
J080307N20GCCCCCACGTGGCNONE 
J080315C02GCCCCCACGTGGCNONE 
J080316A15GCCCCCACGTGGCNONE 
J080316G03GCCCCCACGTGGCNONE 
J090029E24GCCCCCACGTGGCNONE 
J090031H15GCCCCCACGTGGCNONE 
J090034F13GCCCCCACGTGGCNONE 
J090047G02GCCCCCACGTGGCNONE 
J090069M24GCCCCCACGTGGCNONE 
J100052E15GCCCCCACGTGGCNONE 
Os02g0653800J023002B17CCCCCACGTNONE 
J033067E03CCCCCACGTSimilar to GTP-binding protein. 
J033105M04CCCCCACGTNONE 
J053039E15CCCCCACGTNONE 
J065026L07CCCCCACGTNONE 
J065038B03CCCCCACGTNONE 
J065087J15CCCCCACGTNONE 
J065121B22CCCCCACGTNONE 
J065128N12CCCCCACGTNONE 
J065189E19CCCCCACGTNONE 
J100058B03CCCCCACGTNONE 
Os02g0654700006-060-H09CACGTGGGGGATNONE 
AK073812CACGTGGGGGATSimilar to Ethylene-responsive transcription factor 5 (Ethylene-responsive element binding factor 5) (EREBP-5) (AtERF5). 
AK105940CACGTGGGGGATNONE 
AY831394CACGTGGGGGATNONE 
J013134K17CACGTGGGGGATNONE 
J023054H09CACGTGGGGGATNONE 
J033068P11CACGTGGGGGATNONE 
J065161B10CACGTGGGGGATNONE 
J065170K01CACGTGGGGGATNONE 
J100041G22CACGTGGGGGATNONE 
Os02g0690700AK102342CGTGGGGGCClathrin adaptor complex, medium chain family protein. 
J033024M23CGTGGGGGCNONE 
J033091B08CGTGGGGGCNONE 
J065021P06CGTGGGGGCNONE 
J075105B22CGTGGGGGCNONE 
J075181D03CGTGGGGGCNONE 
J090049L10CGTGGGGGCNONE 
J090083A11CGTGGGGGCNONE 
J090099I18CGTGGGGGCNONE 
J100081L02CGTGGGGGCNONE 
Os02g0709900AB110204ACCCCCCACGPrefoldin domain containing protein. 
AK109259ACCCCCCACGNONE 
J013093N22ACCCCCCACGNONE 
J033116F21ACCCCCCACGNONE 
Os02g0719100AK069715GCCCCCACGAASimilar to Fimbrin/plastin-like (Fragment). 
Os02g0730300AK098897ACCCCCCACGCGTCCNONE 
AK111629ACCCCCCACGCGTCCSimilar to Potassium transporter HAK3p (Fragment). 
Os02g0753000AK121015CCCCCACGTGSimilar to Trehalose-6-phosphate phosphatase. 
Os02g0761600AK120494CGTGGGGGConserved hypothetical protein. 
Os03g0109400AK102378CCCCCACGHomeobox domain containing protein. 
AK110678CCCCCACGNONE 
AY425991CCCCCACGNONE 
Os03g0127600AK103695CCCCCACGCGSMAD/FHA domain containing protein. 
J033136J18CCCCCACGCGNONE 
J075046D02CCCCCACGCGNONE 
J075093K04CCCCCACGCGNONE 
J075116M01CCCCCACGCGNONE 
Os03g0130400AK070255CCCCCACGAdenylate kinase, subfamily protein. 
Os03g0131300015-095-G06GGTCCACGTGGGGGCCCACCCNONE 
AK100656GGTCCACGTGGGGGCCCACCCUbiquitin domain containing protein. 
J033140O12GGTCCACGTGGGGGCCCACCCNONE 
J065112C14GGTCCACGTGGGGGCCCACCCNONE 
J090070D10GGTCCACGTGGGGGCCCACCCNONE 
Os03g0133100013-080-E12ATCCCCCACGNONE 
AK063608ATCCCCCACGHypothetical protein. 
AK119680ATCCCCCACGNONE 
J075192B05ATCCCCCACGNONE 
Os03g0143700AK066360GCCCCCACGConserved hypothetical protein. 
J013066M09GCCCCCACGNONE 
J023087N24GCCCCCACGNONE 
Os03g0145200J090048J08CCCCCACGTGZinc finger, GATA-type domain containing protein. 
Os03g0148700AK065978ACGTGGGGGCCGCASimilar to Calcium/calmodulin-regulated receptor-like kinase. 
Os03g0161000AK121425CCCCCACGGGTTTCGGCCNONE 
J023135K12CCCCCACGGGTTTCGGCCNONE 
Os03g0169100006-030-B01GCCCCCACGNONE 
006-098-E09GCCCCCACGNONE 
AF047444GCCCCCACGNONE 
AK061772GCCCCCACGNONE 
AK066306GCCCCCACGRibulose-phosphate 3-epimerase, chloroplast precursor (EC 5.1.3.1) (Pentose-5-phosphate 3-epimerase) (PPE) (RPE) (R5P3E). 
