version

Summary of OsREG538 (All List)

OrganismOryza sativa  
IDOsREG538  
SequenceCCCGGCCC  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count3233  

Entry Sequences (3233 entries)

LocusGene modelSequenceDescription
Os01g0100700006-066-G10CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
009-108-B10CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
AK059844CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
AK121523CCTGGGCCGGGCCCGGCCCAGCCCAACASimilar to 40S ribosomal protein S5-1. 
J023037D16CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J033028P14CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J033064M07CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J033123M01CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J065026O07CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J065082A05CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J075003I02CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J075170J15CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J100040D18CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
Os01g0104400006-026-B08GGGCCGGGNONE 
006-030-C01GGGCCGGGNONE 
006-055-E02GGGCCGGGNONE 
006-061-B12GGGCCGGGNONE 
006-064-F06GGGCCGGGNONE 
006-078-G10GGGCCGGGNONE 
006-079-G09GGGCCGGGNONE 
006-080-B08GGGCCGGGNONE 
006-100-E07GGGCCGGGNONE 
006-110-E01GGGCCGGGNONE 
006-118-D10GGGCCGGGNONE 
006-120-C12GGGCCGGGNONE 
AK060132GGGCCGGGNONE 
AK071375GGGCCGGGRicin B-related lectin domain containing protein. 
AK104555GGGCCGGGNONE 
AK104820GGGCCGGGNONE 
J023121J21GGGCCGGGNONE 
Os01g0147200016-005-F02GGGCCCGGCCCATCANONE 
AK106463GGGCCCGGCCCATCANONE 
AK121921GGGCCCGGCCCATCAIWS1, C-terminal family protein. 
J033098O16GGGCCCGGCCCATCANONE 
J033106E16GGGCCCGGCCCATCANONE 
J043026D12GGGCCCGGCCCATCANONE 
J065070B04GGGCCCGGCCCATCANONE 
J065162L03GGGCCCGGCCCATCANONE 
J065166F01GGGCCCGGCCCATCANONE 
J075030A13GGGCCCGGCCCATCANONE 
J075093O12GGGCCCGGCCCATCANONE 
J075106K15GGGCCCGGCCCATCANONE 
J075107F20GGGCCCGGCCCATCANONE 
J090031F21GGGCCCGGCCCATCANONE 
J090079E17GGGCCCGGCCCATCANONE 
Os01g0206200AK102840CCAGGCCCGGCCCGGCCCATAAConserved hypothetical protein. 
J065099M13CCAGGCCCGGCCCGGCCCATAANONE 
Os01g0214500AK062484CCCGGCCCConserved hypothetical protein. 
Os01g0231700012-002-F11ATATGGGCCGGGCCGAGNONE 
013-082-F05ATATGGGCCGGGCCGAGNONE 
AK107453ATATGGGCCGGGCCGAGSimilar to 60S acidic ribosomal protein P2-B (CaRP2B). 
J065005L22ATATGGGCCGGGCCGAGNONE 
J065023E21ATATGGGCCGGGCCGAGNONE 
J065036H21ATATGGGCCGGGCCGAGNONE 
J065037M24ATATGGGCCGGGCCGAGNONE 
J065049L04ATATGGGCCGGGCCGAGNONE 
J065072F17ATATGGGCCGGGCCGAGNONE 
J065085H10ATATGGGCCGGGCCGAGNONE 
J065109N19ATATGGGCCGGGCCGAGNONE 
J065117M19ATATGGGCCGGGCCGAGNONE 
J065144C15ATATGGGCCGGGCCGAGNONE 
J065159G24ATATGGGCCGGGCCGAGNONE 
J065164N14ATATGGGCCGGGCCGAGNONE 
J075025K16ATATGGGCCGGGCCGAGNONE 
J075057L05ATATGGGCCGGGCCGAGNONE 
J075070I16ATATGGGCCGGGCCGAGNONE 
J075089D10ATATGGGCCGGGCCGAGNONE 
J075138F10ATATGGGCCGGGCCGAGNONE 
J090018C11ATATGGGCCGGGCCGAGNONE 
J100018L19ATATGGGCCGGGCCGAGNONE 
J100024B14ATATGGGCCGGGCCGAGNONE 
J100048L02ATATGGGCCGGGCCGAGNONE 
J100055A22ATATGGGCCGGGCCGAGNONE 
J100069K01ATATGGGCCGGGCCGAGNONE 
Os01g0246500AK058984TCCGGGCCGGGCCCAAAASimilar to Minus dominance protein. 
Os01g0266400009-169-A06CCCGGCCCGCANONE 
AK121188CCCGGCCCGCAConserved hypothetical protein. 
J023085H22CCCGGCCCGCANONE 
J080301K14CCCGGCCCGCANONE 
J080303B07CCCGGCCCGCANONE 
J080303H21CCCGGCCCGCANONE 
J080308F24CCCGGCCCGCANONE 
Os01g0276700011-014-A12CCCGGCCCACACNONE 
012-092-G12CCCGGCCCACACNONE 
AK103164CCCGGCCCACACNONE 
AK103465CCCGGCCCACACSimilar to Pyruvate kinase, cytosolic isozyme (EC 2.7.1.40) (PK). 
J023019H09CCCGGCCCACACNONE 
J023084I02CCCGGCCCACACNONE 
J033027F20CCCGGCCCACACNONE 
J033029M06CCCGGCCCACACNONE 
J033039K13CCCGGCCCACACNONE 
J033057C24CCCGGCCCACACNONE 
J033058G20CCCGGCCCACACNONE 
J033060A14CCCGGCCCACACNONE 
J033061M21CCCGGCCCACACNONE 
J033068M10CCCGGCCCACACNONE 
J033074K16CCCGGCCCACACNONE 
J033076C11CCCGGCCCACACNONE 
J033093O13CCCGGCCCACACNONE 
J033119H20CCCGGCCCACACNONE 
J033121D22CCCGGCCCACACNONE 
J033129N11CCCGGCCCACACNONE 
J033131E12CCCGGCCCACACNONE 
J033150L07CCCGGCCCACACNONE 
J053024N17CCCGGCCCACACNONE 
J053034G19CCCGGCCCACACNONE 
J053035E18CCCGGCCCACACNONE 
J053046M01CCCGGCCCACACNONE 
J053047P04CCCGGCCCACACNONE 
J053048B06CCCGGCCCACACNONE 
J053050M22CCCGGCCCACACNONE 
J053053E09CCCGGCCCACACNONE 
J053053I07CCCGGCCCACACNONE 
J053059K03CCCGGCCCACACNONE 
J053059P12CCCGGCCCACACNONE 
J053060C12CCCGGCCCACACNONE 
J053060H24CCCGGCCCACACNONE 
J053064D19CCCGGCCCACACNONE 
J053066L15CCCGGCCCACACNONE 
J053073I02CCCGGCCCACACNONE 
J053083E15CCCGGCCCACACNONE 
J053094D05CCCGGCCCACACNONE 
J053094P18CCCGGCCCACACNONE 
J053095C15CCCGGCCCACACNONE 
J053095C21CCCGGCCCACACNONE 
J053099N16CCCGGCCCACACNONE 
J090025O19CCCGGCCCACACNONE 
J090049N22CCCGGCCCACACNONE 
J090050F17CCCGGCCCACACNONE 
Os01g0283000AK073165CCCGGCCCGCAConserved hypothetical protein. 
J033023G08CCCGGCCCGCANONE 
Os01g0283100004-018-B01TGCGGGCCGGGNONE 
AK060908TGCGGGCCGGGNONE 
AK071713TGCGGGCCGGGSimilar to Ferripyochelin-binding protein-like. 
AK104205TGCGGGCCGGGNONE 
AK122051TGCGGGCCGGGNONE 
J023109L19TGCGGGCCGGGNONE 
Os01g0286000AK109824AGATGGGCCGGGCCCSnf7 family protein. 
Os01g0388000AK069778GCCCGGCCCSimilar to Cytochrome P450 monooxygenase CYP72A5 (Fragment). 
Os01g0514300AK121086GGGCCGGGCLissencephaly type-1-like homology motif domain containing protein. 
Os01g0527700006-102-G07AACGGGCCCGGCCCATGNONE 
012-094-B11AACGGGCCCGGCCCATGNONE 
015-096-C04AACGGGCCCGGCCCATGNONE 
AK061861AACGGGCCCGGCCCATGProtoheme IX farnesyltransferase family protein. 
AK099005AACGGGCCCGGCCCATGNONE 
J013109B04AACGGGCCCGGCCCATGNONE 
J033057L14AACGGGCCCGGCCCATGNONE 
J090072H04AACGGGCCCGGCCCATGNONE 
J100030A14AACGGGCCCGGCCCATGNONE 
Os01g0551000006-104-A04CCCAGCCCGGCCCAACCNONE 
009-183-B08CCCAGCCCGGCCCAACCNONE 
AK071219CCCAGCCCGGCCCAACCConserved hypothetical protein. 
AK106034CCCAGCCCGGCCCAACCNONE 
Os01g0558600006-120-G12ATCTCGGCCCGGCCCGGCCCAACTNONE 
J013100N20ATCTCGGCCCGGCCCGGCCCAACTNONE 
J033043P09ATCTCGGCCCGGCCCGGCCCAACTNONE 
J033125M18ATCTCGGCCCGGCCCGGCCCAACTNONE 
J053043N11ATCTCGGCCCGGCCCGGCCCAACTNONE 
J065008E07ATCTCGGCCCGGCCCGGCCCAACTNONE 
J065080O16ATCTCGGCCCGGCCCGGCCCAACTNONE 
J075002G24ATCTCGGCCCGGCCCGGCCCAACTNONE 
J075123C09ATCTCGGCCCGGCCCGGCCCAACTNONE 
S66160ATCTCGGCCCGGCCCGGCCCAACTRas-related protein RIC1. 
Os01g0587000AK067605CCCGGCCCGGCCSimilar to Vacuolar ATP synthase subunit d (EC 3.6.3.14) (V-ATPase d subunit) (Vacuolar proton pump d subunit) (V-ATPase 41 KDa accessory protein) (DVA41). 
Os01g0590200011-100-E06GTTGGGCCGGGGCCCATTANONE 
012-005-A05GTTGGGCCGGGGCCCATTANONE 
AK063416GTTGGGCCGGGGCCCATTAConserved hypothetical protein. 
AK099235GTTGGGCCGGGGCCCATTANONE 
AK105022GTTGGGCCGGGGCCCATTANONE 
J065030D21GTTGGGCCGGGGCCCATTANONE 
J065031C10GTTGGGCCGGGGCCCATTANONE 
J065105A22GTTGGGCCGGGGCCCATTANONE 
J065173M19GTTGGGCCGGGGCCCATTANONE 
J075188F15GTTGGGCCGGGGCCCATTANONE 
J090050C15GTTGGGCCGGGGCCCATTANONE 
J100058K07GTTGGGCCGGGGCCCATTANONE 
Os01g0590300014-089-E04CGGGTGGGCCGGGNONE 
AK063740CGGGTGGGCCGGGConserved hypothetical protein. 
Os01g0612600004-008-D07TGCGGGCCGGGCCGNONE 
009-057-C09TGCGGGCCGGGCCGNONE 
009-130-C01TGCGGGCCGGGCCGNONE 
AK062906TGCGGGCCGGGCCGNONE 
AK066561TGCGGGCCGGGCCGProtein of unknown function DUF1644 family protein. 
J013065E14TGCGGGCCGGGCCGNONE 
J013073D14TGCGGGCCGGGCCGNONE 
J023014A21TGCGGGCCGGGCCGNONE 
J023073M13TGCGGGCCGGGCCGNONE 
J023079F02TGCGGGCCGGGCCGNONE 
J023083B16TGCGGGCCGGGCCGNONE 
J023090G19TGCGGGCCGGGCCGNONE 
J023095F15TGCGGGCCGGGCCGNONE 
J023119H11TGCGGGCCGGGCCGNONE 
J033040B01TGCGGGCCGGGCCGNONE 
J033044F13TGCGGGCCGGGCCGNONE 
J033081E23TGCGGGCCGGGCCGNONE 
J033121K07TGCGGGCCGGGCCGNONE 
J033124D11TGCGGGCCGGGCCGNONE 
J033131N22TGCGGGCCGGGCCGNONE 
J065179E10TGCGGGCCGGGCCGNONE 
J090020A13TGCGGGCCGGGCCGNONE 
J090045K17TGCGGGCCGGGCCGNONE 
J090047M24TGCGGGCCGGGCCGNONE 
J090064G23TGCGGGCCGGGCCGNONE 
J090084G08TGCGGGCCGGGCCGNONE 
J090086F18TGCGGGCCGGGCCGNONE 
J100032D09TGCGGGCCGGGCCGNONE 
J100037O18TGCGGGCCGGGCCGNONE 
J100042B03TGCGGGCCGGGCCGNONE 
J100061D06TGCGGGCCGGGCCGNONE 
J100061I03TGCGGGCCGGGCCGNONE 
J100063B17TGCGGGCCGGGCCGNONE 
Os01g0674500013-062-A08CCCGGCCCATCCNONE 
AK072815CCCGGCCCATCCNONE 
J023142B02CCCGGCCCATCCNONE 
Os01g0680400AK067914CCCGGCCCAAAATAFII28-like protein family protein. 
J065039K13CCCGGCCCAAAANONE 
J065042K22CCCGGCCCAAAANONE 
J080016E23CCCGGCCCAAAANONE 
J080064E22CCCGGCCCAAAANONE 
Os01g0743400AK059177GGGCCGGGCCGGCSimilar to Tryptophanyl-tRNA synthetase (Fragment). 
AK069114GGGCCGGGCCGGCNONE 
J065070E07GGGCCGGGCCGGCNONE 
J065152G11GGGCCGGGCCGGCNONE 
Os01g0750900AK111087TCCGGGCCGGGConserved hypothetical protein. 
J100042H18TCCGGGCCGGGNONE 
J100044L13TCCGGGCCGGGNONE 
Os01g0776700J065046N20CATCCCCCGGCCCCACACGConserved hypothetical protein. 
J100086L02CATCCCCCGGCCCCACACGNONE 
Os01g0801000AK064082ACATGGGCCGGGCCGGANONE 
AK101426ACATGGGCCGGGCCGGASimilar to Apurinic endonuclease-redox protein (DNA-(apurinic or apyrimidinic site) lyase) (EC 4.2.99.18). 
Os01g0813400006-025-B06TGTTGGGCTGGGCCGGGNONE 
006-030-C07TGTTGGGCTGGGCCGGGNONE 
006-068-F06TGTTGGGCTGGGCCGGGNONE 
006-096-E09TGTTGGGCTGGGCCGGGNONE 
006-097-B11TGTTGGGCTGGGCCGGGNONE 
006-104-H02TGTTGGGCTGGGCCGGGNONE 
AK062251TGTTGGGCTGGGCCGGGNONE 
AK065370TGTTGGGCTGGGCCGGGSimilar to ADP-ribosylation factor 1. 
J013022G24TGTTGGGCTGGGCCGGGNONE 
J013104C07TGTTGGGCTGGGCCGGGNONE 
J023074M17TGTTGGGCTGGGCCGGGNONE 
J043027C07TGTTGGGCTGGGCCGGGNONE 
J065026K05TGTTGGGCTGGGCCGGGNONE 
J065103I01TGTTGGGCTGGGCCGGGNONE 
J090025M17TGTTGGGCTGGGCCGGGNONE 
J100027L03TGTTGGGCTGGGCCGGGNONE 
J100054I20TGTTGGGCTGGGCCGGGNONE 
Os01g0816100012-082-H02GGGCCGGGCCCACCTGCAGCCCACGTNONE 
AB028183GGGCCGGGCCCACCTGCAGCCCACGTNONE 
AK073848GGGCCGGGCCCACCTGCAGCCCACGTNONE 
AY986504GGGCCGGGCCCACCTGCAGCCCACGTSimilar to NAC domain protein. 
J100061B19GGGCCGGGCCCACCTGCAGCCCACGTNONE 
Os01g0844800AK099801CCCGGCCCSimilar to Pumilio RBD (Fragment). 
AK102882CCCGGCCCNONE 
AK103686CCCGGCCCNONE 
Os01g0846300AK065949CCACGTGTTGCGGGCCGGGCCGGGSimilar to Protein phosphatase 2C. 
Os01g0855600003-004-C02GGGCCCGGCCCACCCGNONE 
016-023-G11GGGCCCGGCCCACCCGNONE 
AK099776GGGCCCGGCCCACCCGSimilar to Hs1pro-1 protein. 
AY224522GGGCCCGGCCCACCCGNONE 
J013095E24GGGCCCGGCCCACCCGNONE 
J023041J04GGGCCCGGCCCACCCGNONE 
J065130B09GGGCCCGGCCCACCCGNONE 
J075031B02GGGCCCGGCCCACCCGNONE 
J075069H11GGGCCCGGCCCACCCGNONE 
J100026O10GGGCCCGGCCCACCCGNONE 
J100050J01GGGCCCGGCCCACCCGNONE 
J100052G04GGGCCCGGCCCACCCGNONE 
J100053D07GGGCCCGGCCCACCCGNONE 
J100054K16GGGCCCGGCCCACCCGNONE 
J100067A06GGGCCCGGCCCACCCGNONE 
J100067G01GGGCCCGGCCCACCCGNONE 
J100088C18GGGCCCGGCCCACCCGNONE 
Os01g0858700015-026-G10GGGCCGGGNONE 
015-049-A05GGGCCGGGNONE 
016-076-F02GGGCCGGGNONE 
AK070663GGGCCGGGNONE 
AK119765GGGCCGGGConserved hypothetical protein. 
J023056F20GGGCCGGGNONE 
J023150I15GGGCCGGGNONE 
J033111A07GGGCCGGGNONE 
Os01g0863166J065007F23GCCGGGCCGGGCCGNONE 
J065124H21GCCGGGCCGGGCCGConserved hypothetical protein. 
Os01g0865100016-066-A05CCCGGCCCATCNONE 
AK065779CCCGGCCCATCNONE 
AK071410CCCGGCCCATCSimilar to Uricase (Fragment). 
J013039E23CCCGGCCCATCNONE 
J023024I07CCCGGCCCATCNONE 
J065160J15CCCGGCCCATCNONE 
J090052J17CCCGGCCCATCNONE 
Os01g0869200AK073453GGGCCGGGMg2+ transporter protein, CorA-like family protein. 
Os01g0913800011-060-B02ATTGGGCCGGGCCGANONE 
016-088-H02ATTGGGCCGGGCCGAProtein prenyltransferase domain containing protein. 
Os01g0915800AK103859TTTTGGGCCGGGCCCAAACSimilar to FK506-binding protein 2-2 precursor (EC 5.2.1.8) (Peptidyl-prolyl cis- trans isomerase) (PPIase) (Rotamase) (15 kDa FKBP) (FKBP-15-2). 
J090051E20TTTTGGGCCGGGCCCAAACNONE 
J090056H03TTTTGGGCCGGGCCCAAACNONE 
J090058L14TTTTGGGCCGGGCCCAAACNONE 
J090058P16TTTTGGGCCGGGCCCAAACNONE 
J090076C19TTTTGGGCCGGGCCCAAACNONE 
J100086P14TTTTGGGCCGGGCCCAAACNONE 
Os01g0921600AK071344GGTGGGCTGGGCCGGGSimilar to Mitochondrial import receptor subunit TOM20 (Translocase of outer membrane 20 kDa subunit). 
J013039J22GGTGGGCTGGGCCGGGNONE 
J013109E03GGTGGGCTGGGCCGGGNONE 
J023081J12GGTGGGCTGGGCCGGGNONE 
J023091E24GGTGGGCTGGGCCGGGNONE 
J033022A01GGTGGGCTGGGCCGGGNONE 
J033074C13GGTGGGCTGGGCCGGGNONE 
J065199E03GGTGGGCTGGGCCGGGNONE 
J075172O04GGTGGGCTGGGCCGGGNONE 
J090007G18GGTGGGCTGGGCCGGGNONE 
J090052B17GGTGGGCTGGGCCGGGNONE 
J090074H01GGTGGGCTGGGCCGGGNONE 
J100043J09GGTGGGCTGGGCCGGGNONE 
J100059J05GGTGGGCTGGGCCGGGNONE 
Os01g0934300AK072640CCCGGCCCNONE 
J013073H18CCCGGCCCNONE 
J023133P13CCCGGCCCNONE 
J075098G20CCCGGCCCNONE 
Os01g0949700AK069037GCCCGGCCCAATNONE 
J023004F17GCCCGGCCCAATNONE 
J065063D04GCCCGGCCCAATNONE 
J065196H02GCCCGGCCCAATNONE 
J075198A05GCCCGGCCCAATNONE 
Os01g0973100J065216G12CCCGGCCCGGCCCProtein of unknown function DUF239, plant domain containing protein. 
Os01g0973400AK060011AGATGGGCCGGGCCGGGCCGAGCCGNONE 
AK068879AGATGGGCCGGGCCGGGCCGAGCCGConserved hypothetical protein 48 family protein. 
AK099210AGATGGGCCGGGCCGGGCCGAGCCGNONE 
AK104863AGATGGGCCGGGCCGGGCCGAGCCGNONE 
J013170C09AGATGGGCCGGGCCGGGCCGAGCCGNONE 
J033106K13AGATGGGCCGGGCCGGGCCGAGCCGNONE 
J075018P18AGATGGGCCGGGCCGGGCCGAGCCGNONE 
J075039C18AGATGGGCCGGGCCGGGCCGAGCCGNONE 
J075104L18AGATGGGCCGGGCCGGGCCGAGCCGNONE 
Os02g0119400AK060055GTTTGGGCCCGGCCCACCTNONE 
AK102774GTTTGGGCCCGGCCCACCTSimilar to Syntaxin 52 (AtSYP52). 
J033107H09GTTTGGGCCCGGCCCACCTNONE 
J075175F09GTTTGGGCCCGGCCCACCTNONE 
J090011H05GTTTGGGCCCGGCCCACCTNONE 
J090091O05GTTTGGGCCCGGCCCACCTNONE 
Os02g0146700AK105609TTGGCCCACCAGGCCCGGCCCACCCGSimilar to PSMD2 subunit (Fragment). 
AK119490TTGGCCCACCAGGCCCGGCCCACCCGNONE 
AK121963TTGGCCCACCAGGCCCGGCCCACCCGNONE 
Os02g0158400006-048-F06TGTTGGGCCGGGNONE 
AK061569TGTTGGGCCGGGssDNA-binding transcriptional regulator family protein. 
AK099479TGTTGGGCCGGGNONE 
AK104768TGTTGGGCCGGGNONE 
J013025B22TGTTGGGCCGGGNONE 
J023009C03TGTTGGGCCGGGNONE 
J033115N14TGTTGGGCCGGGNONE 
J065036F05TGTTGGGCCGGGNONE 
J065191K17TGTTGGGCCGGGNONE 
J065202K16TGTTGGGCCGGGNONE 
J075053E14TGTTGGGCCGGGNONE 
J075101E04TGTTGGGCCGGGNONE 
J075111C06TGTTGGGCCGGGNONE 
J075137O04TGTTGGGCCGGGNONE 
J075139E07TGTTGGGCCGGGNONE 
J075143K07TGTTGGGCCGGGNONE 
J075144K15TGTTGGGCCGGGNONE 
J075164L14TGTTGGGCCGGGNONE 
J075199D06TGTTGGGCCGGGNONE 
J090010G24TGTTGGGCCGGGNONE 
J090017C18TGTTGGGCCGGGNONE 
J090066F01TGTTGGGCCGGGNONE 
J090088G01TGTTGGGCCGGGNONE 
Os02g0169000AK101628TCGGCCCGGCCCATGTConserved hypothetical protein. 
Os02g0169300006-023-D12ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
006-062-B01ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
015-049-F11ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
015-057-G02ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
015-092-F04ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
015-095-H02ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
015-097-B07ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
AK070041ATCTGGGCCCCACGCCTCCCGGCCCCACASimilar to Phosphoglycerate kinase, cytosolic (EC 2.7.2.3). 
J013042K07ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J013134H23ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J013134J23ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J023036N24ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J023049C06ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J023077E10ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J023077F10ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J023105N12ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J033036O12ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J033064P11ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J033079F01ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J033123M22ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J033143E10ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J075013D12ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
Os02g0190900AK111037GCCCAATTTGGGCCGGGCCGTGPhytoene dehydrogenase-like protein. 
AK111037TTTTGGGCCGGGCCCATTAPhytoene dehydrogenase-like protein. 
Os02g0190950J075001E02CACGGCCCGGCCCAAATTGGGCConserved hypothetical protein. 
