version

Summary of OsREG537 (All List)

OrganismOryza sativa  
IDOsREG537  
SequenceCCCCCGCG  
Annotation  
PPDB Motif 
PLACE Motif 
Total Entry Count1811  

Entry Sequences (1811 entries)

LocusGene modelSequenceDescription
Os01g0159600013-096-A02CCCCCGCGNONE 
AK064055CCCCCGCGSmall hydrophilic plant seed protein family protein. 
AK122153CCCCCGCGNONE 
J033073N07CCCCCGCGNONE 
J033088A13CCCCCGCGNONE 
J033143J06CCCCCGCGNONE 
J053031D05CCCCCGCGNONE 
J053037K14CCCCCGCGNONE 
J053045E08CCCCCGCGNONE 
J053062D01CCCCCGCGNONE 
J053083H22CCCCCGCGNONE 
J053089G12CCCCCGCGNONE 
J053089G24CCCCCGCGNONE 
J053099O13CCCCCGCGNONE 
J065070H11CCCCCGCGNONE 
J075013L17CCCCCGCGNONE 
J075021L24CCCCCGCGNONE 
J075033B10CCCCCGCGNONE 
J075034G01CCCCCGCGNONE 
J075035A11CCCCCGCGNONE 
J075045F22CCCCCGCGNONE 
J075046N02CCCCCGCGNONE 
J075047K11CCCCCGCGNONE 
J075058N15CCCCCGCGNONE 
J075059E22CCCCCGCGNONE 
J075061G22CCCCCGCGNONE 
J075078E12CCCCCGCGNONE 
J075079B08CCCCCGCGNONE 
J075090K12CCCCCGCGNONE 
J075096P05CCCCCGCGNONE 
J075097G05CCCCCGCGNONE 
J075097O15CCCCCGCGNONE 
J075101J04CCCCCGCGNONE 
J075104K17CCCCCGCGNONE 
J075110F15CCCCCGCGNONE 
J075118D23CCCCCGCGNONE 
J075118E10CCCCCGCGNONE 
J075137K22CCCCCGCGNONE 
J075138P08CCCCCGCGNONE 
J075142E22CCCCCGCGNONE 
J075147K12CCCCCGCGNONE 
J075149D12CCCCCGCGNONE 
J075152A15CCCCCGCGNONE 
J075152H08CCCCCGCGNONE 
J075156C11CCCCCGCGNONE 
J075156H20CCCCCGCGNONE 
J075162I01CCCCCGCGNONE 
J075166H16CCCCCGCGNONE 
J075186F11CCCCCGCGNONE 
J075189F22CCCCCGCGNONE 
J075190E16CCCCCGCGNONE 
J075193O11CCCCCGCGNONE 
Os01g0164500AK068747CCCCCGCGSimilar to ATP-dependent RNA helicase-like protein. 
AK103737CCCCCGCGNONE 
Os01g0172400AK065102CCCCCGCGNONE 
AK100365CCCCCGCGNONE 
AK119523CCCCCGCGNONE 
D73411CCCCCGCGPhospholipase D alpha 1 precursor (EC 3.1.4.4) (PLD alpha 1) (Choline phosphatase 1) (Phosphatidylcholine-hydrolyzing phospholipase D 1). 
J013001N03CCCCCGCGNONE 
J013052B12CCCCCGCGNONE 
J013071F15CCCCCGCGNONE 
J013108F19CCCCCGCGNONE 
J023025E17CCCCCGCGNONE 
J023083O10CCCCCGCGNONE 
J023084M17CCCCCGCGNONE 
J023100D16CCCCCGCGNONE 
J023107O10CCCCCGCGNONE 
J023119F08CCCCCGCGNONE 
J033035B07CCCCCGCGNONE 
J033052C18CCCCCGCGNONE 
J033092H11CCCCCGCGNONE 
J033096D02CCCCCGCGNONE 
J033117A16CCCCCGCGNONE 
J043010E08CCCCCGCGNONE 
J043013C12CCCCCGCGNONE 
J065001M15CCCCCGCGNONE 
J065021O11CCCCCGCGNONE 
J065089O20CCCCCGCGNONE 
J065117N05CCCCCGCGNONE 
J065129L11CCCCCGCGNONE 
J065170F18CCCCCGCGNONE 
J090066E11CCCCCGCGNONE 
J090076N24CCCCCGCGNONE 
J090093G21CCCCCGCGNONE 
J100041H17CCCCCGCGNONE 
J100050D07CCCCCGCGNONE 
J100063A06CCCCCGCGNONE 
Os01g0188400AK072842CCCCCGCGNONE 
AK121770CCCCCGCGNONE 
D16499CCCCCGCGNADP-dependent malic enzyme, chloroplast precursor (EC 1.1.1.40) (NADP-ME). 
J100053F23CCCCCGCGNONE 
J100060J17CCCCCGCGNONE 
Os01g0219500AK106863CCCCCGCGNONE 
AK109524CCCCCGCGPlant lipid transfer protein/Par allergen family protein. 
J075053J18CCCCCGCGNONE 
J080023G09CCCCCGCGNONE 
J080051F19CCCCCGCGNONE 
J080085H15CCCCCGCGNONE 
Os01g0246400009-143-G05CCCCCGCGNONE 
AK062972CCCCCGCGSimilar to Low molecular mass early light-inducible protein HV90, chloroplast precursor (ELIP). 
Os01g0279700AK067683CGCGGGGGNONE 
AK100107CGCGGGGGMajor facilitator superfamily protein. 
J023004N09CGCGGGGGNONE 
J075019L14CGCGGGGGNONE 
J075187F21CGCGGGGGNONE 
Os01g0295700AK070333CCCCCGCGCGTCGCSimilar to Protein phosphatase-2C. 
Os01g0305900Os01g0305900CCCCCGCGSimilar to A-type R2R3 Myb protein (Fragment). 
Os01g0323600J023095C13CCCCCGCGNONE 
Os01g0507000009-088-A07CCCCCGCGNONE 
AK062682CCCCCGCGNONE 
AK100209CCCCCGCGHypothetical protein. 
J023042P20CCCCCGCGNONE 
J033103I07CCCCCGCGNONE 
J033128A14CCCCCGCGNONE 
J065166E05CCCCCGCGNONE 
J080305A13CCCCCGCGNONE 
Os01g0513400AK069619CCCCCGCGProtein of unknown function DUF789 family protein. 
AK069619CGCGGGGGProtein of unknown function DUF789 family protein. 
Os01g0584900AK108522CCCCCGCGWRKY transcription factor 28-like (WRKY5) (WRKY transcription factor 77). 
AY341846CCCCCGCGNONE 
J065161G19CCCCCGCGNONE 
J065193D14CCCCCGCGNONE 
J065193L05CCCCCGCGNONE 
J065196K16CCCCCGCGNONE 
Os01g0589700J075063C11CCCCCGCGNONE 
J075104N14CCCCCGCGNONE 
J075120J05CCCCCGCGNONE 
J075146O17CCCCCGCGNONE 
J075149C20CCCCCGCGNONE 
J090048E23CCCCCGCGConserved hypothetical protein. 
J090089B22CCCCCGCGNONE 
Os01g0598600AK104992CGCGGGGGNONE 
Os01g0618200AK102319CCCCCGCGProtein phosphatase 2C family protein. 
Os01g0639900004-009-H08CGCGGGGGNONE 
006-050-F07CGCGGGGGNONE 
006-120-D04CGCGGGGGNONE 
AF182806CGCGGGGGNONE 
AK060890CGCGGGGGSimilar to Carbonic anhydrase, chloroplast precursor (EC 4.2.1.1) (Carbonate dehydratase). 
AK099825CGCGGGGGNONE 
J075022I06CGCGGGGGNONE 
U08404CGCGGGGGNONE 
Os01g0647000006-044-B06CTCGGCCCCCGCGNONE 
AK061541CTCGGCCCCCGCGNONE 
J075138L22CTCGGCCCCCGCGNONE 
J080315F03CTCGGCCCCCGCGNONE 
Os01g0662600009-056-E10CCCCCGCGNONE 
AK062234CCCCCGCGNONE 
AK098887CCCCCGCGNONE 
AK099656CCCCCGCGNONE 
AK119723CCCCCGCGSimilar to NifU-like protein. 
J013001K01CCCCCGCGNONE 
J013090F20CCCCCGCGNONE 
J013119A14CCCCCGCGNONE 
J013121P12CCCCCGCGNONE 
J033132I15CCCCCGCGNONE 
J075023F22CCCCCGCGNONE 
J075023M13CCCCCGCGNONE 
J100024D10CCCCCGCGNONE 
J100024N01CCCCCGCGNONE 
J100026H09CCCCCGCGNONE 
J100027H07CCCCCGCGNONE 
J100045K07CCCCCGCGNONE 
J100057K18CCCCCGCGNONE 
J100085C22CCCCCGCGNONE 
Os01g0678600AK071536CCCCCGCGNONE 
Os01g0698300AK100582CCCCCGCGZinc finger, BED-type predicted domain containing protein. 
J023105O09CCCCCGCGNONE 
J023119F15CCCCCGCGNONE 
J075007N19CCCCCGCGNONE 
J075010F10CCCCCGCGNONE 
J075032M22CCCCCGCGNONE 
J075038E01CCCCCGCGNONE 
J075064J17CCCCCGCGNONE 
J075109L20CCCCCGCGNONE 
J075131O16CCCCCGCGNONE 
J075176A17CCCCCGCGNONE 
J075178N11CCCCCGCGNONE 
J075181N15CCCCCGCGNONE 
J090060I06CCCCCGCGNONE 
J090097O21CCCCCGCGNONE 
Os01g0705700003-130-H06CCCCCGCGNONE 
AK064946CCCCCGCGSimilar to Transcription factor ICE1 (Inducer of CBF expression 1) (Basic helix- loop-helix protein 116) (bHLH116) (AtbHLH116). 
J013000P16CCCCCGCGNONE 
Os01g0716200AK062106TGTGGGCCCCCGCGIQ calmodulin-binding region domain containing protein. 
AK098920TGTGGGCCCCCGCGNONE 
J013002N06TGTGGGCCCCCGCGNONE 
J013050O19TGTGGGCCCCCGCGNONE 
J013074N19TGTGGGCCCCCGCGNONE 
J013127F17TGTGGGCCCCCGCGNONE 
J013155C17TGTGGGCCCCCGCGNONE 
J013158K07TGTGGGCCCCCGCGNONE 
J053086D01TGTGGGCCCCCGCGNONE 
Os01g0730300AK101207CGCGGGGGHAD-superfamily hydrolase subfamily IIB protein. 
AK109542CGCGGGGGNONE 
Os01g0736600009-105-F04CCAAGCCCCCGCGNONE 
014-035-D08CCAAGCCCCCGCGNONE 
AK099546CCAAGCCCCCGCGZinc finger, RING-type domain containing protein. 
AK105189CCAAGCCCCCGCGNONE 
J065155B14CCAAGCCCCCGCGNONE 
J075007F01CCAAGCCCCCGCGNONE 
Os01g0743400AK059177CCCCCGCGSimilar to Tryptophanyl-tRNA synthetase (Fragment). 
AK069114CCCCCGCGNONE 
J065070E07CCCCCGCGNONE 
J065152G11CCCCCGCGNONE 
Os01g0748900AK071946CCCCCGCGNONE 
AK072413CCCCCGCGMembrane attack complex component/perforin/complement C9 family protein. 
Os01g0758200AK071083CCCCCGCGSimilar to Dof2 (Fragment). 
Os01g0760600011-038-B09CCCCCGCGNONE 
AB110193CCCCCGCGNONE 
AK103133CCCCCGCGNONE 
AK104829CCCCCGCGNONE 
D14673CCCCCGCGNONE 
J023110C16CCCCCGCGNONE 
J033028M22CCCCCGCGNONE 
J033038A21CCCCCGCGNONE 
J033044D24CCCCCGCGNONE 
J033095C16CCCCCGCGNONE 
J090003F07CCCCCGCGNONE 
J090009P10CCCCCGCGNONE 
J090023K01CCCCCGCGNONE 
J090033G02CCCCCGCGNONE 
J090037I22CCCCCGCGNONE 
J090038A17CCCCCGCGNONE 
J090048K09CCCCCGCGNONE 
J090069N01CCCCCGCGNONE 
J090078C19CCCCCGCGNONE 
J090089P15CCCCCGCGNONE 
J090093D07CCCCCGCGNONE 
J090095H01CCCCCGCGNONE 
J100057J03CCCCCGCGNONE 
Os01g0794100009-027-B12CGCGGGGGNONE 
AK062404CGCGGGGGConserved hypothetical protein. 
Os01g0800300006-097-C12CACGCCACGCGGGGGNONE 
014-070-C12CACGCCACGCGGGGGNONE 
AK072549CACGCCACGCGGGGGNONE 
AK100942CACGCCACGCGGGGGNONE 
AK100951CACGCCACGCGGGGGConserved hypothetical protein. 