AK099215GCCCCCACGNONE 
J013025E07GCCCCCACGNONE 
J013040K21GCCCCCACGNONE 
J013045P06GCCCCCACGNONE 
J013058K11GCCCCCACGNONE 
J013063E18GCCCCCACGNONE 
J013072B22GCCCCCACGNONE 
J013096J08GCCCCCACGNONE 
J075189H20GCCCCCACGNONE 
J080039H06GCCCCCACGNONE 
J080040H17GCCCCCACGNONE 
Os03g0171900006-070-A01GCCCCCACGTGTCAGTGNONE 
AK061079GCCCCCACGTGTCAGTGNONE 
AK105642GCCCCCACGTGTCAGTGSimilar to Alanine:glyoxylate aminotransferase-like protein (Fragment). 
Os03g0180900AK073589CCCCCACGZIM domain containing protein. 
J023044O09CCCCCACGNONE 
J033051K03CCCCCACGNONE 
J043020I11CCCCCACGNONE 
J065005J15CCCCCACGNONE 
J065009L10CCCCCACGNONE 
J065121F02CCCCCACGNONE 
J065124M17CCCCCACGNONE 
J065140F24CCCCCACGNONE 
J065178M13CCCCCACGNONE 
J065178M14CCCCCACGNONE 
J065186G13CCCCCACGNONE 
J100053L08CCCCCACGNONE 
Os03g0192700012-005-H03CCCCCACGNONE 
012-006-B05CCCCCACGNONE 
012-006-E07CCCCCACGNONE 
012-051-D10CCCCCACGNONE 
014-089-H06CCCCCACGNONE 
015-034-C05CCCCCACGNONE 
015-042-C06CCCCCACGNONE 
015-059-E09CCCCCACGNONE 
015-096-A08CCCCCACGNONE 
016-030-D06CCCCCACGNONE 
016-053-H07CCCCCACGNONE 
016-064-D02CCCCCACGNONE 
AB012107CCCCCACGNONE 
AK058750CCCCCACGSimilar to Myo-inositol-1-phosphate synthase. 
AK103501CCCCCACGNONE 
J023102F09CCCCCACGNONE 
J023103H09CCCCCACGNONE 
J023107F22CCCCCACGNONE 
J033031E17CCCCCACGNONE 
J033090C03CCCCCACGNONE 
J033090C17CCCCCACGNONE 
J033091K19CCCCCACGNONE 
J033131B11CCCCCACGNONE 
J033133D04CCCCCACGNONE 
J053050C09CCCCCACGNONE 
J053078O12CCCCCACGNONE 
J075037B10CCCCCACGNONE 
J090021M23CCCCCACGNONE 
Os03g0197300AK102651CACGCCACGCCACCCCCACGTCGCGCGCCupin, RmlC-type domain containing protein. 
Os03g0218300015-078-G09CGTGGGGGCConserved hypothetical protein. 
J090095I10CGTGGGGGCNONE 
Os03g0228900J065037A17GCCCCCACGCGNONE 
J065053L23GCCCCCACGCGNONE 
J065061G13GCCCCCACGCGNONE 
J065100L21GCCCCCACGCGNONE 
J065101C08GCCCCCACGCGNONE 
J065112B13GCCCCCACGCGHypothetical protein. 
J065114G11GCCCCCACGCGNONE 
J065122L03GCCCCCACGCGNONE 
J065127B04GCCCCCACGCGNONE 
Os03g0243350J065025D24CGTGGGGGNONE 
J065046A15CGTGGGGGHypothetical protein. 
J065064E08CGTGGGGGNONE 
Os03g0246800AK070145CCCCCACGCCCAGATNONE 
AK102770CCCCCACGCCCAGATNONE 
Os03g0261800AK060717CCCCCACGGGNONE 
AK121181CCCCCACGGGConserved hypothetical protein. 
J023084D19CCCCCACGGGNONE 
J065127D11CCCCCACGGGNONE 
J065179G15CCCCCACGGGNONE 
J090050I07CCCCCACGGGNONE 
Os03g0271500AK068546CGTGGGGGAGNONE 
AK109239CGTGGGGGAGConserved hypothetical protein. 
J013157P04CGTGGGGGAGNONE 
J075041K23CGTGGGGGAGNONE 
Os03g0272300AK060183CGTGGGGGATNONE 
AK071865CGTGGGGGATZinc finger, RING-type domain containing protein. 
Os03g0300300AK099693CGTGGGGGCWD40-like domain containing protein. 
Os03g0323100009-108-G02ACGTGGGGGNONE 
AK062803ACGTGGGGGHypothetical protein. 