J075117E23CACGGCCCGGCCCAAATTGGGCNONE 
J075117F23CACGGCCCGGCCCAAATTGGGCNONE 
J075144M12CACGGCCCGGCCCAAATTGGGCNONE 
J075145H10CACGGCCCGGCCCAAATTGGGCNONE 
J075186B15CACGGCCCGGCCCAAATTGGGCNONE 
Os02g0193500009-092-G09CTCGGCCCGGCCCNONE 
AK101237CTCGGCCCGGCCCHypothetical protein. 
J033031K13CTCGGCCCGGCCCNONE 
J033034P12CTCGGCCCGGCCCNONE 
J080304L19CTCGGCCCGGCCCNONE 
J100059N21CTCGGCCCGGCCCNONE 
Os02g0215950J090051K07GCGGCCCATACATTTGGGCCGGGConserved hypothetical protein. 
Os02g0227000J023084F07GGCCCGGCCCNONE 
J033051H22GGCCCGGCCCProtein of unknown function UPF0054 family protein. 
Os02g0246600AK101361CCCGGCCCConserved hypothetical protein. 
AK121483CCCGGCCCNONE 
J023149O14CCCGGCCCNONE 
J090033N10CCCGGCCCNONE 
Os02g0266200AK099647TTCGTGGGCCGGGCCGGTCACTGACANONE 
AK103371TTCGTGGGCCGGGCCGGTCACTGACAProtein prenyltransferase domain containing protein. 
Os02g0288200AK073147CCCGGCCCCACGCGTNONE 
AK102886CCCGGCCCCACGCGTConserved hypothetical protein. 
Os02g0289700009-196-H06GCCCGGCCCNONE 
014-005-D09GCCCGGCCCNONE 
AK063231GCCCGGCCCSimilar to Glyceraldehyde-3-phosphate dehydrogenase, testis-specific (EC 1.2.1.12) (Spermatogenic cell-specific glyceraldehyde 3-phosphate dehydrogenase-2) (GAPDH-2). 
Os02g0304800Os02g0304800GGCCCGGCCCAAATProtein prenyltransferase domain containing protein. 
Os02g0445700011-046-C10GGCCCGGCCCGTTNONE 
Os02g0491400AK073233CCCGGCCCCACCTGTCSimilar to Peptidylprolyl isomerase. 
J090046J15CCCGGCCCCACCTGTCNONE 
Os02g0521300AK120851GGGACCCGGCCCCGCGGGGGC2 domain containing protein. 
Os02g0533800009-149-F12GGCCGGGCCGGGNONE 
013-058-H02GGCCGGGCCGGGNONE 
014-017-G07GGCCGGGCCGGGNONE 
014-028-F04GGCCGGGCCGGGNONE 
014-050-G04GGCCGGGCCGGGNONE 
014-095-F04GGCCGGGCCGGGNONE 
014-099-C08GGCCGGGCCGGGNONE 
016-046-F05GGCCGGGCCGGGNONE 
AK121139GGCCGGGCCGGGConserved hypothetical protein. 
J013104A14GGCCGGGCCGGGNONE 
J023077F13GGCCGGGCCGGGNONE 
J023145I11GGCCGGGCCGGGNONE 
J065033D14GGCCGGGCCGGGNONE 
J065079I15GGCCGGGCCGGGNONE 
J065104E21GGCCGGGCCGGGNONE 
J065128E06GGCCGGGCCGGGNONE 
J065174F07GGCCGGGCCGGGNONE 
J065195B12GGCCGGGCCGGGNONE 
J065207B12GGCCGGGCCGGGNONE 
J080304M24GGCCGGGCCGGGNONE 
J090040A13GGCCGGGCCGGGNONE 
J090054B18GGCCGGGCCGGGNONE 
J100037A06GGCCGGGCCGGGNONE 
J100042F24GGCCGGGCCGGGNONE 
J100043N23GGCCGGGCCGGGNONE 
J100044H14GGCCGGGCCGGGNONE 
J100056K24GGCCGGGCCGGGNONE 
J100063O22GGCCGGGCCGGGNONE 
J100071G05GGCCGGGCCGGGNONE 
J100078G15GGCCGGGCCGGGNONE 
Os02g0533900AB062681CCCGGCCCGGCCNONE 
AK061722CCCGGCCCGGCCNONE 
AK106147CCCGGCCCGGCCNONE 
AK121892CCCGGCCCGGCCSimilar to Carbon-nitrogen hydrolase family protein. 
Os02g0537500AK068689GGCCCGGCCCACGGGSimilar to E2F homolog. 
Os02g0556100006-100-D03GGGCCGCACCCGGCCCNONE 
AK059938GGGCCGCACCCGGCCCNONE 
AK103125GGGCCGCACCCGGCCCNAD-dependent epimerase/dehydratase family protein. 
J033107B22GGGCCGCACCCGGCCCNONE 
J033119M03GGGCCGCACCCGGCCCNONE 
J033120L06GGGCCGCACCCGGCCCNONE 
J043007B02GGGCCGCACCCGGCCCNONE 
J043012G03GGGCCGCACCCGGCCCNONE 
J043024A02GGGCCGCACCCGGCCCNONE 
J043027J18GGGCCGCACCCGGCCCNONE 
J100019E06GGGCCGCACCCGGCCCNONE 
J100069C22GGGCCGCACCCGGCCCNONE 
Os02g0593400016-051-C08CCCGGCCCACGGNONE 
AK064226CCCGGCCCACGGNONE 
AK072362CCCGGCCCACGGConserved hypothetical protein. 
AK109015CCCGGCCCACGGNONE 
J023063B12CCCGGCCCACGGNONE 
J065192M02CCCGGCCCACGGNONE 
J075182N05CCCGGCCCACGGNONE 
Os02g0613200AK064869CCCGGCCCNONE 
AK065051CCCGGCCCNONE 
AK098853CCCGGCCCConserved hypothetical protein. 
AK098974CCCGGCCCNONE 
J013000H15CCCGGCCCNONE 
J013001I18CCCGGCCCNONE 
J013022I18CCCGGCCCNONE 
J013025D06CCCGGCCCNONE 
J013037H17CCCGGCCCNONE 
J013043F22CCCGGCCCNONE 
J013075E01CCCGGCCCNONE 
J013088D09CCCGGCCCNONE 
J013088E19CCCGGCCCNONE 
J013102O18CCCGGCCCNONE 
J013110C08CCCGGCCCNONE 
J013118C06CCCGGCCCNONE 
J013119F22CCCGGCCCNONE 
J013128K14CCCGGCCCNONE 
J013158C17CCCGGCCCNONE 
J023013P15CCCGGCCCNONE 
J023044L21CCCGGCCCNONE 
J033023I04CCCGGCCCNONE 
J033038I22CCCGGCCCNONE 
J033095M02CCCGGCCCNONE 
J043022F05CCCGGCCCNONE 
J080307N20CCCGGCCCNONE 
J080315C02CCCGGCCCNONE 
J080316A15CCCGGCCCNONE 
J080316G03CCCGGCCCNONE 
J090029E24CCCGGCCCNONE 
J090031H15CCCGGCCCNONE 
J090034F13CCCGGCCCNONE 
J090047G02CCCGGCCCNONE 
J090069M24CCCGGCCCNONE 
J100052E15CCCGGCCCNONE 
Os02g0636300AK100670TAATGGGCTGGGCCGGGCCGGCDEAD/DEAH box helicase, N-terminal domain containing protein. 
J013149P11TAATGGGCTGGGCCGGGCCGGCNONE 
J023022F15TAATGGGCTGGGCCGGGCCGGCNONE 
J023112J15TAATGGGCTGGGCCGGGCCGGCNONE 
J023145M22TAATGGGCTGGGCCGGGCCGGCNONE 
J043017P16TAATGGGCTGGGCCGGGCCGGCNONE 
Os02g0641800AK066504CCCGGCCCAGCCSimilar to RNA helicase (Fragment). 
AK072124CCCGGCCCAGCCNONE 
Os02g0651500AK066333CCCGGCCCNONE 
AK121865CCCGGCCCHypothetical protein. 
J090038J11CCCGGCCCNONE 
Os02g0672700AK059611CCCCCGCGGGGCCGGGTCCCDNA-directed RNA polymerase, subunit C11/M/9 family protein. 
AK099179CCCCCGCGGGGCCGGGTCCCNONE 
J023098L23CCCCCGCGGGGCCGGGTCCCNONE 
J065042J21CCCCCGCGGGGCCGGGTCCCNONE 
J065187L09CCCCCGCGGGGCCGGGTCCCNONE 
J065190O10CCCCCGCGGGGCCGGGTCCCNONE 
J080041G14CCCCCGCGGGGCCGGGTCCCNONE 
J080078K08CCCCCGCGGGGCCGGGTCCCNONE 
J080089D20CCCCCGCGGGGCCGGGTCCCNONE 
J080094D04CCCCCGCGGGGCCGGGTCCCNONE 
Os02g0686600AK102917CCCGGCCCMetal-dependent protein hydrolase family protein. 
Os02g0698100009-089-H10CAACGGCCCGGCCCATTTNONE 
AK060614CAACGGCCCGGCCCATTTGalactose oxidase, central domain containing protein. 
J090039P20CAACGGCCCGGCCCATTTNONE 
Os02g0736500AK065166GTTTGGGCCGGGCNicastrin family protein. 
J013099D16GTTTGGGCCGGGCNONE 
Os02g0750500AK101960TACGGCCCGGCCCAATASAM (and some other nucleotide) binding motif domain containing protein. 
J033075P05TACGGCCCGGCCCAATANONE 
J065054F02TACGGCCCGGCCCAATANONE 
J065124N03TACGGCCCGGCCCAATANONE 
J090001H12TACGGCCCGGCCCAATANONE 
J100057J01TACGGCCCGGCCCAATANONE 
J100062F12TACGGCCCGGCCCAATANONE 
Os02g0751300J033055P08GGGCCGGGProtein of unknown function DUF581 family protein. 
Os02g0766700AK072062CCCGGCCCCACSimilar to Abscisic acid responsive elements-binding factor (ABA-responsive element binding protein 2) (AREB2). 
J100073F09CCCGGCCCCACNONE 
Os02g0768600006-034-F01TCTGGCCCGGCCCAAACNONE 
006-046-G07TCTGGCCCGGCCCAAACNONE 
006-054-C07TCTGGCCCGGCCCAAACNONE 
006-056-F07TCTGGCCCGGCCCAAACNONE 
006-100-C02TCTGGCCCGGCCCAAACNONE 
AK059725TCTGGCCCGGCCCAAACNONE 
AK098996TCTGGCCCGGCCCAAACNONE 
AK099120TCTGGCCCGGCCCAAACNONE 
AK104659TCTGGCCCGGCCCAAACNONE 
J065043H04TCTGGCCCGGCCCAAACNONE 
J075034N21TCTGGCCCGGCCCAAACNONE 
J075145C18TCTGGCCCGGCCCAAACNONE 
J080016H01TCTGGCCCGGCCCAAACNONE 
J080040F01TCTGGCCCGGCCCAAACNONE 
J080047L23TCTGGCCCGGCCCAAACNONE 
J080049B22TCTGGCCCGGCCCAAACNONE 
J080062J16TCTGGCCCGGCCCAAACNONE 
J080064C23TCTGGCCCGGCCCAAACNONE 
J080064L22TCTGGCCCGGCCCAAACNONE 
J080077N01TCTGGCCCGGCCCAAACNONE 
J080097G17TCTGGCCCGGCCCAAACNONE 
J100065L15TCTGGCCCGGCCCAAACNONE 
J100066K23TCTGGCCCGGCCCAAACNONE 
J100088C07TCTGGCCCGGCCCAAACNONE 
J100090H09TCTGGCCCGGCCCAAACNONE 
Os02g0771200011-006-B07CCCGGCCCACGTNONE 
AK066823CCCGGCCCACGTConserved hypothetical protein. 
AK071059CCCGGCCCACGTNONE 
J013075K03CCCGGCCCACGTNONE 
Os02g0775600003-118-H07AAATGGGCCGGGNONE 
009-075-H07AAATGGGCCGGGNONE 
AK058592AAATGGGCCGGGNONE 
AK068762AAATGGGCCGGGZinc finger, C2H2-type domain containing protein. 
Os02g0780700AK063558CCCGGCCCACCACCGCACLipase, class 3 family protein. 
Os02g0782100AK065421CGCGGGGGCCGGGChorismate synthase family protein. 
J065038A03CGCGGGGGCCGGGNONE 
Os02g0801900006-113-E02GCCGGGCCGGGCCGNONE 
AK109488GCCGGGCCGGGCCGNONE 
AK109498GCCGGGCCGGGCCGConserved hypothetical protein. 
J065007D19GCCGGGCCGGGCCGNONE 
J065035G11GCCGGGCCGGGCCGNONE 
J065044E05GCCGGGCCGGGCCGNONE 
J065112N01GCCGGGCCGGGCCGNONE 
J065143B03GCCGGGCCGGGCCGNONE 
J065159A16GCCGGGCCGGGCCGNONE 
J090007K23GCCGGGCCGGGCCGNONE 
J090045N09GCCGGGCCGGGCCGNONE 
J090049L20GCCGGGCCGGGCCGNONE 
Os02g0804300006-046-D12GCTGGGCCGGGNONE 
AK060165GCTGGGCCGGGNONE 
AK067584GCTGGGCCGGGSAM (and some other nucleotide) binding motif domain containing protein. 
J013112C12GCTGGGCCGGGNONE 
J023098C22GCTGGGCCGGGNONE 
J033123P06GCTGGGCCGGGNONE 
J065060N24GCTGGGCCGGGNONE 
J065069H22GCTGGGCCGGGNONE 
J065155N20GCTGGGCCGGGNONE 
J065170K07GCTGGGCCGGGNONE 
J090033D12GCTGGGCCGGGNONE 
Os02g0815500AK099733CCCGGCCCAATTAlcohol dehydrogenase class III (EC 1.1.1.1) (Glutathione-dependent formaldehyde dehydrogenase) (EC 1.2.1.1) (FDH) (FALDH) (GSH-FDH). 
J013089P19CCCGGCCCAATTNONE 
J043022H19CCCGGCCCAATTNONE 
J065008L14CCCGGCCCAATTNONE 
J065016G09CCCGGCCCAATTNONE 
J065023C22CCCGGCCCAATTNONE 
J065024K13CCCGGCCCAATTNONE 
J065043D14CCCGGCCCAATTNONE 
J065052K16CCCGGCCCAATTNONE 
J065058D17CCCGGCCCAATTNONE 
J065087L03CCCGGCCCAATTNONE 
J065107H15CCCGGCCCAATTNONE 
J065110E12CCCGGCCCAATTNONE 
J065124P14CCCGGCCCAATTNONE 
J065131B20CCCGGCCCAATTNONE 
J065155I10CCCGGCCCAATTNONE 
J065172J02CCCGGCCCAATTNONE 
J065184D04CCCGGCCCAATTNONE 
J065189D21CCCGGCCCAATTNONE 
J065201O14CCCGGCCCAATTNONE 
J065203D20CCCGGCCCAATTNONE 
J065206M13CCCGGCCCAATTNONE 
J065211E14CCCGGCCCAATTNONE 
J065217J21CCCGGCCCAATTNONE 
J090004A20CCCGGCCCAATTNONE 
Os02g0827300AK069159GGCCCGGCCCACGAGCCCAACCProtein of unknown function DUF382 domain containing protein. 
Os03g0102200AK120183TCGGCCCGGCCCGGTSimilar to DNA-directed RNA polymerase II 14.5 kDa polypeptide (EC 2.7.7.6) (RPB9) (RPB14.5). 
J013034D10TCGGCCCGGCCCGGTNONE 
J065116C05TCGGCCCGGCCCGGTNONE 
J065120N21TCGGCCCGGCCCGGTNONE 
J090049D24TCGGCCCGGCCCGGTNONE 
Os03g0109300AK099538GCCCGGCCCCAGSimilar to Lysine decarboxylase-like protein. 
J013032C19GCCCGGCCCCAGNONE 
Os03g0113700AK103835AGTTGGGCCGGGCCGTGGSimilar to Heat shock 70 kDa protein, mitochondrial precursor. 
Os03g0113800AK065925CCACGGCCCGGCCCAACTProtein prenyltransferase domain containing protein. 
J013047E20CCACGGCCCGGCCCAACTNONE 
J065026F21CCACGGCCCGGCCCAACTNONE 
J065047B03CCACGGCCCGGCCCAACTNONE 
J065054J12CCACGGCCCGGCCCAACTNONE 
J065079M24CCACGGCCCGGCCCAACTNONE 
J065093M07CCACGGCCCGGCCCAACTNONE 
J065153F02CCACGGCCCGGCCCAACTNONE 
J065155E21CCACGGCCCGGCCCAACTNONE 
J065179H15CCACGGCCCGGCCCAACTNONE 
J075019N02CCACGGCCCGGCCCAACTNONE 
J075089E01CCACGGCCCGGCCCAACTNONE 
J090066I18CCACGGCCCGGCCCAACTNONE 
J090087K20CCACGGCCCGGCCCAACTNONE 
J100079F05CCACGGCCCGGCCCAACTNONE 
Os03g0122000AK101458TGCGGGCCCGGCCCATATProtein kinase-like domain containing protein. 
J013035K10TGCGGGCCCGGCCCATATNONE 
J013050E10TGCGGGCCCGGCCCATATNONE 
J033040C13TGCGGGCCCGGCCCATATNONE 
Os03g0133300AK064510TGTTGGGCCGGGCCGAConserved hypothetical protein. 
Os03g0142900011-054-A05CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
AK067103CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
AK120438CCAGGCCCAGGCCCAGGCCCGGCCCProtein of unknown function DUF946, plant family protein. 
J013097D18CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J013098E18CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J013099I17CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J013108C09CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J023045J15CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J033034E13CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J033095F07CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J033102N22CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J065016C14CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J065034E13CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J065065F21CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J065159M09CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J075012C13CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J075017P18CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J075018M03CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J075021H19CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J075070K23CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J075077B18CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J075085E20CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J075090N23CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J075137M16CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J075151E03CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J090042L02CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J090060C21CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J090089I17CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J100024L19CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J100025A06CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J100033C24CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J100052J17CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J100063H10CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J100073P04CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J100075D01CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J100077J17CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J100087F03CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J100087F09CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
Os03g0143400AK073999TAGGCCCACAACCCGGCCCATTSimilar to mitochondrial chaperonin-60 [Oryza sativa (japonica cultivar-group)]. 
J023025G21TAGGCCCACAACCCGGCCCATTNONE 
J033073C08TAGGCCCACAACCCGGCCCATTNONE 
J033094C19TAGGCCCACAACCCGGCCCATTNONE 
J065017L10TAGGCCCACAACCCGGCCCATTNONE 
J065070H22TAGGCCCACAACCCGGCCCATTNONE 
J065079M09TAGGCCCACAACCCGGCCCATTNONE 
J065091N18TAGGCCCACAACCCGGCCCATTNONE 
J065109N03TAGGCCCACAACCCGGCCCATTNONE 
J065113F05TAGGCCCACAACCCGGCCCATTNONE 
J065135D23TAGGCCCACAACCCGGCCCATTNONE 
J065156L16TAGGCCCACAACCCGGCCCATTNONE 
J065207O04TAGGCCCACAACCCGGCCCATTNONE 
J065208F03TAGGCCCACAACCCGGCCCATTNONE 
J090010M15TAGGCCCACAACCCGGCCCATTNONE 
J090056J18TAGGCCCACAACCCGGCCCATTNONE 
Os03g0146400AK111974GGCCCGGCCCGTTSimilar to Lethal leaf-spot 1 (Fragment). 
AK120554GGCCCGGCCCGTTNONE 
J075060J10GGCCCGGCCCGTTNONE 
Os03g0161000AK121425CAAGTGGGCCGGGNONE 
AK121425CACTGACAGGTGGGCCGGGGACGGCTNONE 
J023135K12CAAGTGGGCCGGGNONE 
J023135K12CACTGACAGGTGGGCCGGGGACGGCTNONE 
Os03g0184600AK065264ATTTGGGCCCGGCCCACAANAD-dependent epimerase/dehydratase family protein. 
Os03g0192100AK064747ATTTGGGCCGGGCNONE 
AK105523ATTTGGGCCGGGCPeptidase S10, serine carboxypeptidase family protein. 
Os03g0192400009-081-A03AGTGGGCCCGGCCCNONE 
009-159-B02AGTGGGCCCGGCCCNONE 
AK070573AGTGGGCCCGGCCCGRIM-19 family protein. 
J023056B01AGTGGGCCCGGCCCNONE 
J023075G06AGTGGGCCCGGCCCNONE 
J033048K16AGTGGGCCCGGCCCNONE 
J033048L16AGTGGGCCCGGCCCNONE 
J053031H23AGTGGGCCCGGCCCNONE 
J065002H14AGTGGGCCCGGCCCNONE 
J065006G22AGTGGGCCCGGCCCNONE 
J065032G13AGTGGGCCCGGCCCNONE 
J065056A09AGTGGGCCCGGCCCNONE 
J065078I01AGTGGGCCCGGCCCNONE 
J065095G01AGTGGGCCCGGCCCNONE 
J065095I18AGTGGGCCCGGCCCNONE 
J065134M18AGTGGGCCCGGCCCNONE 
J065158P07AGTGGGCCCGGCCCNONE 
J065165K17AGTGGGCCCGGCCCNONE 
J065181J12AGTGGGCCCGGCCCNONE 
J065189N09AGTGGGCCCGGCCCNONE 
J065200D13AGTGGGCCCGGCCCNONE 
J065202H20AGTGGGCCCGGCCCNONE 
J065215K20AGTGGGCCCGGCCCNONE 
J075049N19AGTGGGCCCGGCCCNONE 
J075147J16AGTGGGCCCGGCCCNONE 
J090081E19AGTGGGCCCGGCCCNONE 
J100017C16AGTGGGCCCGGCCCNONE 
J100039M16AGTGGGCCCGGCCCNONE 
J100043E23AGTGGGCCCGGCCCNONE 
J100063L12AGTGGGCCCGGCCCNONE 
J100079F22AGTGGGCCCGGCCCNONE 
Os03g0204900009-041-G04TAATGGGCCGGGNONE 
AK062601TAATGGGCCGGGSimilar to TATA-binding protein associated factor 2N (RNA-binding protein 56) (TAFII68) (TAF(II)68). 
Os03g0205500Os03g0205500CCCGGGCCCGGCCCACTGGCCCAGTCytochrome b5 domain containing protein. 
Os03g0214100AB111916CGGCCCGGCCCATCTNONE 
AF009179CGGCCCGGCCCATCTReplication protein A1. 
AK060582CGGCCCGGCCCATCTNONE 
Os03g0240700009-086-G10GGCCCGGCCCAACANONE 
009-086-G10TAATGGGCCCGGCCCAAACNONE 
AK071799GGCCCGGCCCAACAConserved hypothetical protein. 
AK071799TAATGGGCCCGGCCCAAACConserved hypothetical protein. 
J023112A13GGCCCGGCCCAACANONE 
J023112A13TAATGGGCCCGGCCCAAACNONE 
J043022A01GGCCCGGCCCAACANONE 
J043022A01TAATGGGCCCGGCCCAAACNONE 
J065106A01GGCCCGGCCCAACANONE 
J065106A01TAATGGGCCCGGCCCAAACNONE 
J075023P22GGCCCGGCCCAACANONE 
J075023P22TAATGGGCCCGGCCCAAACNONE 
J075138I21GGCCCGGCCCAACANONE 
J075138I21TAATGGGCCCGGCCCAAACNONE 
J075173L02GGCCCGGCCCAACANONE 
J075173L02TAATGGGCCCGGCCCAAACNONE 
Os03g0240800006-092-D05GTTTGGGCCGGGCCCATTANONE 
006-092-D05TGTTGGGCCGGGCCNONE 
AK059292GTTTGGGCCGGGCCCATTANONE 
AK059292TGTTGGGCCGGGCCNONE 
AK061178GTTTGGGCCGGGCCCATTASimilar to AGL157Cp. 
AK061178TGTTGGGCCGGGCCSimilar to AGL157Cp. 