AK106023CACGCCACGCGGGGGNONE 
J023138D05CACGCCACGCGGGGGNONE 
J075097P16CACGCCACGCGGGGGNONE 
J075099F23CACGCCACGCGGGGGNONE 
Os01g0801000AK064082CGCGGGGGNONE 
AK101426CGCGGGGGSimilar to Apurinic endonuclease-redox protein (DNA-(apurinic or apyrimidinic site) lyase) (EC 4.2.99.18). 
Os01g0801700AK073813CGCGGGGGConserved hypothetical protein. 
J033067K14CGCGGGGGNONE 
Os01g0802200009-092-E04GTCGCGCGGGGGNONE 
AK062699GTCGCGCGGGGGConserved hypothetical protein. 
J065186C19GTCGCGCGGGGGNONE 
Os01g0803200009-028-E02CCCCCGCGNONE 
AF435976CCCCCGCGNONE 
AK072206CCCCCGCGNONE 
AK121632CCCCCGCGNONE 
D29717CCCCCGCGNONE 
J013088C04CCCCCGCGNONE 
J023110F17CCCCCGCGNONE 
J033029J21CCCCCGCGNONE 
J033050G08CCCCCGCGNONE 
J033121L08CCCCCGCGNONE 
J03469CCCCCGCGNONE 
J043040J18CCCCCGCGNONE 
J065009B11CCCCCGCGNONE 
J065037D05CCCCCGCGNONE 
J065046C08CCCCCGCGNONE 
J065051M08CCCCCGCGNONE 
J065059H24CCCCCGCGNONE 
J065060A10CCCCCGCGNONE 
J065075N07CCCCCGCGNONE 
J065088G17CCCCCGCGNONE 
J065111I03CCCCCGCGNONE 
J065122A02CCCCCGCGNONE 
J065128L10CCCCCGCGNONE 
J065134A09CCCCCGCGNONE 
J065162H09CCCCCGCGNONE 
J065178F05CCCCCGCGNONE 
J065209J08CCCCCGCGNONE 
J065217F08CCCCCGCGNONE 
J075023A10CCCCCGCGNONE 
J075023H20CCCCCGCGNONE 
J075048H09CCCCCGCGNONE 
J075062K16CCCCCGCGNONE 
J075074F03CCCCCGCGNONE 
J075080G02CCCCCGCGNONE 
J075125J09CCCCCGCGNONE 
J075125L15CCCCCGCGNONE 
J075152L15CCCCCGCGNONE 
J075173B03CCCCCGCGNONE 
J075177M22CCCCCGCGNONE 
J080001B16CCCCCGCGNONE 
J080005K01CCCCCGCGNONE 
J080005L08CCCCCGCGNONE 
J080005N22CCCCCGCGNONE 
J080007B02CCCCCGCGNONE 
J080008E24CCCCCGCGNONE 
J080008L18CCCCCGCGNONE 
J080009H13CCCCCGCGNONE 
J080010E21CCCCCGCGNONE 
J080011D21CCCCCGCGNONE 
J080011P22CCCCCGCGNONE 
J080013A16CCCCCGCGNONE 
J080016M01CCCCCGCGNONE 
J080017A09CCCCCGCGNONE 
J080020A09CCCCCGCGNONE 
J080023B21CCCCCGCGNONE 
J080023L04CCCCCGCGNONE 
J080023M10CCCCCGCGNONE 
J080028B02CCCCCGCGNONE 
J080031E01CCCCCGCGNONE 
J080036N13CCCCCGCGNONE 
J080036N17CCCCCGCGNONE 
J080037M05CCCCCGCGNONE 
J080043K21CCCCCGCGNONE 
J080043M11CCCCCGCGNONE 
J080044I08CCCCCGCGNONE 
J080044N16CCCCCGCGNONE 
J080049L02CCCCCGCGNONE 
J080050H04CCCCCGCGNONE 
J080054G17CCCCCGCGNONE 
J080054G21CCCCCGCGNONE 
J080057A13CCCCCGCGNONE 
J080057G02CCCCCGCGNONE 
J080057G23CCCCCGCGNONE 
J080061A19CCCCCGCGNONE 
J080062A13CCCCCGCGNONE 
J080062J22CCCCCGCGNONE 
J080063G15CCCCCGCGNONE 
J080066A18CCCCCGCGNONE 
J080066E03CCCCCGCGNONE 
J080067E10CCCCCGCGNONE 
J080069L14CCCCCGCGNONE 
J080071I09CCCCCGCGNONE 
J080076E22CCCCCGCGNONE 
J080078L03CCCCCGCGNONE 
J080078L15CCCCCGCGNONE 
J080081G17CCCCCGCGNONE 
J080083C20CCCCCGCGNONE 
J080083J03CCCCCGCGNONE 
J080086C02CCCCCGCGNONE 
J080088E16CCCCCGCGNONE 
J080090A03CCCCCGCGNONE 
J080090C14CCCCCGCGNONE 
J080090F11CCCCCGCGNONE 
J080093N06CCCCCGCGNONE 
J080094B22CCCCCGCGNONE 
J080094C11CCCCCGCGNONE 
J080096E22CCCCCGCGNONE 
J080096F18CCCCCGCGNONE 
J080301K11CCCCCGCGNONE 
J080302C22CCCCCGCGNONE 
J080304K12CCCCCGCGNONE 
J080317G06CCCCCGCGNONE 
J080318L23CCCCCGCGNONE 
J090047A06CCCCCGCGNONE 
J100025M24CCCCCGCGNONE 
J100026O09CCCCCGCGNONE 
J100027D03CCCCCGCGNONE 
J100028C19CCCCCGCGNONE 
J100028D07CCCCCGCGNONE 
J100031H13CCCCCGCGNONE 
J100054J03CCCCCGCGNONE 
J100055D24CCCCCGCGNONE 
J100059L24CCCCCGCGNONE 
J100062D23CCCCCGCGNONE 
J100062F02CCCCCGCGNONE 
J100063G22CCCCCGCGNONE 
J100064A04CCCCCGCGNONE 
J100064P17CCCCCGCGNONE 
J100065F17CCCCCGCGNONE 
J100072F05CCCCCGCGNONE 
J100077D21CCCCCGCGNONE 
J100081B17CCCCCGCGNONE 
J100087G09CCCCCGCGNONE 
J100090G01CCCCCGCGNONE 
U54702CCCCCGCGNONE 
Os01g0814200AK070675CCTCGCCCCCGCGNONE 
AK073107CCTCGCCCCCGCGSimilar to Type I inositol-1,4,5-trisphosphate 5-phosphatase CVP2 (EC 3.1.3.56) (Cotyledon vascular pattern 2 protein). 
J023061B19CCTCGCCCCCGCGNONE 
Os01g0834200AK069188CCCCCGCGNONE 
AK100543CCCCCGCGSimilar to T-cell immune regulator 1 transcript variant 3 (Fragment). 
Os01g0835500AK100241CCCCCGCGSimilar to Respiratory burst oxidase protein. 
Os01g0860601011-099-B05CCCCCGCGNONE 
013-093-G06CCCCCGCGNONE 
AK069860CCCCCGCGSimilar to Ferredoxin, root R-B1. 
J065017K08CCCCCGCGNONE 
J065020D23CCCCCGCGNONE 
J065041N15CCCCCGCGNONE 
J065119F17CCCCCGCGNONE 
J065169G20CCCCCGCGNONE 
J065179F21CCCCCGCGNONE 
J065182L09CCCCCGCGNONE 
Os01g0866000AK108924CCCCCGCGSimilar to E3 ubiquitin ligase EL5 (EC 6.3.2.-). 
Os01g0870100AK103428CGCGGGGGNONE 
Os01g0896400AK107067CCCCCGCGConserved hypothetical protein. 
Os01g0913600AK071735CCTCGCCCCCCGCGACGCSimilar to Rho GDP-dissociation inhibitor 1 (Rho GDI-1) (AtRhoGDI1). 
J023003J11CCTCGCCCCCCGCGACGCNONE 
J023037O11CCTCGCCCCCCGCGACGCNONE 
J023109K10CCTCGCCCCCCGCGACGCNONE 
Os01g0925800009-186-A06CCCCCGCGNONE 
009-198-H07CCCCCGCGNONE 
AK073357CCCCCGCGSimilar to Ubiquitin conjugating enzyme. 
J013170D01CCCCCGCGNONE 
J033027F19CCCCCGCGNONE 
Os02g0162500009-181-F03CCCCCGCGNONE 
AK058907CCCCCGCGNONE 
AK121223CCCCCGCGSimilar to 40S ribosomal protein S14. 
J023090I10CCCCCGCGNONE 
J023136J11CCCCCGCGNONE 
J053097J20CCCCCGCGNONE 
J053098F01CCCCCGCGNONE 
J065065B09CCCCCGCGNONE 
J065082M04CCCCCGCGNONE 
J065188O05CCCCCGCGNONE 
J075057P15CCCCCGCGNONE 
J075061J08CCCCCGCGNONE 
J075061N15CCCCCGCGNONE 
J075131I08CCCCCGCGNONE 
J075141H13CCCCCGCGNONE 
J080062E14CCCCCGCGNONE 
J080062P15CCCCCGCGNONE 
J080318G17CCCCCGCGNONE 
J080319G19CCCCCGCGNONE 
J090001L10CCCCCGCGNONE 
J090024I18CCCCCGCGNONE 
J090033F24CCCCCGCGNONE 
J090036M16CCCCCGCGNONE 
J090040I24CCCCCGCGNONE 
J090048P06CCCCCGCGNONE 
J090049B12CCCCCGCGNONE 
J090068C02CCCCCGCGNONE 
J090069O04CCCCCGCGNONE 
J090084H22CCCCCGCGNONE 
J100022L03CCCCCGCGNONE 
J100028O14CCCCCGCGNONE 
J100028O18CCCCCGCGNONE 
J100032A15CCCCCGCGNONE 
J100033D21CCCCCGCGNONE 
J100034J23CCCCCGCGNONE 
J100043K22CCCCCGCGNONE 
J100052M22CCCCCGCGNONE 
J100053N03CCCCCGCGNONE 
J100074N24CCCCCGCGNONE 
J100082J10CCCCCGCGNONE 
Os02g0193900AK069578CGCGGGGGConserved hypothetical protein. 
AK104014CGCGGGGGNONE 
J080308C08CGCGGGGGNONE 
J090043C09CGCGGGGGNONE 
Os02g0209900Os02g0209900CGCGGGGGSyntaxin/epimorphin family protein. 
Os02g0234300003-129-C12CGCGGGGGNONE 
AK062592CGCGGGGGU box domain containing protein. 
Os02g0270200AK110825CCCCCGCGSimilar to Subtilase. 
Os02g0299200AK105486CCCCCGCGIQ calmodulin-binding region domain containing protein. 
Os02g0327000006-110-H11CGCGGGGGNONE 
AK073631CGCGGGGGC2 domain containing protein. 
AK104165CGCGGGGGNONE 
J023004L22CGCGGGGGNONE 
J023091P07CGCGGGGGNONE 
J023115A09CGCGGGGGNONE 
J023139A19CGCGGGGGNONE 
J033043I10CGCGGGGGNONE 
J033052D22CGCGGGGGNONE 
J033066B05CGCGGGGGNONE 
J043003P17CGCGGGGGNONE 
J043030K22CGCGGGGGNONE 
J065109P18CGCGGGGGNONE 
J065130G19CGCGGGGGNONE 
J065150K12CGCGGGGGNONE 
J065202B18CGCGGGGGNONE 
J065203K23CGCGGGGGNONE 
J090012O12CGCGGGGGNONE 
J090076M23CGCGGGGGNONE 
J100019I12CGCGGGGGNONE 
J100028N06CGCGGGGGNONE 
J100030G13CGCGGGGGNONE 
J100031O22CGCGGGGGNONE 
J100042F17CGCGGGGGNONE 
J100059C04CGCGGGGGNONE 
J100067G16CGCGGGGGNONE 
J100075K20CGCGGGGGNONE 
J100078D05CGCGGGGGNONE 
Os02g0475300AK072737CCCCCGCGTCGTGGGCCCCACCTGNONE 
AK120516CCCCCGCGTCGTGGGCCCCACCTGMembrane attack complex component/perforin/complement C9 family protein. 
Os02g0521300AK120851GGGACCCGGCCCCGCGGGGGC2 domain containing protein. 
Os02g0527200009-022-A08ACACGTGGCCCCCCGCGNONE 
009-030-A06ACACGTGGCCCCCCGCGNONE 
009-034-F08ACACGTGGCCCCCCGCGNONE 
009-041-E08ACACGTGGCCCCCCGCGNONE 
009-048-H03ACACGTGGCCCCCCGCGNONE 
009-067-E04ACACGTGGCCCCCCGCGNONE 
009-081-E04ACACGTGGCCCCCCGCGNONE 
009-124-C06ACACGTGGCCCCCCGCGNONE 
009-154-A07ACACGTGGCCCCCCGCGNONE 
009-180-G04ACACGTGGCCCCCCGCGNONE 
009-180-H01ACACGTGGCCCCCCGCGNONE 
009-183-C03ACACGTGGCCCCCCGCGNONE 
009-198-E04ACACGTGGCCCCCCGCGNONE 
009-199-A12ACACGTGGCCCCCCGCGNONE 
AK058851ACACGTGGCCCCCCGCGConserved hypothetical protein. 