AK070776ACGTGGGGGNONE 
Os03g0323200AK067323CCCCCACGTSimilar to Protoporphyrin IX Mg-chelatase subunit precursor. 
Os03g0327100006-119-C12CGTGGGGGCGAGGNONE 
011-018-C10CGTGGGGGCGAGGNONE 
AK065989CGTGGGGGCGAGGSimilar to CUC1. 
J013046E14CGTGGGGGCGAGGNONE 
J065066N20CGTGGGGGCGAGGNONE 
Os03g0379300006-039-F11GCCCCCACGTGNONE 
AK061515GCCCCCACGTGBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
AK068704GCCCCCACGTGNONE 
J013159M16GCCCCCACGTGNONE 
J090067F01GCCCCCACGTGNONE 
J090083F21GCCCCCACGTGNONE 
J100040M08GCCCCCACGTGNONE 
J100048C03GCCCCCACGTGNONE 
J100056M07GCCCCCACGTGNONE 
J100062N22GCCCCCACGTGNONE 
J100086L07GCCCCCACGTGNONE 
Os03g0411800009-042-G11AGATGGGCCCCCACGTNONE 
AK121551AGATGGGCCCCCACGTSimilar to Metal transport protein. 
AY302059AGATGGGCCCCCACGTNONE 
J013095L05AGATGGGCCCCCACGTNONE 
J033033B06AGATGGGCCCCCACGTNONE 
J033118G11AGATGGGCCCCCACGTNONE 
Os03g0624600009-086-F08CCCCCACGNONE 
AK062675CCCCCACGNo apical meristem (NAM) protein domain containing protein. 
J100090F17CCCCCACGNONE 
Os03g0667100012-045-B01ACCCCCCACGTNONE 
AK065363ACCCCCCACGTBTB domain containing protein. 
AK065952ACCCCCCACGTNONE 
J013045I05ACCCCCCACGTNONE 
J013129F20ACCCCCCACGTNONE 
Os03g0670200011-069-G05CCCCCACGTGGCNONE 
AK069553CCCCCACGTGGCSimilar to YJR013Wp (Fragment). 
J023020O11CCCCCACGTGGCNONE 
J023114J22CCCCCACGTGGCNONE 
J100084F17CCCCCACGTGGCNONE 
J100087A11CCCCCACGTGGCNONE 
Os03g0704100003-129-D05GCCCCCACGTNONE 
AK070474GCCCCCACGTPAP fibrillin family protein. 
Os03g0713100J013039M09CCCCCACGCCTCNONE 
J023007K01CCCCCACGCCTCNONE 
J023073H01CCCCCACGCCTCNONE 
J023087M20CCCCCACGCCTCNONE 
J023142E01CCCCCACGCCTCNONE 
J033048E03CCCCCACGCCTCNONE 
J033048F03CCCCCACGCCTCSimilar to Dynamin-related protein 1C (Dynamin-like protein C) (Dynamin-like protein 5) (Dynamin-like protein DLP1). 
J033058C11CCCCCACGCCTCNONE 
J033074M20CCCCCACGCCTCNONE 
J033084M11CCCCCACGCCTCNONE 
J033091I23CCCCCACGCCTCNONE 
J033100C08CCCCCACGCCTCNONE 
J033123K19CCCCCACGCCTCNONE 
J090006P21CCCCCACGCCTCNONE 
J090045O16CCCCCACGCCTCNONE 
J100087M13CCCCCACGCCTCNONE 
Os03g0737600014-094-E01CTCCCCCACGGGNONE 
AB038234CTCCCCCACGGGNONE 
AK101854CTCCCCCACGGGCyclin H-1. 
AK105468CTCCCCCACGGGNONE 
J033069N12CTCCCCCACGGGNONE 
J043017A22CTCCCCCACGGGNONE 
J065154A20CTCCCCCACGGGNONE 
Os03g0754800AK101584ATCCCCCACGMitochondrial substrate carrier family protein. 
J080305A09ATCCCCCACGNONE 
J080310E24ATCCCCCACGNONE 
J080310O12ATCCCCCACGNONE 
J080311N04ATCCCCCACGNONE 
J080313N20ATCCCCCACGNONE 
J080317H24ATCCCCCACGNONE 
Os03g0762400AK071181ACGTGGGGGCSimilar to Peroxidase2 precursor (EC 1.11.1.7). 