AK121552GTTTGGGCCGGGCCCATTANONE 
AK121552TGTTGGGCCGGGCCNONE 
J023131D06GTTTGGGCCGGGCCCATTANONE 
J023131D06TGTTGGGCCGGGCCNONE 
J033033E14GTTTGGGCCGGGCCCATTANONE 
J033033E14TGTTGGGCCGGGCCNONE 
J033105B01GTTTGGGCCGGGCCCATTANONE 
J033105B01TGTTGGGCCGGGCCNONE 
J033114L18GTTTGGGCCGGGCCCATTANONE 
J033114L18TGTTGGGCCGGGCCNONE 
J033132N24GTTTGGGCCGGGCCCATTANONE 
J033132N24TGTTGGGCCGGGCCNONE 
J065032H03GTTTGGGCCGGGCCCATTANONE 
J065032H03TGTTGGGCCGGGCCNONE 
J065115J20GTTTGGGCCGGGCCCATTANONE 
J065115J20TGTTGGGCCGGGCCNONE 
J065150C05GTTTGGGCCGGGCCCATTANONE 
J065150C05TGTTGGGCCGGGCCNONE 
J080302A11GTTTGGGCCGGGCCCATTANONE 
J080302A11TGTTGGGCCGGGCCNONE 
J080302H16GTTTGGGCCGGGCCCATTANONE 
J080302H16TGTTGGGCCGGGCCNONE 
J080305M12GTTTGGGCCGGGCCCATTANONE 
J080305M12TGTTGGGCCGGGCCNONE 
J080306F13GTTTGGGCCGGGCCCATTANONE 
J080306F13TGTTGGGCCGGGCCNONE 
J080312A06GTTTGGGCCGGGCCCATTANONE 
J080312A06TGTTGGGCCGGGCCNONE 
J090088P09GTTTGGGCCGGGCCCATTANONE 
J090088P09TGTTGGGCCGGGCCNONE 
Os03g0261500AK061995GCCCGGCCCGGCNONE 
J013044K20GCCCGGCCCGGCNONE 
J033113A11GCCCGGCCCGGCNONE 
J100032O18GCCCGGCCCGGCNONE 
J100037K21GCCCGGCCCGGCNONE 
Os03g0279400AK101851CCCGGCCCSimilar to Arginine biosynthesis bifunctional protein argJ 1 [Includes: Glutamate N-acetyltransferase (EC 2.3.1.35) (Ornithine acetyltransferase) (Ornithine transacetylase) (OATase); Amino-acid acetyltransferase (EC 2.3.1.1) (N-acetylglutamate synthase) (AGS)] [Contains: Arginine biosynthesis bifunctional protein argJ1 alpha chain; Arginine biosynthesis bifunctional protein argJ1 beta chain]. 
AK106253CCCGGCCCNONE 
J023079P21CCCGGCCCNONE 
J023120G14CCCGGCCCNONE 
J090042F16CCCGGCCCNONE 
Os03g0287900009-074-B07GGCCCGGCCCAAGNONE 
014-027-E07GGCCCGGCCCAAGNONE 
AK063663GGCCCGGCCCAAGSimilar to Protein disulfide isomerase. 
J065009N21GGCCCGGCCCAAGNONE 
Os03g0288900AK100329GGCCCGGCCCACCConserved hypothetical protein. 
J023080H15GGCCCGGCCCACCNONE 
J033136I21GGCCCGGCCCACCNONE 
J065036A16GGCCCGGCCCACCNONE 
J065186A16GGCCCGGCCCACCNONE 
J065187B08GGCCCGGCCCACCNONE 
J065202E24GGCCCGGCCCACCNONE 
Os03g0293100AK060680GGCCCGGCCCAAAConserved hypothetical protein. 
J065193F02GGCCCGGCCCAAANONE 
J075003N10GGCCCGGCCCAAANONE 
Os03g0308800AK066789CCCGGCCCNONE 
AK068534CCCGGCCCProtein prenyltransferase domain containing protein. 
Os03g0338000AK121399GTGTGGGGGCCGGGSimilar to Alanine:glyoxylate aminotransferase-like protein (Fragment). 
Os03g0339100AK111641TGATGGGCCGGGSimilar to PRL1 protein. 
Os03g0374100AK066002CCCGGCCCHepatocellular carcinoma-associated antigen 59 family protein. 
AK099328CCCGGCCCNONE 
AK104845CCCGGCCCNONE 
Os03g0388100AK059680GGGCCGGGHeavy metal transport/detoxification protein domain containing protein. 
AK099133GGGCCGGGNONE 
Os03g0410700J065102A22CCCGGCCCACGANONE 
Os03g0410900J065067F10TCGTGGGCCGGGNONE 
J065073D08TCGTGGGCCGGGNONE 
J065176C06TCGTGGGCCGGGNONE 
J065189O13TCGTGGGCCGGGNONE 
J065214E05TCGTGGGCCGGGNONE 
J080007H09TCGTGGGCCGGGNONE 
J080012B19TCGTGGGCCGGGNONE 
J080020J16TCGTGGGCCGGGNONE 
J080038J22TCGTGGGCCGGGNONE 
J080045I09TCGTGGGCCGGGNONE 
J080059M16TCGTGGGCCGGGNONE 
J080060C19TCGTGGGCCGGGNONE 
J080080P22TCGTGGGCCGGGNONE 
J080083C03TCGTGGGCCGGGNONE 
J080093M17TCGTGGGCCGGGNONE 
J100029F12TCGTGGGCCGGGLike-Sm ribonucleoprotein, core family protein. 
Os03g0442400Os03g0442400CCCGGCCCATCCNONE 
Os03g0576900AK071314GGGCCGGGTCCCAmino acid/polyamine transporter I family protein. 
J023074L08GGGCCGGGTCCCNONE 
J023084D13GGGCCGGGTCCCNONE 
J080011C14GGGCCGGGTCCCNONE 
J080012F24GGGCCGGGTCCCNONE 
J080018M05GGGCCGGGTCCCNONE 
J080021G05GGGCCGGGTCCCNONE 
J080021N18GGGCCGGGTCCCNONE 
J080023E19GGGCCGGGTCCCNONE 
J080024H14GGGCCGGGTCCCNONE 
J080025E15GGGCCGGGTCCCNONE 
J080038F19GGGCCGGGTCCCNONE 
J080044N09GGGCCGGGTCCCNONE 
J080054D05GGGCCGGGTCCCNONE 
J080057J16GGGCCGGGTCCCNONE 
J080060A05GGGCCGGGTCCCNONE 
J080061M12GGGCCGGGTCCCNONE 
J080063H13GGGCCGGGTCCCNONE 
J080065O04GGGCCGGGTCCCNONE 
J080066I17GGGCCGGGTCCCNONE 
J080066J06GGGCCGGGTCCCNONE 
J080089J22GGGCCGGGTCCCNONE 
J080090I03GGGCCGGGTCCCNONE 
J080091J23GGGCCGGGTCCCNONE 
J080091K20GGGCCGGGTCCCNONE 
J080093G24GGGCCGGGTCCCNONE 
J080094I08GGGCCGGGTCCCNONE 
J080096A17GGGCCGGGTCCCNONE 
J090051G12GGGCCGGGTCCCNONE 
Os03g0606200009-030-E09CCCGGCCCATGTNONE 
009-076-H10CCCGGCCCATGTNONE 
009-122-H12CCCGGCCCATGTNONE 
009-153-F09CCCGGCCCATGTNONE 
AB055076CCCGGCCCATGTMitochondrial ATP synthase 6 KD subunit. 
AK072384CCCGGCCCATGTNONE 
AK107928CCCGGCCCATGTNONE 
J023078E13CCCGGCCCATGTNONE 
J053031N01CCCGGCCCATGTNONE 
J053046K19CCCGGCCCATGTNONE 
J053062P07CCCGGCCCATGTNONE 
J053091C23CCCGGCCCATGTNONE 
J053099N19CCCGGCCCATGTNONE 
J065005E06CCCGGCCCATGTNONE 
J065030N03CCCGGCCCATGTNONE 
J065138O21CCCGGCCCATGTNONE 
J065159K03CCCGGCCCATGTNONE 
J075030M08CCCGGCCCATGTNONE 
J080006E23CCCGGCCCATGTNONE 
J080010D10CCCGGCCCATGTNONE 
J080016N17CCCGGCCCATGTNONE 
J080024N09CCCGGCCCATGTNONE 
J080028E23CCCGGCCCATGTNONE 
J080035I11CCCGGCCCATGTNONE 
J080038D15CCCGGCCCATGTNONE 
J080040H08CCCGGCCCATGTNONE 
J080043L04CCCGGCCCATGTNONE 
J080047C06CCCGGCCCATGTNONE 
J080061G04CCCGGCCCATGTNONE 
J080066E10CCCGGCCCATGTNONE 
J080067P03CCCGGCCCATGTNONE 
J080082D07CCCGGCCCATGTNONE 
J080089M13CCCGGCCCATGTNONE 
J080094O09CCCGGCCCATGTNONE 
J080095C24CCCGGCCCATGTNONE 
J080309E21CCCGGCCCATGTNONE 
J090016G15CCCGGCCCATGTNONE 
J090031C20CCCGGCCCATGTNONE 
J090033A15CCCGGCCCATGTNONE 
J090037L07CCCGGCCCATGTNONE 
J090038I10CCCGGCCCATGTNONE 
J090072P19CCCGGCCCATGTNONE 
J100040J02CCCGGCCCATGTNONE 
J100047N05CCCGGCCCATGTNONE 
J100048M10CCCGGCCCATGTNONE 
J100076C02CCCGGCCCATGTNONE 
J100077G23CCCGGCCCATGTNONE 
J100080O08CCCGGCCCATGTNONE 
J100085C06CCCGGCCCATGTNONE 
J100085F16CCCGGCCCATGTNONE 
Os03g0634000014-034-A03GTATGGGCCGGGACCCANONE 
AK063673GTATGGGCCGGGACCCASimilar to THA4. 
Os03g0654700AK107417CCCGGCCCProtein of unknown function DUF1637 family protein. 
Os03g0666850J065037F06CCCGGCCCConserved hypothetical protein. 
Os03g0685600AK111863CCCGGCCCCGACCCGCWD40-like domain containing protein. 
AK111863CCTGGGCCGGGWD40-like domain containing protein. 
AK111863GGGCCGGGGCCGGGWD40-like domain containing protein. 
Os03g0685700AK066043CCCGGCCCCGGCCCProtein prenyltransferase domain containing protein. 
J013048F08CCCGGCCCCGGCCCNONE 
Os03g0701900AK068404CCCGGCCCATTConserved hypothetical protein. 
Os03g0712200AK073205ACCGGGCCGGGZinc finger, RanBP2-type domain containing protein. 
AK098968ACCGGGCCGGGNONE 
Os03g0725000AK059294CCTGGGCCGGGNONE 
J043026H11CCTGGGCCGGGNONE 
J065187O06CCTGGGCCGGGNONE 
J090066M23CCTGGGCCGGGNONE 
Os03g0736300AK104929GGCCGGGCCGGGCNONE 
Os03g0737600014-094-E01TACTGGGCCGGGCCGANONE 
AB038234TACTGGGCCGGGCCGANONE 
AK101854TACTGGGCCGGGCCGACyclin H-1. 
AK105468TACTGGGCCGGGCCGANONE 
J033069N12TACTGGGCCGGGCCGANONE 
J043017A22TACTGGGCCGGGCCGANONE 
J065154A20TACTGGGCCGGGCCGANONE 
Os03g0740700011-093-H12GGCCCGGCCCATCCNONE 
AK102723GGCCCGGCCCATCCProtein similar to CwfJ, C-terminal 1 domain containing protein. 
J013059N19GGCCCGGCCCATCCNONE 
J013126N16GGCCCGGCCCATCCNONE 
J033105J16GGCCCGGCCCATCCNONE 
J090059D19GGCCCGGCCCATCCNONE 
Os03g0746800AK101718TCATGGGCCGGGCWD-40 repeat containing protein. 
Os03g0747700AK058795GGGCCGGGConserved hypothetical protein. 
Os03g0750800AK061386CCCGGCCCNONE 
AK072597CCCGGCCCSimilar to Transcriptional adaptor (Fragment). 
Os03g0766000AK070596AGTTGGGCCGGGNONE 
AK104743AGTTGGGCCGGGNONE 
AK106079AGTTGGGCCGGGNONE 
J013063M09AGTTGGGCCGGGNONE 
J023056A03AGTTGGGCCGGGNONE 
J043038L07AGTTGGGCCGGGNONE 
J053067N16AGTTGGGCCGGGNONE 
J053073G09AGTTGGGCCGGGNONE 
J053075I19AGTTGGGCCGGGNONE 
Os03g0776900AK107941CCCGGCCCAATTSimilar to DNAJ protein-like. 
J053100E14CCCGGCCCAATTNONE 
J075111A12CCCGGCCCAATTNONE 
Os03g0785500AK067718AGATGGGCCGGGCProtein of unknown function DUF284, transmembrane eukaryotic family protein. 
Os03g0793500AK103407GCCCGGCCCCACCACNONE 
AK121620GCCCGGCCCCACCACSimilar to Casein kinase-like protein. 
Os03g0807200011-031-F07CCCGGCCCAGCNONE 
011-031-F07GGGCCGGGCCGGCNONE 
011-031-F07GTTTGGGCCGGGCCGTCNONE 
AK063932CCCGGCCCAGCNONE 
AK063932GGGCCGGGCCGGCNONE 
AK063932GTTTGGGCCGGGCCGTCNONE 
AK103496CCCGGCCCAGCProtein of unknown function DUF1639 family protein. 
AK103496GGGCCGGGCCGGCProtein of unknown function DUF1639 family protein. 
AK103496GTTTGGGCCGGGCCGTCProtein of unknown function DUF1639 family protein. 
J033131A04CCCGGCCCAGCNONE 
J033131A04GGGCCGGGCCGGCNONE 
J033131A04GTTTGGGCCGGGCCGTCNONE 
J065109O03CCCGGCCCAGCNONE 
J065109O03GGGCCGGGCCGGCNONE 
J065109O03GTTTGGGCCGGGCCGTCNONE 
J080001M11CCCGGCCCAGCNONE 
J080001M11GGGCCGGGCCGGCNONE 
J080001M11GTTTGGGCCGGGCCGTCNONE 
J080002H18CCCGGCCCAGCNONE 
J080002H18GGGCCGGGCCGGCNONE 
J080002H18GTTTGGGCCGGGCCGTCNONE 
J080005I08CCCGGCCCAGCNONE 
J080005I08GGGCCGGGCCGGCNONE 
J080005I08GTTTGGGCCGGGCCGTCNONE 
J080006B05CCCGGCCCAGCNONE 
J080006B05GGGCCGGGCCGGCNONE 
J080006B05GTTTGGGCCGGGCCGTCNONE 
J080006D17CCCGGCCCAGCNONE 
J080006D17GGGCCGGGCCGGCNONE 
J080006D17GTTTGGGCCGGGCCGTCNONE 
J080007M19CCCGGCCCAGCNONE 
J080007M19GGGCCGGGCCGGCNONE 
J080007M19GTTTGGGCCGGGCCGTCNONE 
J080011E07CCCGGCCCAGCNONE 
J080011E07GGGCCGGGCCGGCNONE 
J080011E07GTTTGGGCCGGGCCGTCNONE 
J080012H06CCCGGCCCAGCNONE 
J080012H06GGGCCGGGCCGGCNONE 
J080012H06GTTTGGGCCGGGCCGTCNONE 
J080014D08CCCGGCCCAGCNONE 
J080014D08GGGCCGGGCCGGCNONE 
J080014D08GTTTGGGCCGGGCCGTCNONE 
J080017D06CCCGGCCCAGCNONE 
J080017D06GGGCCGGGCCGGCNONE 
J080017D06GTTTGGGCCGGGCCGTCNONE 
J080017K17CCCGGCCCAGCNONE 
J080017K17GGGCCGGGCCGGCNONE 
J080017K17GTTTGGGCCGGGCCGTCNONE 
J080020B17CCCGGCCCAGCNONE 
J080020B17GGGCCGGGCCGGCNONE 
J080020B17GTTTGGGCCGGGCCGTCNONE 
J080021O05CCCGGCCCAGCNONE 
J080021O05GGGCCGGGCCGGCNONE 
J080021O05GTTTGGGCCGGGCCGTCNONE 
J080021O15CCCGGCCCAGCNONE 
J080021O15GGGCCGGGCCGGCNONE 
J080021O15GTTTGGGCCGGGCCGTCNONE 
J080023I18CCCGGCCCAGCNONE 
J080023I18GGGCCGGGCCGGCNONE 
J080023I18GTTTGGGCCGGGCCGTCNONE 
J080025A21CCCGGCCCAGCNONE 
J080025A21GGGCCGGGCCGGCNONE 
J080025A21GTTTGGGCCGGGCCGTCNONE 
J080027P22CCCGGCCCAGCNONE 
J080027P22GGGCCGGGCCGGCNONE 
J080027P22GTTTGGGCCGGGCCGTCNONE 
J080028M22CCCGGCCCAGCNONE 
J080028M22GGGCCGGGCCGGCNONE 
J080028M22GTTTGGGCCGGGCCGTCNONE 
J080029B09CCCGGCCCAGCNONE 
J080029B09GGGCCGGGCCGGCNONE 
J080029B09GTTTGGGCCGGGCCGTCNONE 
J080029M07CCCGGCCCAGCNONE 
J080029M07GGGCCGGGCCGGCNONE 
J080029M07GTTTGGGCCGGGCCGTCNONE 
J080029M17CCCGGCCCAGCNONE 
J080029M17GGGCCGGGCCGGCNONE 
J080029M17GTTTGGGCCGGGCCGTCNONE 
J080030H23CCCGGCCCAGCNONE 
J080030H23GGGCCGGGCCGGCNONE 
J080030H23GTTTGGGCCGGGCCGTCNONE 
J080030K16CCCGGCCCAGCNONE 
J080030K16GGGCCGGGCCGGCNONE 
J080030K16GTTTGGGCCGGGCCGTCNONE 
J080030L19CCCGGCCCAGCNONE 
J080030L19GGGCCGGGCCGGCNONE 
J080030L19GTTTGGGCCGGGCCGTCNONE 
J080031A12CCCGGCCCAGCNONE 
J080031A12GGGCCGGGCCGGCNONE 
J080031A12GTTTGGGCCGGGCCGTCNONE 
J080031N21CCCGGCCCAGCNONE 
J080031N21GGGCCGGGCCGGCNONE 
J080031N21GTTTGGGCCGGGCCGTCNONE 
J080032G05CCCGGCCCAGCNONE 
J080032G05GGGCCGGGCCGGCNONE 
J080032G05GTTTGGGCCGGGCCGTCNONE 
J080032P20CCCGGCCCAGCNONE 
J080032P20GGGCCGGGCCGGCNONE 
J080032P20GTTTGGGCCGGGCCGTCNONE 
J080033H20CCCGGCCCAGCNONE 
J080033H20GGGCCGGGCCGGCNONE 
J080033H20GTTTGGGCCGGGCCGTCNONE 
J080034H22CCCGGCCCAGCNONE 
J080034H22GGGCCGGGCCGGCNONE 
J080034H22GTTTGGGCCGGGCCGTCNONE 
J080034J03CCCGGCCCAGCNONE 
J080034J03GGGCCGGGCCGGCNONE 
J080034J03GTTTGGGCCGGGCCGTCNONE 
J080034J16CCCGGCCCAGCNONE 
J080034J16GGGCCGGGCCGGCNONE 
J080034J16GTTTGGGCCGGGCCGTCNONE 
J080034N01CCCGGCCCAGCNONE 
J080034N01GGGCCGGGCCGGCNONE 
J080034N01GTTTGGGCCGGGCCGTCNONE 
J080035K20CCCGGCCCAGCNONE 
J080035K20GGGCCGGGCCGGCNONE 
J080035K20GTTTGGGCCGGGCCGTCNONE 
J080036I04CCCGGCCCAGCNONE 
J080036I04GGGCCGGGCCGGCNONE 
J080036I04GTTTGGGCCGGGCCGTCNONE 
J080036I19CCCGGCCCAGCNONE 
J080036I19GGGCCGGGCCGGCNONE 
J080036I19GTTTGGGCCGGGCCGTCNONE 
J080036O21CCCGGCCCAGCNONE 
J080036O21GGGCCGGGCCGGCNONE 
J080036O21GTTTGGGCCGGGCCGTCNONE 
J080038D06CCCGGCCCAGCNONE 
J080038D06GGGCCGGGCCGGCNONE 
J080038D06GTTTGGGCCGGGCCGTCNONE 
J080039J15CCCGGCCCAGCNONE 
J080039J15GGGCCGGGCCGGCNONE 
J080039J15GTTTGGGCCGGGCCGTCNONE 
J080039P18CCCGGCCCAGCNONE 
J080039P18GGGCCGGGCCGGCNONE 
J080039P18GTTTGGGCCGGGCCGTCNONE 
J080041H20CCCGGCCCAGCNONE 
J080041H20GGGCCGGGCCGGCNONE 
J080041H20GTTTGGGCCGGGCCGTCNONE 
J080041M11CCCGGCCCAGCNONE 
J080041M11GGGCCGGGCCGGCNONE 
J080041M11GTTTGGGCCGGGCCGTCNONE 
J080042F14CCCGGCCCAGCNONE 
J080042F14GGGCCGGGCCGGCNONE 
J080042F14GTTTGGGCCGGGCCGTCNONE 
J080043G10CCCGGCCCAGCNONE 
J080043G10GGGCCGGGCCGGCNONE 
J080043G10GTTTGGGCCGGGCCGTCNONE 
J080043J02CCCGGCCCAGCNONE 
J080043J02GGGCCGGGCCGGCNONE 
J080043J02GTTTGGGCCGGGCCGTCNONE 
J080044C19CCCGGCCCAGCNONE 
J080044C19GGGCCGGGCCGGCNONE 
J080044C19GTTTGGGCCGGGCCGTCNONE 
J080044G11CCCGGCCCAGCNONE 
J080044G11GGGCCGGGCCGGCNONE 
J080044G11GTTTGGGCCGGGCCGTCNONE 
J080045M03CCCGGCCCAGCNONE 
J080045M03GGGCCGGGCCGGCNONE 
J080045M03GTTTGGGCCGGGCCGTCNONE 
J080045N07CCCGGCCCAGCNONE 
J080045N07GGGCCGGGCCGGCNONE 
J080045N07GTTTGGGCCGGGCCGTCNONE 
J080047K14CCCGGCCCAGCNONE 
J080047K14GGGCCGGGCCGGCNONE 
J080047K14GTTTGGGCCGGGCCGTCNONE 
J080049I21CCCGGCCCAGCNONE 
J080049I21GGGCCGGGCCGGCNONE 
J080049I21GTTTGGGCCGGGCCGTCNONE 
J080050A06CCCGGCCCAGCNONE 
J080050A06GGGCCGGGCCGGCNONE 
J080050A06GTTTGGGCCGGGCCGTCNONE 
J080050I16CCCGGCCCAGCNONE 
J080050I16GGGCCGGGCCGGCNONE 
J080050I16GTTTGGGCCGGGCCGTCNONE 
J080050N16CCCGGCCCAGCNONE 
J080050N16GGGCCGGGCCGGCNONE 
J080050N16GTTTGGGCCGGGCCGTCNONE 
J080052C23CCCGGCCCAGCNONE 
J080052C23GGGCCGGGCCGGCNONE 
J080052C23GTTTGGGCCGGGCCGTCNONE 
J080052D18CCCGGCCCAGCNONE 
J080052D18GGGCCGGGCCGGCNONE 
J080052D18GTTTGGGCCGGGCCGTCNONE 
J080052F20CCCGGCCCAGCNONE 
J080052F20GGGCCGGGCCGGCNONE 
J080052F20GTTTGGGCCGGGCCGTCNONE 
J080052F23CCCGGCCCAGCNONE 
J080052F23GGGCCGGGCCGGCNONE 
J080052F23GTTTGGGCCGGGCCGTCNONE 
J080053M03CCCGGCCCAGCNONE 
J080053M03GGGCCGGGCCGGCNONE 
J080053M03GTTTGGGCCGGGCCGTCNONE 
J080054G13CCCGGCCCAGCNONE 
J080054G13GGGCCGGGCCGGCNONE 
J080054G13GTTTGGGCCGGGCCGTCNONE 
J080054H12CCCGGCCCAGCNONE 
J080054H12GGGCCGGGCCGGCNONE 
J080054H12GTTTGGGCCGGGCCGTCNONE 
J080055N03CCCGGCCCAGCNONE 
J080055N03GGGCCGGGCCGGCNONE 
J080055N03GTTTGGGCCGGGCCGTCNONE 
J080056E07CCCGGCCCAGCNONE 
J080056E07GGGCCGGGCCGGCNONE 
J080056E07GTTTGGGCCGGGCCGTCNONE 
J080057L04CCCGGCCCAGCNONE 
J080057L04GGGCCGGGCCGGCNONE 
J080057L04GTTTGGGCCGGGCCGTCNONE 
J080063O19CCCGGCCCAGCNONE 
J080063O19GGGCCGGGCCGGCNONE 
J080063O19GTTTGGGCCGGGCCGTCNONE 
J080064E21CCCGGCCCAGCNONE 
J080064E21GGGCCGGGCCGGCNONE 
J080064E21GTTTGGGCCGGGCCGTCNONE 
J080065D18CCCGGCCCAGCNONE 
J080065D18GGGCCGGGCCGGCNONE 
J080065D18GTTTGGGCCGGGCCGTCNONE 
J080065F18CCCGGCCCAGCNONE 
J080065F18GGGCCGGGCCGGCNONE 
J080065F18GTTTGGGCCGGGCCGTCNONE 
J080065H14CCCGGCCCAGCNONE 
J080065H14GGGCCGGGCCGGCNONE 
J080065H14GTTTGGGCCGGGCCGTCNONE 
J080065K15CCCGGCCCAGCNONE 
J080065K15GGGCCGGGCCGGCNONE 
J080065K15GTTTGGGCCGGGCCGTCNONE 
J080065M24CCCGGCCCAGCNONE 
J080065M24GGGCCGGGCCGGCNONE 
J080065M24GTTTGGGCCGGGCCGTCNONE 
J080066B18CCCGGCCCAGCNONE 
J080066B18GGGCCGGGCCGGCNONE 
J080066B18GTTTGGGCCGGGCCGTCNONE 
J080066B19CCCGGCCCAGCNONE 
J080066B19GGGCCGGGCCGGCNONE 
J080066B19GTTTGGGCCGGGCCGTCNONE 
J080071H19CCCGGCCCAGCNONE 
J080071H19GGGCCGGGCCGGCNONE 
J080071H19GTTTGGGCCGGGCCGTCNONE 
J080072E18CCCGGCCCAGCNONE 
J080072E18GGGCCGGGCCGGCNONE 
J080072E18GTTTGGGCCGGGCCGTCNONE 
J080074K21CCCGGCCCAGCNONE 
J080074K21GGGCCGGGCCGGCNONE 
J080074K21GTTTGGGCCGGGCCGTCNONE 
J080075B06CCCGGCCCAGCNONE 
J080075B06GGGCCGGGCCGGCNONE 
J080075B06GTTTGGGCCGGGCCGTCNONE 
J080076H07CCCGGCCCAGCNONE 
J080076H07GGGCCGGGCCGGCNONE 
J080076H07GTTTGGGCCGGGCCGTCNONE 
J080079D16CCCGGCCCAGCNONE 
J080079D16GGGCCGGGCCGGCNONE 
J080079D16GTTTGGGCCGGGCCGTCNONE 
J080082B20CCCGGCCCAGCNONE 
J080082B20GGGCCGGGCCGGCNONE 
J080082B20GTTTGGGCCGGGCCGTCNONE 
J080084N16CCCGGCCCAGCNONE 
J080084N16GGGCCGGGCCGGCNONE 
J080084N16GTTTGGGCCGGGCCGTCNONE 
J080085L07CCCGGCCCAGCNONE 
J080085L07GGGCCGGGCCGGCNONE 
J080085L07GTTTGGGCCGGGCCGTCNONE 
J080086L04CCCGGCCCAGCNONE 
J080086L04GGGCCGGGCCGGCNONE 
J080086L04GTTTGGGCCGGGCCGTCNONE 
J080086M07CCCGGCCCAGCNONE 
J080086M07GGGCCGGGCCGGCNONE 
J080086M07GTTTGGGCCGGGCCGTCNONE 
J080087D02CCCGGCCCAGCNONE 
J080087D02GGGCCGGGCCGGCNONE 
J080087D02GTTTGGGCCGGGCCGTCNONE 
J080087D15CCCGGCCCAGCNONE 
J080087D15GGGCCGGGCCGGCNONE 
J080087D15GTTTGGGCCGGGCCGTCNONE 
J080087J19CCCGGCCCAGCNONE 
J080087J19GGGCCGGGCCGGCNONE 
J080087J19GTTTGGGCCGGGCCGTCNONE 
J080088G20CCCGGCCCAGCNONE 
J080088G20GGGCCGGGCCGGCNONE 
J080088G20GTTTGGGCCGGGCCGTCNONE 
J080092M15CCCGGCCCAGCNONE 
J080092M15GGGCCGGGCCGGCNONE 
J080092M15GTTTGGGCCGGGCCGTCNONE 
J080093O10CCCGGCCCAGCNONE 
J080093O10GGGCCGGGCCGGCNONE 
J080093O10GTTTGGGCCGGGCCGTCNONE 
J080095L09CCCGGCCCAGCNONE 
J080095L09GGGCCGGGCCGGCNONE 
J080095L09GTTTGGGCCGGGCCGTCNONE 
J080096A18CCCGGCCCAGCNONE 
J080096A18GGGCCGGGCCGGCNONE 
J080096A18GTTTGGGCCGGGCCGTCNONE 
J080097C03CCCGGCCCAGCNONE 
J080097C03GGGCCGGGCCGGCNONE 
J080097C03GTTTGGGCCGGGCCGTCNONE 
J090019J07CCCGGCCCAGCNONE 
J090019J07GGGCCGGGCCGGCNONE 
J090019J07GTTTGGGCCGGGCCGTCNONE 
J090024N12CCCGGCCCAGCNONE 
J090024N12GGGCCGGGCCGGCNONE 
J090024N12GTTTGGGCCGGGCCGTCNONE 
J090049I09CCCGGCCCAGCNONE 
J090049I09GGGCCGGGCCGGCNONE 
J090049I09GTTTGGGCCGGGCCGTCNONE 
Os03g0808300006-053-B11CCCGGCCCNONE 
006-057-A01CCCGGCCCNONE 
006-090-F05CCCGGCCCNONE 
006-106-G01CCCGGCCCNONE 
006-120-D10CCCGGCCCNONE 
009-139-H09CCCGGCCCNONE 
AK109389CCCGGCCCRemorin, C-terminal region domain containing protein. 