J075041O08ACACGTGGCCCCCCGCGNONE 
J075112L20ACACGTGGCCCCCCGCGNONE 
J075193M15ACACGTGGCCCCCCGCGNONE 
Os02g0555000015-020-G02CCCCCGCGNONE 
AK065270CCCCCGCGNONE 
AK121253CCCCCGCGProtein of unknown function, ATP binding family protein. 
J013002L01CCCCCGCGNONE 
J023060A02CCCCCGCGNONE 
J023101O11CCCCCGCGNONE 
J023140A15CCCCCGCGNONE 
J033042H19CCCCCGCGNONE 
J033046C02CCCCCGCGNONE 
J033080N19CCCCCGCGNONE 
J065026I02CCCCCGCGNONE 
J065040C18CCCCCGCGNONE 
J090004I16CCCCCGCGNONE 
Os02g0566700AK102754CCCCCGCGConserved hypothetical protein. 
Os02g0607700AK109261CCCCCGCGGlucose/ribitol dehydrogenase family protein. 
Os02g0618400AK099283CGCGGGGGNONE 
AK111807CGCGGGGGSimilar to Snapdragon myb protein 305 homolog. 
J090053M16CGCGGGGGNONE 
J090067D02CGCGGGGGNONE 
Os02g0625500011-025-C06GCCCACCAACCGCGGGGGNONE 
AB050624GCCCACCAACCGCGGGGGNONE 
AK059188GCCCACCAACCGCGGGGGNONE 
AK059771GCCCACCAACCGCGGGGGNONE 
AK101791GCCCACCAACCGCGGGGGSimilar to Adenosine kinase-like protein (Fragment). 
AY224510GCCCACCAACCGCGGGGGNONE 
J013152H02GCCCACCAACCGCGGGGGNONE 
J023012P09GCCCACCAACCGCGGGGGNONE 
J023127D16GCCCACCAACCGCGGGGGNONE 
J033024G01GCCCACCAACCGCGGGGGNONE 
J033025L19GCCCACCAACCGCGGGGGNONE 
J033080M04GCCCACCAACCGCGGGGGNONE 
J033101A08GCCCACCAACCGCGGGGGNONE 
J033121L12GCCCACCAACCGCGGGGGNONE 
J043017N15GCCCACCAACCGCGGGGGNONE 
J065207J01GCCCACCAACCGCGGGGGNONE 
J090049G12GCCCACCAACCGCGGGGGNONE 
J100036A07GCCCACCAACCGCGGGGGNONE 
J100076C04GCCCACCAACCGCGGGGGNONE 
J100080N22GCCCACCAACCGCGGGGGNONE 
Os02g0630300AK108598CCCCCGCGNONE 
Os02g0643500AK068423CATCCCCCGCGPentapeptide repeat containing protein. 
Os02g0653800J023002B17GCTTTCCCCCGCGNONE 
J033067E03GCTTTCCCCCGCGSimilar to GTP-binding protein. 
J033105M04GCTTTCCCCCGCGNONE 
J053039E15GCTTTCCCCCGCGNONE 
J065026L07GCTTTCCCCCGCGNONE 
J065038B03GCTTTCCCCCGCGNONE 
J065087J15GCTTTCCCCCGCGNONE 
J065121B22GCTTTCCCCCGCGNONE 
J065128N12GCTTTCCCCCGCGNONE 
J065189E19GCTTTCCCCCGCGNONE 
J100058B03GCTTTCCCCCGCGNONE 
Os02g0653900006-024-H11CCCCCGCGNONE 
006-069-F05CCCCCGCGNONE 
012-005-H01CCCCCGCGNONE 
AK064950CCCCCGCGSimilar to Avr9/Cf-9 rapidly elicited protein 14 (Fragment). 
AK098925CCCCCGCGNONE 
AK104793CCCCCGCGNONE 
AK106154CCCCCGCGNONE 
J013000P22CCCCCGCGNONE 
J013002P22CCCCCGCGNONE 
J013072L24CCCCCGCGNONE 
J013110J23CCCCCGCGNONE 
J013126I23CCCCCGCGNONE 
J013160D23CCCCCGCGNONE 
J023056H01CCCCCGCGNONE 
J033058I09CCCCCGCGNONE 
J065183H09CCCCCGCGNONE 
J065214P06CCCCCGCGNONE 
J075071L23CCCCCGCGNONE 
J090042C11CCCCCGCGNONE 
J090057H07CCCCCGCGNONE 
J090071O22CCCCCGCGNONE 
J100029M07CCCCCGCGNONE 
J100040O18CCCCCGCGNONE 
J100041P12CCCCCGCGNONE 
J100047J02CCCCCGCGNONE 
J100063L09CCCCCGCGNONE 
J100065B12CCCCCGCGNONE 
J100066N05CCCCCGCGNONE 
J100080O21CCCCCGCGNONE 
J100083F13CCCCCGCGNONE 
J100087G04CCCCCGCGNONE 
J100090J20CCCCCGCGNONE 
J100090N08CCCCCGCGNONE 
Os02g0668500006-056-A05CCCCCGCGNONE 
AK060958CCCCCGCGNONE 
AK071867CCCCCGCGCellular retinaldehyde-binding/triple function, C-terminal domain containing protein. 
J023117I15CCCCCGCGNONE 
J065013J03CCCCCGCGNONE 
J065021P16CCCCCGCGNONE 
J065044B07CCCCCGCGNONE 
J065059E23CCCCCGCGNONE 
J065087N20CCCCCGCGNONE 
J065185I04CCCCCGCGNONE 
J065190G19CCCCCGCGNONE 
J065199C15CCCCCGCGNONE 
J065213L12CCCCCGCGNONE 
J080305C01CCCCCGCGNONE 
J080308C07CCCCCGCGNONE 
J080310F02CCCCCGCGNONE 
Os02g0672700AK059611CCCCCGCGGGGCCGGGTCCCDNA-directed RNA polymerase, subunit C11/M/9 family protein. 
AK099179CCCCCGCGGGGCCGGGTCCCNONE 
J023098L23CCCCCGCGGGGCCGGGTCCCNONE 
J065042J21CCCCCGCGGGGCCGGGTCCCNONE 
J065187L09CCCCCGCGGGGCCGGGTCCCNONE 
J065190O10CCCCCGCGGGGCCGGGTCCCNONE 
J080041G14CCCCCGCGGGGCCGGGTCCCNONE 
J080078K08CCCCCGCGGGGCCGGGTCCCNONE 
J080089D20CCCCCGCGGGGCCGGGTCCCNONE 
J080094D04CCCCCGCGGGGCCGGGTCCCNONE 
Os02g0699000AK109931CGCGGGGGTGF-beta receptor, type I/II extracellular region family protein. 
Os02g0700000AK100709CCCCCGCGPWWP domain containing protein. 
J013072L20CCCCCGCGNONE 
J023115E12CCCCCGCGNONE 
J033099N14CCCCCGCGNONE 
J033148H17CCCCCGCGNONE 
J100074E14CCCCCGCGNONE 
Os02g0709200AK058999CGCGGGGGSimilar to Histidinol-phosphate aminotransferase, chloroplast precursor (EC 2.6.1.9) (Imidazole acetol-phosphate transaminase). 
AK099074CGCGGGGGNONE 
Os02g0717500AK067050CGCGGGGGGCTGGGConserved hypothetical protein. 
J013092A12CGCGGGGGGCTGGGNONE 
J013124H24CGCGGGGGGCTGGGNONE 
J013154C11CGCGGGGGGCTGGGNONE 
J075098L15CGCGGGGGGCTGGGNONE 
J090083L24CGCGGGGGGCTGGGNONE 
J100049G21CGCGGGGGGCTGGGNONE 
J100073N20CGCGGGGGGCTGGGNONE 
Os02g0717600J090003H19CCCCCGCGACGCGGATCGGACGGCTNONE 
J100090A12CCCCCGCGACGCGGATCGGACGGCTConserved hypothetical protein. 
Os02g0762400AK103084CGCGGGGGCyclin-dependent kinase inhibitor family protein. 
Os02g0766700AK072062CCCCCGCGSimilar to Abscisic acid responsive elements-binding factor (ABA-responsive element binding protein 2) (AREB2). 
J100073F09CCCCCGCGNONE 
Os02g0777800AK066978CCCCCGCGSimilar to Avr9/Cf-9 induced kinase 1. 
Os02g0782100AK065421CGCGGGGGCCGGGChorismate synthase family protein. 
J065038A03CGCGGGGGCCGGGNONE 
Os02g0788800AK066747CCCCCGCGCCCACGCCCACCTAmino acid/polyamine transporter II family protein. 
Os03g0117900AK108930CCCCCGCGSimilar to Transcription factor. 
Os03g0123300003-131-G09CGCGGGGGNONE 
AK058595CGCGGGGGNONE 
AK070642CGCGGGGGSimilar to Cell cycle switch protein. 
J075056B01CGCGGGGGNONE 
Os03g0123600006-064-G05CCCCCGCGNONE 
AK101248CCCCCGCGNONE 
AK105012CCCCCGCGProtein of unknown function Cys-rich family protein. 
AK109354CCCCCGCGNONE 
J033032D06CCCCCGCGNONE 
J080308A01CCCCCGCGNONE 
J090071H02CCCCCGCGNONE 
J100048C10CCCCCGCGNONE 
Os03g0140700AK070000GTCCGTCCCCCGCGCGACGCGACTetratricopeptide-like helical domain containing protein. 
Os03g0141200AK068968CCCCCGCGSimilar to Beta-amylase PCT-BMYI (EC 3.2.1.2). 
AK100092CCCCCGCGNONE 
J023003L18CCCCCGCGNONE 
J023022K18CCCCCGCGNONE 
J023107H13CCCCCGCGNONE 
J023107K02CCCCCGCGNONE 
Os03g0156500011-075-F02CGCGGGGGGGTGGGCCCCACACNONE 
012-077-G10CGCGGGGGGGTGGGCCCCACACNONE 
AK103466CGCGGGGGGGTGGGCCCCACACLupus La protein family protein. 
J013088H17CGCGGGGGGGTGGGCCCCACACNONE 
J013135G21CGCGGGGGGGTGGGCCCCACACNONE 
J033050E10CGCGGGGGGGTGGGCCCCACACNONE 
J033050J01CGCGGGGGGGTGGGCCCCACACNONE 
J033129N23CGCGGGGGGGTGGGCCCCACACNONE 
J065085L16CGCGGGGGGGTGGGCCCCACACNONE 
J065101B19CGCGGGGGGGTGGGCCCCACACNONE 
J065167N03CGCGGGGGGGTGGGCCCCACACNONE 
J090009O21CGCGGGGGGGTGGGCCCCACACNONE 
J090049D11CGCGGGGGGGTGGGCCCCACACNONE 
J100017F23CGCGGGGGGGTGGGCCCCACACNONE 
J100040E12CGCGGGGGGGTGGGCCCCACACNONE 
J100055O18CGCGGGGGGGTGGGCCCCACACNONE 
J100061K08CGCGGGGGGGTGGGCCCCACACNONE 
J100072M05CGCGGGGGGGTGGGCCCCACACNONE 
J100077B08CGCGGGGGGGTGGGCCCCACACNONE 
J100086G03CGCGGGGGGGTGGGCCCCACACNONE 
Os03g0161200AK066932CCCCCGCGSimilar to Sulfate transporter 3.1 (AST12) (AtST1). 
Os03g0162200009-031-E05CCCCCGCGNONE 
013-049-D04CCCCCGCGNONE 
013-082-E03CCCCCGCGNONE 
014-039-G04CCCCCGCGNONE 
014-098-G11CCCCCGCGNONE 
AK061605CCCCCGCGNONE 
AK121533CCCCCGCGSimilar to Histone H2A. 
