version

Summary of OsREG539 (All List)

OrganismOryza sativa  
IDOsREG539  
SequenceCCCGGGCC  
Annotation  
PPDB Motif 
PLACE Motif 
Total Entry Count956  

Entry Sequences (956 entries)

LocusGene modelSequenceDescription
Os01g0184800AK073377CACTGACAGCCCGGGCCCACCPhosducin family protein. 
AK102544CACTGACAGCCCGGGCCCACCNONE 
J023047L21CACTGACAGCCCGGGCCCACCNONE 
J023135I09CACTGACAGCCCGGGCCCACCNONE 
J033028G17CACTGACAGCCCGGGCCCACCNONE 
J065164L07CACTGACAGCCCGGGCCCACCNONE 
J065193F22CACTGACAGCCCGGGCCCACCNONE 
J075035I10CACTGACAGCCCGGGCCCACCNONE 
J075168H15CACTGACAGCCCGGGCCCACCNONE 
Os01g0223600AK110821CCCGGGCCSimilar to Pto kinase interactor 1-like protein. 
Os01g0279700AK067683CCCGGGCCNONE 
AK067683GGCCCGGGNONE 
AK100107CCCGGGCCMajor facilitator superfamily protein. 
AK100107GGCCCGGGMajor facilitator superfamily protein. 
J023004N09CCCGGGCCNONE 
J023004N09GGCCCGGGNONE 
J075019L14CCCGGGCCNONE 
J075019L14GGCCCGGGNONE 
J075187F21CCCGGGCCNONE 
J075187F21GGCCCGGGNONE 
Os01g0506200AK073118CCCGGGCCCCGCCCCACATetratricopeptide-like helical domain containing protein. 
J065002A07CCCGGGCCCCGCCCCACANONE 
J065079J08CCCGGGCCCCGCCCCACANONE 
J065167M18CCCGGGCCCCGCCCCACANONE 
Os01g0539400004-019-C07CCCGGGCCNONE 
AK059524CCCGGGCCConserved hypothetical protein. 
AK106137CCCGGGCCNONE 
J065099M02CCCGGGCCNONE 
J075170M12CCCGGGCCNONE 
Os01g0605100AK120157CCCGGGCCSimilar to BCS1 protein-like protein. 
J043013E06CCCGGGCCNONE 
Os01g0606900AK065697CCCGGGCCGCAHeat shock protein DnaJ, N-terminal domain containing protein. 
Os01g0764800AK102809GGGGCCCGGGSimilar to Nt-gh3 deduced protein. 
Os01g0767600AK070672CCCGGGCCCCConserved hypothetical protein. 
J013131M12CCCGGGCCCCNONE 
J023027B15CCCGGGCCCCNONE 
J023059I06CCCGGGCCCCNONE 
J023095L05CCCGGGCCCCNONE 
J033033E20CCCGGGCCCCNONE 
J033105F24CCCGGGCCCCNONE 
J033148N05CCCGGGCCCCNONE 
J065060H14CCCGGGCCCCNONE 
J090093E17CCCGGGCCCCNONE 
Os01g0867900AK061366CCCGGGCCProtein of unknown function DUF502 family protein. 
Os01g0891400J065077E24CTCGCGCGGCCCGGGConserved hypothetical protein. 
J065206I07CTCGCGCGGCCCGGGNONE 
Os01g0914300009-174-C06GGCCCGGGNONE 
014-073-B09GGCCCGGGNONE 
AK103489GGCCCGGGNONE 
AK105463GGCCCGGGPlant lipid transfer/seed storage/trypsin-alpha amylase inhibitor domain containing protein. 
J033076A02GGCCCGGGNONE 
J033130M24GGCCCGGGNONE 
Os01g0921600AK071344CCCGGGCCCACGTGTCSimilar to Mitochondrial import receptor subunit TOM20 (Translocase of outer membrane 20 kDa subunit). 