J033065F13CCCGGCCCNONE 
J053045H15CCCGGCCCNONE 
J065021C02CCCGGCCCNONE 
J065021D01CCCGGCCCNONE 
J065039B14CCCGGCCCNONE 
J065064J22CCCGGCCCNONE 
J065167I09CCCGGCCCNONE 
J065170A13CCCGGCCCNONE 
J065183J10CCCGGCCCNONE 
J065202K10CCCGGCCCNONE 
J065218F21CCCGGCCCNONE 
J075028D07CCCGGCCCNONE 
J100048J08CCCGGCCCNONE 
J100050H06CCCGGCCCNONE 
J100054M24CCCGGCCCNONE 
J100068G07CCCGGCCCNONE 
J100079F23CCCGGCCCNONE 
Os03g0819300AK072873GGGCCGGGSimilar to Annexin A7 (Annexin VII) (Synexin) (Fragment). 
J023027N16GGGCCGGGNONE 
J023105J17GGGCCGGGNONE 
J023145D16GGGCCGGGNONE 
J023149I08GGGCCGGGNONE 
Os03g0819900006-058-B05TAATGGGCCTGAATGGGCCGGGCCNONE 
AK111912TAATGGGCCTGAATGGGCCGGGCCNONE 
AK112029TAATGGGCCTGAATGGGCCGGGCCSimilar to RAB8C. 
AY576526TAATGGGCCTGAATGGGCCGGGCCNONE 
AY579410TAATGGGCCTGAATGGGCCGGGCCNONE 
J075041G24TAATGGGCCTGAATGGGCCGGGCCNONE 
J100070N08TAATGGGCCTGAATGGGCCGGGCCNONE 
Os03g0822700005-010-E01GACGGCCCGGCCCNONE 
006-088-H12GACGGCCCGGCCCNONE 
AK061682GACGGCCCGGCCCNONE 
AK101448GACGGCCCGGCCCArmadillo-like helical domain containing protein. 
J023091N05GACGGCCCGGCCCNONE 
Os03g0843400009-195-F11CCCGGCCCAACANONE 
AK061198CCCGGCCCAACASimilar to 30S ribosomal protein S6, chloroplast precursor (Fragment). 
AK099076CCCGGCCCAACANONE 
Os03g0846400AK067706CGGGCCGTGCCCGGCCCNONE 
AK067706GCTGGGCCGTGTCTGGGCCGGGCCGTGNONE 
AK070549CGGGCCGTGCCCGGCCCPeptidase, trypsin-like serine and cysteine domain containing protein. 
AK070549GCTGGGCCGTGTCTGGGCCGGGCCGTGPeptidase, trypsin-like serine and cysteine domain containing protein. 
Os03g0846900016-055-F06CCCGGCCCATCCNONE 
AK059297CCCGGCCCATCCConserved hypothetical protein. 
J090028J16CCCGGCCCATCCNONE 
Os03g0848600AK065662GGGCCGGGSimilar to NOI protein. 
J013041L20GGGCCGGGNONE 
J053074F15GGGCCGGGNONE 
J090098L10GGGCCGGGNONE 
Os03g0850600AK067191AGTTGGGCCGGGACGGCCACGTGGCGConserved hypothetical protein. 
J013095N12AGTTGGGCCGGGACGGCCACGTGGCGNONE 
J065214L06AGTTGGGCCGGGACGGCCACGTGGCGNONE 
J075093J10AGTTGGGCCGGGACGGCCACGTGGCGNONE 
Os03g0851000006-098-C01TTGTGGGCCGGGCCCAAACNONE 
AK060496TTGTGGGCCGGGCCCAAACSimilar to Transcription factor homolog BTF3-like protein. 
AK102202TTGTGGGCCGGGCCCAAACNONE 
AK104157TTGTGGGCCGGGCCCAAACNONE 
J033087F19TTGTGGGCCGGGCCCAAACNONE 
J065087I16TTGTGGGCCGGGCCCAAACNONE 
J065113G04TTGTGGGCCGGGCCCAAACNONE 
J090026M02TTGTGGGCCGGGCCCAAACNONE 
J090027I04TTGTGGGCCGGGCCCAAACNONE 
J100073E19TTGTGGGCCGGGCCCAAACNONE 
Os03g0858400AK102968GTTGGTGGGGCCGGGWD40-like domain containing protein. 
Os03g0860600AK071828CCCGGCCCATTTSimilar to 2-oxoglutarate-dependent oxygenase. 
J023118E08CCCGGCCCATTTNONE 
J100032J11CCCGGCCCATTTNONE 
Os04g0117100009-025-D02CCCGGCCCAACANONE 
009-025-D02GGGACCCACCCCACCCGGCCCAAGNONE 
009-056-D03CCCGGCCCAACANONE 
009-056-D03GGGACCCACCCCACCCGGCCCAAGNONE 
009-145-F01CCCGGCCCAACANONE 
009-145-F01GGGACCCACCCCACCCGGCCCAAGNONE 
009-146-C06CCCGGCCCAACANONE 
009-146-C06GGGACCCACCCCACCCGGCCCAAGNONE 
009-186-C05CCCGGCCCAACANONE 
009-186-C05GGGACCCACCCCACCCGGCCCAAGNONE 
AK060395CCCGGCCCAACANONE 
AK060395GGGACCCACCCCACCCGGCCCAAGNONE 
AK121763CCCGGCCCAACAConserved hypothetical protein. 
AK121763GGGACCCACCCCACCCGGCCCAAGConserved hypothetical protein. 
J033090J17CCCGGCCCAACANONE 
J033090J17GGGACCCACCCCACCCGGCCCAAGNONE 
J065058O06CCCGGCCCAACANONE 
J065058O06GGGACCCACCCCACCCGGCCCAAGNONE 
J065058P05CCCGGCCCAACANONE 
J065058P05GGGACCCACCCCACCCGGCCCAAGNONE 
J065141C14CCCGGCCCAACANONE 
J065141C14GGGACCCACCCCACCCGGCCCAAGNONE 
J065162F07CCCGGCCCAACANONE 
J065162F07GGGACCCACCCCACCCGGCCCAAGNONE 
J065199N16CCCGGCCCAACANONE 
J065199N16GGGACCCACCCCACCCGGCCCAAGNONE 
J065214I05CCCGGCCCAACANONE 
J065214I05GGGACCCACCCCACCCGGCCCAAGNONE 
J075003L04CCCGGCCCAACANONE 
J075003L04GGGACCCACCCCACCCGGCCCAAGNONE 
J075014C14CCCGGCCCAACANONE 
J075014C14GGGACCCACCCCACCCGGCCCAAGNONE 
J075063K14CCCGGCCCAACANONE 
J075063K14GGGACCCACCCCACCCGGCCCAAGNONE 
J075111N19CCCGGCCCAACANONE 
J075111N19GGGACCCACCCCACCCGGCCCAAGNONE 
J075138E13CCCGGCCCAACANONE 
J075138E13GGGACCCACCCCACCCGGCCCAAGNONE 
J075189E23CCCGGCCCAACANONE 
J075189E23GGGACCCACCCCACCCGGCCCAAGNONE 
J080304J23CCCGGCCCAACANONE 
J080304J23GGGACCCACCCCACCCGGCCCAAGNONE 
J080310L07CCCGGCCCAACANONE 
J080310L07GGGACCCACCCCACCCGGCCCAAGNONE 
J080318A16CCCGGCCCAACANONE 
J080318A16GGGACCCACCCCACCCGGCCCAAGNONE 
J100054P14CCCGGCCCAACANONE 
J100054P14GGGACCCACCCCACCCGGCCCAAGNONE 
Os04g0173800AK103206CCCGGCCCLectin precursor (Agglutinin). 
J033122E14CCCGGCCCNONE 
J075001E08CCCGGCCCNONE 
J075005H05CCCGGCCCNONE 
J075006A12CCCGGCCCNONE 
J075026O21CCCGGCCCNONE 
J075040I24CCCGGCCCNONE 
J075060N11CCCGGCCCNONE 
J075069A22CCCGGCCCNONE 
J075070A15CCCGGCCCNONE 
J075074K06CCCGGCCCNONE 
J075078E13CCCGGCCCNONE 
J075085O15CCCGGCCCNONE 
J075088A22CCCGGCCCNONE 
J075094E22CCCGGCCCNONE 
J075095E06CCCGGCCCNONE 
J075120L07CCCGGCCCNONE 
J075138I15CCCGGCCCNONE 
J075140I20CCCGGCCCNONE 
J075140N11CCCGGCCCNONE 
J075142I18CCCGGCCCNONE 
J075147F23CCCGGCCCNONE 
J075147J18CCCGGCCCNONE 
J075155H18CCCGGCCCNONE 
J075156J22CCCGGCCCNONE 
J075157J02CCCGGCCCNONE 
J075167L04CCCGGCCCNONE 
J075170H22CCCGGCCCNONE 
J075172G01CCCGGCCCNONE 
J075180L07CCCGGCCCNONE 
J075182B03CCCGGCCCNONE 
J075194C19CCCGGCCCNONE 
J100063D16CCCGGCCCNONE 
M24504CCCGGCCCNONE 
Os04g0208400AK069629GCTGGGCCGGGCCGCyclin-like F-box domain containing protein. 
Os04g0258900009-146-B02CCCGGCCCATTTNONE 
AK062983CCCGGCCCATTTCyclin-like F-box domain containing protein. 
Os04g0378200AK103076GGGCCGGGCCGGGSterile alpha motif SAM domain containing protein. 
J033118E02GGGCCGGGCCGGGNONE 
J065065F15GGGCCGGGCCGGGNONE 
J090080I24GGGCCGGGCCGGGNONE 
Os04g0388900AK063224CAAGGCCCGGCCCATCASimilar to U6 snRNA-associated Sm-like protein LSm6 (Sm protein F). 
J065037N19CAAGGCCCGGCCCATCANONE 
J065148P22CAAGGCCCGGCCCATCANONE 
J075040G12CAAGGCCCGGCCCATCANONE 
Os04g0399300AK105282CCCGGCCCSimilar to Nudix hydrolase 13, mitochondrial precursor (EC 3.6.1.-) (AtNUDT13). 
Os04g0430600009-014-G12CCCGGCCCNONE 
015-019-A08CCCGGCCCNONE 
015-048-C08CCCGGCCCNONE 
015-085-E11CCCGGCCCNONE 
AK072050CCCGGCCCNONE 
AK106337CCCGGCCCConserved hypothetical protein. 
J065037C09CCCGGCCCNONE 
J075125G18CCCGGCCCNONE 
Os04g0436100AK072631CCCGGCCCPhenylacetic acid degradation-related protein domain containing protein. 
J023132I18CCCGGCCCNONE 
J065112K15CCCGGCCCNONE 
J065138F04CCCGGCCCNONE 
J075078D03CCCGGCCCNONE 
J090090K17CCCGGCCCNONE 
Os04g0461100009-136-H10ATCTGGGCCGGGCCGTTTNONE 
009-147-H12ATCTGGGCCGGGCCGTTTNONE 
AK068022ATCTGGGCCGGGCCGTTTPlastid and cyanobacterial ribosomal protein PSRP-3/Ycf65 family protein. 
J013130N24ATCTGGGCCGGGCCGTTTNONE 
J065019D10ATCTGGGCCGGGCCGTTTNONE 
J065168O21ATCTGGGCCGGGCCGTTTNONE 
J075051G06ATCTGGGCCGGGCCGTTTNONE 
J075148G11ATCTGGGCCGGGCCGTTTNONE 
Os04g0480900AK109889CCCGGCCCGlycoside hydrolase, family 5 protein. 
Os04g0483500009-132-G09GCCCGGCCCNONE 
AK060512GCCCGGCCCSimilar to B-keto acyl reductase. 
J065021G03GCCCGGCCCNONE 
J080304E09GCCCGGCCCNONE 
J080311F01GCCCGGCCCNONE 
J080317H02GCCCGGCCCNONE 
J080317L09GCCCGGCCCNONE 
J100047G13GCCCGGCCCNONE 
J100066L09GCCCGGCCCNONE 
Os04g0486400AJ535489GGGCCGGGCCGGGCCGAANONE 
AK103296GGGCCGGGCCGGGCCGAARML1 protein. 
J013045L03GGGCCGGGCCGGGCCGAANONE 
J013045M03GGGCCGGGCCGGGCCGAANONE 
J033034L24GGGCCGGGCCGGGCCGAANONE 
J033125B02GGGCCGGGCCGGGCCGAANONE 
J075001G08GGGCCGGGCCGGGCCGAANONE 
J075011I16GGGCCGGGCCGGGCCGAANONE 
J075033M08GGGCCGGGCCGGGCCGAANONE 
J075044G01GGGCCGGGCCGGGCCGAANONE 
J075047D04GGGCCGGGCCGGGCCGAANONE 
J075061J09GGGCCGGGCCGGGCCGAANONE 
J075085L07GGGCCGGGCCGGGCCGAANONE 
J075087D20GGGCCGGGCCGGGCCGAANONE 
J075117A04GGGCCGGGCCGGGCCGAANONE 
J075134H06GGGCCGGGCCGGGCCGAANONE 
J075184J12GGGCCGGGCCGGGCCGAANONE 
Os04g0489600003-130-E01CCCGGCCCNONE 
AK062301CCCGGCCCNONE 
AK068039CCCGGCCCBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
Os04g0491500AK068089TTTCGGCCCGGCCCAACCNONE 
AK101116TTTCGGCCCGGCCCAACCTGF-beta receptor, type I/II extracellular region family protein. 
Os04g0527700AK072980AACGGGCCGGGCCGGCCCAGTACHCH domain containing protein. 
J023117E20AACGGGCCGGGCCGGCCCAGTANONE 
J023150D11AACGGGCCGGGCCGGCCCAGTANONE 
Os04g0531300016-006-E10GCCCGGCCCATATNONE 
AK072647GCCCGGCCCATATDihydrouridine synthase, DuS family protein. 
AK103911GCCCGGCCCATATNONE 
J013038P22GCCCGGCCCATATNONE 
J023130D01GCCCGGCCCATATNONE 
J033150P13GCCCGGCCCATATNONE 
J043026L14GCCCGGCCCATATNONE 
J065049A08GCCCGGCCCATATNONE 
J065215C17GCCCGGCCCATATNONE 
Os04g0541700AK109177ACCGGGCCGGGNONE 
AY554030ACCGGGCCGGGNONE 
J065055P13ACCGGGCCGGGNONE 
J065057N20ACCGGGCCGGGNONE 
J065136D07ACCGGGCCGGGNONE 
Os04g0563300AK100487CAGGTGGGCCCGGCCCATACyclin-like F-box domain containing protein. 
AK100487CCCGGCCCACGCCyclin-like F-box domain containing protein. 
J023097O18CAGGTGGGCCCGGCCCATANONE 
J023097O18CCCGGCCCACGCNONE 
J065100E16CAGGTGGGCCCGGCCCATANONE 
J065100E16CCCGGCCCACGCNONE 
J075022C23CAGGTGGGCCCGGCCCATANONE 
J075022C23CCCGGCCCACGCNONE 
J075023L18CAGGTGGGCCCGGCCCATANONE 
J075023L18CCCGGCCCACGCNONE 
J075040N10CAGGTGGGCCCGGCCCATANONE 
J075040N10CCCGGCCCACGCNONE 
J075061L14CAGGTGGGCCCGGCCCATANONE 
J075061L14CCCGGCCCACGCNONE 
J075069B15CAGGTGGGCCCGGCCCATANONE 
J075069B15CCCGGCCCACGCNONE 
J075106C16CAGGTGGGCCCGGCCCATANONE 
J075106C16CCCGGCCCACGCNONE 
J075138P13CAGGTGGGCCCGGCCCATANONE 
J075138P13CCCGGCCCACGCNONE 
J075139H18CAGGTGGGCCCGGCCCATANONE 
J075139H18CCCGGCCCACGCNONE 
J075139L06CAGGTGGGCCCGGCCCATANONE 
J075139L06CCCGGCCCACGCNONE 
J075149B07CAGGTGGGCCCGGCCCATANONE 
J075149B07CCCGGCCCACGCNONE 
J075177N21CAGGTGGGCCCGGCCCATANONE 
J075177N21CCCGGCCCACGCNONE 
Os04g0564600009-038-A02CCCGGCCCATAAGGCCCACGTNONE 
AK105145CCCGGCCCATAAGGCCCACGTNONE 
AK120614CCCGGCCCATAAGGCCCACGTSimilar to HMG1 protein. 
J013102D16CCCGGCCCATAAGGCCCACGTNONE 
J013151P06CCCGGCCCATAAGGCCCACGTNONE 
J033082C11CCCGGCCCATAAGGCCCACGTNONE 
J065073N13CCCGGCCCATAAGGCCCACGTNONE 
J065142E11CCCGGCCCATAAGGCCCACGTNONE 
J065187I19CCCGGCCCATAAGGCCCACGTNONE 
J065204K02CCCGGCCCATAAGGCCCACGTNONE 
J090089P22CCCGGCCCATAAGGCCCACGTNONE 
J100060B16CCCGGCCCATAAGGCCCACGTNONE 
Os04g0577500006-039-C03CCCGGCCCACAANONE 
006-043-H01CCCGGCCCACAANONE 
AK061538CCCGGCCCACAANONE 
AK065648CCCGGCCCACAATatD-related deoxyribonuclease family protein. 
AK104763CCCGGCCCACAANONE 
J013035E21CCCGGCCCACAANONE 
J013066M11CCCGGCCCACAANONE 
J100026B02CCCGGCCCACAANONE 
Os04g0611300009-006-G08GCCCGGCCCAAGNONE 
009-011-C01GCCCGGCCCAAGNONE 
009-036-B09GCCCGGCCCAAGNONE 
009-116-G09GCCCGGCCCAAGNONE 
009-126-E09GCCCGGCCCAAGNONE 
009-132-F09GCCCGGCCCAAGNONE 
009-151-G07GCCCGGCCCAAGNONE 
009-155-C07GCCCGGCCCAAGNONE 
009-163-G01GCCCGGCCCAAGNONE 
009-169-G08GCCCGGCCCAAGNONE 
009-191-B02GCCCGGCCCAAGNONE 
009-196-A08GCCCGGCCCAAGNONE 
009-198-E07GCCCGGCCCAAGNONE 
014-015-F04GCCCGGCCCAAGNONE 
015-087-H04GCCCGGCCCAAGNONE 
AK062605GCCCGGCCCAAGNONE 
AK063022GCCCGGCCCAAGConserved hypothetical protein. 
AK066749GCCCGGCCCAAGNONE 
AK104924GCCCGGCCCAAGNONE 
J065002M20GCCCGGCCCAAGNONE 
J065045L23GCCCGGCCCAAGNONE 
J065101E05GCCCGGCCCAAGNONE 
J065140J23GCCCGGCCCAAGNONE 
J065179G11GCCCGGCCCAAGNONE 
J065191B18GCCCGGCCCAAGNONE 
J065192E03GCCCGGCCCAAGNONE 
J065199H21GCCCGGCCCAAGNONE 
J075067F01GCCCGGCCCAAGNONE 
J075089L01GCCCGGCCCAAGNONE 
J075147K22GCCCGGCCCAAGNONE 
J080069G23GCCCGGCCCAAGNONE 
J100053D10GCCCGGCCCAAGNONE 
J100078C10GCCCGGCCCAAGNONE 
Os04g0654700006-097-D06CCCGGCCCNONE 
013-016-H01CCCGGCCCNONE 
AB055495CCCGGCCCNONE 
AF072849CCCGGCCCNONE 
AK062107CCCGGCCCNONE 
AK099088CCCGGCCCSimilar to COP9 signalosome complex subunit 5b (EC 3.4.-.-) (Signalosome subunit 5b) (Jun activation domain-binding homolog 1). 