J033024D06CCCCCGCGNONE 
J033030P21CCCCCGCGNONE 
J065063C20CCCCCGCGNONE 
J065064A18CCCCCGCGNONE 
J065147G02CCCCCGCGNONE 
J065204K06CCCCCGCGNONE 
J090004C22CCCCCGCGNONE 
J090014K02CCCCCGCGNONE 
J090074E10CCCCCGCGNONE 
J090086L09CCCCCGCGNONE 
Os03g0183300003-107-A07CCCCCGCGTGGGCCCCACCCACCTGNONE 
003-113-H10CCCCCGCGTGGGCCCCACCCACCTGNONE 
003-118-G01CCCCCGCGTGGGCCCCACCCACCTGNONE 
006-028-A09CCCCCGCGTGGGCCCCACCCACCTGNONE 
006-047-D01CCCCCGCGTGGGCCCCACCCACCTGNONE 
006-052-D04CCCCCGCGTGGGCCCCACCCACCTGNONE 
006-087-H06CCCCCGCGTGGGCCCCACCCACCTGNONE 
006-089-B03CCCCCGCGTGGGCCCCACCCACCTGNONE 
006-092-D08CCCCCGCGTGGGCCCCACCCACCTGNONE 
006-093-E07CCCCCGCGTGGGCCCCACCCACCTGNONE 
009-029-H07CCCCCGCGTGGGCCCCACCCACCTGNONE 
009-067-B05CCCCCGCGTGGGCCCCACCCACCTGNONE 
009-091-F04CCCCCGCGTGGGCCCCACCCACCTGNONE 
009-101-C10CCCCCGCGTGGGCCCCACCCACCTGNONE 
009-113-A06CCCCCGCGTGGGCCCCACCCACCTGNONE 
009-140-E12CCCCCGCGTGGGCCCCACCCACCTGNONE 
009-145-E10CCCCCGCGTGGGCCCCACCCACCTGNONE 
009-196-F02CCCCCGCGTGGGCCCCACCCACCTGNONE 
011-054-E07CCCCCGCGTGGGCCCCACCCACCTGNONE 
012-074-E10CCCCCGCGTGGGCCCCACCCACCTGNONE 
012-076-E11CCCCCGCGTGGGCCCCACCCACCTGNONE 
014-006-C07CCCCCGCGTGGGCCCCACCCACCTGNONE 
014-085-G11CCCCCGCGTGGGCCCCACCCACCTGNONE 
015-049-C04CCCCCGCGTGGGCCCCACCCACCTGNONE 
015-062-E10CCCCCGCGTGGGCCCCACCCACCTGNONE 
016-063-E02CCCCCGCGTGGGCCCCACCCACCTGNONE 
AK058349CCCCCGCGTGGGCCCCACCCACCTGHypothetical protein. 
AK105922CCCCCGCGTGGGCCCCACCCACCTGNONE 
AK106163CCCCCGCGTGGGCCCCACCCACCTGNONE 
AK119553CCCCCGCGTGGGCCCCACCCACCTGNONE 
AY831395CCCCCGCGTGGGCCCCACCCACCTGNONE 
Os03g0184100AK067400CCCCCGCGCCACGTHypothetical protein. 
J013030J24CCCCCGCGCCACGTNONE 
J013037M23CCCCCGCGCCACGTNONE 
J013106B15CCCCCGCGCCACGTNONE 
J013130H10CCCCCGCGCCACGTNONE 
J013152B03CCCCCGCGCCACGTNONE 
J013157J24CCCCCGCGCCACGTNONE 
J013157K04CCCCCGCGCCACGTNONE 
J033093A19CCCCCGCGCCACGTNONE 
J033106E24CCCCCGCGCCACGTNONE 
J090043G12CCCCCGCGCCACGTNONE 
Os03g0188400AK107555CCCCCGCGBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
AK107555CCCCCGCGBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
Os03g0200700AK061432CCCCCGCGNONE 
Os03g0207400AK072292CCCCCGCGCCCCCGCGSimilar to Protein phosphatase 2C-like. 
Os03g0222100AK070688CGCGGGGGSimilar to Topoisomerase-like protein. 
J023057E15CGCGGGGGNONE 
J023099M24CGCGGGGGNONE 
J023147F14CGCGGGGGNONE 
Os03g0226300AK111731CCCCCGCGSimilar to Pto kinase interactor 1. 
Os03g0241900AK098994CCCCCGCGNONE 
AK111568CCCCCGCGSimilar to Senescence-associated protein 12. 
Os03g0275500AK065232CCCCCGCGCGACEpsin, N-terminal domain containing protein. 
J013002H14CCCCCGCGCGACNONE 
J013047G17CCCCCGCGCGACNONE 
J013050M23CCCCCGCGCGACNONE 
J013066D16CCCCCGCGCGACNONE 
J013088C16CCCCCGCGCGACNONE 
J023026P14CCCCCGCGCGACNONE 
J023031E04CCCCCGCGCGACNONE 
J023045C06CCCCCGCGCGACNONE 
J023086K13CCCCCGCGCGACNONE 
J023119G16CCCCCGCGCGACNONE 
J033079G11CCCCCGCGCGACNONE 
J033090O21CCCCCGCGCGACNONE 
J033103H08CCCCCGCGCGACNONE 
J033103M23CCCCCGCGCGACNONE 
J033106J17CCCCCGCGCGACNONE 
J033141M15CCCCCGCGCGACNONE 
J090029G22CCCCCGCGCGACNONE 
J090032O20CCCCCGCGCGACNONE 
J090034P11CCCCCGCGCGACNONE 
J090087D18CCCCCGCGCGACNONE 
J100078E18CCCCCGCGCGACNONE 
J100081C12CCCCCGCGCGACNONE 
Os03g0277000AK100522CGCGGGGGSimilar to GDP dissociation inhibitor protein OsGDI1. 
Os03g0278200AK103544CGCGGGGGCCGGCNAD-dependent epimerase/dehydratase family protein. 
Os03g0279200009-097-C06CCCCCGCGNONE 
013-007-B07CCCCCGCGNONE 
AK121750CCCCCGCGSimilar to Histone H2A. 
J033087I02CCCCCGCGNONE 
J065002G20CCCCCGCGNONE 
J065102M04CCCCCGCGNONE 
J065139A02CCCCCGCGNONE 
J075109D21CCCCCGCGNONE 
J075191L12CCCCCGCGNONE 
J090096C03CCCCCGCGNONE 
J100036C23CCCCCGCGNONE 
Os03g0283600AK060009CCCCCGCGNONE 
Os03g0284500012-066-D02CCCCCGCGCGAGNONE 
AK105295CCCCCGCGCGAGNONE 
AK121300CCCCCGCGCGAGHAD-superfamily subfamily IIA hydrolase, CECR5 protein. 
Os03g0284600AK110712CTCGCGCGGGGGThioredoxin fold domain containing protein. 
Os03g0285800AF216315CCCCCGCGTCGCNONE 
AF332873CCCCCGCGTCGCNONE 
AF479883CCCCCGCGTCGCNONE 
AF479884CCCCCGCGTCGCNONE 
AJ250311CCCCCGCGTCGCNONE 
AJ486975CCCCCGCGTCGCNONE 
AK067339CCCCCGCGTCGCMAP Kinase. 
AK104834CCCCCGCGTCGCNONE 
J013102O17CCCCCGCGTCGCNONE 
J023055N19CCCCCGCGTCGCNONE 
J023099F06CCCCCGCGTCGCNONE 
J065144H06CCCCCGCGTCGCNONE 
J065153A14CCCCCGCGTCGCNONE 
J065212K01CCCCCGCGTCGCNONE 
Os03g0319300006-021-E05CGCGGGGGNONE 
006-022-H12CGCGGGGGNONE 
009-187-E02CGCGGGGGNONE 
AF042840CGCGGGGGNONE 
AK059756CGCGGGGGCalmodulin (CaM). 
AK070090CGCGGGGGNONE 
J065017J02CGCGGGGGNONE 
J065028G17CGCGGGGGNONE 
J065045N09CGCGGGGGNONE 
J065078F21CGCGGGGGNONE 
J065091H01CGCGGGGGNONE 
J065112B19CGCGGGGGNONE 
J065186E08CGCGGGGGNONE 
J065199G12CGCGGGGGNONE 
J075030K07CGCGGGGGNONE 
J075050B02CGCGGGGGNONE 
J075057G07CGCGGGGGNONE 
J075070F01CGCGGGGGNONE 
J075093N12CGCGGGGGNONE 
J075095K13CGCGGGGGNONE 
J075102D14CGCGGGGGNONE 
J075103B17CGCGGGGGNONE 
J075114K05CGCGGGGGNONE 
J075142F18CGCGGGGGNONE 
J075154L11CGCGGGGGNONE 
J075185F08CGCGGGGGNONE 
J090012A14CGCGGGGGNONE 
J090044L10CGCGGGGGNONE 
J100044C12CGCGGGGGNONE 
J100088J19CGCGGGGGNONE 
Os03g0327800J023133J12CCCCCGCGNONE 
J023133J12CCCCCGCGNONE 
J023133J12GGGGCCCACCCCCGCGNONE 
J065118C24CCCCCGCGNONE 
J065118C24CCCCCGCGNONE 
J065118C24GGGGCCCACCCCCGCGNONE 
J065136O13CCCCCGCGNo apical meristem (NAM) protein domain containing protein. 
J065136O13CCCCCGCGNo apical meristem (NAM) protein domain containing protein. 
J065136O13GGGGCCCACCCCCGCGNo apical meristem (NAM) protein domain containing protein. 
J065184M03CCCCCGCGNONE 
J065184M03CCCCCGCGNONE 
J065184M03GGGGCCCACCCCCGCGNONE 
J075105K14CCCCCGCGNONE 
J075105K14CCCCCGCGNONE 
J075105K14GGGGCCCACCCCCGCGNONE 
J075115E14CCCCCGCGNONE 
J075115E14CCCCCGCGNONE 
J075115E14GGGGCCCACCCCCGCGNONE 
J075166M18CCCCCGCGNONE 
J075166M18CCCCCGCGNONE 
J075166M18GGGGCCCACCCCCGCGNONE 
J075178F01CCCCCGCGNONE 
J075178F01CCCCCGCGNONE 
J075178F01GGGGCCCACCCCCGCGNONE 
J090008O14CCCCCGCGNONE 
J090008O14CCCCCGCGNONE 
J090008O14GGGGCCCACCCCCGCGNONE 
J090075F12CCCCCGCGNONE 
J090075F12CCCCCGCGNONE 
J090075F12GGGGCCCACCCCCGCGNONE 
J100019F12CCCCCGCGNONE 
J100019F12CCCCCGCGNONE 
J100019F12GGGGCCCACCCCCGCGNONE 
J100074P18CCCCCGCGNONE 
J100074P18CCCCCGCGNONE 
J100074P18GGGGCCCACCCCCGCGNONE 
J100075D15CCCCCGCGNONE 
J100075D15CCCCCGCGNONE 
J100075D15GGGGCCCACCCCCGCGNONE 
Os03g0363500AK064996CGCGGGGGSimilar to Sugar transporter-like protein. 
Os03g0374400016-027-B12TCCACGCCCCCGCGNONE 
AK069719TCCACGCCCCCGCGConserved hypothetical protein. 
J023020L05TCCACGCCCCCGCGNONE 
J023026H16TCCACGCCCCCGCGNONE 
J033025P22TCCACGCCCCCGCGNONE 
J075016I21TCCACGCCCCCGCGNONE 
J090015G21TCCACGCCCCCGCGNONE 
Os03g0374500Os03g0374500TCCACGCCCCCGCGHypothetical protein. 
Os03g0376000AK059565CCCCCGCGemp24/gp25L/p24 family protein. 
Os03g0383800009-149-G01CGCGGGGGNONE 
AK062998CGCGGGGGNONE 
AK065904CGCGGGGGNONE 
Os03g0397400AB112772CCCCCGCGNONE 
AK069928CCCCCGCGSimilar to Low affinity calcium transporter CAX2 (Fragment). 
J023014O18CCCCCGCGNONE 
J023036P06CCCCCGCGNONE 
J023145E24CCCCCGCGNONE 
J033142I11CCCCCGCGNONE 
J043003A10CCCCCGCGNONE 
J075023H21CCCCCGCGNONE 
J075145O10CCCCCGCGNONE 
J075149A03CCCCCGCGNONE 
J090099B09CCCCCGCGNONE 
J100017L14CCCCCGCGNONE 
J100050K18CCCCCGCGNONE 
J100063P16CCCCCGCGNONE 
Os03g0413000009-180-E02CCCCCGCGNONE 
009-188-B06CCCCCGCGNONE 
AK060225CCCCCGCGNONE 
AY062181CCCCCGCGSimilar to Potential histone-like transcription factor. 
Os03g0419100AK073482CCCCCGCGCCCACCANONE 
AK119969CCCCCGCGCCCACCAProtein of unknown function DUF1675 family protein. 
Os03g0445700AK071624CCCCCGCGSimilar to LOB domain protein 39. 
J023106M18CCCCCGCGNONE 
J065178J05CCCCCGCGNONE 
J065196F10CCCCCGCGNONE 
Os03g0574300AK072541CCCCCGCGHypothetical protein. 
J023134M10CCCCCGCGNONE 
Os03g0576900AK064861CCCCCGCGCGCGAGNONE 
AK071314CGCGGGGGAmino acid/polyamine transporter I family protein. 