J013039J22CCCGGGCCCACGTGTCNONE 
J013109E03CCCGGGCCCACGTGTCNONE 
J023081J12CCCGGGCCCACGTGTCNONE 
J023091E24CCCGGGCCCACGTGTCNONE 
J033022A01CCCGGGCCCACGTGTCNONE 
J033074C13CCCGGGCCCACGTGTCNONE 
J065199E03CCCGGGCCCACGTGTCNONE 
J075172O04CCCGGGCCCACGTGTCNONE 
J090007G18CCCGGGCCCACGTGTCNONE 
J090052B17CCCGGGCCCACGTGTCNONE 
J090074H01CCCGGGCCCACGTGTCNONE 
J100043J09CCCGGGCCCACGTGTCNONE 
J100059J05CCCGGGCCCACGTGTCNONE 
Os02g0115700AK065094CCCGGGCCCACCACatalase isozyme A (EC 1.11.1.6) (CAT-A). 
AK099231CCCGGGCCCACCANONE 
AK099923CCCGGGCCCACCANONE 
X61626CCCGGGCCCACCANONE 
Os02g0160200AK109618CCCGGGCCCyclin-like F-box domain containing protein. 
AK109618GGCCCGGGCyclin-like F-box domain containing protein. 
Os02g0197600003-113-H08CCCGGGCCCACCCNONE 
003-129-H06CCCGGGCCCACCCNONE 
006-021-H09CCCGGGCCCACCCNONE 
006-022-B05CCCGGGCCCACCCNONE 
006-022-G12CCCGGGCCCACCCNONE 
006-023-A02CCCGGGCCCACCCNONE 
006-023-C02CCCGGGCCCACCCNONE 
006-023-G09CCCGGGCCCACCCNONE 
006-024-D12CCCGGGCCCACCCNONE 
006-025-C09CCCGGGCCCACCCNONE 
006-025-E01CCCGGGCCCACCCNONE 
006-026-A11CCCGGGCCCACCCNONE 
006-026-A12CCCGGGCCCACCCNONE 
006-028-E11CCCGGGCCCACCCNONE 
006-028-G03CCCGGGCCCACCCNONE 
006-029-A09CCCGGGCCCACCCNONE 
006-029-A12CCCGGGCCCACCCNONE 
006-029-D01CCCGGGCCCACCCNONE 
006-029-F12CCCGGGCCCACCCNONE 
006-029-G12CCCGGGCCCACCCNONE 
006-030-A08CCCGGGCCCACCCNONE 
006-030-C09CCCGGGCCCACCCNONE 
006-030-G06CCCGGGCCCACCCNONE 
006-031-D06CCCGGGCCCACCCNONE 
006-032-C01CCCGGGCCCACCCNONE 
006-034-B07CCCGGGCCCACCCNONE 
006-035-G01CCCGGGCCCACCCNONE 
006-036-H12CCCGGGCCCACCCNONE 
006-040-C01CCCGGGCCCACCCNONE 
006-041-G12CCCGGGCCCACCCNONE 
006-041-H02CCCGGGCCCACCCNONE 
006-041-H11CCCGGGCCCACCCNONE 
006-042-B01CCCGGGCCCACCCNONE 
006-042-F10CCCGGGCCCACCCNONE 
006-043-C04CCCGGGCCCACCCNONE 
006-044-D10CCCGGGCCCACCCNONE 
006-048-D11CCCGGGCCCACCCNONE 
006-049-D07CCCGGGCCCACCCNONE 
006-050-H05CCCGGGCCCACCCNONE 
006-051-D10CCCGGGCCCACCCNONE 
006-051-E05CCCGGGCCCACCCNONE 
006-053-C07CCCGGGCCCACCCNONE 
006-054-B10CCCGGGCCCACCCNONE 
006-054-C12CCCGGGCCCACCCNONE 
006-054-G08CCCGGGCCCACCCNONE 
006-055-D12CCCGGGCCCACCCNONE 
006-056-C04CCCGGGCCCACCCNONE 
006-056-H06CCCGGGCCCACCCNONE 
006-057-E07CCCGGGCCCACCCNONE 
006-058-C12CCCGGGCCCACCCNONE 
006-059-B06CCCGGGCCCACCCNONE 
006-059-B09CCCGGGCCCACCCNONE 
006-059-D05CCCGGGCCCACCCNONE 
006-060-D07CCCGGGCCCACCCNONE 