J023084I20ACGTGGGGGCNONE 
J033039C18ACGTGGGGGCNONE 
J033108N03ACGTGGGGGCNONE 
J043017N16ACGTGGGGGCNONE 
J065026C13ACGTGGGGGCNONE 
J065045C01ACGTGGGGGCNONE 
J065045D11ACGTGGGGGCNONE 
J065050N09ACGTGGGGGCNONE 
J065058P21ACGTGGGGGCNONE 
J065075I20ACGTGGGGGCNONE 
J065077I17ACGTGGGGGCNONE 
J065081I20ACGTGGGGGCNONE 
J065085B14ACGTGGGGGCNONE 
J065101K21ACGTGGGGGCNONE 
J065112A17ACGTGGGGGCNONE 
J065112N13ACGTGGGGGCNONE 
J065118J02ACGTGGGGGCNONE 
J065123E01ACGTGGGGGCNONE 
J065134N12ACGTGGGGGCNONE 
J065139L04ACGTGGGGGCNONE 
J065141I11ACGTGGGGGCNONE 
J065161J24ACGTGGGGGCNONE 
J065164I10ACGTGGGGGCNONE 
J065171L01ACGTGGGGGCNONE 
J065178P21ACGTGGGGGCNONE 
J065185L24ACGTGGGGGCNONE 
J065219C04ACGTGGGGGCNONE 
J075029B07ACGTGGGGGCNONE 
J075033G20ACGTGGGGGCNONE 
J075054N01ACGTGGGGGCNONE 
J075068B22ACGTGGGGGCNONE 
J075096N11ACGTGGGGGCNONE 
J075098C11ACGTGGGGGCNONE 
J075115J22ACGTGGGGGCNONE 
J075127D11ACGTGGGGGCNONE 
J075156J21ACGTGGGGGCNONE 
J075166G08ACGTGGGGGCNONE 
J075166P17ACGTGGGGGCNONE 
J075170O18ACGTGGGGGCNONE 
J075181A16ACGTGGGGGCNONE 
J075195J11ACGTGGGGGCNONE 
Os03g0859550J065092L21CGTGGGGGCTCAGCTGGGCCTCConserved hypothetical protein. 
Os04g0119500AJ698084ATCCCCCACGNONE 
AK061898ATCCCCCACGNONE 
AK065035ATCCCCCACGSimilar to Membrane related protein-like. 
J013001H07ATCCCCCACGNONE 
J013128B11ATCCCCCACGNONE 
J013153L13ATCCCCCACGNONE 
J013157F08ATCCCCCACGNONE 
J065140L14ATCCCCCACGNONE 
J075147J12ATCCCCCACGNONE 
J090087C14ATCCCCCACGNONE 
J100048O09ATCCCCCACGNONE 
J100051O16ATCCCCCACGNONE 
J100083H22ATCCCCCACGNONE 
Os04g0382100AK108218CGTGGGGGCSWIB/MDM2 domain containing protein. 
J065059M07CGTGGGGGCNONE 
J065104M04CGTGGGGGCNONE 
Os04g0405500011-007-D12ACCCCCCACGTGNONE 
011-007-D12GCCCCCACGNONE 
AK063263ACCCCCCACGTGConserved hypothetical protein. 
AK063263GCCCCCACGConserved hypothetical protein. 
J065166G19ACCCCCCACGTGNONE 
J065166G19GCCCCCACGNONE 
J075180M09ACCCCCCACGTGNONE 
J075180M09GCCCCCACGNONE 
Os04g0445200009-034-A06ACCCCCCACGNONE 
AK062427ACCCCCCACGProtein of unknown function DUF861, cupin_3 domain containing protein. 
AK119720ACCCCCCACGNONE 
J065022E20ACCCCCCACGNONE 
J065062D16ACCCCCCACGNONE 
J065081I02ACCCCCCACGNONE 
J065087C10ACCCCCCACGNONE 
J065116N16ACCCCCCACGNONE 
J065132F10ACCCCCCACGNONE 
J065140F18ACCCCCCACGNONE 
J065143M22ACCCCCCACGNONE 
J065158K17ACCCCCCACGNONE 
J065162D07ACCCCCCACGNONE 
J065207H19ACCCCCCACGNONE 
J075155B20ACCCCCCACGNONE 
J075167E24ACCCCCCACGNONE 
J075178B19ACCCCCCACGNONE 
J080301D22ACCCCCCACGNONE 
J080301J15ACCCCCCACGNONE 
J080308J02ACCCCCCACGNONE 
Os04g0461400AK066992CGTGGGGGCHypothetical protein. 
J013089P17CGTGGGGGCNONE 
Os04g0477500AK063950GCCCCCACGNONE 
AK067372GCCCCCACGGlycosyl transferase, family 17 protein. 
AK100897GCCCCCACGNONE 
J013106K01GCCCCCACGNONE 
J065025M07GCCCCCACGNONE 
J065025M08GCCCCCACGNONE 
Os04g0535200012-036-D08CCCCCACGCGNONE 
AK060585CCCCCACGCGNONE 
AK101505CCCCCACGCGNONE 
AK119767CCCCCACGCGPeptidase A1, pepsin family protein. 