J013000I01CCCCCGCGCGCGAGNONE 
J013169P21CCCCCGCGCGCGAGNONE 
J023001P03CCCCCGCGCGCGAGNONE 
J023009M10CCCCCGCGCGCGAGNONE 
J023025G11CCCCCGCGCGCGAGNONE 
J023074L08CGCGGGGGNONE 
J023084D13CGCGGGGGNONE 
J033046B19CCCCCGCGCGCGAGNONE 
J033149I10CCCCCGCGCGCGAGNONE 
J080011C14CGCGGGGGNONE 
J080012F24CGCGGGGGNONE 
J080018M05CGCGGGGGNONE 
J080021G05CGCGGGGGNONE 
J080021N18CGCGGGGGNONE 
J080023E19CGCGGGGGNONE 
J080024H14CGCGGGGGNONE 
J080025E15CGCGGGGGNONE 
J080038F19CGCGGGGGNONE 
J080044N09CGCGGGGGNONE 
J080054D05CGCGGGGGNONE 
J080057J16CGCGGGGGNONE 
J080060A05CGCGGGGGNONE 
J080061M12CGCGGGGGNONE 
J080063H13CGCGGGGGNONE 
J080065O04CGCGGGGGNONE 
J080066I17CGCGGGGGNONE 
J080066J06CGCGGGGGNONE 
J080089J22CGCGGGGGNONE 
J080090I03CGCGGGGGNONE 
J080091J23CGCGGGGGNONE 
J080091K20CGCGGGGGNONE 
J080093G24CGCGGGGGNONE 
J080094I08CGCGGGGGNONE 
J080096A17CGCGGGGGNONE 
J090051G12CGCGGGGGNONE 
J090081C04CCCCCGCGCGCGAGNONE 
Os03g0592500003-125-D02CGCGGGGGNONE 
006-021-F01CGCGGGGGNONE 
006-025-C12CGCGGGGGNONE 
006-027-A06CGCGGGGGNONE 
006-031-D08CGCGGGGGNONE 
006-031-H05CGCGGGGGNONE 
006-034-A10CGCGGGGGNONE 
006-034-H11CGCGGGGGNONE 
006-035-D10CGCGGGGGNONE 
006-037-H08CGCGGGGGNONE 
006-044-B09CGCGGGGGNONE 
006-044-F02CGCGGGGGNONE 
006-045-B11CGCGGGGGNONE 
006-045-E09CGCGGGGGNONE 
006-046-H12CGCGGGGGNONE 
006-047-D04CGCGGGGGNONE 
006-047-F02CGCGGGGGNONE 
006-050-C12CGCGGGGGNONE 
006-052-B07CGCGGGGGNONE 
006-053-A09CGCGGGGGNONE 
006-057-H02CGCGGGGGNONE 
006-061-G12CGCGGGGGNONE 
006-064-A04CGCGGGGGNONE 
006-067-G10CGCGGGGGNONE 
006-069-F06CGCGGGGGNONE 
006-070-D02CGCGGGGGNONE 
006-076-D11CGCGGGGGNONE 
006-078-B12CGCGGGGGNONE 
006-080-A10CGCGGGGGNONE 
006-082-B04CGCGGGGGNONE 
006-082-C05CGCGGGGGNONE 
006-082-C08CGCGGGGGNONE 
006-085-G08CGCGGGGGNONE 
006-086-E03CGCGGGGGNONE 
006-087-E03CGCGGGGGNONE 
006-088-A07CGCGGGGGNONE 
006-088-H06CGCGGGGGNONE 
006-089-G09CGCGGGGGNONE 
006-092-C03CGCGGGGGNONE 
006-092-C06CGCGGGGGNONE 
006-093-D09CGCGGGGGNONE 
006-097-B08CGCGGGGGNONE 
006-098-B09CGCGGGGGNONE 
006-102-D11CGCGGGGGNONE 
006-103-G02CGCGGGGGNONE 
006-104-A12CGCGGGGGNONE 
006-106-D10CGCGGGGGNONE 
006-108-A08CGCGGGGGNONE 
006-108-A12CGCGGGGGNONE 
006-108-B08CGCGGGGGNONE 
006-110-D07CGCGGGGGNONE 
006-110-D09CGCGGGGGNONE 
006-111-B04CGCGGGGGNONE 
006-111-G11CGCGGGGGNONE 
006-117-A08CGCGGGGGNONE 
006-119-A08CGCGGGGGNONE 
009-005-H11CGCGGGGGNONE 
009-013-A12CGCGGGGGNONE 
009-023-H09CGCGGGGGNONE 
009-056-D04CGCGGGGGNONE 
009-073-F11CGCGGGGGNONE 
009-127-B01CGCGGGGGNONE 
009-175-E01CGCGGGGGNONE 
AF022739CGCGGGGGNONE 
AF061577CGCGGGGGNONE 
AK058315CGCGGGGGNONE 
AK066762CGCGGGGGSimilar to Photosystem II type II chlorophyll a/b binding protein (Fragment). 
D00642CGCGGGGGNONE 
J013075I09CGCGGGGGNONE 
J023115C07CGCGGGGGNONE 
J065024G17CGCGGGGGNONE 
J065051K08CGCGGGGGNONE 
J065137D16CGCGGGGGNONE 
J075057E17CGCGGGGGNONE 
J075096E24CGCGGGGGNONE 
J075105K04CGCGGGGGNONE 
J075125F06CGCGGGGGNONE 
J075132E10CGCGGGGGNONE 
J075149I20CGCGGGGGNONE 
J075151M21CGCGGGGGNONE 
J075160K21CGCGGGGGNONE 
J075187C08CGCGGGGGNONE 
J075187E15CGCGGGGGNONE 
J075194K02CGCGGGGGNONE 
J075194L07CGCGGGGGNONE 
J090008E24CGCGGGGGNONE 
Os03g0685000009-031-F08CCCCCGCGNONE 
AK059896CCCCCGCGSimilar to Ferredoxin. 
AK098989CCCCCGCGNONE 
AK099303CCCCCGCGNONE 
J065041E14CCCCCGCGNONE 
J065085G22CCCCCGCGNONE 
Os03g0750000AK071321CCCCCGCGUniversal stress protein (Usp) family protein. 
J023088M23CCCCCGCGNONE 
J065163N07CCCCCGCGNONE 
J075006P15CCCCCGCGNONE 
J075007N13CCCCCGCGNONE 
J075018H04CCCCCGCGNONE 
J075025E04CCCCCGCGNONE 
J075036K02CCCCCGCGNONE 
J075049I06CCCCCGCGNONE 
J075050F19CCCCCGCGNONE 
J075055M07CCCCCGCGNONE 
J075070D11CCCCCGCGNONE 
J075072A01CCCCCGCGNONE 
J075081I23CCCCCGCGNONE 
J075083G08CCCCCGCGNONE 
J075095B03CCCCCGCGNONE 
J075099I22CCCCCGCGNONE 
J075122G06CCCCCGCGNONE 
J075130C13CCCCCGCGNONE 
J075143H06CCCCCGCGNONE 
J075154E20CCCCCGCGNONE 
J075174D01CCCCCGCGNONE 
J075175E01CCCCCGCGNONE 
J075185H11CCCCCGCGNONE 
J080005K09CCCCCGCGNONE 
J080006M06CCCCCGCGNONE 
J080009M15CCCCCGCGNONE 
J080013J23CCCCCGCGNONE 
J080014L22CCCCCGCGNONE 
J080018B22CCCCCGCGNONE 
J080023C20CCCCCGCGNONE 
J080025B08CCCCCGCGNONE 
J080025C17CCCCCGCGNONE 
J080025D21CCCCCGCGNONE 
J080027A19CCCCCGCGNONE 
J080030K08CCCCCGCGNONE 
J080034I08CCCCCGCGNONE 
J080034P08CCCCCGCGNONE 
J080039E04CCCCCGCGNONE 
J080041J05CCCCCGCGNONE 
J080043G01CCCCCGCGNONE 
J080044M21CCCCCGCGNONE 
J080045J24CCCCCGCGNONE 
J080045M10CCCCCGCGNONE 
J080047E17CCCCCGCGNONE 
J080047I12CCCCCGCGNONE 
J080052I15CCCCCGCGNONE 
J080060L19CCCCCGCGNONE 
J080062M06CCCCCGCGNONE 
J080064F23CCCCCGCGNONE 
J080068L14CCCCCGCGNONE 
J080070H15CCCCCGCGNONE 
J080071P16CCCCCGCGNONE 
J080076H11CCCCCGCGNONE 
J080076L20CCCCCGCGNONE 
J080077H05CCCCCGCGNONE 
J080079E17CCCCCGCGNONE 
J080089N23CCCCCGCGNONE 
J080095J09CCCCCGCGNONE 
J080096M12CCCCCGCGNONE 
J080097E11CCCCCGCGNONE 
Os03g0766600009-108-B11CCCCCGCGNONE 
AB054528CCCCCGCGNONE 
AK063832CCCCCGCGConserved hypothetical protein. 
AK121417CCCCCGCGNONE 
J023133G21CCCCCGCGNONE 
Os03g0788500AK072204CCCCCGCGSimilar to Calcium-dependent protein kinase 2. 
Os03g0819600006-069-D12CCCCCGCGNONE 
009-043-D06CCCCCGCGNONE 
009-087-G10CCCCCGCGNONE 
009-153-G08CCCCCGCGNONE 
009-162-G07CCCCCGCGNONE 
AK061390CCCCCGCGChalcone isomerase (EC 5.5.1.6). 
AK104791CCCCCGCGNONE 
J013092J08CCCCCGCGNONE 
J013102G09CCCCCGCGNONE 
J013160E06CCCCCGCGNONE 
J065046A14CCCCCGCGNONE 
J065077M16CCCCCGCGNONE 
J065103H02CCCCCGCGNONE 
J065164K09CCCCCGCGNONE 
J065208D13CCCCCGCGNONE 
J075088G06CCCCCGCGNONE 
J075093L09CCCCCGCGNONE 
J075093N09CCCCCGCGNONE 
J090007L08CCCCCGCGNONE 
J100024D12CCCCCGCGNONE 
J100052L09CCCCCGCGNONE 
J100062I20CCCCCGCGNONE 
Os03g0835600AK101677CCCCCGCGAcyl-coA-binding protein, ACBP family protein. 
Os04g0462500006-073-E08CCCCCGCGNONE 
006-073-E08CCCCCGCGNONE 
AK062065CCCCCGCGNONE 
AK062065CCCCCGCGNONE 
AK071311CCCCCGCGSimilar to 14-3-3-like protein GF14-6. 
AK071311CCCCCGCGSimilar to 14-3-3-like protein GF14-6. 
AK071822CCCCCGCGNONE 
AK071822CCCCCGCGNONE 
AK099243CCCCCGCGNONE 
AK099243CCCCCGCGNONE 
AK101938CCCCCGCGNONE 
AK101938CCCCCGCGNONE 
J013056F02CCCCCGCGNONE 
J013056F02CCCCCGCGNONE 
J023020E08CCCCCGCGNONE 
J023020E08CCCCCGCGNONE 
J023085B16CCCCCGCGNONE 
J023085B16CCCCCGCGNONE 
J023117D08CCCCCGCGNONE 
J023117D08CCCCCGCGNONE 
J023133K12CCCCCGCGNONE 
J023133K12CCCCCGCGNONE 
J033025G04CCCCCGCGNONE 
J033025G04CCCCCGCGNONE 
J033052A15CCCCCGCGNONE 
J033052A15CCCCCGCGNONE 
J033074G16CCCCCGCGNONE 
J033074G16CCCCCGCGNONE 
J033090A16CCCCCGCGNONE 
J033090A16CCCCCGCGNONE 
J033122A07CCCCCGCGNONE 
J033122A07CCCCCGCGNONE 
J033133G09CCCCCGCGNONE 
J033133G09CCCCCGCGNONE 
J065002F16CCCCCGCGNONE 
J065002F16CCCCCGCGNONE 
J065030M09CCCCCGCGNONE 
J065030M09CCCCCGCGNONE 
J065056B11CCCCCGCGNONE 
J065056B11CCCCCGCGNONE 
J065115I10CCCCCGCGNONE 
J065115I10CCCCCGCGNONE 
J065120O09CCCCCGCGNONE 
J065120O09CCCCCGCGNONE 
J065124G21CCCCCGCGNONE 
J065124G21CCCCCGCGNONE 
J075031C14CCCCCGCGNONE 
J075031C14CCCCCGCGNONE 
J075040H07CCCCCGCGNONE 
J075040H07CCCCCGCGNONE 
J075047F04CCCCCGCGNONE 
J075047F04CCCCCGCGNONE 
J075065F14CCCCCGCGNONE 
J075065F14CCCCCGCGNONE 
J075066G20CCCCCGCGNONE 
J075066G20CCCCCGCGNONE 
J075105D01CCCCCGCGNONE 
J075105D01CCCCCGCGNONE 
J075147B04CCCCCGCGNONE 
J075147B04CCCCCGCGNONE 
J075149A12CCCCCGCGNONE 
J075149A12CCCCCGCGNONE 
J075172D07CCCCCGCGNONE 
J075172D07CCCCCGCGNONE 
J075190J11CCCCCGCGNONE 
J075190J11CCCCCGCGNONE 
J090038H18CCCCCGCGNONE 
J090038H18CCCCCGCGNONE 
J090087G05CCCCCGCGNONE 
J090087G05CCCCCGCGNONE 
J100025A10CCCCCGCGNONE 
J100025A10CCCCCGCGNONE 
J100025O10CCCCCGCGNONE 
J100025O10CCCCCGCGNONE 
J100027D02CCCCCGCGNONE 
J100027D02CCCCCGCGNONE 
J100027P06CCCCCGCGNONE 
J100027P06CCCCCGCGNONE 
J100032K04CCCCCGCGNONE 
J100032K04CCCCCGCGNONE 
J100056D21CCCCCGCGNONE 
J100056D21CCCCCGCGNONE 
J100060J08CCCCCGCGNONE 
J100060J08CCCCCGCGNONE 
J100063N19CCCCCGCGNONE 
J100063N19CCCCCGCGNONE 
J100064C14CCCCCGCGNONE 
J100064C14CCCCCGCGNONE 
J100064K18CCCCCGCGNONE 
J100064K18CCCCCGCGNONE 
J100070L21CCCCCGCGNONE 
J100070L21CCCCCGCGNONE 
J100072M17CCCCCGCGNONE 
J100072M17CCCCCGCGNONE 
J100074F21CCCCCGCGNONE 
J100074F21CCCCCGCGNONE 
J100087E05CCCCCGCGNONE 
J100087E05CCCCCGCGNONE 
U65956CCCCCGCGNONE 
U65956CCCCCGCGNONE 
Os04g0481100AK099817CCCCCGCGSimilar to Seed imbibition protein (Fragment). 