J013038I16CCCGGCCCNONE 
J013038J23CCCGGCCCNONE 
J013038L17CCCGGCCCNONE 
J013038N18CCCGGCCCNONE 
J013038O18CCCGGCCCNONE 
J013124A09CCCGGCCCNONE 
J023007N04CCCGGCCCNONE 
J033023C02CCCGGCCCNONE 
J033030M18CCCGGCCCNONE 
J033068I09CCCGGCCCNONE 
J033100E04CCCGGCCCNONE 
J065153E19CCCGGCCCNONE 
J065207I02CCCGGCCCNONE 
J075007A07CCCGGCCCNONE 
J075036M04CCCGGCCCNONE 
J075147I03CCCGGCCCNONE 
J075197L11CCCGGCCCNONE 
Os04g0670400012-048-A10TACGGCCCGGCCCATTTGGCCCACGAANONE 
AK103099TACGGCCCGGCCCATTTGGCCCACGAAOvarian tumour, otubain domain containing protein. 
J033118N06TACGGCCCGGCCCATTTGGCCCACGAANONE 
J100019K03TACGGCCCGGCCCATTTGGCCCACGAANONE 
Os04g0670500AK107506TTCGTGGGCCAAATGGGCCGGGCCGTACysteine protease 1 precursor (EC 3.4.22.-) (OsCP1). 
Os04g0670600AK064255AAAAGCCCGGCCCAGTTNONE 
Os04g0673400Os04g0673400ACCGGGCCGGGCSimilar to Uracil-DNA glycosylase (EC 3.2.2.-) (UDG). 
Os04g0683800011-050-B05CTCGGCCCGGCCCNONE 
AK073897CTCGGCCCGGCCCSimilar to Phosphoribosyltransferase (Fragment). 
AK102910CTCGGCCCGGCCCNONE 
J033075A06CTCGGCCCGGCCCNONE 
J033079F23CTCGGCCCGGCCCNONE 
J033093D20CTCGGCCCGGCCCNONE 
J033099B18CTCGGCCCGGCCCNONE 
J033129G13CTCGGCCCGGCCCNONE 
J065075F21CTCGGCCCGGCCCNONE 
J065093M19CTCGGCCCGGCCCNONE 
J075023K10CTCGGCCCGGCCCNONE 
J075046J08CTCGGCCCGGCCCNONE 
J090003I20CTCGGCCCGGCCCNONE 
J090017L12CTCGGCCCGGCCCNONE 
J090024B04CTCGGCCCGGCCCNONE 
J090033A20CTCGGCCCGGCCCNONE 
J090083F02CTCGGCCCGGCCCNONE 
Os05g0111200009-033-A06CCCGGCCCNONE 
AK101693CCCGGCCCSimilar to Amino acid selective channel protein. 
J065006E13CCCGGCCCNONE 
J075001D12CCCGGCCCNONE 
J075005J18CCCGGCCCNONE 
J075009L08CCCGGCCCNONE 
J075012M21CCCGGCCCNONE 
J075019K17CCCGGCCCNONE 
J075020D07CCCGGCCCNONE 
J075041D11CCCGGCCCNONE 
J075051C03CCCGGCCCNONE 
J075060C05CCCGGCCCNONE 
J075079N09CCCGGCCCNONE 
J075094B04CCCGGCCCNONE 
J075108E08CCCGGCCCNONE 
J075115G05CCCGGCCCNONE 
J075147L21CCCGGCCCNONE 
J075161G12CCCGGCCCNONE 
J075168J11CCCGGCCCNONE 
J075168L11CCCGGCCCNONE 
J075174F22CCCGGCCCNONE 
Os05g0126200AK059554CCCGGCCCATCTConserved hypothetical protein. 
AK059554GTCGAGTCATTGGGCCGGGCCCATATConserved hypothetical protein. 
AK121734CCCGGCCCATCTNONE 
AK121734GTCGAGTCATTGGGCCGGGCCCATATNONE 
J033084B09CCCGGCCCATCTNONE 
J033084B09GTCGAGTCATTGGGCCGGGCCCATATNONE 
J090010I10CCCGGCCCATCTNONE 
J090010I10GTCGAGTCATTGGGCCGGGCCCATATNONE 
Os05g0150300AK100732GCCCGGCCCSimilar to Possible global transcription activator SNF2L1 (SWI/SNF related matrix associated actin dependent regulator of chromatin subfamily A member 1). 
Os05g0182700003-102-E07CCCGGCCCATGANONE 
011-019-D04CCCGGCCCATGANONE 
013-068-D09CCCGGCCCATGANONE 
014-032-G03CCCGGCCCATGANONE 
AK065911CCCGGCCCATGAProtein of unknown function DUF1664 family protein. 
AK104343CCCGGCCCATGANONE 
J013045E01CCCGGCCCATGANONE 
J013156L15CCCGGCCCATGANONE 
J023029P17CCCGGCCCATGANONE 
J023134I24CCCGGCCCATGANONE 
J033099A10CCCGGCCCATGANONE 
J033115L16CCCGGCCCATGANONE 
J090007M24CCCGGCCCATGANONE 
J090019F02CCCGGCCCATGANONE 
Os05g0223300AK069616CCCGGCCCGGCCCGGCCCGCASimilar to RNA-binding protein. 
J080093O15CCCGGCCCGGCCCGGCCCGCANONE 
J090061N02CCCGGCCCGGCCCGGCCCGCANONE 
Os05g0241400AK107803ATATGGGCCTATTGGGCCGGGCConserved hypothetical protein. 
Os05g0397700AK067298GGCCGGGCCGGGCCGGTSecY protein family protein. 
Os05g0408900006-053-D03CCCGGCCCGTTNONE 
AF024512CCCGGCCCGTTNONE 
AK058950CCCGGCCCGTTNONE 
AK059821CCCGGCCCGTTNONE 
AK064944CCCGGCCCGTTSimilar to 1-D-deoxyxylulose 5-phosphate synthase. 
AK104851CCCGGCCCGTTNONE 
AK106750CCCGGCCCGTTNONE 
Os05g0430300AK121670GGGCCCGGCCCProtein of unknown function DUF668 family protein. 
Os05g0437800015-045-B10CCAGGCCCGGCCCACANONE 
AK106328CCAGGCCCGGCCCACAConserved hypothetical protein. 
Os05g0451300AK108341AGTGGGCCACCTCGCCCGGCCCAACCConserved hypothetical protein. 
Os05g0465000AK111286CCCGGCCCAGAConserved hypothetical protein. 
Os05g0486100AK119823CCCGGCCCCCGCGProtein kinase-like domain containing protein. 
Os05g0488900AK071883CCCGGCCCATACSimilar to Cytochrome b5 reductase. 
AK073699CCCGGCCCATACNONE 
AK105459CCCGGCCCATACNONE 
J080009C06CCCGGCCCATACNONE 
J080021N09CCCGGCCCATACNONE 
J080041K24CCCGGCCCATACNONE 
J080058H15CCCGGCCCATACNONE 
J080064P06CCCGGCCCATACNONE 
J080077B16CCCGGCCCATACNONE 
Os05g0490800J065037L19CCAGCCCACGGCCCGGCCCACCTNONE 
Os05g0503300011-013-H12CCCGGCCCNONE 
012-072-B03CCCGGCCCNONE 
AK073969CCCGGCCCSimilar to Sulfite reductase (Fragment). 
AK100773CCCGGCCCNONE 
AK103289CCCGGCCCNONE 
J013045K07CCCGGCCCNONE 
J033075F01CCCGGCCCNONE 
J033125N07CCCGGCCCNONE 
J033130G12CCCGGCCCNONE 
Os05g0536900009-033-D11AGATGGGCCGGGCCGGTNONE 
AK105140AGATGGGCCGGGCCGGTSimilar to RAB7A. 
Os05g0540100AB021666CCCGGCCCNONE 
AK060623CCCGGCCCNONE 
AK103819CCCGGCCCFlap endonuclease-1a (EC 3.-.-.-) (OsFEN-1a). 
Os05g0552900AK102095GCCCGGCCCAGTAMAP65/ASE1 family protein. 
Os05g0566500AK073468TGTGGGCCGGGCNONE 
AK099052TGTGGGCCGGGCSimilar to Initiation factor 3d (Fragment). 
AK104093TGTGGGCCGGGCNONE 
J090025I18TGTGGGCCGGGCNONE 
Os05g0571400009-019-B04GACGGCCCGGCCCAGTTNONE 
009-043-H02GACGGCCCGGCCCAGTTNONE 
AK062369GACGGCCCGGCCCAGTTConserved hypothetical protein. 
Os05g0577200AK069756GCCCGGCCCACTCarboxylesterase, type B family protein. 
Os05g0577900016-028-C02TTGTGGGCCTACATGGGCCGGGCCCATGGNONE 
AK064201TTGTGGGCCTACATGGGCCGGGCCCATGGConserved hypothetical protein. 
Os05g0578000AK065040CCATGGGCCCGGCCCATGTAGGCCCACAASimilar to PEX14 protein. 
J013001H17CCATGGGCCCGGCCCATGTAGGCCCACAANONE 
J013036A06CCATGGGCCCGGCCCATGTAGGCCCACAANONE 
J033122K08CCATGGGCCCGGCCCATGTAGGCCCACAANONE 
Os06g0104000AK068490GCCACGTGCCACGGCCCGGCCCGGCCCATGAConserved hypothetical protein. 
Os06g0114600015-077-E06CCTGGGCCGGGCCNONE 
AK067972CCTGGGCCGGGCCConserved hypothetical protein. 
Os06g0137500AK072896CCCGGCCCACTBrix domain containing protein. 
AK121945CCCGGCCCACTNONE 
Os06g0140100011-063-A02TGTTGGGCCGGGCCGTGNONE 
AK063371TGTTGGGCCGGGCCGTGLeucine carboxyl methyltransferase family protein. 
Os06g0157800AK121504TCGGCCCGGCCCAGTTSimilar to CG7224 (Fragment). 
J033022L20TCGGCCCGGCCCAGTTNONE 
J075033D09TCGGCCCGGCCCAGTTNONE 
Os06g0166500016-094-H06CGCGGGGGGCCGGGNONE 
AK102541CGCGGGGGGCCGGGSimilar to Auxin-responsive protein IAA20 (Indoleacetic acid-induced protein 20). 
Os06g0168000AK059250CTTGGGCCGGGCCNONE 
AK099356CTTGGGCCGGGCCGlutathione S-transferase, C-terminal-like domain containing protein. 
J033040E19CTTGGGCCGGGCCNONE 
J033097H04CTTGGGCCGGGCCNONE 
J075087M11CTTGGGCCGGGCCNONE 
J075146H06CTTGGGCCGGGCCNONE 
J075188H11CTTGGGCCGGGCCNONE 
J090071D03CTTGGGCCGGGCCNONE 
J090097L20CTTGGGCCGGGCCNONE 
J100051M05CTTGGGCCGGGCCNONE 
J100082H13CTTGGGCCGGGCCNONE 
Os06g0174350J043034B05CCCGGCCCACTConserved hypothetical protein. 
Os06g0226500009-030-E06TGTGGGCCCGGCCCNONE 
AK071601TGTGGGCCCGGCCCBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
J023102C01TGTGGGCCCGGCCCNONE 
Os06g0247800AK102187GGCCCGGCCCAACCSimilar to Dynamin-like protein (Fragment). 
AY224491GGCCCGGCCCAACCNONE 
Os06g0268800AK120796CCCGGCCCCACACGProtein of unknown function UPF0005 family protein. 
Os06g0274500AK066417CACGGCCCCATCCCCCCGGCCCSimilar to SERK1 (Fragment). 
Os06g0275500AK111743AATGGGCCGGGSimilar to Polycomb protein EZ1 (Enhancer of zeste protein 1). 
Os06g0316100011-089-C01ACATGGGCCGGGCCCAGGNONE 
015-030-D11ACATGGGCCGGGCCCAGGNONE 
015-044-H10ACATGGGCCGGGCCCAGGNONE 
AK105260ACATGGGCCGGGCCCAGGConserved hypothetical protein. 
AK119646ACATGGGCCGGGCCCAGGNONE 
Os06g0319700AK120884GGCCCGGCCCAACGCCCAGCCCSimilar to 60S ribosomal protein L31. 
AK120884GGCCCGGCCCGGTSimilar to 60S ribosomal protein L31. 
J013089A14GGCCCGGCCCAACGCCCAGCCCNONE 
J013089A14GGCCCGGCCCGGTNONE 
J023028N24GGCCCGGCCCAACGCCCAGCCCNONE 
J023028N24GGCCCGGCCCGGTNONE 
J033098H21GGCCCGGCCCAACGCCCAGCCCNONE 
J033098H21GGCCCGGCCCGGTNONE 
J033118G04GGCCCGGCCCAACGCCCAGCCCNONE 
J033118G04GGCCCGGCCCGGTNONE 
J090056P15GGCCCGGCCCAACGCCCAGCCCNONE 
J090056P15GGCCCGGCCCGGTNONE 
J090062B02GGCCCGGCCCAACGCCCAGCCCNONE 
J090062B02GGCCCGGCCCGGTNONE 
J100024B09GGCCCGGCCCAACGCCCAGCCCNONE 
J100024B09GGCCCGGCCCGGTNONE 
J100060I04GGCCCGGCCCAACGCCCAGCCCNONE 
J100060I04GGCCCGGCCCGGTNONE 
J100078H11GGCCCGGCCCAACGCCCAGCCCNONE 
J100078H11GGCCCGGCCCGGTNONE 
J100080A14GGCCCGGCCCAACGCCCAGCCCNONE 
J100080A14GGCCCGGCCCGGTNONE 
J100086F18GGCCCGGCCCAACGCCCAGCCCNONE 
J100086F18GGCCCGGCCCGGTNONE 
Os06g0334600AK064993CCCGGCCCACGCGHypothetical protein. 
J013001D16CCCGGCCCACGCGNONE 
J043009I09CCCGGCCCACGCGNONE 
Os06g0338900016-067-B02GGGCCGGGCGGCCCANONE 
AK100837GGGCCGGGCGGCCCANucleotidyl transferase domain containing protein. 
J013058L01GGGCCGGGCGGCCCANONE 
J013135N01GGGCCGGGCGGCCCANONE 
J023123E15GGGCCGGGCGGCCCANONE 
J033051J01GGGCCGGGCGGCCCANONE 
J090002O21GGGCCGGGCGGCCCANONE 
J090013F06GGGCCGGGCGGCCCANONE 
J090056F16GGGCCGGGCGGCCCANONE 
J090081G13GGGCCGGGCGGCCCANONE 
J090090P21GGGCCGGGCGGCCCANONE 
J100039F05GGGCCGGGCGGCCCANONE 
J100059J03GGGCCGGGCGGCCCANONE 
Os06g0500000J065064K10GCCCGGCCCConserved hypothetical protein. 
J065148C10GCCCGGCCCNONE 
J065183N06GCCCGGCCCNONE 
J065203F05GCCCGGCCCNONE 
Os06g0530200009-042-B02GCCCGGCCCNONE 
009-042-B02TGTTGGGCCGGGCCNONE 
009-050-E10GCCCGGCCCNONE 
009-050-E10TGTTGGGCCGGGCCNONE 
009-060-F07GCCCGGCCCNONE 
009-060-F07TGTTGGGCCGGGCCNONE 
009-117-H08GCCCGGCCCNONE 
009-117-H08TGTTGGGCCGGGCCNONE 
009-129-C10GCCCGGCCCNONE 
009-129-C10TGTTGGGCCGGGCCNONE 
AK073116GCCCGGCCCConserved hypothetical protein. 
AK073116TGTTGGGCCGGGCCConserved hypothetical protein. 
AK104077GCCCGGCCCNONE 
AK104077TGTTGGGCCGGGCCNONE 
J065032N16GCCCGGCCCNONE 
J065032N16TGTTGGGCCGGGCCNONE 
J065153K07GCCCGGCCCNONE 
J065153K07TGTTGGGCCGGGCCNONE 
J065169N18GCCCGGCCCNONE 
J065169N18TGTTGGGCCGGGCCNONE 
J065190H18GCCCGGCCCNONE 
J065190H18TGTTGGGCCGGGCCNONE 
J075127E14GCCCGGCCCNONE 
J075127E14TGTTGGGCCGGGCCNONE 
J090008F20GCCCGGCCCNONE 
J090008F20TGTTGGGCCGGGCCNONE 
Os06g0551400009-003-D11CCCACCCGGCCCGGCCCACANONE 
011-025-C09CCCACCCGGCCCGGCCCACANONE 
AK066548CCCACCCGGCCCGGCCCACARas-related protein RIC2. 
D13758CCCACCCGGCCCGGCCCACANONE 
J013069H14CCCACCCGGCCCGGCCCACANONE 
J053037J07CCCACCCGGCCCGGCCCACANONE 
J065011J03CCCACCCGGCCCGGCCCACANONE 
J065078L15CCCACCCGGCCCGGCCCACANONE 
J065103H24CCCACCCGGCCCGGCCCACANONE 
J065157A07CCCACCCGGCCCGGCCCACANONE 
J065213P12CCCACCCGGCCCGGCCCACANONE 
J090007P04CCCACCCGGCCCGGCCCACANONE 
J090052N23CCCACCCGGCCCGGCCCACANONE 
Os06g0567000009-166-G12CCCACCTGTTGGGCCGGGCCCACTNONE 
AK121337CCCACCTGTTGGGCCGGGCCCACTProtein of unknown function UPF0197 family protein. 
J013122F01CCCACCTGTTGGGCCGGGCCCACTNONE 
J023080N12CCCACCTGTTGGGCCGGGCCCACTNONE 
J023120F03CCCACCTGTTGGGCCGGGCCCACTNONE 
J065013B18CCCACCTGTTGGGCCGGGCCCACTNONE 
J065039P21CCCACCTGTTGGGCCGGGCCCACTNONE 
J065089E06CCCACCTGTTGGGCCGGGCCCACTNONE 
J065095N19CCCACCTGTTGGGCCGGGCCCACTNONE 
J065119H03CCCACCTGTTGGGCCGGGCCCACTNONE 
J065121D18CCCACCTGTTGGGCCGGGCCCACTNONE 
J065149G04CCCACCTGTTGGGCCGGGCCCACTNONE 
J075012J04CCCACCTGTTGGGCCGGGCCCACTNONE 
J075021G13CCCACCTGTTGGGCCGGGCCCACTNONE 
J075106I23CCCACCTGTTGGGCCGGGCCCACTNONE 
J075107F19CCCACCTGTTGGGCCGGGCCCACTNONE 
J075152J22CCCACCTGTTGGGCCGGGCCCACTNONE 
J075186J20CCCACCTGTTGGGCCGGGCCCACTNONE 
J075188F16CCCACCTGTTGGGCCGGGCCCACTNONE 
J080001G06CCCACCTGTTGGGCCGGGCCCACTNONE 
J080002O09CCCACCTGTTGGGCCGGGCCCACTNONE 
J080006E10CCCACCTGTTGGGCCGGGCCCACTNONE 
J080006F24CCCACCTGTTGGGCCGGGCCCACTNONE 
J080012L07CCCACCTGTTGGGCCGGGCCCACTNONE 
J080016A10CCCACCTGTTGGGCCGGGCCCACTNONE 
J080017D11CCCACCTGTTGGGCCGGGCCCACTNONE 
J080017I04CCCACCTGTTGGGCCGGGCCCACTNONE 
J080017I10CCCACCTGTTGGGCCGGGCCCACTNONE 
J080020P06CCCACCTGTTGGGCCGGGCCCACTNONE 
J080024A20CCCACCTGTTGGGCCGGGCCCACTNONE 
J080027B10CCCACCTGTTGGGCCGGGCCCACTNONE 
J080027E03CCCACCTGTTGGGCCGGGCCCACTNONE 
J080027I01CCCACCTGTTGGGCCGGGCCCACTNONE 
J080027K20CCCACCTGTTGGGCCGGGCCCACTNONE 
J080041L12CCCACCTGTTGGGCCGGGCCCACTNONE 
J080043D21CCCACCTGTTGGGCCGGGCCCACTNONE 
J080044K11CCCACCTGTTGGGCCGGGCCCACTNONE 
J080048I08CCCACCTGTTGGGCCGGGCCCACTNONE 
J080049M12CCCACCTGTTGGGCCGGGCCCACTNONE 
J080050C14CCCACCTGTTGGGCCGGGCCCACTNONE 
J080050N21CCCACCTGTTGGGCCGGGCCCACTNONE 
J080053F04CCCACCTGTTGGGCCGGGCCCACTNONE 
J080054O16CCCACCTGTTGGGCCGGGCCCACTNONE 
J080058O21CCCACCTGTTGGGCCGGGCCCACTNONE 
J080059M11CCCACCTGTTGGGCCGGGCCCACTNONE 
J080061A11CCCACCTGTTGGGCCGGGCCCACTNONE 
J080063B15CCCACCTGTTGGGCCGGGCCCACTNONE 
J080063F22CCCACCTGTTGGGCCGGGCCCACTNONE 
J080066M18CCCACCTGTTGGGCCGGGCCCACTNONE 
J080068D12CCCACCTGTTGGGCCGGGCCCACTNONE 
J080070D22CCCACCTGTTGGGCCGGGCCCACTNONE 
J080071B06CCCACCTGTTGGGCCGGGCCCACTNONE 
J080072B17CCCACCTGTTGGGCCGGGCCCACTNONE 
J080081O04CCCACCTGTTGGGCCGGGCCCACTNONE 
J080089H05CCCACCTGTTGGGCCGGGCCCACTNONE 
J080093K13CCCACCTGTTGGGCCGGGCCCACTNONE 
J080095I05CCCACCTGTTGGGCCGGGCCCACTNONE 
J080097F19CCCACCTGTTGGGCCGGGCCCACTNONE 
J080304C03CCCACCTGTTGGGCCGGGCCCACTNONE 
J080304H11CCCACCTGTTGGGCCGGGCCCACTNONE 
J080308M21CCCACCTGTTGGGCCGGGCCCACTNONE 
J080313O15CCCACCTGTTGGGCCGGGCCCACTNONE 
J090020N23CCCACCTGTTGGGCCGGGCCCACTNONE 
J100023C12CCCACCTGTTGGGCCGGGCCCACTNONE 
Os06g0585200016-065-C02GCCGGGCCGGGCCGTGNONE 
AK068592GCCGGGCCGGGCCGTGNONE 
AK073844GCCGGGCCGGGCCGTGNONE 
AK106549GCCGGGCCGGGCCGTGConserved hypothetical protein. 
J013154A14GCCGGGCCGGGCCGTGNONE 
J100049K24GCCGGGCCGGGCCGTGNONE 
J100059C18GCCGGGCCGGGCCGTGNONE 
J100082N13GCCGGGCCGGGCCGTGNONE 
Os06g0642900AK073896GCCCACCCGGCCCACGCUbiquitin system component Cue domain containing protein. 
J033042P11GCCCACCCGGCCCACGCNONE 
J033072G12GCCCACCCGGCCCACGCNONE 
J090050C02GCCCACCCGGCCCACGCNONE 
Os06g0693000AK064280TCTGGGCCGGGCCGTGProtein kinase-like domain containing protein. 
Os06g0704300AK107008ATCTGGGCCGGGCCCZinc finger, CCCH-type domain containing protein. 
J065038I12ATCTGGGCCGGGCCCNONE 
J065079E03ATCTGGGCCGGGCCCNONE 
J075035B15ATCTGGGCCGGGCCCNONE 
J090072D21ATCTGGGCCGGGCCCNONE 
Os06g0717400AK072887GCCGGCCCGGCCCATTTPseudouridine synthase, Rlu family protein. 
Os06g0725400J065086O07AATGGGCCGGGCCGGTSimilar to BLE1 protein. 
J065114J19AATGGGCCGGGCCGGTNONE 
Os07g0110800009-107-B11GGCCCGGCCCATCANONE 
AK062792GGCCCGGCCCATCAConserved hypothetical protein. 
J053026P09GGCCCGGCCCATCANONE 
J053074L17GGCCCGGCCCATCANONE 
J065057E24GGCCCGGCCCATCANONE 
J065149B18GGCCCGGCCCATCANONE 
J075002O20GGCCCGGCCCATCANONE 
J090002C13GGCCCGGCCCATCANONE 
Os07g0110900AK058987TGATGGGCCGGGCCConserved hypothetical protein. 
J065032L02TGATGGGCCGGGCCNONE 
J065074H06TGATGGGCCGGGCCNONE 
J065168M23TGATGGGCCGGGCCNONE 
Os07g0112800AK058206CCCGGCCCATTTSimilar to Eukaryotic translation initiation factor 5A-4 (eIF-5A-4). 