J033044F04CCCCCACGCGNONE 
J065167K19CCCCCACGCGNONE 
J075017H22CCCCCACGCGNONE 
J075180E03CCCCCACGCGNONE 
J080025H04CCCCCACGCGNONE 
J080026P04CCCCCACGCGNONE 
J080029A01CCCCCACGCGNONE 
J080034L18CCCCCACGCGNONE 
J080038J07CCCCCACGCGNONE 
J080053L24CCCCCACGCGNONE 
J080071P08CCCCCACGCGNONE 
J080093F09CCCCCACGCGNONE 
Os04g0558700AK110633CTCCCCCACGTConserved hypothetical protein. 
Os04g0561500AK065953CCCCCACGTGSimilar to Prolyl endopeptidase (EC 3.4.21.26) (Post-proline cleaving enzyme) (PE). 
AK069664CCCCCACGTGNONE 
Os04g0579700AK065545CCCCCACGSimilar to Predicted protein. 
J013034F23CCCCCACGNONE 
J023056P03CCCCCACGNONE 
J033108M23CCCCCACGNONE 
J065061L24CCCCCACGNONE 
J065062K23CCCCCACGNONE 
J090038B10CCCCCACGNONE 
J090043L24CCCCCACGNONE 
J090080J08CCCCCACGNONE 
J090082E14CCCCCACGNONE 
Os04g0602800AK100925CCCCCACGSimilar to Yarrowia lipolytica chromosome D of strain CLIB99 of Yarrowia lipolytica. 
Os04g0623300AK064902GCCCCCACGTSimilar to Flavin-containing monamine oxidase family protein. 
Os04g0683900004-009-A11CGTGGGGGCNONE 
014-076-H12CGTGGGGGCNONE 
AK060880CGTGGGGGCNONE 
AK099749CGTGGGGGCHMG-I and HMG-Y, DNA-binding domain containing protein. 
AK100309CGTGGGGGCNONE 
J013050K21CGTGGGGGCNONE 
J013092E09CGTGGGGGCNONE 
J013095N06CGTGGGGGCNONE 
J013095P07CGTGGGGGCNONE 
J013130D22CGTGGGGGCNONE 
J013134O15CGTGGGGGCNONE 
J023022I06CGTGGGGGCNONE 
J023062L11CGTGGGGGCNONE 
J023078J11CGTGGGGGCNONE 
J023086J01CGTGGGGGCNONE 
J033125A20CGTGGGGGCNONE 
J065023K13CGTGGGGGCNONE 
J065045N02CGTGGGGGCNONE 
J065129F01CGTGGGGGCNONE 
J065164H14CGTGGGGGCNONE 
J065192H09CGTGGGGGCNONE 
J075064P15CGTGGGGGCNONE 
J075088G17CGTGGGGGCNONE 
J075199D20CGTGGGGGCNONE 
Os05g0169300AK071481CCCCCACGTGNONE 
AK071687CCCCCACGTGAllinase, C-terminal domain containing protein. 
J023091A07CCCCCACGTGNONE 
Os05g0195200015-031-H09CCCCCACGTGGGNONE 
015-031-H09GCCCCCACGTGTCNONE 
015-070-C11CCCCCACGTGGGNONE 
015-070-C11GCCCCCACGTGTCNONE 
016-063-C11CCCCCACGTGGGNONE 
016-063-C11GCCCCCACGTGTCNONE 
AK106392CCCCCACGTGGGZinc finger, CCCH-type domain containing protein. 
AK106392GCCCCCACGTGTCZinc finger, CCCH-type domain containing protein. 
J033051N05CCCCCACGTGGGNONE 
J033051N05GCCCCCACGTGTCNONE 
J065118P05CCCCCACGTGGGNONE 
J065118P05GCCCCCACGTGTCNONE 
J100071H15CCCCCACGTGGGNONE 
J100071H15GCCCCCACGTGTCNONE 
J100078J22CCCCCACGTGGGNONE 
J100078J22GCCCCCACGTGTCNONE 
Os05g0291700AK073234CATCCCCCACGCGTNONE 
AK099865CATCCCCCACGCGTConserved hypothetical protein. 
AK108453CATCCCCCACGCGTNONE 
Os05g0295100AK100239CCCGTGGGGGCCCGProtein of unknown function DUF1253 family protein. 
AK108559CCCGTGGGGGCCCGNONE 
Os05g0358500AK060575CCCCCACGCCTCNONE 
AK100777CCCCCACGCCTCProtein phosphatase 2C-like domain containing protein. 
Os05g0384300AK107183ACGTGGGGGCPeptidase A1, pepsin family protein. 
Os05g0385400AK109014CCCCCACGConserved hypothetical protein. 
Os05g0408200AK100057CCCCCACGSBP domain containing protein. 
J065182F20CCCCCACGNONE 
Os05g0453700009-171-G06CTCCCCCACGNONE 
015-019-F02CTCCCCCACGNONE 
AB110169CTCCCCCACGNONE 
AK063881CTCCCCCACGSimilar to ENOD18 protein (Fragment). 