AK099817CGCGGGGGSimilar to Seed imbibition protein (Fragment). 
AK100197CCCCCGCGNONE 
AK100197CGCGGGGGNONE 
AK111421CCCCCGCGNONE 
AK111421CGCGGGGGNONE 
Os04g0525900AK065806CCCCCGCGMajor facilitator superfamily protein. 
Os04g0529100AK107680CCCCCGCGPathogenesis-related transcriptional factor and ERF domain containing protein. 
AK107680CGCGGGGGPathogenesis-related transcriptional factor and ERF domain containing protein. 
Os04g0529400J013039I24CCTGGGCCCCCGCGNONE 
J013055M04CCTGGGCCCCCGCGNONE 
J023050E21CCTGGGCCCCCGCGNONE 
J033060K22CCTGGGCCCCCGCGNONE 
J075026D13CCTGGGCCCCCGCGNONE 
J075033M03CCTGGGCCCCCGCGNONE 
J075138F11CCTGGGCCCCCGCGNONE 
J090022B15CCTGGGCCCCCGCGNONE 
Os04g0551800016-049-G12CGCGGGGGCGAGGNONE 
AK121568CGCGGGGGCGAGGSimilar to T-complex protein 1, alpha subunit (TCP-1-alpha) (CCT-alpha). 
J013073O06CGCGGGGGCGAGGNONE 
J013111B11CGCGGGGGCGAGGNONE 
J013121H23CGCGGGGGCGAGGNONE 
J023012A17CGCGGGGGCGAGGNONE 
J023092M05CGCGGGGGCGAGGNONE 
J033026P14CGCGGGGGCGAGGNONE 
J033033C10CGCGGGGGCGAGGNONE 
J033033M10CGCGGGGGCGAGGNONE 
J033035C24CGCGGGGGCGAGGNONE 
J033052E19CGCGGGGGCGAGGNONE 
J033140K19CGCGGGGGCGAGGNONE 
J065036F18CGCGGGGGCGAGGNONE 
J065067L12CGCGGGGGCGAGGNONE 
J065095G09CGCGGGGGCGAGGNONE 
J065115B08CGCGGGGGCGAGGNONE 
J065218E24CGCGGGGGCGAGGNONE 
J090002N13CGCGGGGGCGAGGNONE 
J090008B12CGCGGGGGCGAGGNONE 
J090016F24CGCGGGGGCGAGGNONE 
J090019H14CGCGGGGGCGAGGNONE 
J090020G20CGCGGGGGCGAGGNONE 
J090029L18CGCGGGGGCGAGGNONE 
J090057C23CGCGGGGGCGAGGNONE 
J090073H23CGCGGGGGCGAGGNONE 
J090081C16CGCGGGGGCGAGGNONE 
J090081E21CGCGGGGGCGAGGNONE 
J090084L14CGCGGGGGCGAGGNONE 
J090086M01CGCGGGGGCGAGGNONE 
J090089E16CGCGGGGGCGAGGNONE 
J100031P12CGCGGGGGCGAGGNONE 
J100090N23CGCGGGGGCGAGGNONE 
Os04g0553800AK068076CCCCCGCGNONE 
J013159F02CCCCCGCGNONE 
Os04g0555000AK100757CGCGGGGGGRAS transcription factor domain containing protein. 
J023002M24CGCGGGGGNONE 
J023118P13CGCGGGGGNONE 
J065166A22CGCGGGGGNONE 
J065192H19CGCGGGGGNONE 
Os04g0568900AY224421CGCGGGGGNONE 
Os04g0579700AK065545CCCCCGCGSimilar to Predicted protein. 
J013034F23CCCCCGCGNONE 
J023056P03CCCCCGCGNONE 
J033108M23CCCCCGCGNONE 
J065061L24CCCCCGCGNONE 
J065062K23CCCCCGCGNONE 
J090038B10CCCCCGCGNONE 
J090043L24CCCCCGCGNONE 
J090080J08CCCCCGCGNONE 
J090082E14CCCCCGCGNONE 
Os04g0586500015-095-E09CCCCCGCGNONE 
AK106447CCCCCGCGConserved hypothetical protein. 
J075065I17CCCCCGCGNONE 
J100078J08CCCCCGCGNONE 
Os04g0618400AK108024CCCCCGCGHypothetical protein. 
J075075A11CCCCCGCGNONE 
J075131O10CCCCCGCGNONE 
J075170P14CCCCCGCGNONE 
Os04g0674000006-093-C01CCCCCGCGACGCNONE 
009-040-F06CCCCCGCGACGCNONE 
AK071276CCCCCGCGACGCNONE 
AK109377CCCCCGCGACGCConserved hypothetical protein. 
AK119671CCCCCGCGACGCNONE 
J023084J11CCCCCGCGACGCNONE 
J023088F18CCCCCGCGACGCNONE 
J065099M12CCCCCGCGACGCNONE 
J065136J08CCCCCGCGACGCNONE 
J065167H22CCCCCGCGACGCNONE 
J075046L21CCCCCGCGACGCNONE 
J080029F17CCCCCGCGACGCNONE 
J080053C16CCCCCGCGACGCNONE 
J080053E24CCCCCGCGACGCNONE 
J080074D14CCCCCGCGACGCNONE 
J100029C12CCCCCGCGACGCNONE 
J100030D01CCCCCGCGACGCNONE 
J100044E16CCCCCGCGACGCNONE 
J100065N18CCCCCGCGACGCNONE 
J100077D18CCCCCGCGACGCNONE 
J100090P13CCCCCGCGACGCNONE 
Os04g0674300AK059048CGCGGGGGNONE 
Os04g0683900004-009-A11CCCCCGCGNONE 
014-076-H12CCCCCGCGNONE 
AK060880CCCCCGCGNONE 
AK099749CCCCCGCGHMG-I and HMG-Y, DNA-binding domain containing protein. 
AK100309CCCCCGCGNONE 
J013050K21CCCCCGCGNONE 
J013092E09CCCCCGCGNONE 
J013095N06CCCCCGCGNONE 
J013095P07CCCCCGCGNONE 
J013130D22CCCCCGCGNONE 
J013134O15CCCCCGCGNONE 
J023022I06CCCCCGCGNONE 
J023062L11CCCCCGCGNONE 
J023078J11CCCCCGCGNONE 
J023086J01CCCCCGCGNONE 
J033125A20CCCCCGCGNONE 
J065023K13CCCCCGCGNONE 
J065045N02CCCCCGCGNONE 
J065129F01CCCCCGCGNONE 
J065164H14CCCCCGCGNONE 
J065192H09CCCCCGCGNONE 
J075064P15CCCCCGCGNONE 
J075088G17CCCCCGCGNONE 
J075199D20CCCCCGCGNONE 
Os05g0162600012-069-E09CCCCCGCGNONE 
AK063518CCCCCGCGSimilar to Splicing factor RSZ33. 
AK121854CCCCCGCGNONE 
J065178M11CCCCCGCGNONE 
J090016J24CCCCCGCGNONE 
J090023E07CCCCCGCGNONE 
Os05g0164100AF456329CCCCCGCGTGGGCCCCACCCGNONE 
AK065086CCCCCGCGTGGGCCCCACCCGNONE 
AK072243CCCCCGCGTGGGCCCCACCCGSimilar to Fructose-6-phosphate 2-kinase/fructose-2,6-bisphosphatase (EC 2.7.1.105) (EC 3.1.3.46) (Fragment). 
J013001L18CCCCCGCGTGGGCCCCACCCGNONE 
J013132O12CCCCCGCGTGGGCCCCACCCGNONE 
J023003N09CCCCCGCGTGGGCCCCACCCGNONE 
Os05g0173700012-035-H08CCCCCGCGNONE 
AK063470CCCCCGCGSimilar to DNA replication licensing factor MCM3 homolog (Replication origin activator) (ROA protein) (Fragment). 
Os05g0203000AK107744CCCCCGCGConserved hypothetical protein. 
Os05g0350500013-071-D05CCCCCGCGNONE 
AF020787CCCCCGCGNONE 
AK061712CCCCCGCGNONE 
AK102897CCCCCGCGProliferation-associated protein 1 family protein. 
J033060G23CCCCCGCGNONE 
J033112P14CCCCCGCGNONE 
J033127J04CCCCCGCGNONE 
J090015L18CCCCCGCGNONE 
J090047K03CCCCCGCGNONE 
J090097J17CCCCCGCGNONE 
Os05g0370200AK070493CCCCCGCGConserved hypothetical protein. 
Os05g0386800AK060897CCCCCGCGNONE 
AK070472CCCCCGCGSimilar to Phytochelatin synthetase-like protein 2. 
Os05g0388500AK065313CCCCCGCGSimilar to 50S ribosomal protein L1. 
AK065313CCCCCGCGACGCGCGAGSimilar to 50S ribosomal protein L1. 
AK098990CCCCCGCGNONE 
AK098990CCCCCGCGACGCGCGAGNONE 
AK104689CCCCCGCGNONE 
AK104689CCCCCGCGACGCGCGAGNONE 
J013094L23CCCCCGCGNONE 
J013094L23CCCCCGCGACGCGCGAGNONE 
J065118O04CCCCCGCGNONE 
J065118O04CCCCCGCGACGCGCGAGNONE 
Os05g0391500AK119412CCCCCGCGSimilar to Endo-beta-mannosidase. 
AK119412CCCCCGCGSimilar to Endo-beta-mannosidase. 
Os05g0393800AK069074CCCCCGCGProtein of unknown function DUF221 domain containing protein. 
Os05g0408300AK068553CCCCCGCGConserved hypothetical protein. 
Os05g0413200006-067-C03CCCCCGCGNONE 
006-080-C03CCCCCGCGNONE 
006-095-G10CCCCCGCGNONE 
006-115-G11CCCCCGCGNONE 
013-040-E05CCCCCGCGNONE 
AB104732CCCCCGCGNONE 
AK122099CCCCCGCGBeta-tubulin. 
J033087H20CCCCCGCGNONE 
J033117C18CCCCCGCGNONE 
J033125G10CCCCCGCGNONE 
Os05g0414200015-033-G02CCCCCGCGNONE 
AK106297CCCCCGCGDisease resistance protein family protein. 
Os05g0466600009-088-F09CCCCCGCGNONE 
009-105-C11CCCCCGCGNONE 
009-156-C06CCCCCGCGNONE 
AK119240CCCCCGCGhistone H4 [Oryza sativa (japonica cultivar-group)]. 
Os05g0486100AK119823CCCGGCCCCCGCGProtein kinase-like domain containing protein. 
Os05g0497625Os05g0497625CCCCCGCGConserved hypothetical protein. 
Os05g0507000AK108025CCCCCGCGConserved hypothetical protein. 
Os05g0514600AK107211CCCCCGCG2OG-Fe(II) oxygenase domain containing protein. 
Os05g0539400AK068572CCCCCGCGGlycoside hydrolase, family 35 protein. 
J013063P08CCCCCGCGNONE 
J013110N24CCCCCGCGNONE 
J013156K22CCCCCGCGNONE 
J043038A08CCCCCGCGNONE 
J090004K18CCCCCGCGNONE 
J090085F03CCCCCGCGNONE 
Os05g0566800AK065748CTCGGCCCCCGCGCold acclimation protein COR413-TM1. 
AY181210CTCGGCCCCCGCGNONE 
Os05g0573900J080085J19CCCCCGCGConserved hypothetical protein. 
Os05g0580900AK108609CGCGGGGGNONE 
AK120030CGCGGGGGConserved hypothetical protein. 