006-061-D01CCCGGGCCCACCCNONE 
006-061-G09CCCGGGCCCACCCNONE 
006-062-A12CCCGGGCCCACCCNONE 
006-062-D04CCCGGGCCCACCCNONE 
006-062-G01CCCGGGCCCACCCNONE 
006-063-C10CCCGGGCCCACCCNONE 
006-064-A10CCCGGGCCCACCCNONE 
006-067-E04CCCGGGCCCACCCNONE 
006-067-H11CCCGGGCCCACCCNONE 
006-069-G08CCCGGGCCCACCCNONE 
006-071-G06CCCGGGCCCACCCNONE 
006-073-E06CCCGGGCCCACCCNONE 
006-074-B12CCCGGGCCCACCCNONE 
006-074-F06CCCGGGCCCACCCNONE 
006-074-H01CCCGGGCCCACCCNONE 
006-076-D12CCCGGGCCCACCCNONE 
006-077-C08CCCGGGCCCACCCNONE 
006-083-H01CCCGGGCCCACCCNONE 
006-083-H09CCCGGGCCCACCCNONE 
006-084-C02CCCGGGCCCACCCNONE 
006-086-D05CCCGGGCCCACCCNONE 
006-086-E09CCCGGGCCCACCCNONE 
006-087-D04CCCGGGCCCACCCNONE 
006-087-E12CCCGGGCCCACCCNONE 
006-088-A01CCCGGGCCCACCCNONE 
006-088-H09CCCGGGCCCACCCNONE 
006-089-G01CCCGGGCCCACCCNONE 
006-090-G01CCCGGGCCCACCCNONE 
006-092-H10CCCGGGCCCACCCNONE 
006-096-G12CCCGGGCCCACCCNONE 
006-097-C04CCCGGGCCCACCCNONE 
006-098-B06CCCGGGCCCACCCNONE 
006-099-A02CCCGGGCCCACCCNONE 
006-099-B05CCCGGGCCCACCCNONE 
006-100-F02CCCGGGCCCACCCNONE 
006-100-F07CCCGGGCCCACCCNONE 
006-104-A01CCCGGGCCCACCCNONE 
006-107-F06CCCGGGCCCACCCNONE 
006-109-A05CCCGGGCCCACCCNONE 
006-110-G03CCCGGGCCCACCCNONE 
006-111-A06CCCGGGCCCACCCNONE 
006-111-C12CCCGGGCCCACCCNONE 
006-112-B03CCCGGGCCCACCCNONE 
006-113-A02CCCGGGCCCACCCNONE 
006-113-H06CCCGGGCCCACCCNONE 
006-115-D11CCCGGGCCCACCCNONE 
006-116-F11CCCGGGCCCACCCNONE 
006-117-A10CCCGGGCCCACCCNONE 
006-117-C01CCCGGGCCCACCCNONE 
006-117-D08CCCGGGCCCACCCNONE 
006-118-B12CCCGGGCCCACCCNONE 
006-118-D08CCCGGGCCCACCCNONE 
006-118-E11CCCGGGCCCACCCNONE 
006-118-H08CCCGGGCCCACCCNONE 
006-119-C10CCCGGGCCCACCCNONE 
006-120-H11CCCGGGCCCACCCNONE 
009-025-G09CCCGGGCCCACCCNONE 
009-061-H06CCCGGGCCCACCCNONE 
009-070-E02CCCGGGCCCACCCNONE 
009-077-A07CCCGGGCCCACCCNONE 
009-114-A07CCCGGGCCCACCCNONE 
009-115-G02CCCGGGCCCACCCNONE 
009-123-C06CCCGGGCCCACCCNONE 
009-125-H03CCCGGGCCCACCCNONE 
009-127-H11CCCGGGCCCACCCNONE 
009-136-G03CCCGGGCCCACCCNONE 
009-154-B05CCCGGGCCCACCCNONE 
009-162-B02CCCGGGCCCACCCNONE 
009-176-D09CCCGGGCCCACCCNONE 
009-178-F10CCCGGGCCCACCCNONE 
009-190-F05CCCGGGCCCACCCNONE 
009-200-C08CCCGGGCCCACCCNONE 
011-064-H10CCCGGGCCCACCCNONE 
AK060143CCCGGGCCCACCCNONE 
AK060970CCCGGGCCCACCCNONE 
AK068102CCCGGGCCCACCCSimilar to PSI type III chlorophyll a/b-binding protein. 