AK073600CTCCCCCACGNONE 
J033048I03CTCCCCCACGNONE 
J065026A09CTCCCCCACGNONE 
J065028M08CTCCCCCACGNONE 
J075140N01CTCCCCCACGNONE 
Os05g0461300AK111917CCCCCACGCGSimilar to RAB8C. 
AK111946CCCCCACGCGNONE 
AK111972CCCCCACGCGNONE 
AK112021CCCCCACGCGNONE 
J033135H16CCCCCACGCGNONE 
J043036O11CCCCCACGCGNONE 
Os05g0463800AB095439ACCCCCCACGCGNONE 
AK100811ACCCCCCACGCGSimilar to CCAAT-binding transcription factor-like protein (Fragment). 
AY224530ACCCCCCACGCGNONE 
J023075E18ACCCCCCACGCGNONE 
J023121O11ACCCCCCACGCGNONE 
Os05g0521600013-027-G05ATCCCCCACGNONE 
AK063238ATCCCCCACGVirulence factor, pectin lyase fold family protein. 
Os05g0567100015-030-G11GCCCCCACGNONE 
AK066453GCCCCCACGNONE 
AK067742GCCCCCACGNONE 
AK098906GCCCCCACGNONE 
AK098911GCCCCCACGNONE 
AK103421GCCCCCACGNONE 
AK104838GCCCCCACGNONE 
D32144GCCCCCACGAspartic proteinase oryzasin 1 precursor (EC 3.4.23.-). 
J013002D14GCCCCCACGNONE 
J013002H22GCCCCCACGNONE 
J013022G01GCCCCCACGNONE 
J013039N15GCCCCCACGNONE 
J023007F19GCCCCCACGNONE 
J023107B10GCCCCCACGNONE 
J033038D21GCCCCCACGNONE 
J033043E23GCCCCCACGNONE 
J033061A06GCCCCCACGNONE 
Os06g0134800014-049-H04CGCCACGTCTCTCCCCCACGCGTNONE 
AK063692CGCCACGTCTCTCCCCCACGCGTGlycine cleavage T protein (aminomethyl transferase) family protein. 
Os06g0135900AK100230CCCCCACGSimilar to Sec1p-like protein 2 (Fragment). 
Os06g0168600AK068858ACGCGTGGGGGSimilar to Ribonucleotide reductase. 
Os06g0192800AK070038CTCCCCCACGTSimilar to RING-H2 finger protein ATL1R (RING-H2 finger protein ATL8). 
J065057C13CTCCCCCACGTNONE 
J100067A03CTCCCCCACGTNONE 
Os06g0232000006-109-B11GCCCCCACGNONE 
011-080-C04GCCCCCACGNONE 
016-019-G01GCCCCCACGNONE 
AB110192GCCCCCACGNONE 
AK068966GCCCCCACGNONE 
AK071776GCCCCCACGConserved hypothetical protein. 
AK106053GCCCCCACGNONE 
J013146K14GCCCCCACGNONE 
J023013A10GCCCCCACGNONE 
J023029O20GCCCCCACGNONE 
J023110G05GCCCCCACGNONE 
J023135H04GCCCCCACGNONE 
J033125H14GCCCCCACGNONE 
J043009N01GCCCCCACGNONE 
J090096E06GCCCCCACGNONE 
J100070G19GCCCCCACGNONE 
Os06g0590301J033139K16CGCGTGGGGGCNONE 
J065011M13CGCGTGGGGGCNONE 
J065027D20CGCGTGGGGGCNONE 
J065039O05CGCGTGGGGGCGlucose/ribitol dehydrogenase family protein. 
J065051O10CGCGTGGGGGCNONE 
J065128I21CGCGTGGGGGCNONE 
J065163P10CGCGTGGGGGCNONE 
J065169H02CGCGTGGGGGCNONE 
Os06g0597600AK120804ACGTGGGGGAromatic-ring hydroxylase family protein. 
Os06g0678200AK059456CCCCCACGCCGGCCCCACGTGTCNONE 
AK071299CCCCCACGCCGGCCCCACGTGTCSimilar to Geranyl diphosphate synthase. 
Os06g0703800AK066056CGTGGGGGConserved hypothetical protein. 
J013052F01CGTGGGGGNONE 
J043013B13CGTGGGGGNONE 
J053048L08CGTGGGGGNONE 
J053057L01CGTGGGGGNONE 
J065010K18CGTGGGGGNONE 
J065070J10CGTGGGGGNONE 
J065139E08CGTGGGGGNONE 
J075048B04CGTGGGGGNONE 
J075078N08CGTGGGGGNONE 
J075089C03CGTGGGGGNONE 
Os07g0124600AK073437CCCCCACGAARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J033042K24CCCCCACGAANONE 
J033136G07CCCCCACGAANONE 
J065092I12CCCCCACGAANONE 
J065132F04CCCCCACGAANONE 
J065143I11CCCCCACGAANONE 
Os07g0459200AK066819CTCCCCCACGTGTCNONE 
AK102099CTCCCCCACGTGTCSimilar to Possible kinase. 