J023052P13CCCGGCCCATTTNONE 
J033064G11CCCGGCCCATTTNONE 
J065044F12CCCGGCCCATTTNONE 
J065047I05CCCGGCCCATTTNONE 
J065059P17CCCGGCCCATTTNONE 
J065180P17CCCGGCCCATTTNONE 
J075131M22CCCGGCCCATTTNONE 
Os07g0113200AK108787GGCCCGGCCCATCAConserved hypothetical protein. 
J065090J04GGCCCGGCCCATCANONE 
J065116K24GGCCCGGCCCATCANONE 
J065161F14GGCCCGGCCCATCANONE 
J065203E23GGCCCGGCCCATCANONE 
Os07g0144200Os07g0144200GGCCCGGCCCGGCCCHypothetical protein. 
Os07g0158900AK064980GGCCCGGCCCATTTCyclin-like F-box domain containing protein. 
Os07g0160600011-014-G11CCCGGCCCCACCTGNONE 
015-033-C08CCCGGCCCCACCTGNONE 
AK065047CCCGGCCCCACCTGBeta-Ig-H3/fasciclin domain containing protein. 
AK098844CCCGGCCCCACCTGNONE 
J013000B24CCCGGCCCCACCTGNONE 
J013001I08CCCGGCCCCACCTGNONE 
J023150E13CCCGGCCCCACCTGNONE 
J033026K03CCCGGCCCCACCTGNONE 
J065093N10CCCGGCCCCACCTGNONE 
J075054B05CCCGGCCCCACCTGNONE 
J075131H23CCCGGCCCCACCTGNONE 
J090007M18CCCGGCCCCACCTGNONE 
J090029B19CCCGGCCCCACCTGNONE 
J100026A09CCCGGCCCCACCTGNONE 
Os07g0185700012-040-A11GCCCGGCCCATATNONE 
AK070572GCCCGGCCCATATConserved hypothetical protein. 
J065116D10GCCCGGCCCATATNONE 
J065122F20GCCCGGCCCATATNONE 
Os07g0213600AK107696GCCCGGCCCPlant lipid transfer/seed storage/trypsin-alpha amylase inhibitor domain containing protein. 
J100067F09GCCCGGCCCNONE 
J100082J05GCCCGGCCCNONE 
Os07g0224000009-060-E01GCCCGGCCCATTANONE 
J065042D20GCCCGGCCCATTANONE 
J065127D14GCCCGGCCCATTANONE 
J065176C24GCCCGGCCCATTANONE 
J065188M12GCCCGGCCCATTANONE 
J065194L14GCCCGGCCCATTANONE 
J075060P09GCCCGGCCCATTANONE 
J075134C14GCCCGGCCCATTARibosomal protein L24E family protein. 
J075192M12GCCCGGCCCATTANONE 
J100032N01GCCCGGCCCATTANONE 
Os07g0245100J023048C16CAAGTGGGGCCGGGNONE 
J023110L14CAAGTGGGGCCGGGNONE 
J053023B18CAAGTGGGGCCGGGNONE 
J053031L17CAAGTGGGGCCGGGNONE 
J065035I22CAAGTGGGGCCGGGNONE 
J065043D21CAAGTGGGGCCGGGNONE 
J065072L16CAAGTGGGGCCGGGNONE 
J065214I23CAAGTGGGGCCGGGNONE 
Os07g0256200AK072904GCCCGGCCCACAARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J023148I23GCCCGGCCCACAANONE 
Os07g0258400AK121534CTCGGCCCGGCCCACCTNONE 
L41217CTCGGCCCGGCCCACCTNONE 
S81897CTCGGCCCGGCCCACCTOsNramp1 (Integral membrane protein). 
Os07g0289800J080305A01GTGTGGGCCGGGConserved hypothetical protein. 
Os07g0294800AK065831CCCGGCCCConserved hypothetical protein. 
J013037A06CCCGGCCCNONE 
J065191M21CCCGGCCCNONE 
Os07g0301200AB110202GCTGGGCCGGGCCGNONE 
AK073463GCTGGGCCGGGCCGSimilar to RNA helicase (Fragment). 
Os07g0438800AK060412CCCGGCCCCACCTGTCAGNONE 
AK100065CCCGGCCCCACCTGTCAGSimilar to Phosphate starvation regulator protein (Regulatory protein of P- starvation acclimation response Psr1). 
AK103195CCCGGCCCCACCTGTCAGNONE 
AY224478CCCGGCCCCACCTGTCAGNONE 
J013160O05CCCGGCCCCACCTGTCAGNONE 
J023030C05CCCGGCCCCACCTGTCAGNONE 
J033025O04CCCGGCCCCACCTGTCAGNONE 
J033121P15CCCGGCCCCACCTGTCAGNONE 
J043034I23CCCGGCCCCACCTGTCAGNONE 
J065022N01CCCGGCCCCACCTGTCAGNONE 
J065022N02CCCGGCCCCACCTGTCAGNONE 
J065023M01CCCGGCCCCACCTGTCAGNONE 
J065101G13CCCGGCCCCACCTGTCAGNONE 
J075058P13CCCGGCCCCACCTGTCAGNONE 
J075186K10CCCGGCCCCACCTGTCAGNONE 
J075199F17CCCGGCCCCACCTGTCAGNONE 
Os07g0458800AK111873CCCGGCCCRibosomal protein S16 family protein. 
Os07g0462700009-033-D05GCCCGGCCCNONE 
AK073834GCCCGGCCCNONE 
AK104968GCCCGGCCCThioesterase superfamily domain containing protein. 
J065104G16GCCCGGCCCNONE 
J065197C14GCCCGGCCCNONE 
J065213E17GCCCGGCCCNONE 
J065215D11GCCCGGCCCNONE 
J075001J15GCCCGGCCCNONE 
J075026M11GCCCGGCCCNONE 
J075142G03GCCCGGCCCNONE 
J075178H04GCCCGGCCCNONE 
J100069P18GCCCGGCCCNONE 
Os07g0486500AK063998CCCGGCCCRho GTPase activation protein domain containing protein. 
AK068175CCCGGCCCNONE 
J013130L24CCCGGCCCNONE 
J013156J03CCCGGCCCNONE 
J033031L21CCCGGCCCNONE 
J043001A20CCCGGCCCNONE 
J043007B17CCCGGCCCNONE 
J043017M19CCCGGCCCNONE 
J043024H09CCCGGCCCNONE 
J043030B12CCCGGCCCNONE 
J065177C18CCCGGCCCNONE 
J075004K10CCCGGCCCNONE 
J075004K12CCCGGCCCNONE 
J075088G07CCCGGCCCNONE 
J075107M02CCCGGCCCNONE 
J075126G01CCCGGCCCNONE 
J075185J08CCCGGCCCNONE 
J100034E04CCCGGCCCNONE 
J100038G12CCCGGCCCNONE 
Os07g0512100Os07g0512100TTGTGGGCCCGGCCCGGCCCGGCCCAGTTAnkyrin repeat containing protein. 
Os07g0516200AK061373GGCCCGTTCAGGCCCGGCCCACGCSimilar to Endoribonuclease, L-PSP family. 
Os07g0539900AK071889GCCCGGCCCAGTTSimilar to Beta-1,3-glucanase-like protein. 
AK098943GCCCGGCCCAGTTNONE 
J013047P11GCCCGGCCCAGTTNONE 
Os07g0546000AF188065GGCCCGGCCCGGCCGGCCCACCNONE 
AK061800GGCCCGGCCCGGCCGGCCCACCNONE 
AK065871GGCCCGGCCCGGCCGGCCCACCSimilar to Isopentenyl pyrophosphate:dimethyllallyl pyrophosphate isomerase (EC 5.3.3.2) (Fragment). 
J013024C02GGCCCGGCCCGGCCGGCCCACCNONE 
J013035F03GGCCCGGCCCGGCCGGCCCACCNONE 
J013044J20GGCCCGGCCCGGCCGGCCCACCNONE 
Os07g0555400AK070977GCTGGGCCGGGCCGCCCATTTConserved hypothetical protein. 
Os07g0562700003-111-G08GCCCGGCCCAAAANONE 
004-013-E07GCCCGGCCCAAAANONE 
006-021-D03GCCCGGCCCAAAANONE 
006-021-D07GCCCGGCCCAAAANONE 
006-021-F09GCCCGGCCCAAAANONE 
006-023-D01GCCCGGCCCAAAANONE 
006-024-F04GCCCGGCCCAAAANONE 
006-024-G09GCCCGGCCCAAAANONE 
006-024-G11GCCCGGCCCAAAANONE 
006-025-A10GCCCGGCCCAAAANONE 
006-025-B08GCCCGGCCCAAAANONE 
006-025-E10GCCCGGCCCAAAANONE 
006-025-F10GCCCGGCCCAAAANONE 
006-026-B04GCCCGGCCCAAAANONE 
006-026-C08GCCCGGCCCAAAANONE 
006-026-D03GCCCGGCCCAAAANONE 
006-026-F03GCCCGGCCCAAAANONE 
006-026-F08GCCCGGCCCAAAANONE 
006-026-F12GCCCGGCCCAAAANONE 
006-027-A10GCCCGGCCCAAAANONE 
006-027-C03GCCCGGCCCAAAANONE 
006-028-C03GCCCGGCCCAAAANONE 
006-029-E02GCCCGGCCCAAAANONE 
006-029-G05GCCCGGCCCAAAANONE 
006-030-A10GCCCGGCCCAAAANONE 
006-030-C06GCCCGGCCCAAAANONE 
006-030-D03GCCCGGCCCAAAANONE 
006-030-D06GCCCGGCCCAAAANONE 
006-030-G05GCCCGGCCCAAAANONE 
006-031-B10GCCCGGCCCAAAANONE 
006-031-D04GCCCGGCCCAAAANONE 
006-031-D11GCCCGGCCCAAAANONE 
006-031-H09GCCCGGCCCAAAANONE 
006-032-C09GCCCGGCCCAAAANONE 
006-032-H09GCCCGGCCCAAAANONE 
006-033-B02GCCCGGCCCAAAANONE 
006-033-B09GCCCGGCCCAAAANONE 
006-033-E01GCCCGGCCCAAAANONE 
006-033-F06GCCCGGCCCAAAANONE 
006-033-G03GCCCGGCCCAAAANONE 
006-034-A08GCCCGGCCCAAAANONE 
006-034-C09GCCCGGCCCAAAANONE 
006-034-F06GCCCGGCCCAAAANONE 
006-035-B12GCCCGGCCCAAAANONE 
006-035-C12GCCCGGCCCAAAANONE 
006-035-H04GCCCGGCCCAAAANONE 
006-035-H12GCCCGGCCCAAAANONE 
006-036-A05GCCCGGCCCAAAANONE 
006-036-A09GCCCGGCCCAAAANONE 
006-036-B10GCCCGGCCCAAAANONE 
006-036-C03GCCCGGCCCAAAANONE 
006-036-E06GCCCGGCCCAAAANONE 
006-037-H11GCCCGGCCCAAAANONE 
006-038-G01GCCCGGCCCAAAANONE 
006-039-B01GCCCGGCCCAAAANONE 
006-039-B12GCCCGGCCCAAAANONE 
006-039-C02GCCCGGCCCAAAANONE 
006-039-E06GCCCGGCCCAAAANONE 
006-039-G12GCCCGGCCCAAAANONE 
006-040-G07GCCCGGCCCAAAANONE 
006-041-H04GCCCGGCCCAAAANONE 
006-042-A11GCCCGGCCCAAAANONE 
006-042-E07GCCCGGCCCAAAANONE 
006-042-F12GCCCGGCCCAAAANONE 
006-043-C01GCCCGGCCCAAAANONE 
006-045-H12GCCCGGCCCAAAANONE 
006-046-A12GCCCGGCCCAAAANONE 
006-046-F03GCCCGGCCCAAAANONE 
006-047-A07GCCCGGCCCAAAANONE 
006-047-A09GCCCGGCCCAAAANONE 
006-047-E10GCCCGGCCCAAAANONE 
006-047-G12GCCCGGCCCAAAANONE 
006-048-B04GCCCGGCCCAAAANONE 
006-049-D01GCCCGGCCCAAAANONE 
006-049-G02GCCCGGCCCAAAANONE 
006-049-G10GCCCGGCCCAAAANONE 
006-049-H04GCCCGGCCCAAAANONE 
006-050-D05GCCCGGCCCAAAANONE 
006-050-F05GCCCGGCCCAAAANONE 
006-051-B05GCCCGGCCCAAAANONE 
006-051-G12GCCCGGCCCAAAANONE 
006-052-D12GCCCGGCCCAAAANONE 
006-053-D06GCCCGGCCCAAAANONE 
006-054-H02GCCCGGCCCAAAANONE 
006-055-A03GCCCGGCCCAAAANONE 
006-055-C01GCCCGGCCCAAAANONE 
006-055-E07GCCCGGCCCAAAANONE 
006-055-H06GCCCGGCCCAAAANONE 
006-056-F06GCCCGGCCCAAAANONE 
006-057-D03GCCCGGCCCAAAANONE 
006-057-D05GCCCGGCCCAAAANONE 
006-057-G01GCCCGGCCCAAAANONE 
006-058-A03GCCCGGCCCAAAANONE 
006-058-B06GCCCGGCCCAAAANONE 
006-059-A09GCCCGGCCCAAAANONE 
006-059-H11GCCCGGCCCAAAANONE 
006-060-A04GCCCGGCCCAAAANONE 
006-060-A09GCCCGGCCCAAAANONE 
006-060-C11GCCCGGCCCAAAANONE 
006-060-D08GCCCGGCCCAAAANONE 
006-061-A04GCCCGGCCCAAAANONE 
006-061-E01GCCCGGCCCAAAANONE 
006-061-G10GCCCGGCCCAAAANONE 
006-061-H12GCCCGGCCCAAAANONE 
006-062-B07GCCCGGCCCAAAANONE 
006-062-G03GCCCGGCCCAAAANONE 
006-062-H12GCCCGGCCCAAAANONE 
006-063-D05GCCCGGCCCAAAANONE 
006-063-E04GCCCGGCCCAAAANONE 
006-063-F05GCCCGGCCCAAAANONE 
006-063-G05GCCCGGCCCAAAANONE 
006-064-B07GCCCGGCCCAAAANONE 
006-065-C11GCCCGGCCCAAAANONE 
006-065-H02GCCCGGCCCAAAANONE 
006-067-C12GCCCGGCCCAAAANONE 
006-067-F10GCCCGGCCCAAAANONE 
006-068-E02GCCCGGCCCAAAANONE 
006-068-G04GCCCGGCCCAAAANONE 
006-069-A02GCCCGGCCCAAAANONE 
006-071-A07GCCCGGCCCAAAANONE 
006-072-F11GCCCGGCCCAAAANONE 
006-072-F12GCCCGGCCCAAAANONE 
006-073-E12GCCCGGCCCAAAANONE 
006-073-F08GCCCGGCCCAAAANONE 
006-073-H07GCCCGGCCCAAAANONE 
006-074-A07GCCCGGCCCAAAANONE 
006-075-A12GCCCGGCCCAAAANONE 
006-075-B01GCCCGGCCCAAAANONE 
006-075-H10GCCCGGCCCAAAANONE 
006-075-H12GCCCGGCCCAAAANONE 
006-076-B06GCCCGGCCCAAAANONE 
006-077-A09GCCCGGCCCAAAANONE 
006-077-D05GCCCGGCCCAAAANONE 
006-078-C11GCCCGGCCCAAAANONE 
006-078-D12GCCCGGCCCAAAANONE 
006-078-E02GCCCGGCCCAAAANONE 
006-079-A01GCCCGGCCCAAAANONE 
006-079-E02GCCCGGCCCAAAANONE 
006-079-F03GCCCGGCCCAAAANONE 
006-080-G11GCCCGGCCCAAAANONE 
006-081-C02GCCCGGCCCAAAANONE 
006-081-C08GCCCGGCCCAAAANONE 
006-082-B06GCCCGGCCCAAAANONE 
006-082-C11GCCCGGCCCAAAANONE 
006-082-H04GCCCGGCCCAAAANONE 
006-083-E04GCCCGGCCCAAAANONE 
006-083-H12GCCCGGCCCAAAANONE 
006-084-C08GCCCGGCCCAAAANONE 
006-084-E07GCCCGGCCCAAAANONE 
006-084-E10GCCCGGCCCAAAANONE 
006-085-E06GCCCGGCCCAAAANONE 
006-085-E10GCCCGGCCCAAAANONE 
006-086-F06GCCCGGCCCAAAANONE 
006-087-D08GCCCGGCCCAAAANONE 
006-087-F03GCCCGGCCCAAAANONE 
006-087-F10GCCCGGCCCAAAANONE 
006-087-G07GCCCGGCCCAAAANONE 
006-088-A02GCCCGGCCCAAAANONE 
006-089-A04GCCCGGCCCAAAANONE 
006-089-B12GCCCGGCCCAAAANONE 
006-089-D06GCCCGGCCCAAAANONE 
006-089-D10GCCCGGCCCAAAANONE 
006-089-H05GCCCGGCCCAAAANONE 
006-090-C06GCCCGGCCCAAAANONE 
006-091-A03GCCCGGCCCAAAANONE 
006-091-E04GCCCGGCCCAAAANONE 
006-091-H12GCCCGGCCCAAAANONE 
006-092-A08GCCCGGCCCAAAANONE 
006-092-F01GCCCGGCCCAAAANONE 
006-092-G08GCCCGGCCCAAAANONE 
006-093-B12GCCCGGCCCAAAANONE 
006-093-D04GCCCGGCCCAAAANONE 
006-093-F01GCCCGGCCCAAAANONE 
006-094-A08GCCCGGCCCAAAANONE 
006-094-F01GCCCGGCCCAAAANONE 
006-094-F03GCCCGGCCCAAAANONE 
006-095-C12GCCCGGCCCAAAANONE 
006-095-E10GCCCGGCCCAAAANONE 
006-095-E12GCCCGGCCCAAAANONE 
006-095-G06GCCCGGCCCAAAANONE 
006-096-B12GCCCGGCCCAAAANONE 
006-096-C12GCCCGGCCCAAAANONE 
006-096-G02GCCCGGCCCAAAANONE 
006-097-D01GCCCGGCCCAAAANONE 
006-097-D07GCCCGGCCCAAAANONE 
006-097-F04GCCCGGCCCAAAANONE 
006-098-C07GCCCGGCCCAAAANONE 
006-098-D04GCCCGGCCCAAAANONE 
006-099-E06GCCCGGCCCAAAANONE 
006-099-F02GCCCGGCCCAAAANONE 
006-099-F10GCCCGGCCCAAAANONE 
006-100-A07GCCCGGCCCAAAANONE 
006-100-B10GCCCGGCCCAAAANONE 
006-100-G01GCCCGGCCCAAAANONE 
006-100-H06GCCCGGCCCAAAANONE 
006-101-D01GCCCGGCCCAAAANONE 
006-101-F03GCCCGGCCCAAAANONE 
006-102-A12GCCCGGCCCAAAANONE 
006-102-B11GCCCGGCCCAAAANONE 
006-102-C03GCCCGGCCCAAAANONE 
006-102-F11GCCCGGCCCAAAANONE 
006-103-A08GCCCGGCCCAAAANONE 
006-103-B06GCCCGGCCCAAAANONE 
006-103-D01GCCCGGCCCAAAANONE 
006-103-F02GCCCGGCCCAAAANONE 
006-104-B02GCCCGGCCCAAAANONE 
006-104-C01GCCCGGCCCAAAANONE 
006-104-F09GCCCGGCCCAAAANONE 
006-104-H11GCCCGGCCCAAAANONE 
006-105-A03GCCCGGCCCAAAANONE 
006-105-D09GCCCGGCCCAAAANONE 
006-106-B10GCCCGGCCCAAAANONE 
006-107-A06GCCCGGCCCAAAANONE 
006-107-C04GCCCGGCCCAAAANONE 
006-107-E03GCCCGGCCCAAAANONE 
006-107-F05GCCCGGCCCAAAANONE 
006-108-C09GCCCGGCCCAAAANONE 
006-109-C09GCCCGGCCCAAAANONE 
006-109-D10GCCCGGCCCAAAANONE 
006-109-E06GCCCGGCCCAAAANONE 
006-109-E10GCCCGGCCCAAAANONE 
006-110-A06GCCCGGCCCAAAANONE 
006-110-C11GCCCGGCCCAAAANONE 
006-111-A02GCCCGGCCCAAAANONE 
006-111-F02GCCCGGCCCAAAANONE 
006-112-A08GCCCGGCCCAAAANONE 
006-112-H06GCCCGGCCCAAAANONE 
006-113-A08GCCCGGCCCAAAANONE 
006-113-B01GCCCGGCCCAAAANONE 
006-113-C05GCCCGGCCCAAAANONE 
006-113-D01GCCCGGCCCAAAANONE 
006-113-D04GCCCGGCCCAAAANONE 
006-113-D06GCCCGGCCCAAAANONE 
006-113-E09GCCCGGCCCAAAANONE 
006-114-F06GCCCGGCCCAAAANONE 
006-116-B02GCCCGGCCCAAAANONE 
006-117-B07GCCCGGCCCAAAANONE 
006-117-G04GCCCGGCCCAAAANONE 
006-118-D01GCCCGGCCCAAAANONE 
006-118-D12GCCCGGCCCAAAANONE 
006-118-F12GCCCGGCCCAAAANONE 
006-118-G12GCCCGGCCCAAAANONE 
006-119-B08GCCCGGCCCAAAANONE 
006-120-E09GCCCGGCCCAAAANONE 
006-120-G05GCCCGGCCCAAAANONE 
006-120-G10GCCCGGCCCAAAANONE 
009-022-D12GCCCGGCCCAAAANONE 
009-051-H08GCCCGGCCCAAAANONE 
009-065-F05GCCCGGCCCAAAANONE 
009-070-A06GCCCGGCCCAAAANONE 
009-073-B07GCCCGGCCCAAAANONE 
009-092-C10GCCCGGCCCAAAANONE 
009-093-D03GCCCGGCCCAAAANONE 
009-103-B04GCCCGGCCCAAAANONE 
009-106-H08GCCCGGCCCAAAANONE 
009-120-B05GCCCGGCCCAAAANONE 
009-121-F05GCCCGGCCCAAAANONE 
009-122-B04GCCCGGCCCAAAANONE 
009-122-D08GCCCGGCCCAAAANONE 
009-123-F07GCCCGGCCCAAAANONE 
009-125-G02GCCCGGCCCAAAANONE 
009-128-F02GCCCGGCCCAAAANONE 
009-128-H07GCCCGGCCCAAAANONE 
009-131-C06GCCCGGCCCAAAANONE 
009-132-F08GCCCGGCCCAAAANONE 
009-133-G08GCCCGGCCCAAAANONE 
009-134-D09GCCCGGCCCAAAANONE 
009-135-F01GCCCGGCCCAAAANONE 
009-149-E11GCCCGGCCCAAAANONE 
009-153-H04GCCCGGCCCAAAANONE 
009-161-E04GCCCGGCCCAAAANONE 
009-163-A09GCCCGGCCCAAAANONE 
009-163-C05GCCCGGCCCAAAANONE 
009-163-E10GCCCGGCCCAAAANONE 
009-165-F04GCCCGGCCCAAAANONE 
009-166-A07GCCCGGCCCAAAANONE 
009-169-G12GCCCGGCCCAAAANONE 
009-172-G08GCCCGGCCCAAAANONE 
009-179-E06GCCCGGCCCAAAANONE 
009-181-F09GCCCGGCCCAAAANONE 
009-190-G07GCCCGGCCCAAAANONE 
009-191-D01GCCCGGCCCAAAANONE 
009-195-G02GCCCGGCCCAAAANONE 
AF022738GCCCGGCCCAAAANONE 
AK061512GCCCGGCCCAAAANONE 
AK068972GCCCGGCCCAAAANONE 
AK103926GCCCGGCCCAAAANONE 
AK103999GCCCGGCCCAAAANONE 
AK104224GCCCGGCCCAAAANONE 
AK104465GCCCGGCCCAAAANONE 
AK104495GCCCGGCCCAAAANONE 
AK109399GCCCGGCCCAAAASimilar to Type III chlorophyll a/b-binding protein (Fragment). 