Os06g0166500016-094-H06CGCGGGGGGCCGGGNONE 
AK102541CGCGGGGGGCCGGGSimilar to Auxin-responsive protein IAA20 (Indoleacetic acid-induced protein 20). 
Os06g0225300AK065224CCCCCGCGNONE 
AK100258CCCCCGCGSimilar to SERK1 (Fragment). 
J013002G23CCCCCGCGNONE 
Os06g0225800AB188835CCCCCGCGShikimate kinase domain containing protein. 
AK109730CCCCCGCGNONE 
J065176A08CCCCCGCGNONE 
Os06g0233200AK108060CCCCCGCGSimilar to RING-H2 finger protein ATL1R (RING-H2 finger protein ATL8). 
Os06g0274500AK066417CCCCCGCGSimilar to SERK1 (Fragment). 
Os06g0354700AK066777CCCCCGCGEsterase/lipase/thioesterase domain containing protein. 
AK068937CCCCCGCGNONE 
J013056F09CCCCCGCGNONE 
J013065L21CCCCCGCGNONE 
J013069H09CCCCCGCGNONE 
J013070D15CCCCCGCGNONE 
J013073L19CCCCCGCGNONE 
J013075L23CCCCCGCGNONE 
J013088D18CCCCCGCGNONE 
J013095G23CCCCCGCGNONE 
J013097K24CCCCCGCGNONE 
J013106G04CCCCCGCGNONE 
J013132J10CCCCCGCGNONE 
J013135F08CCCCCGCGNONE 
J013156B21CCCCCGCGNONE 
J013159L05CCCCCGCGNONE 
J013170J16CCCCCGCGNONE 
J023007C08CCCCCGCGNONE 
J023062F13CCCCCGCGNONE 
J023085D05CCCCCGCGNONE 
J033046C05CCCCCGCGNONE 
J043015P17CCCCCGCGNONE 
J090029M06CCCCCGCGNONE 
J090035K04CCCCCGCGNONE 
J090066H02CCCCCGCGNONE 
Os06g0499900J065053E01CGCGGGGGNONE 
J065078C19CGCGGGGGNONE 
J065122P11CGCGGGGGNONE 
J065209B15CGCGGGGGNONE 
J065218E19CGCGGGGGNONE 
Os06g0553100J065130H10CCCCCGCGNONE 
J075102G23CCCCCGCGNONE 
J075147H23CCCCCGCGHeat shock factor (HSF)-type, DNA-binding domain containing protein. 
Os06g0598900AK100386CCCCCGCGSimilar to Serine-threonine kinase receptor-associated protein (UNR-interacting protein) (WD-40 repeat protein PT-WD) (MAP activator with WD repeats). 
J013088O05CCCCCGCGNONE 
J090043L20CCCCCGCGNONE 
Os06g0603600012-088-B11CCCCCGCGNONE 
AK063544CCCCCGCGNONE 
AK072067CCCCCGCGSimilar to Ids4-like protein. 
J065011H14CCCCCGCGNONE 
J065020D09CCCCCGCGNONE 
J065130O10CCCCCGCGNONE 
J065132J07CCCCCGCGNONE 
J075015L15CCCCCGCGNONE 
J090091K07CCCCCGCGNONE 
Os06g0639000AK102470CCCCCGCGGGGGGCCCCACCNONE 
J013106M02CCCCCGCGGGGGGCCCCACCNONE 
J100051K23CCCCCGCGGGGGGCCCCACCNONE 
Os06g0691000AK100072CCCCCGCGTCTCNONE 
Os06g0696400011-019-C01CCCCCGCGTCTCTGGCCCCCACACNONE 
011-027-D04CCCCCGCGTCTCTGGCCCCCACACNONE 
013-051-H10CCCCCGCGTCTCTGGCCCCCACACNONE 
013-054-A06CCCCCGCGTCTCTGGCCCCCACACNONE 
013-061-D06CCCCCGCGTCTCTGGCCCCCACACNONE 
013-088-F04CCCCCGCGTCTCTGGCCCCCACACNONE 
014-018-C07CCCCCGCGTCTCTGGCCCCCACACNONE 
014-026-E10CCCCCGCGTCTCTGGCCCCCACACNONE 
AK058291CCCCCGCGTCTCTGGCCCCCACACNONE 
AK066125CCCCCGCGTCTCTGGCCCCCACACNONE 
AK104912CCCCCGCGTCTCTGGCCCCCACACNONE 
BT014685CCCCCGCGTCTCTGGCCCCCACACSimilar to Xyloglucan endotransglucosylase/hydrolase protein 24 precursor (EC 2.4.1.207) (At-XTH24) (XTH-24) (Meristem protein 5) (MERI-5 protein) (MERI5 protein) (Endo-xyloglucan transferase) (Xyloglucan endo-1,4-beta-D-glucanase). 
J013059H08CCCCCGCGTCTCTGGCCCCCACACNONE 
J065065L22CCCCCGCGTCTCTGGCCCCCACACNONE 
J065084O06CCCCCGCGTCTCTGGCCCCCACACNONE 
J075006O13CCCCCGCGTCTCTGGCCCCCACACNONE 
J075013J18CCCCCGCGTCTCTGGCCCCCACACNONE 
J075018L23CCCCCGCGTCTCTGGCCCCCACACNONE 
J075036E14CCCCCGCGTCTCTGGCCCCCACACNONE 
J075039K21CCCCCGCGTCTCTGGCCCCCACACNONE 
J075075H13CCCCCGCGTCTCTGGCCCCCACACNONE 
J075091A14CCCCCGCGTCTCTGGCCCCCACACNONE 
J075093I09CCCCCGCGTCTCTGGCCCCCACACNONE 
J075136L17CCCCCGCGTCTCTGGCCCCCACACNONE 
J075156M24CCCCCGCGTCTCTGGCCCCCACACNONE 
J075174J01CCCCCGCGTCTCTGGCCCCCACACNONE 
J075179P15CCCCCGCGTCTCTGGCCCCCACACNONE 
J075181F02CCCCCGCGTCTCTGGCCCCCACACNONE 
J075194L24CCCCCGCGTCTCTGGCCCCCACACNONE 
J080302J02CCCCCGCGTCTCTGGCCCCCACACNONE 
J080304J11CCCCCGCGTCTCTGGCCCCCACACNONE 
J080308A15CCCCCGCGTCTCTGGCCCCCACACNONE 
J100041B09CCCCCGCGTCTCTGGCCCCCACACNONE 
Os06g0704700AK120907CCCCCGCGCCCCACCACNmrA-like family protein. 
AY224493CCCCCGCGCCCCACCACNONE 
Os06g0716700AB037681CCCCCGCGTGGACCSimilar to Endoplasmin homolog precursor (GRP94 homolog). 
AK063385CCCCCGCGTGGACCNONE 
AK102478CCCCCGCGTGGACCNONE 
J013030D18CCCCCGCGTGGACCNONE 
J090091L06CCCCCGCGTGGACCNONE 
Os07g0124100014-015-G11CCCCCGCGTGGACCNONE 
AJ276693CCCCCGCGTGGACCPhytosulfokines 4 precursor [Contains: Phytosulfokine-alpha (PSK- alpha) (Phytosulfokine-a); Phytosulfokine-beta (PSK-beta) (Phytosulfokine-b)]. 
AK063647CCCCCGCGTGGACCNONE 
Os07g0240200AK068978CGCGGGGGSimilar to Beta-1,3 glucanase precursor (EC 3.2.1.39). 
J023003K14CGCGGGGGNONE 
Os07g0258400AK121534CCCCCGCGNONE 
L41217CCCCCGCGNONE 
S81897CCCCCGCGOsNramp1 (Integral membrane protein). 
Os07g0490300AK068288TCGCGCGCGCGGGGGGGTGGGCCCACCSimilar to Preproacrosin. 
J013149P03TCGCGCGCGCGGGGGGGTGGGCCCACCNONE 
J065039L14TCGCGCGCGCGGGGGGGTGGGCCCACCNONE 
J100024A06TCGCGCGCGCGGGGGGGTGGGCCCACCNONE 
Os07g0490400AK067941CACTGACAGGTGGGCCCACCCCCCCGCGCGCGCGAPeptidylprolyl isomerase, FKBP-type domain containing protein. 
J013121F22CACTGACAGGTGGGCCCACCCCCCCGCGCGCGCGANONE 
Os07g0502200006-027-C06CCCCCGCGCGCGACNONE 
012-007-C05CCCCCGCGCGCGACNONE 
AK120682CCCCCGCGCGCGACMulti antimicrobial extrusion protein MatE family protein. 
J053045G13CCCCCGCGCGCGACNONE 
J053064I18CCCCCGCGCGCGACNONE 
J053091G24CCCCCGCGCGCGACNONE 
J065016E10CCCCCGCGCGCGACNONE 
J065021B18CCCCCGCGCGCGACNONE 
J065022A17CCCCCGCGCGCGACNONE 
J065059D18CCCCCGCGCGCGACNONE 
J065063N19CCCCCGCGCGCGACNONE 
J065065O10CCCCCGCGCGCGACNONE 
J065196F12CCCCCGCGCGCGACNONE 
J065208I01CCCCCGCGCGCGACNONE 
J065218G15CCCCCGCGCGCGACNONE 
J100040G01CCCCCGCGCGCGACNONE 
J100060M03CCCCCGCGCGCGACNONE 
J100061P09CCCCCGCGCGCGACNONE 
J100065P05CCCCCGCGCGCGACNONE 
Os07g0558000AK069272CCCCCGCGNONE 
AK101867CCCCCGCGABC-1 domain containing protein. 
Os07g0567700AK059008CGCGGGGGNONE 
Os07g0581000013-010-F09CCCCCGCGNONE 
013-040-C05CCCCCGCGNONE 
AK064035CCCCCGCGNONE 
AK102987CCCCCGCGProtein of unknown function DUF250 domain containing protein. 
J033116C12CCCCCGCGNONE 
J065086C01CCCCCGCGNONE 
J065191G19CCCCCGCGNONE 
J075016L03CCCCCGCGNONE 
J075083N11CCCCCGCGNONE 
J100060A06CCCCCGCGNONE 
Os07g0608400AK109447CGCGGGGGSimilar to nucleic acid binding protein [Oryza sativa (japonica cultivar-group)]. 
Os07g0609550J065095O17CCCCCGCGHypothetical protein. 
J065197P21CCCCCGCGNONE 
Os07g0656700J065166M23CCCCCGCGUncharacterized protein UPF0114 family protein. 
Os07g0659300AK069789CCCCCGCGCGCGAConserved hypothetical protein. 
Os08g0135900AK072535CCCCCGCGTGGGSimilar to Tryptophan synthase beta chain 1 (EC 4.2.1.20) (Orange pericarp 1) (Fragment). 
Os08g0150800AK101530CGCGGGGGSimilar to Tyrosyl-tRNA synthetase (Tyrosyl-tRNA ligase; TyrRS). class-I aaRS. 
Os08g0184800016-029-D09CCCCCGCGNONE 
AK066827CCCCCGCGNONE 
AK071706CCCCCGCGNONE 
AK072453CCCCCGCGHypothetical protein. 
AK104021CCCCCGCGNONE 
J013057C24CCCCCGCGNONE 
J013111I20CCCCCGCGNONE 
J023060J16CCCCCGCGNONE 
J023112F07CCCCCGCGNONE 
J023119K08CCCCCGCGNONE 
J033075M21CCCCCGCGNONE 
J033109A21CCCCCGCGNONE 
J065153H16CCCCCGCGNONE 
J100044B22CCCCCGCGNONE 
Os08g0414600AK101578CCCCCGCGSoluble quinoprotein glucose dehydrogenase domain containing protein. 
AK101579CCCCCGCGNONE 
Os08g0447200AK067377CGCGGGGGSGT1 family protein. 
J013106M17CGCGGGGGNONE 
J033133D18CGCGGGGGNONE 
J033140B09CGCGGGGGNONE 
J100028I17CGCGGGGGNONE 
J100086C22CGCGGGGGNONE 
Os08g0471800AK105281CGCGGGGGRemorin, C-terminal region domain containing protein. 
Os08g0474000009-121-F01CCCCCGCGTGCGNONE 
009-124-B06CCCCCGCGTGCGNONE 
AK062882CCCCCGCGTGCGSimilar to AP2 domain containing protein RAP2.6 (Fragment). 
Os08g0560900AK120366CCCCCGCGNONE 
Os09g0309500J100027L22TGTGGGCCCCACCCCCCGCGConserved hypothetical protein. 
Os09g0360400009-192-H06CGCGGGGGTGGGGCCCACTGGGCCCCCACCCGNONE 
AK071395CGCGGGGGTGGGGCCCACTGGGCCCCCACCCGConserved hypothetical protein. 