Os07g0501100AK110924CTCCCCCACGSimilar to Chalcone synthase 2 (EC 2.3.1.74) (Naringenin-chalcone synthase 2). 
Os07g0545400009-136-E03CCCAGCCCCCACGNONE 
013-015-G08CCCAGCCCCCACGNONE 
AK059228CCCAGCCCCCACGNONE 
J065040D09CCCAGCCCCCACGNONE 
J065051C19CCCAGCCCCCACGNONE 
J065139B05CCCAGCCCCCACGNONE 
J065160E20CCCAGCCCCCACGNONE 
J065207I17CCCAGCCCCCACGNONE 
J080319M24CCCAGCCCCCACGNONE 
Os07g0568900009-083-H02TTATGGGCCCCCACGNONE 
AK062660TTATGGGCCCCCACGConserved hypothetical protein. 
Os07g0569000AK073915CGTGGGGGCCCATAAConserved hypothetical protein. 
Os08g0374800012-075-F07GGTGGGCCCCCACGNONE 
AB096863GGTGGGCCCCCACGNONE 
AK066269GGTGGGCCCCCACGSimilar to UDP-galactose 4-epimerase-like protein. 
J013059D16GGTGGGCCCCCACGNONE 
J033132O05GGTGGGCCCCCACGNONE 
J065044E20GGTGGGCCCCCACGNONE 
J065139E23GGTGGGCCCCCACGNONE 
J075065B03GGTGGGCCCCCACGNONE 
J090050M10GGTGGGCCCCCACGNONE 
J090094F08GGTGGGCCCCCACGNONE 
J100031C21GGTGGGCCCCCACGNONE 
J100050I23GGTGGGCCCCCACGNONE 
J100081I16GGTGGGCCCCCACGNONE 
Os08g0459100AK121795CTTGGGCCCGCCCCCACGTLeucine-rich repeat, cysteine-containing containing protein. 
Os08g0461800012-071-E12ACCCCCCACGNONE 
AK066516ACCCCCCACGNONE 
AK067364ACCCCCCACGConserved hypothetical protein. 
AK098966ACCCCCCACGNONE 
Os08g0474000009-121-F01CGCGTGGGGGATNONE 
009-124-B06CGCGTGGGGGATNONE 
AK062882CGCGTGGGGGATSimilar to AP2 domain containing protein RAP2.6 (Fragment). 
Os08g0533700AK073691TTCGTGGGGGATConserved hypothetical protein. 
J033060E01TTCGTGGGGGATNONE 
J033111N06TTCGTGGGGGATNONE 
J053025N12TTCGTGGGGGATNONE 
J053080P18TTCGTGGGGGATNONE 
J053098H09TTCGTGGGGGATNONE 
J090076L19TTCGTGGGGGATNONE 
J100056A18TTCGTGGGGGATNONE 
Os09g0111800004-013-C09CGTGGGGGAGNONE 
006-085-E01CGTGGGGGAGNONE 
016-037-E02CGTGGGGGAGNONE 
AK060898CGTGGGGGAGNONE 
AK069338CGTGGGGGAGRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J013039A09CGTGGGGGAGNONE 
J023012N03CGTGGGGGAGNONE 
J033029N15CGTGGGGGAGNONE 
J033064E17CGTGGGGGAGNONE 
J080305G19CGTGGGGGAGNONE 
J080305N02CGTGGGGGAGNONE 
J080306B09CGTGGGGGAGNONE 
J080310C20CGTGGGGGAGNONE 
J080311A20CGTGGGGGAGNONE 
J080311G17CGTGGGGGAGNONE 
J080316J11CGTGGGGGAGNONE 
J090054J05CGTGGGGGAGNONE 
J090055M10CGTGGGGGAGNONE 
J090059H08CGTGGGGGAGNONE 
Os09g0119100AK102931CATCCCCCACGUBA-like domain containing protein. 
Os09g0360400009-192-H06CCCCCACGTGNONE 
AK071395CCCCCACGTGConserved hypothetical protein. 
J013045J21CCCCCACGTGNONE 
J023095O09CCCCCACGTGNONE 
J065207K01CCCCCACGTGNONE 
Os09g0436500AK107460CGTGGGGGCNONE 
Os09g0464000AK060777CCCCCACGTGNONE 
AK069530CCCCCACGTGSimilar to Carbonate dehydratase-like protein. 
Os09g0493800011-053-H02CGTGGGGGATNONE 
015-024-E10CGTGGGGGATNONE 
AK103057CGTGGGGGATSimilar to Chaperone protein dnaJ 10 (AtJ10) (AtDjC10). 