AK119533GCCCGGCCCAAAANONE 
AK119545GCCCGGCCCAAAANONE 
J013043L10GCCCGGCCCAAAANONE 
J013050A09GCCCGGCCCAAAANONE 
J023001G03GCCCGGCCCAAAANONE 
J023024D14GCCCGGCCCAAAANONE 
J023072E11GCCCGGCCCAAAANONE 
J023149E18GCCCGGCCCAAAANONE 
J033029B16GCCCGGCCCAAAANONE 
J065001O21GCCCGGCCCAAAANONE 
J065035B04GCCCGGCCCAAAANONE 
J065044D18GCCCGGCCCAAAANONE 
J065057F12GCCCGGCCCAAAANONE 
J065060A11GCCCGGCCCAAAANONE 
J065062G15GCCCGGCCCAAAANONE 
J065080F13GCCCGGCCCAAAANONE 
J065084N12GCCCGGCCCAAAANONE 
J065101D02GCCCGGCCCAAAANONE 
J065107C07GCCCGGCCCAAAANONE 
J065112N24GCCCGGCCCAAAANONE 
J065141I16GCCCGGCCCAAAANONE 
J065147D05GCCCGGCCCAAAANONE 
J065167H02GCCCGGCCCAAAANONE 
J065207K23GCCCGGCCCAAAANONE 
J075008E16GCCCGGCCCAAAANONE 
J075014F03GCCCGGCCCAAAANONE 
J075015O17GCCCGGCCCAAAANONE 
J075020H20GCCCGGCCCAAAANONE 
J075021E22GCCCGGCCCAAAANONE 
J075023N13GCCCGGCCCAAAANONE 
J075028H10GCCCGGCCCAAAANONE 
J075040F20GCCCGGCCCAAAANONE 
J075051L23GCCCGGCCCAAAANONE 
J075069G16GCCCGGCCCAAAANONE 
J075084F24GCCCGGCCCAAAANONE 
J075090H09GCCCGGCCCAAAANONE 
J075092M21GCCCGGCCCAAAANONE 
J075110C10GCCCGGCCCAAAANONE 
J075111J12GCCCGGCCCAAAANONE 
J075114L04GCCCGGCCCAAAANONE 
J075139E02GCCCGGCCCAAAANONE 
J075160M10GCCCGGCCCAAAANONE 
J075176J03GCCCGGCCCAAAANONE 
J075183I17GCCCGGCCCAAAANONE 
J075191N10GCCCGGCCCAAAANONE 
J075193D07GCCCGGCCCAAAANONE 
J075194M16GCCCGGCCCAAAANONE 
J075197K04GCCCGGCCCAAAANONE 
J080032I11GCCCGGCCCAAAANONE 
J080076M11GCCCGGCCCAAAANONE 
J080311J08GCCCGGCCCAAAANONE 
J080317E05GCCCGGCCCAAAANONE 
J090034L08GCCCGGCCCAAAANONE 
J100040D19GCCCGGCCCAAAANONE 
J100074C11GCCCGGCCCAAAANONE 
Os07g0573600AK073925GTTTGGGCCGGGCCGAAAREX1 DNA Repair family protein. 
J033072E11GTTTGGGCCGGGCCGAAANONE 
Os07g0578600AK067155TTCGGCCCGGCCCACTCCSimilar to 5-formyltetrahydrofolate cycloligase (EC 6.3.3.2). 
AK106065TTCGGCCCGGCCCACTCCNONE 
Os07g0585800006-106-A05TCTGGGCCGCAAGGCCCGGCCCATAANONE 
AK066419TCTGGGCCGCAAGGCCCGGCCCATAANONE 
AK105064TCTGGGCCGCAAGGCCCGGCCCATAASimilar to NADH-ubiquinone oxidoreductase 18 kDa subunit (EC 1.6.5.3) (EC 1.6.99.3) (Complex I-18KD) (CI-18KD) (Fragment). 
J065065N01TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J065085B08TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J065099I23TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J065169A01TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J065187N13TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J065191L18TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J065194D04TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J065211M09TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J065212I02TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J090003C10TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J090025O11TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J090092F10TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J100055A04TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J100064A01TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J100080L02TCTGGGCCGCAAGGCCCGGCCCATAANONE 
Os07g0606600AK111621CCCGGCCCACACNONE 
AK112118CCCGGCCCACACSimilar to Nuclear factor Y transcription factor subunit B homolog. 
J080301F22CCCGGCCCACACNONE 
Os07g0608400AK109447CGATGGGCCGGGGCCCACCASimilar to nucleic acid binding protein [Oryza sativa (japonica cultivar-group)]. 
Os07g0616900AK071047CCCGGCCCProtein of unknown function DUF500 family protein. 
J013106G03CCCGGCCCNONE 
J013124C20CCCGGCCCNONE 
J033096D16CCCGGCCCNONE 
J043005E08CCCGGCCCNONE 
J065197K12CCCGGCCCNONE 
J065211I03CCCGGCCCNONE 
Os07g0618800009-116-H12TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
AK074019TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCSimilar to Centrin (Caltractin). 
J033074L14TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J065187P13TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080002E06TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080010A10TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080012N16TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080014F21TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080016E05TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080018L10TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080021F24TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080022M11TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080023F12TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080023H02TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080024A13TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080025F03TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080025F04TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080028H05TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080030B18TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080031E07TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080033H12TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080038J06TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080039M20TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080042E01TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080042G10TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080044H14TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080046F19TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080047A01TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080049O03TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080050H10TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080052P06TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080052P09TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080056I06TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080061A12TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080061I04TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080063K06TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080069I24TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080072D24TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080076D19TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080076F15TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080076I22TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080076J11TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080077C19TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080080A22TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080081E12TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080081I23TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080084H01TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080085A04TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080085N21TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080086A14TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080086G22TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080096H06TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080097G06TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J090002O14TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J100072G23TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J100077M11TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
Os07g0639900J080305F09CAGGTGGGCCGGGCCCATAANONE 
J080305F09TCGTGGGCCGGGCCGGGCCGGGCCGAANONE 
J080305J22CAGGTGGGCCGGGCCCATAAThymidylate kinase domain containing protein. 
J080305J22TCGTGGGCCGGGCCGGGCCGGGCCGAAThymidylate kinase domain containing protein. 
J080311G07CAGGTGGGCCGGGCCCATAANONE 
J080311G07TCGTGGGCCGGGCCGGGCCGGGCCGAANONE 
J080315B14CAGGTGGGCCGGGCCCATAANONE 
J080315B14TCGTGGGCCGGGCCGGGCCGGGCCGAANONE 
J080317C02CAGGTGGGCCGGGCCCATAANONE 
J080317C02TCGTGGGCCGGGCCGGGCCGGGCCGAANONE 
Os07g0661400006-083-E05CCCGGCCCCACACGNONE 
006-083-E05CCCGGCCCCACCACCCCACCCGNONE 
006-084-B12CCCGGCCCCACACGNONE 
006-084-B12CCCGGCCCCACCACCCCACCCGNONE 
006-096-B03CCCGGCCCCACACGNONE 
006-096-B03CCCGGCCCCACCACCCCACCCGNONE 
009-013-C12CCCGGCCCCACACGNONE 
009-013-C12CCCGGCCCCACCACCCCACCCGNONE 
009-017-C10CCCGGCCCCACACGNONE 
009-017-C10CCCGGCCCCACCACCCCACCCGNONE 
009-027-A02CCCGGCCCCACACGNONE 
009-027-A02CCCGGCCCCACCACCCCACCCGNONE 
009-035-A06CCCGGCCCCACACGNONE 
009-035-A06CCCGGCCCCACCACCCCACCCGNONE 
009-047-H11CCCGGCCCCACACGNONE 
009-047-H11CCCGGCCCCACCACCCCACCCGNONE 
009-050-B11CCCGGCCCCACACGNONE 
009-050-B11CCCGGCCCCACCACCCCACCCGNONE 
009-051-C02CCCGGCCCCACACGNONE 
009-051-C02CCCGGCCCCACCACCCCACCCGNONE 
009-089-G06CCCGGCCCCACACGNONE 
009-089-G06CCCGGCCCCACCACCCCACCCGNONE 
009-091-C05CCCGGCCCCACACGNONE 
009-091-C05CCCGGCCCCACCACCCCACCCGNONE 
009-095-B11CCCGGCCCCACACGNONE 
009-095-B11CCCGGCCCCACCACCCCACCCGNONE 
009-151-C01CCCGGCCCCACACGNONE 
009-151-C01CCCGGCCCCACCACCCCACCCGNONE 
009-154-F06CCCGGCCCCACACGNONE 
009-154-F06CCCGGCCCCACCACCCCACCCGNONE 
009-169-F02CCCGGCCCCACACGNONE 
009-169-F02CCCGGCCCCACCACCCCACCCGNONE 
009-171-G01CCCGGCCCCACACGNONE 
009-171-G01CCCGGCCCCACCACCCCACCCGNONE 
009-179-F07CCCGGCCCCACACGNONE 
009-179-F07CCCGGCCCCACCACCCCACCCGNONE 
013-018-H06CCCGGCCCCACACGNONE 
013-018-H06CCCGGCCCCACCACCCCACCCGNONE 
013-024-E05CCCGGCCCCACACGNONE 
013-024-E05CCCGGCCCCACCACCCCACCCGNONE 
013-038-F09CCCGGCCCCACACGNONE 
013-038-F09CCCGGCCCCACCACCCCACCCGNONE 
013-099-F06CCCGGCCCCACACGNONE 
013-099-F06CCCGGCCCCACCACCCCACCCGNONE 
014-042-E09CCCGGCCCCACACGNONE 
014-042-E09CCCGGCCCCACCACCCCACCCGNONE 
014-086-C02CCCGGCCCCACACGNONE 
014-086-C02CCCGGCCCCACCACCCCACCCGNONE 
014-093-B08CCCGGCCCCACACGNONE 
014-093-B08CCCGGCCCCACCACCCCACCCGNONE 
015-039-G11CCCGGCCCCACACGNONE 
015-039-G11CCCGGCCCCACCACCCCACCCGNONE 
016-036-E05CCCGGCCCCACACGNONE 
016-036-E05CCCGGCCCCACCACCCCACCCGNONE 
AK068814CCCGGCCCCACACGNONE 
AK068814CCCGGCCCCACCACCCCACCCGNONE 
AK102682CCCGGCCCCACACGNONE 
AK102682CCCGGCCCCACCACCCCACCCGNONE 
AK105973CCCGGCCCCACACGNONE 
AK105973CCCGGCCCCACCACCCCACCCGNONE 
AK107202CCCGGCCCCACACGConserved hypothetical protein. 
AK107202CCCGGCCCCACCACCCCACCCGConserved hypothetical protein. 
J053035N21CCCGGCCCCACACGNONE 
J053035N21CCCGGCCCCACCACCCCACCCGNONE 
J053099D11CCCGGCCCCACACGNONE 
J053099D11CCCGGCCCCACCACCCCACCCGNONE 
J065023B18CCCGGCCCCACACGNONE 
J065023B18CCCGGCCCCACCACCCCACCCGNONE 
J065031M15CCCGGCCCCACACGNONE 
J065031M15CCCGGCCCCACCACCCCACCCGNONE 
J065035G23CCCGGCCCCACACGNONE 
J065035G23CCCGGCCCCACCACCCCACCCGNONE 
J065060M18CCCGGCCCCACACGNONE 
J065060M18CCCGGCCCCACCACCCCACCCGNONE 
J065073J18CCCGGCCCCACACGNONE 
J065073J18CCCGGCCCCACCACCCCACCCGNONE 
J065103E20CCCGGCCCCACACGNONE 
J065103E20CCCGGCCCCACCACCCCACCCGNONE 
J065105N19CCCGGCCCCACACGNONE 
J065105N19CCCGGCCCCACCACCCCACCCGNONE 
J065137A08CCCGGCCCCACACGNONE 
J065137A08CCCGGCCCCACCACCCCACCCGNONE 
J065152K09CCCGGCCCCACACGNONE 
J065152K09CCCGGCCCCACCACCCCACCCGNONE 
J065156M12CCCGGCCCCACACGNONE 
J065156M12CCCGGCCCCACCACCCCACCCGNONE 
J065162G23CCCGGCCCCACACGNONE 
J065162G23CCCGGCCCCACCACCCCACCCGNONE 
J065162L13CCCGGCCCCACACGNONE 
J065162L13CCCGGCCCCACCACCCCACCCGNONE 
J065163H16CCCGGCCCCACACGNONE 
J065163H16CCCGGCCCCACCACCCCACCCGNONE 
J065165E06CCCGGCCCCACACGNONE 
J065165E06CCCGGCCCCACCACCCCACCCGNONE 
J065171J04CCCGGCCCCACACGNONE 
J065171J04CCCGGCCCCACCACCCCACCCGNONE 
J065180L23CCCGGCCCCACACGNONE 
J065180L23CCCGGCCCCACCACCCCACCCGNONE 
J065183K23CCCGGCCCCACACGNONE 
J065183K23CCCGGCCCCACCACCCCACCCGNONE 
J065186H13CCCGGCCCCACACGNONE 
J065186H13CCCGGCCCCACCACCCCACCCGNONE 
J065195D10CCCGGCCCCACACGNONE 
J065195D10CCCGGCCCCACCACCCCACCCGNONE 
J065209G11CCCGGCCCCACACGNONE 
J065209G11CCCGGCCCCACCACCCCACCCGNONE 
J075006J08CCCGGCCCCACACGNONE 
J075006J08CCCGGCCCCACCACCCCACCCGNONE 
J075112O07CCCGGCCCCACACGNONE 
J075112O07CCCGGCCCCACCACCCCACCCGNONE 
J080301H14CCCGGCCCCACACGNONE 
J080301H14CCCGGCCCCACCACCCCACCCGNONE 
J100058C17CCCGGCCCCACACGNONE 
J100058C17CCCGGCCCCACCACCCCACCCGNONE 
J100077I23CCCGGCCCCACACGNONE 
J100077I23CCCGGCCCCACCACCCCACCCGNONE 
J100080I24CCCGGCCCCACACGNONE 
J100080I24CCCGGCCCCACCACCCCACCCGNONE 
Os07g0675250013-097-G10TCTGGCCCCGGCCCNONE 
AK063620TCTGGCCCCGGCCCConserved hypothetical protein. 
J075026H18TCTGGCCCCGGCCCNONE 
J075192A02TCTGGCCCCGGCCCNONE 
Os07g0682400014-055-G10CCCGGCCCNONE 
AK111514CCCGGCCCNONE 
AK111556CCCGGCCCNONE 
AK119893CCCGGCCCZinc finger, CCCH-type domain containing protein. 
Os08g0139100006-027-E12GGCCCGGCCCGGCCCGGCCCACTNONE 
006-089-E06GGCCCGGCCCGGCCCGGCCCACTNONE 
006-113-G02GGCCCGGCCCGGCCCGGCCCACTNONE 
AK061429GGCCCGGCCCGGCCCGGCCCACTNONE 
AK099590GGCCCGGCCCGGCCCGGCCCACTSimilar to DAG protein, chloroplast precursor. 
AK104727GGCCCGGCCCGGCCCGGCCCACTNONE 
J013043H11GGCCCGGCCCGGCCCGGCCCACTNONE 
J013049N13GGCCCGGCCCGGCCCGGCCCACTNONE 
J065079F01GGCCCGGCCCGGCCCGGCCCACTNONE 
J065122N24GGCCCGGCCCGGCCCGGCCCACTNONE 
J065142J24GGCCCGGCCCGGCCCGGCCCACTNONE 
J065193N03GGCCCGGCCCGGCCCGGCCCACTNONE 
J075041I21GGCCCGGCCCGGCCCGGCCCACTNONE 
J075145E04GGCCCGGCCCGGCCCGGCCCACTNONE 
Os08g0161700009-088-D09AAATGGGCCTTATTGGGCCGGGCCNONE 
009-131-H02AAATGGGCCTTATTGGGCCGGGCCNONE 
009-182-D04AAATGGGCCTTATTGGGCCGGGCCNONE 
AK059272AAATGGGCCTTATTGGGCCGGGCCConserved hypothetical protein. 
J075002M21AAATGGGCCTTATTGGGCCGGGCCNONE 
J075090H12AAATGGGCCTTATTGGGCCGGGCCNONE 
J075129C21AAATGGGCCTTATTGGGCCGGGCCNONE 
J075146N03AAATGGGCCTTATTGGGCCGGGCCNONE 
J075178P18AAATGGGCCTTATTGGGCCGGGCCNONE 
J075190M03AAATGGGCCTTATTGGGCCGGGCCNONE 
J090030G01AAATGGGCCTTATTGGGCCGGGCCNONE 
J100088M23AAATGGGCCTTATTGGGCCGGGCCNONE 
Os08g0167500006-063-D04TCATGGGCCGGGCCGGGNONE 
006-066-G09TCATGGGCCGGGCCGGGNONE 
AK061061TCATGGGCCGGGCCGGGConserved hypothetical protein. 
AK071197TCATGGGCCGGGCCGGGNONE 
J023082N10TCATGGGCCGGGCCGGGNONE 
Os08g0172800AK111113AACGGGCCGGGConserved hypothetical protein. 
Os08g0203800J065195H23GGCCCGGCCCNONE 
J075146H03GGCCCGGCCCNONE 
Os08g0230000014-096-F01CCGTGGGCCGGGCCGTCGGGCCGTANONE 
AK067127CCGTGGGCCGGGCCGTCGGGCCGTAConserved hypothetical protein. 
J013096C05CCGTGGGCCGGGCCGTCGGGCCGTANONE 
J100032D12CCGTGGGCCGGGCCGTCGGGCCGTANONE 
Os08g0328300AK102227GGCCCGGCCCATTTNONE 
AK105392GGCCCGGCCCATTTENT domain containing protein. 
Os08g0406500016-001-C06GCCCGGCCCNONE 
AK064160GCCCGGCCCTRAF-like domain containing protein. 
Os08g0431500009-186-D05ATTTGGGCCGGGCNONE 
009-186-D05GGCCCGGCCCATTTNONE 
AK058993ATTTGGGCCGGGCNONE 
AK058993GGCCCGGCCCATTTNONE 
AK100797ATTTGGGCCGGGCConserved hypothetical protein. 
AK100797GGCCCGGCCCATTTConserved hypothetical protein. 
J023121F15ATTTGGGCCGGGCNONE 
J023121F15GGCCCGGCCCATTTNONE 
Os08g0433200013-023-E07TACGGCCCGGCCCAAANONE 
AK099471TACGGCCCGGCCCAAAConserved hypothetical protein. 
J013024A05TACGGCCCGGCCCAAANONE 
J013065N03TACGGCCCGGCCCAAANONE 
J023111A21TACGGCCCGGCCCAAANONE 
J065035F10TACGGCCCGGCCCAAANONE 
J065083H01TACGGCCCGGCCCAAANONE 
J065159E03TACGGCCCGGCCCAAANONE 
J065186A03TACGGCCCGGCCCAAANONE 
J075032B02TACGGCCCGGCCCAAANONE 
J075038L14TACGGCCCGGCCCAAANONE 
J075047N21TACGGCCCGGCCCAAANONE 
J075076H05TACGGCCCGGCCCAAANONE 
J075110C08TACGGCCCGGCCCAAANONE 
J090096K17TACGGCCCGGCCCAAANONE 
Os08g0447200AK067377GCCCGGCCCATCTGGCCCSGT1 family protein. 
J013106M17GCCCGGCCCATCTGGCCCNONE 
J033133D18GCCCGGCCCATCTGGCCCNONE 
J033140B09GCCCGGCCCATCTGGCCCNONE 
J100028I17GCCCGGCCCATCTGGCCCNONE 
J100086C22GCCCGGCCCATCTGGCCCNONE 
Os08g0474700AK064878GCCCGGCCCSimilar to COPII subunit Sec23 (Fragment). 
Os08g0493900AK101284CCCGGCCCACCACNONE 
AK101284CCCGGCCCACCCACGGGNONE 
AK111820CCCGGCCCACCACWD40-like domain containing protein. 
AK111820CCCGGCCCACCCACGGGWD40-like domain containing protein. 
Os08g0499200AK120828CCCGGCCCAACCSimilar to Chloride channel protein CLC-f (AtCLC-f). Splice isoform 2. 
Os08g0522600014-041-A10GGGCCGGGGGCCCATTNONE 
AK105364GGGCCGGGGGCCCATTSimilar to Chaperone protein dnaJ 10 (AtJ10) (AtDjC10). 
Os08g0527100AK119411TACTGGGCCGGGCCTTGPeptidase C19, ubiquitin carboxyl-terminal hydrolase 2 family protein. 
J090013J12TACTGGGCCGGGCCTTGNONE 
J090029K18TACTGGGCCGGGCCTTGNONE 
Os08g0535400004-001-H10CCCGGCCCAAAANONE 
AK071527CCCGGCCCAAAAZinc finger, DHHC-type domain containing protein. 
J023107B02CCCGGCCCAAAANONE 
Os08g0535600AK121683CCCGGCCCGGCCCGTTZinc finger, Tim10/DDP-type family protein. 
J065077E05CCCGGCCCGGCCCGTTNONE 
J075088M24CCCGGCCCGGCCCGTTNONE 
J075140B03CCCGGCCCGGCCCGTTNONE 
J090014B14CCCGGCCCGGCCCGTTNONE 
Os08g0542100AK058490GCCCGGCCCAGTARibosomal protein L7, eukaryotic form family protein. 
AK101416GCCCGGCCCAGTANONE 
J033037N08GCCCGGCCCAGTANONE 
J033086B16GCCCGGCCCAGTANONE 
J043036J02GCCCGGCCCAGTANONE 
J065137E02GCCCGGCCCAGTANONE 
J090015L07GCCCGGCCCAGTANONE 
J100036D02GCCCGGCCCAGTANONE 
Os08g0554000AK111661AGATGGGCCGGGCCGTAWD-40 repeat containing protein. 
AK112044AGATGGGCCGGGCCGTANONE 
J013039N12AGATGGGCCGGGCCGTANONE 
J013134D02AGATGGGCCGGGCCGTANONE 
J013153B06AGATGGGCCGGGCCGTANONE 
J033044L16AGATGGGCCGGGCCGTANONE 
J033073P14AGATGGGCCGGGCCGTANONE 
Os09g0115900009-055-E06AGTTGGGCCGGGCCNONE 
AK068597AGTTGGGCCGGGCCConserved hypothetical protein. 
J065136F11AGTTGGGCCGGGCCNONE 
J080023D14AGTTGGGCCGGGCCNONE 
Os09g0296400J090084M08CCCGGCCCGGCCCConserved hypothetical protein. 
J090084M08GCCCGGCCCAGCCConserved hypothetical protein. 
Os09g0307800AK060843TCTGGGCCGGGNuclear protein SET domain containing protein. 
Os09g0321300AK122141AGAGTGGGCCGGGNONE 
Os09g0329800AK069775GGGCCGGGCConserved hypothetical protein. 
Os09g0329900Os09g0329900GGGCCGGGCNONE 
Os09g0360400009-192-H06AAGGCCCACCCGGCCCGGGNONE 
AK071395AAGGCCCACCCGGCCCGGGConserved hypothetical protein. 
J013045J21AAGGCCCACCCGGCCCGGGNONE 
J023095O09AAGGCCCACCCGGCCCGGGNONE 
J065207K01AAGGCCCACCCGGCCCGGGNONE 
Os09g0388400AK069644CTTGGGCCGGGCCTGGCTGGGCGGCCCATATCof protein family protein. 
J023147A17CTTGGGCCGGGCCTGGCTGGGCGGCCCATATNONE 
Os09g0412900014-003-F10GGGCCGGGCCCGTTAGGCCCAACANONE 
AK102254GGGCCGGGCCCGTTAGGCCCAACAProtein prenyltransferase domain containing protein. 
AK102867GGGCCGGGCCCGTTAGGCCCAACANONE 
J033088H22GGGCCGGGCCCGTTAGGCCCAACANONE 
Os09g0416400J075067A16GGCCCGGCCCATCAConserved hypothetical protein. 
J075104N21GGCCCGGCCCATCANONE 
J075106F04GGCCCGGCCCATCANONE 
J075131F08GGCCCGGCCCATCANONE 
Os09g0453900AK107054CCCGGCCCACCCGNONE 
Os09g0471900AK073815GCCCGGCCCAACTBacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p domain containing protein. 