J013045J21CGCGGGGGTGGGGCCCACTGGGCCCCCACCCGNONE 
J023095O09CGCGGGGGTGGGGCCCACTGGGCCCCCACCCGNONE 
J065207K01CGCGGGGGTGGGGCCCACTGGGCCCCCACCCGNONE 
Os09g0364100AK071233CCCCCGCGLateral organ boundaries, LOB domain containing protein. 
Os09g0367900011-030-A03CCCCCGCGNONE 
AK061601CCCCCGCGNONE 
AK063310CCCCCGCGHypothetical protein. 
J100063G01CCCCCGCGNONE 
Os09g0372900006-044-C02CCCCCGCGNONE 
AK059785CCCCCGCGCyclin-like F-box domain containing protein. 
AK067586CCCCCGCGNONE 
AK100129CCCCCGCGNONE 
J023009I10CCCCCGCGNONE 
J065195A19CCCCCGCGNONE 
J065202M02CCCCCGCGNONE 
J065215H14CCCCCGCGNONE 
Os09g0418000006-022-F01CCCCCGCGCCCACACACCNONE 
006-038-G10CCCCCGCGCCCACACACCNONE 
006-089-G04CCCCCGCGCCCACACACCNONE 
006-098-F07CCCCCGCGCCCACACACCNONE 
AK061220CCCCCGCGCCCACACACCNONE 
AK061493CCCCCGCGCCCACACACCNONE 
AK100881CCCCCGCGCCCACACACCNONE 
AK119760CCCCCGCGCCCACACACCProtein kinase-like domain containing protein. 
J023127H10CCCCCGCGCCCACACACCNONE 
J033122J01CCCCCGCGCCCACACACCNONE 
J065162D08CCCCCGCGCCCACACACCNONE 
J065214P03CCCCCGCGCCCACACACCNONE 
J090009B17CCCCCGCGCCCACACACCNONE 
J090093C21CCCCCGCGCCCACACACCNONE 
J100067C01CCCCCGCGCCCACACACCNONE 
J100067P06CCCCCGCGCCCACACACCNONE 
Os09g0420300AK120582CCCCCGCGDNA glycosylase family protein. 
Os09g0480400AK100641TCCGGGCCCCCCCGCGSimilar to Glycosyltransferase QUASIMODO1 (EC 2.4.1.-). 
J023110G15TCCGGGCCCCCCCGCGNONE 
J090053K21TCCGGGCCCCCCCGCGNONE 
Os09g0484800AK071962CCCCCGCGNONE 
AK109548CCCCCGCGSimilar to Pirin-like protein. 
Os09g0503000AK109203CGCGGGGGAlcohol dehydrogenase superfamily, zinc-containing protein. 
Os09g0505300AK061352CGCGGGGGSimilar to Br FatA1. 
Os09g0522800015-033-B12CGCGGGGGNONE 
015-083-G12CGCGGGGGNONE 
AK070906CGCGGGGGProtein of unknown function DUF1618 domain containing protein. 
J023065L17CGCGGGGGNONE 
J090090P20CGCGGGGGNONE 
Os09g0525900006-115-E04CGCGGGGGNONE 
AK059988CGCGGGGGRhomboid-like protein family protein. 
AK071290CGCGGGGGNONE 
J013153K05CGCGGGGGNONE 
J023087M04CGCGGGGGNONE 
J065165B13CGCGGGGGNONE 
J075013G15CGCGGGGGNONE 
J075028A09CGCGGGGGNONE 
J075031I06CGCGGGGGNONE 
J075051C21CGCGGGGGNONE 
J075114H22CGCGGGGGNONE 
J075129A19CGCGGGGGNONE 
J075129M12CGCGGGGGNONE 
J075166N24CGCGGGGGNONE 
J075167M23CGCGGGGGNONE 
J075168D10CGCGGGGGNONE 
Os09g0528200006-021-E01CCCCCGCGNONE 
AK059755CCCCCGCGNONE 
Os09g0533900003-104-E05CCCCCGCGNONE 
012-076-C03CCCCCGCGNONE 
AK067774CCCCCGCGNONE 
AK100449CCCCCGCGSimilar to CEL5=CELLULASE 5 (Fragment). 
J013048F07CCCCCGCGNONE 
J023026E11CCCCCGCGNONE 
J023028B20CCCCCGCGNONE 
J023050P11CCCCCGCGNONE 
J023052K08CCCCCGCGNONE 
J023075J03CCCCCGCGNONE 
J023078E15CCCCCGCGNONE 
J023090P12CCCCCGCGNONE 
J023120E01CCCCCGCGNONE 
J023142K01CCCCCGCGNONE 
J033027K23CCCCCGCGNONE 
J033058A09CCCCCGCGNONE 
J033058C12CCCCCGCGNONE 
J033125A04CCCCCGCGNONE 
J043040L01CCCCCGCGNONE 
J053061D06CCCCCGCGNONE 
J053096N13CCCCCGCGNONE 
J065193H10CCCCCGCGNONE 
J090075L17CCCCCGCGNONE 
J100050D10CCCCCGCGNONE 
Os11g0180300AK072438CCCCCGCGConserved hypothetical protein. 
J013092P11CCCCCGCGNONE 
J013092P13CCCCCGCGNONE 
J023107D15CCCCCGCGNONE 
J065191C20CCCCCGCGNONE 
J090082F02CCCCCGCGNONE 
Os11g0234200AK105440CGCGGGGGZinc finger, FYVE/PHD-type domain containing protein. 
Os11g0484300AK121422CCCCCGCGSimilar to Mcm2-prov protein. 
Os11g0530600AB000801CCCCCGCGSimilar to Chalcone synthase C2 (EC 2.3.1.74) (Naringenin-chalcone synthase C2). 
AK067810CCCCCGCGNONE 
D29697CCCCCGCGNONE 
J013119K06CCCCCGCGNONE 
J023001C21CCCCCGCGNONE 
J023081C19CCCCCGCGNONE 
J065026K21CCCCCGCGNONE 
J065040A17CCCCCGCGNONE 
J065043H01CCCCCGCGNONE 
J065093P05CCCCCGCGNONE 
J065104P15CCCCCGCGNONE 
J065127C09CCCCCGCGNONE 
J065140D08CCCCCGCGNONE 
X89859CCCCCGCGNONE 
Os11g0547000AK100677CCCCCGCGSimilar to FKF1. 
Os11g0582400AF049348CCCCCGCGCGCGACGTGGGCTConserved hypothetical protein. 
AF516927CCCCCGCGCGCGACGTGGGCTNONE 
AK073083CCCCCGCGCGCGACGTGGGCTNONE 
AK108352CCCCCGCGCGCGACGTGGGCTNONE 
J075005O16CCCCCGCGCGCGACGTGGGCTNONE 
J075007D15CCCCCGCGCGCGACGTGGGCTNONE 
J075007L04CCCCCGCGCGCGACGTGGGCTNONE 
J075009C11CCCCCGCGCGCGACGTGGGCTNONE 
J075012L11CCCCCGCGCGCGACGTGGGCTNONE 
J075013A14CCCCCGCGCGCGACGTGGGCTNONE 
J075015K01CCCCCGCGCGCGACGTGGGCTNONE 
J075019O21CCCCCGCGCGCGACGTGGGCTNONE 
J075020G20CCCCCGCGCGCGACGTGGGCTNONE 
J075020H06CCCCCGCGCGCGACGTGGGCTNONE 
J075022D07CCCCCGCGCGCGACGTGGGCTNONE 
J075024M12CCCCCGCGCGCGACGTGGGCTNONE 
J075025G04CCCCCGCGCGCGACGTGGGCTNONE 
J075026F09CCCCCGCGCGCGACGTGGGCTNONE 
J075027D19CCCCCGCGCGCGACGTGGGCTNONE 
J075030A12CCCCCGCGCGCGACGTGGGCTNONE 
J075030C16CCCCCGCGCGCGACGTGGGCTNONE 
J075030D15CCCCCGCGCGCGACGTGGGCTNONE 
J075034M20CCCCCGCGCGCGACGTGGGCTNONE 
J075041H12CCCCCGCGCGCGACGTGGGCTNONE 
J075052D12CCCCCGCGCGCGACGTGGGCTNONE 
J075052G11CCCCCGCGCGCGACGTGGGCTNONE 
J075053L09CCCCCGCGCGCGACGTGGGCTNONE 
J075064G05CCCCCGCGCGCGACGTGGGCTNONE 
J075067J01CCCCCGCGCGCGACGTGGGCTNONE 
J075071O03CCCCCGCGCGCGACGTGGGCTNONE 
J075072G12CCCCCGCGCGCGACGTGGGCTNONE 
J075078H06CCCCCGCGCGCGACGTGGGCTNONE 
J075081D06CCCCCGCGCGCGACGTGGGCTNONE 
J075084G23CCCCCGCGCGCGACGTGGGCTNONE 
J075085M10CCCCCGCGCGCGACGTGGGCTNONE 
J075087N20CCCCCGCGCGCGACGTGGGCTNONE 
J075088E11CCCCCGCGCGCGACGTGGGCTNONE 
J075088O22CCCCCGCGCGCGACGTGGGCTNONE 
J075091E10CCCCCGCGCGCGACGTGGGCTNONE 
J075092B12CCCCCGCGCGCGACGTGGGCTNONE 
J075093E08CCCCCGCGCGCGACGTGGGCTNONE 
J075095D04CCCCCGCGCGCGACGTGGGCTNONE 
J075095J10CCCCCGCGCGCGACGTGGGCTNONE 
J075095O19CCCCCGCGCGCGACGTGGGCTNONE 
J075096H20CCCCCGCGCGCGACGTGGGCTNONE 
J075098F10CCCCCGCGCGCGACGTGGGCTNONE 
J075100H10CCCCCGCGCGCGACGTGGGCTNONE 
J075104C23CCCCCGCGCGCGACGTGGGCTNONE 
J075105B10CCCCCGCGCGCGACGTGGGCTNONE 
J075106I24CCCCCGCGCGCGACGTGGGCTNONE 
J075109H23CCCCCGCGCGCGACGTGGGCTNONE 
J075115A03CCCCCGCGCGCGACGTGGGCTNONE 
J075118M06CCCCCGCGCGCGACGTGGGCTNONE 
J075121G08CCCCCGCGCGCGACGTGGGCTNONE 
J075122C09CCCCCGCGCGCGACGTGGGCTNONE 
J075122J12CCCCCGCGCGCGACGTGGGCTNONE 
J075123E06CCCCCGCGCGCGACGTGGGCTNONE 
J075123E16CCCCCGCGCGCGACGTGGGCTNONE 
J075124N09CCCCCGCGCGCGACGTGGGCTNONE 
J075127F23CCCCCGCGCGCGACGTGGGCTNONE 
J075128H17CCCCCGCGCGCGACGTGGGCTNONE 
J075129C02CCCCCGCGCGCGACGTGGGCTNONE 
J075139P18CCCCCGCGCGCGACGTGGGCTNONE 
J075140H17CCCCCGCGCGCGACGTGGGCTNONE 
J075146E12CCCCCGCGCGCGACGTGGGCTNONE 
J075146I07CCCCCGCGCGCGACGTGGGCTNONE 
J075150A08CCCCCGCGCGCGACGTGGGCTNONE 
J075150I22CCCCCGCGCGCGACGTGGGCTNONE 
J075155D01CCCCCGCGCGCGACGTGGGCTNONE 
J075155N10CCCCCGCGCGCGACGTGGGCTNONE 
J075155O09CCCCCGCGCGCGACGTGGGCTNONE 
J075156K11CCCCCGCGCGCGACGTGGGCTNONE 
J075157N01CCCCCGCGCGCGACGTGGGCTNONE 
J075164L09CCCCCGCGCGCGACGTGGGCTNONE 
J075166F14CCCCCGCGCGCGACGTGGGCTNONE 
J075169E20CCCCCGCGCGCGACGTGGGCTNONE 
J075170B13CCCCCGCGCGCGACGTGGGCTNONE 
J075170F24CCCCCGCGCGCGACGTGGGCTNONE 
J075170N16CCCCCGCGCGCGACGTGGGCTNONE 
J075172H22CCCCCGCGCGCGACGTGGGCTNONE 
J075172I02CCCCCGCGCGCGACGTGGGCTNONE 
J075176E08CCCCCGCGCGCGACGTGGGCTNONE 
J075177H17CCCCCGCGCGCGACGTGGGCTNONE 
J075179C18CCCCCGCGCGCGACGTGGGCTNONE 
J075182H23CCCCCGCGCGCGACGTGGGCTNONE 
J075187B10CCCCCGCGCGCGACGTGGGCTNONE 
J075192L10CCCCCGCGCGCGACGTGGGCTNONE 
J075195C04CCCCCGCGCGCGACGTGGGCTNONE 
U25969CCCCCGCGCGCGACGTGGGCTNONE 
Os12g0106700AK106509CGCGGGGGSimilar to OsPK4. 
Os12g0124700AK073156CGCGGGGGCDC45-like protein family protein. 
J090013O22CGCGGGGGNONE 
Os12g0554800AK105676CCCCCGCGSimilar to Polygalacturonase-like protein. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.