AK105408CGTGGGGGATNONE 
J033117K03CGTGGGGGATNONE 
J065135F16CGTGGGGGATNONE 
J065140A21CGTGGGGGATNONE 
J075018O14CGTGGGGGATNONE 
J075033C15CGTGGGGGATNONE 
Os09g0533900003-104-E05CACACACCCCCACGCGNONE 
012-076-C03CACACACCCCCACGCGNONE 
AK067774CACACACCCCCACGCGNONE 
AK100449CACACACCCCCACGCGSimilar to CEL5=CELLULASE 5 (Fragment). 
J013048F07CACACACCCCCACGCGNONE 
J023026E11CACACACCCCCACGCGNONE 
J023028B20CACACACCCCCACGCGNONE 
J023050P11CACACACCCCCACGCGNONE 
J023052K08CACACACCCCCACGCGNONE 
J023075J03CACACACCCCCACGCGNONE 
J023078E15CACACACCCCCACGCGNONE 
J023090P12CACACACCCCCACGCGNONE 
J023120E01CACACACCCCCACGCGNONE 
J023142K01CACACACCCCCACGCGNONE 
J033027K23CACACACCCCCACGCGNONE 
J033058A09CACACACCCCCACGCGNONE 
J033058C12CACACACCCCCACGCGNONE 
J033125A04CACACACCCCCACGCGNONE 
J043040L01CACACACCCCCACGCGNONE 
J053061D06CACACACCCCCACGCGNONE 
J053096N13CACACACCCCCACGCGNONE 
J065193H10CACACACCCCCACGCGNONE 
J090075L17CACACACCCCCACGCGNONE 
J100050D10CACACACCCCCACGCGNONE 
Os11g0147800005-013-G01TGCGGCCCCCACGTNONE 
006-022-F04TGCGGCCCCCACGTNONE 
006-029-E06TGCGGCCCCCACGTNONE 
006-036-H09TGCGGCCCCCACGTNONE 
006-043-F11TGCGGCCCCCACGTNONE 
006-045-G11TGCGGCCCCCACGTNONE 
006-062-C07TGCGGCCCCCACGTNONE 
006-062-G04TGCGGCCCCCACGTNONE 
006-063-C01TGCGGCCCCCACGTNONE 
006-065-A03TGCGGCCCCCACGTNONE 
006-074-E02TGCGGCCCCCACGTNONE 
006-076-H11TGCGGCCCCCACGTNONE 
006-078-E12TGCGGCCCCCACGTNONE 
006-098-A12TGCGGCCCCCACGTNONE 
006-103-B01TGCGGCCCCCACGTNONE 
006-107-C01TGCGGCCCCCACGTNONE 
006-111-D09TGCGGCCCCCACGTNONE 
006-113-H09TGCGGCCCCCACGTNONE 
006-118-D07TGCGGCCCCCACGTNONE 
006-120-B04TGCGGCCCCCACGTNONE 
009-064-G07TGCGGCCCCCACGTNONE 
009-200-A06TGCGGCCCCCACGTNONE 
AK071762TGCGGCCCCCACGTNONE 
AK102998TGCGGCCCCCACGTNONE 
AK104445TGCGGCCCCCACGTNONE 
AK105169TGCGGCCCCCACGTNONE 
AK119185TGCGGCCCCCACGTSimilar to Wali7 protein (Fragment). 
Os11g0163500AK101154CGCGTGGGGGCHomeodomain-like containing protein. 
Os11g0586300AK072257CTCCCCCACGTConserved hypothetical protein. 
AK072257TGTGGGCCCCACACCCCCCACGConserved hypothetical protein. 
Os12g0175700AK069143CCCCCACGNonaspanin (TM9SF) family protein. 
Os12g0620400015-008-B10CTCCCCCACGNONE 
AK059006CTCCCCCACGNONE 
AK059973CTCCCCCACGNONE 
AK063843CTCCCCCACGMethyl-CpG binding domain containing protein. 
AK072503CTCCCCCACGNONE 
AK072934CTCCCCCACGNONE 
J023126H05CTCCCCCACGNONE 
J023131G11CTCCCCCACGNONE 
J023146E17CTCCCCCACGNONE 
J033064P08CTCCCCCACGNONE 
J033095L07CTCCCCCACGNONE 
J065101N06CTCCCCCACGNONE 
J065186F11CTCCCCCACGNONE 
J065215J15CTCCCCCACGNONE 
J080049H05CTCCCCCACGNONE 
J080059L05CTCCCCCACGNONE 
J080061M17CTCCCCCACGNONE 
J080063D16CTCCCCCACGNONE 
J090012D01CTCCCCCACGNONE 
J090023D20CTCCCCCACGNONE 
J090040A09CTCCCCCACGNONE 
J090044K08CTCCCCCACGNONE 
J100019H03CTCCCCCACGNONE 
J100054N04CTCCCCCACGNONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.