Os09g0481200005-016-B10CCCGGCCCCACCNONE 
009-011-E05CCCGGCCCCACCNONE 
009-045-E02CCCGGCCCCACCNONE 
009-049-A02CCCGGCCCCACCNONE 
009-055-H07CCCGGCCCCACCNONE 
009-067-E08CCCGGCCCCACCNONE 
009-068-G08CCCGGCCCCACCNONE 
009-076-E11CCCGGCCCCACCNONE 
009-077-E02CCCGGCCCCACCNONE 
009-085-H03CCCGGCCCCACCNONE 
009-088-C06CCCGGCCCCACCNONE 
009-088-D07CCCGGCCCCACCNONE 
009-098-A03CCCGGCCCCACCNONE 
009-100-B03CCCGGCCCCACCNONE 
009-105-H04CCCGGCCCCACCNONE 
009-108-D08CCCGGCCCCACCNONE 
009-110-E02CCCGGCCCCACCNONE 
009-114-F08CCCGGCCCCACCNONE 
009-118-A09CCCGGCCCCACCNONE 
009-118-C10CCCGGCCCCACCNONE 
009-120-F08CCCGGCCCCACCNONE 
009-123-B07CCCGGCCCCACCNONE 
009-126-F11CCCGGCCCCACCNONE 
009-131-D02CCCGGCCCCACCNONE 
009-132-F11CCCGGCCCCACCNONE 
009-133-H07CCCGGCCCCACCNONE 
009-134-B03CCCGGCCCCACCNONE 
009-135-D08CCCGGCCCCACCNONE 
009-138-E07CCCGGCCCCACCNONE 
009-138-G03CCCGGCCCCACCNONE 
009-140-E05CCCGGCCCCACCNONE 
009-143-B06CCCGGCCCCACCNONE 
009-144-D01CCCGGCCCCACCNONE 
009-147-D09CCCGGCCCCACCNONE 
009-149-C09CCCGGCCCCACCNONE 
009-150-F10CCCGGCCCCACCNONE 
009-151-E10CCCGGCCCCACCNONE 
009-151-H10CCCGGCCCCACCNONE 
009-154-A08CCCGGCCCCACCNONE 
009-154-D03CCCGGCCCCACCNONE 
009-155-B09CCCGGCCCCACCNONE 
009-163-E08CCCGGCCCCACCNONE 
009-163-G11CCCGGCCCCACCNONE 
009-165-B06CCCGGCCCCACCNONE 
009-165-C12CCCGGCCCCACCNONE 
009-165-H07CCCGGCCCCACCNONE 
009-167-D02CCCGGCCCCACCNONE 
009-175-F08CCCGGCCCCACCNONE 
009-177-H04CCCGGCCCCACCNONE 
009-177-H08CCCGGCCCCACCNONE 
009-178-B09CCCGGCCCCACCNONE 
009-184-E07CCCGGCCCCACCNONE 
009-186-F09CCCGGCCCCACCNONE 
009-188-H01CCCGGCCCCACCNONE 
009-191-G10CCCGGCCCCACCNONE 
009-192-C08CCCGGCCCCACCNONE 
009-192-D06CCCGGCCCCACCNONE 
009-195-H11CCCGGCCCCACCNONE 
009-197-C06CCCGGCCCCACCNONE 
AK061695CCCGGCCCCACCNONE 
AK098847CCCGGCCCCACCSimilar to Photosystem I reaction center subunit V (PSI-G) (Photosystem I 9 kDa protein) (Fragment). 
J013000C21CCCGGCCCCACCNONE 
J065026J24CCCGGCCCCACCNONE 
J065038L06CCCGGCCCCACCNONE 
J065059E08CCCGGCCCCACCNONE 
J065059N21CCCGGCCCCACCNONE 
J065066H14CCCGGCCCCACCNONE 
J065112H14CCCGGCCCCACCNONE 
J065152I16CCCGGCCCCACCNONE 
J065152L16CCCGGCCCCACCNONE 
J065179N13CCCGGCCCCACCNONE 
J065198E01CCCGGCCCCACCNONE 
J075002I24CCCGGCCCCACCNONE 
J075021G08CCCGGCCCCACCNONE 
J075023N02CCCGGCCCCACCNONE 
J075031C09CCCGGCCCCACCNONE 
J075032G16CCCGGCCCCACCNONE 
J075083F07CCCGGCCCCACCNONE 
J075086P19CCCGGCCCCACCNONE 
J075094D01CCCGGCCCCACCNONE 
J075127I02CCCGGCCCCACCNONE 
J075176I18CCCGGCCCCACCNONE 
J100029F21CCCGGCCCCACCNONE 
J100031P15CCCGGCCCCACCNONE 
J100049C10CCCGGCCCCACCNONE 
J100089B21CCCGGCCCCACCNONE 
Os09g0486700011-018-H05GCCCGGCCCNONE 
012-065-H02GCCCGGCCCNONE 
015-043-C08GCCCGGCCCNONE 
AK105294GCCCGGCCCSimilar to P90 ribosomal S6 kinase. 
Os09g0487500AK108131GCCCGGCCCAATConserved hypothetical protein. 
J080062L16GCCCGGCCCAATNONE 
Os09g0497400009-087-E03CCCGGCCCNONE 
AK058354CCCGGCCCNONE 
AK068677CCCGGCCCProtein of unknown function DUF850, transmembrane eukaryotic family protein. 
J013159B19CCCGGCCCNONE 
J023011D22CCCGGCCCNONE 
J023081K05CCCGGCCCNONE 
J033060O14CCCGGCCCNONE 
J075020I08CCCGGCCCNONE 
J075034J03CCCGGCCCNONE 
J075049M15CCCGGCCCNONE 
J075065K02CCCGGCCCNONE 
J075099L06CCCGGCCCNONE 
Os09g0498600AK066995AGCCCAACCCGGCCCNONE 
AK066995CCCGGCCCGTTNONE 
Os09g0506000AK073281CCCGGCCCNONE 
AK102346CCCGGCCCNONE 
AK106533CCCGGCCCSimilar to Diphosphonucleotide phosphatase 1 precursor. 
Os09g0511700AK101420ATTGGGCCGGGCSimilar to Prunasin hydrolase isoform PH C precursor (EC 3.2.1.118). 
J013022L19ATTGGGCCGGGCNONE 
J013036D23ATTGGGCCGGGCNONE 
J013037F22ATTGGGCCGGGCNONE 
J013111M23ATTGGGCCGGGCNONE 
J023109F14ATTGGGCCGGGCNONE 
J023119H17ATTGGGCCGGGCNONE 
J023133H23ATTGGGCCGGGCNONE 
J033032G17ATTGGGCCGGGCNONE 
J033038B10ATTGGGCCGGGCNONE 
J033071M16ATTGGGCCGGGCNONE 
J033096G04ATTGGGCCGGGCNONE 
J033109D06ATTGGGCCGGGCNONE 
J043016E22ATTGGGCCGGGCNONE 
J043022O09ATTGGGCCGGGCNONE 
J100023N11ATTGGGCCGGGCNONE 
J100046I21ATTGGGCCGGGCNONE 
Os09g0522800015-033-B12CCCGGCCCGGANONE 
015-083-G12CCCGGCCCGGANONE 
AK070906CCCGGCCCGGAProtein of unknown function DUF1618 domain containing protein. 
J023065L17CCCGGCCCGGANONE 
J090090P20CCCGGCCCGGANONE 
Os09g0528800AK070219GTGGTGGGGGCCGGGRabGAP/TBC domain containing protein. 
Os09g0569400AK063384GCCCGGCCCATGTBeta-lactamase-like domain containing protein. 
AK070608GCCCGGCCCATGTNONE 
Os11g0106700006-055-F11GGCCGGGCCGGGCNONE 
006-099-D08GGCCGGGCCGGGCNONE 
009-155-A12GGCCGGGCCGGGCNONE 
AF519570GGCCGGGCCGGGCNONE 
AK059354GGCCGGGCCGGGCSimilar to Ferritin 1, chloroplast precursor (EC 1.16.3.1) (ZmFer1). 
Os11g0157100012-010-F03TAATGGGCCGGGNONE 
J013028H01TAATGGGCCGGGNONE 
J013061L19TAATGGGCCGGGNONE 
J033044L03TAATGGGCCGGGNONE 
J033064P09TAATGGGCCGGGNONE 
J033076A10TAATGGGCCGGGNONE 
J033076K22TAATGGGCCGGGNONE 
J033084J05TAATGGGCCGGGNONE 
J033145A22TAATGGGCCGGGNONE 
J033148L19TAATGGGCCGGGNONE 
J065027P20TAATGGGCCGGGNONE 
J065085D16TAATGGGCCGGGNONE 
J065091L03TAATGGGCCGGGNONE 
J065195C18TAATGGGCCGGGNONE 
J090018N23TAATGGGCCGGGNONE 
J090048A10TAATGGGCCGGGNONE 
J090048M03TAATGGGCCGGGNONE 
J090066L11TAATGGGCCGGGNONE 
J090075G16TAATGGGCCGGGNONE 
J090083G23TAATGGGCCGGGNONE 
J090087E24TAATGGGCCGGGNONE 
J090096H16TAATGGGCCGGGNONE 
Os11g0171700AK099115GGCCCGGCCCAACGGAACGSMAD/FHA domain containing protein. 
Os11g0244800AK103215GGGCCGGGSimilar to Alfin-1. 
J065009E13GGGCCGGGNONE 
J065027D16GGGCCGGGNONE 
J065085B06GGGCCGGGNONE 
J065180O17GGGCCGGGNONE 
J090010C16GGGCCGGGNONE 
J090039K20GGGCCGGGNONE 
Os11g0264600J100079I22CCCGGCCCATCCANONE 
Os11g0276000AK108684CTTGGGCCGGGCNONE 
Os11g0482000006-056-D12CCCGGCCCGGCCCAACANONE 
006-102-C10CCCGGCCCGGCCCAACANONE 
009-005-E07CCCGGCCCGGCCCAACANONE 
014-088-D03CCCGGCCCGGCCCAACANONE 
AK059558CCCGGCCCGGCCCAACASimilar to 40S ribosomal protein S5-1. 
AK103918CCCGGCCCGGCCCAACANONE 
Os11g0484300AK121422AAATGGGCCGGGCCGAGGCCCAAASimilar to Mcm2-prov protein. 
Os11g0544600AK064128CTCGGCCCGGCCCGGCCCGGCCConserved hypothetical protein. 
J075118L07CTCGGCCCGGCCCGGCCCGGCCNONE 
Os11g0545000011-025-F09CCCGGCCCAACTCAGCCCAATANONE 
AK058871CCCGGCCCAACTCAGCCCAATAConserved hypothetical protein. 
AK063297CCCGGCCCAACTCAGCCCAATANONE 
AK100607CCCGGCCCAACTCAGCCCAATANONE 
Os11g0549690J065085G07AGTGGGCCGGGCCCAACTConserved hypothetical protein. 
J065218B08AGTGGGCCGGGCCCAACTNONE 
J090036H16AGTGGGCCGGGCCCAACTNONE 
Os11g0557900009-196-H11AGTTGGGCCGGGCNONE 
AK063232AGTTGGGCCGGGCARP2/3 complex 16 kDa subunit (p16-Arc) family protein. 
Os11g0572100AB109200CCCGGCCCNONE 
AK070564CCCGGCCCSimilar to DNA ligase (EC 6.5.1.2). 
AK101875CCCGGCCCNONE 
Os11g0586300AK072257TCGGCCCGGCCCACGTConserved hypothetical protein. 
Os11g0629200AK065196CCCGGCCCAACCSimilar to Vacuolar sorting protein-like; embryogenesis protein H beta 58-like protein. 
Os11g0630900AK107482GGGCCGGGMATH domain containing protein. 
Os11g0660000AK066709GGCCCGGCCCGTTSodium/calcium exchanger membrane region domain containing protein. 
J013074O18GGCCCGGCCCGTTNONE 
J023081H12GGCCCGGCCCGTTNONE 
J065072E24GGCCCGGCCCGTTNONE 
J065186K08GGCCCGGCCCGTTNONE 
J075079E19GGCCCGGCCCGTTNONE 
J075093J05GGCCCGGCCCGTTNONE 
J075124I21GGCCCGGCCCGTTNONE 
J075187F09GGCCCGGCCCGTTNONE 
J090037O16GGCCCGGCCCGTTNONE 
Os11g0703100J100071A15TGCGGGCCGGGThaumatin, pathogenesis-related family protein. 
Os11g0703200Os11g0703200TGCGGGCCGGGNONE 
Os12g0106000AF370029GGCCGGGCCGGGCSimilar to Ferritin 1, chloroplast precursor (EC 1.16.3.1) (ZmFer1). 
AF519571GGCCGGGCCGGGCNONE 
AK102242GGCCGGGCCGGGCNONE 
AY324879GGCCGGGCCGGGCNONE 
J053063M21GGCCGGGCCGGGCNONE 
J090080A16GGCCGGGCCGGGCNONE 
Os12g0111000AK064603CCCGGCCCConserved hypothetical protein. 
J053025I03CCCGGCCCNONE 
Os12g0120400AK099904CCCGGCCCSimilar to ATPase-like protein. 
J065169A07CCCGGCCCNONE 
Os12g0151500AK058389CCCGGCCCCTGGGCCCCACCSimilar to Alpha-2,8-sialyltransferase 8B (EC 2.4.99.-) (ST8Sia II) (Sialyltransferase X) (STX). 
AK105865CCCGGCCCCTGGGCCCCACCNONE 
Os12g0188900012-030-C08CCCGGCCCAAGNONE 
012-030-C08GCCCGGCCCNONE 
J013027N23CCCGGCCCAAGConserved hypothetical protein. 
J013027N23GCCCGGCCCConserved hypothetical protein. 
J013156K23CCCGGCCCAAGNONE 
J013156K23GCCCGGCCCNONE 
J023134K02CCCGGCCCAAGNONE 
J023134K02GCCCGGCCCNONE 
J033051M18CCCGGCCCAAGNONE 
J033051M18GCCCGGCCCNONE 
J033143K05CCCGGCCCAAGNONE 
J033143K05GCCCGGCCCNONE 
J080003C24CCCGGCCCAAGNONE 
J080003C24GCCCGGCCCNONE 
J080004K05CCCGGCCCAAGNONE 
J080004K05GCCCGGCCCNONE 
J080009D14CCCGGCCCAAGNONE 
J080009D14GCCCGGCCCNONE 
J080014L12CCCGGCCCAAGNONE 
J080014L12GCCCGGCCCNONE 
J080020E23CCCGGCCCAAGNONE 
J080020E23GCCCGGCCCNONE 
J080021K20CCCGGCCCAAGNONE 
J080021K20GCCCGGCCCNONE 
J080024B19CCCGGCCCAAGNONE 
J080024B19GCCCGGCCCNONE 
J080024C12CCCGGCCCAAGNONE 
J080024C12GCCCGGCCCNONE 
J080031K10CCCGGCCCAAGNONE 
J080031K10GCCCGGCCCNONE 
J080034G09CCCGGCCCAAGNONE 
J080034G09GCCCGGCCCNONE 
J080036C10CCCGGCCCAAGNONE 
J080036C10GCCCGGCCCNONE 
J080037K18CCCGGCCCAAGNONE 
J080037K18GCCCGGCCCNONE 
J080039J17CCCGGCCCAAGNONE 
J080039J17GCCCGGCCCNONE 
J080040A20CCCGGCCCAAGNONE 
J080040A20GCCCGGCCCNONE 
J080042B06CCCGGCCCAAGNONE 
J080042B06GCCCGGCCCNONE 
J080046P07CCCGGCCCAAGNONE 
J080046P07GCCCGGCCCNONE 
J080047G02CCCGGCCCAAGNONE 
J080047G02GCCCGGCCCNONE 
J080049E12CCCGGCCCAAGNONE 
J080049E12GCCCGGCCCNONE 
J080056N14CCCGGCCCAAGNONE 
J080056N14GCCCGGCCCNONE 
J080059K10CCCGGCCCAAGNONE 
J080059K10GCCCGGCCCNONE 
J080064F05CCCGGCCCAAGNONE 
J080064F05GCCCGGCCCNONE 
J080064I04CCCGGCCCAAGNONE 
J080064I04GCCCGGCCCNONE 
J080064K17CCCGGCCCAAGNONE 
J080064K17GCCCGGCCCNONE 
J080069A15CCCGGCCCAAGNONE 
J080069A15GCCCGGCCCNONE 
J080071E22CCCGGCCCAAGNONE 
J080071E22GCCCGGCCCNONE 
J080071M24CCCGGCCCAAGNONE 
J080071M24GCCCGGCCCNONE 
J080074C17CCCGGCCCAAGNONE 
J080074C17GCCCGGCCCNONE 
J080075J07CCCGGCCCAAGNONE 
J080075J07GCCCGGCCCNONE 
J080079F11CCCGGCCCAAGNONE 
J080079F11GCCCGGCCCNONE 
J080083F15CCCGGCCCAAGNONE 
J080083F15GCCCGGCCCNONE 
J080084N21CCCGGCCCAAGNONE 
J080084N21GCCCGGCCCNONE 
J080086O03CCCGGCCCAAGNONE 
J080086O03GCCCGGCCCNONE 
J080089K02CCCGGCCCAAGNONE 
J080089K02GCCCGGCCCNONE 
J080092K22CCCGGCCCAAGNONE 
J080092K22GCCCGGCCCNONE 
J080093P09CCCGGCCCAAGNONE 
J080093P09GCCCGGCCCNONE 
J090001N04CCCGGCCCAAGNONE 
J090001N04GCCCGGCCCNONE 
J090041M02CCCGGCCCAAGNONE 
J090041M02GCCCGGCCCNONE 
Os12g0189300AK068710GTGGCGTGGGCCCCACTCCCGGCCCACCAGGCCCAGCCCIsocitrate lyase and phosphorylmutase family protein. 
Os12g0223300006-037-D03GGGCCCGGCCCATTNONE 
AJ429043GGGCCCGGCCCATTNONE 
AK060133GGGCCCGGCCCATTSimilar to Outer membrane cytochrome b(5) (Fragment). 
AK073017GGGCCCGGCCCATTNONE 
J065085K05GGGCCCGGCCCATTNONE 
J075053C01GGGCCCGGCCCATTNONE 
J075055O06GGGCCCGGCCCATTNONE 
J075073B01GGGCCCGGCCCATTNONE 
J075089M07GGGCCCGGCCCATTNONE 
J075095E16GGGCCCGGCCCATTNONE 
J075112O19GGGCCCGGCCCATTNONE 
J075143A11GGGCCCGGCCCATTNONE 
J075173D24GGGCCCGGCCCATTNONE 
J075199G18GGGCCCGGCCCATTNONE 
J090030N06GGGCCCGGCCCATTNONE 
J100052H12GGGCCCGGCCCATTNONE 
J100079F09GGGCCCGGCCCATTNONE 
Os12g0241000AK068925CCCGTGGGCCGGGIojap-related protein family protein. 
J023001D05CCCGTGGGCCGGGNONE 
J065042C19CCCGTGGGCCGGGNONE 
J065081G23CCCGTGGGCCGGGNONE 
J065105M09CCCGTGGGCCGGGNONE 
J065163P20CCCGTGGGCCGGGNONE 
J065182L22CCCGTGGGCCGGGNONE 
Os12g0299700AK071145CCCGGCCCAGGConserved hypothetical protein. 
J023082N05CCCGGCCCAGGNONE 
Os12g0481100AK073151CCCGGCCCATTASimilar to RNA helicase. 
Os12g0488800015-085-F11GGCCCGGCCCGTGGGCCGTGGNONE 
AK064347GGCCCGGCCCGTGGGCCGTGGRNA polymerase II, RPB4 domain containing protein. 
J033065H11GGCCCGGCCCGTGGGCCGTGGNONE 
J033145P10GGCCCGGCCCGTGGGCCGTGGNONE 
J065137L04GGCCCGGCCCGTGGGCCGTGGNONE 
J065171P08GGCCCGGCCCGTGGGCCGTGGNONE 
Os12g0489400AK062351GGGCCGGGHypothetical protein. 
Os12g0508300009-006-G07CCCGGCCCAAGNONE 
009-133-E05CCCGGCCCAAGNONE 
009-137-F10CCCGGCCCAAGNONE 
014-024-A06CCCGGCCCAAGNONE 
AK059123CCCGGCCCAAGRibosomal protein S14 family protein. 
J100088E22CCCGGCCCAAGNONE 
Os12g0509300AK108497GCCCGGCCCAACConserved hypothetical protein. 
Os12g0533500AK068646TCGGCCCGGCCCGGCCCAGAConserved hypothetical protein. 
J013158L10TCGGCCCGGCCCGGCCCAGANONE 
J065083J02TCGGCCCGGCCCGGCCCAGANONE 
J075079D02TCGGCCCGGCCCGGCCCAGANONE 
J100037H16TCGGCCCGGCCCGGCCCAGANONE 
J100075P13TCGGCCCGGCCCGGCCCAGANONE 
Os12g0534700AK122037GCCCGGCCCAAGProtein kinase-like domain containing protein. 
J033112P03GCCCGGCCCAAGNONE 
J090022G02GCCCGGCCCAAGNONE 
J090066N06GCCCGGCCCAAGNONE 
J100064H18GCCCGGCCCAAGNONE 
J100074N21GCCCGGCCCAAGNONE 
J100081P16GCCCGGCCCAAGNONE 
Os12g0573200AK111522CCCGGCCCACCCNONE 
AK121943CCCGGCCCACCCGRAS transcription factor domain containing protein. 
J013002M11CCCGGCCCACCCNONE 
J013151M11CCCGGCCCACCCNONE 
J013159J22CCCGGCCCACCCNONE 
J023087F18CCCGGCCCACCCNONE 
J033107F03CCCGGCCCACCCNONE 
J033125L09CCCGGCCCACCCNONE 
J033126E12CCCGGCCCACCCNONE 
J043022I15CCCGGCCCACCCNONE 
J065176F05CCCGGCCCACCCNONE 
J090034D17CCCGGCCCACCCNONE 
J090075J06CCCGGCCCACCCNONE 
J100058D22CCCGGCCCACCCNONE 
J100058P04CCCGGCCCACCCNONE 
Os12g0592200Os12g0592200GCCCGGCCCACGGCCCACTConserved hypothetical protein. 
Os12g0596000AK073530ATATGGGCCGGGCSimilar to Lipoyltransferase (EC 2.3.1.-) (Lipoyl-[acyl-carrier protein]-protein- N-lipoyltransferase) (Lipoate-protein ligase B). 
AK101541ATATGGGCCGGGCNONE 
Os12g0609800AK101303CCCGGCCCACGTCytochrome cd1-nitrite reductase-like, C-terminal haem d1 domain containing protein. 
J033032I01CCCGGCCCACGTNONE 
J033033K21CCCGGCCCACGTNONE 
J033082L13CCCGGCCCACGTNONE 
J043034M20CCCGGCCCACGTNONE 
J065137J24CCCGGCCCACGTNONE 
J065141A11CCCGGCCCACGTNONE 
J065217H09CCCGGCCCACGTNONE 
Os12g0612500Os12g0612500CCCGGCCCATTTModification methylase HemK family protein. 
Os12g0613500009-028-C05CCACTGACAACCGGGCCCCACCACACACCCGGCCCCACANONE 
011-081-E10CCACTGACAACCGGGCCCCACCACACACCCGGCCCCACANONE 
AB118018CCACTGACAACCGGGCCCCACCACACACCCGGCCCCACANONE 
AK058205CCACTGACAACCGGGCCCCACCACACACCCGGCCCCACANONE 
AK101273CCACTGACAACCGGGCCCCACCACACACCCGGCCCCACALissencephaly type-1-like homology motif domain containing protein. 
J033033A11CCACTGACAACCGGGCCCCACCACACACCCGGCCCCACANONE 
Os12g0620400015-008-B10TGGGGGAGGGCCGGGNONE 
AK059006TGGGGGAGGGCCGGGNONE 
AK059973TGGGGGAGGGCCGGGNONE 
AK063843TGGGGGAGGGCCGGGMethyl-CpG binding domain containing protein. 
AK072503TGGGGGAGGGCCGGGNONE 
AK072934TGGGGGAGGGCCGGGNONE 
J023126H05TGGGGGAGGGCCGGGNONE 
J023131G11TGGGGGAGGGCCGGGNONE 
J023146E17TGGGGGAGGGCCGGGNONE 
J033064P08TGGGGGAGGGCCGGGNONE 
J033095L07TGGGGGAGGGCCGGGNONE 
J065101N06TGGGGGAGGGCCGGGNONE 
J065186F11TGGGGGAGGGCCGGGNONE 
J065215J15TGGGGGAGGGCCGGGNONE 
J080049H05TGGGGGAGGGCCGGGNONE 
J080059L05TGGGGGAGGGCCGGGNONE 
J080061M17TGGGGGAGGGCCGGGNONE 
J080063D16TGGGGGAGGGCCGGGNONE 
J090012D01TGGGGGAGGGCCGGGNONE 
J090023D20TGGGGGAGGGCCGGGNONE 
J090040A09TGGGGGAGGGCCGGGNONE 
J090044K08TGGGGGAGGGCCGGGNONE 
J100019H03TGGGGGAGGGCCGGGNONE 
J100054N04TGGGGGAGGGCCGGGNONE 
Os12g0621700AK073528CCCGGCCCAAGConserved hypothetical protein. 
J033043M23CCCGGCCCAAGNONE 
J033114G18CCCGGCCCAAGNONE 
J033120E10CCCGGCCCAAGNONE 
J033143J21CCCGGCCCAAGNONE 
J065080M02CCCGGCCCAAGNONE 
J065138O22CCCGGCCCAAGNONE 
J090048B16CCCGGCCCAAGNONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.