AK104096CCCGGGCCCACCCNONE 
AK104215CCCGGGCCCACCCNONE 
AK104348CCCGGGCCCACCCNONE 
AK104385CCCGGGCCCACCCNONE 
AK104392CCCGGGCCCACCCNONE 
AK104446CCCGGGCCCACCCNONE 
AK104458CCCGGGCCCACCCNONE 
AK104469CCCGGGCCCACCCNONE 
AK104522CCCGGGCCCACCCNONE 
AK104535CCCGGGCCCACCCNONE 
AK104557CCCGGGCCCACCCNONE 
AK104636CCCGGGCCCACCCNONE 
AK104646CCCGGGCCCACCCNONE 
AK104734CCCGGGCCCACCCNONE 
AK106085CCCGGGCCCACCCNONE 
AK109398CCCGGGCCCACCCNONE 
AK119554CCCGGGCCCACCCNONE 
J013044I21CCCGGGCCCACCCNONE 
J013090N21CCCGGGCCCACCCNONE 
J013130I24CCCGGGCCCACCCNONE 
J023038D09CCCGGGCCCACCCNONE 
J023064C23CCCGGGCCCACCCNONE 
J023088A09CCCGGGCCCACCCNONE 
J023105K12CCCGGGCCCACCCNONE 
J065022M15CCCGGGCCCACCCNONE 
J075062L23CCCGGGCCCACCCNONE 
J075069B05CCCGGGCCCACCCNONE 
J075072D15CCCGGGCCCACCCNONE 
J075090E24CCCGGGCCCACCCNONE 
J075126D14CCCGGGCCCACCCNONE 
J075154L21CCCGGGCCCACCCNONE 
J075165F23CCCGGGCCCACCCNONE 
J075166D04CCCGGGCCCACCCNONE 
J080003O05CCCGGGCCCACCCNONE 
J080005L07CCCGGGCCCACCCNONE 
J080008K15CCCGGGCCCACCCNONE 
J080009A07CCCGGGCCCACCCNONE 
J080009F05CCCGGGCCCACCCNONE 
J080010M06CCCGGGCCCACCCNONE 
J080011E06CCCGGGCCCACCCNONE 
J080011H20CCCGGGCCCACCCNONE 
J080018I05CCCGGGCCCACCCNONE 
J080021N17CCCGGGCCCACCCNONE 
J080036E20CCCGGGCCCACCCNONE 
J080040E22CCCGGGCCCACCCNONE 
J080044D19CCCGGGCCCACCCNONE 
J080045C21CCCGGGCCCACCCNONE 
J080047B08CCCGGGCCCACCCNONE 
J080048E24CCCGGGCCCACCCNONE 
J080053D19CCCGGGCCCACCCNONE 
J080053N09CCCGGGCCCACCCNONE 
J080054A19CCCGGGCCCACCCNONE 
J080061O16CCCGGGCCCACCCNONE 
J080064P15CCCGGGCCCACCCNONE 
J080065M06CCCGGGCCCACCCNONE 
J080067G11CCCGGGCCCACCCNONE 
J080072M09CCCGGGCCCACCCNONE 
J080079I15CCCGGGCCCACCCNONE 
J080082I12CCCGGGCCCACCCNONE 
J080083K21CCCGGGCCCACCCNONE 
J080096H12CCCGGGCCCACCCNONE 
J080096J10CCCGGGCCCACCCNONE 
J080097O13CCCGGGCCCACCCNONE 
J080305P05CCCGGGCCCACCCNONE 
J080311C21CCCGGGCCCACCCNONE 
J080317C16CCCGGGCCCACCCNONE 
Os02g0445700011-046-C10CCCGGGCCGNONE 
Os02g0521300AK120851CCCGGGCCC2 domain containing protein. 
Os02g0595700006-057-E01CCCGGGCCGNONE 
006-082-F10CCCGGGCCGNONE 
006-087-C10CCCGGGCCGNONE 
006-091-H03CCCGGGCCGNONE 
006-094-A11CCCGGGCCGNONE 
AF145053CCCGGGCCGNONE 
AK064937CCCGGGCCGNONE 
AK066858CCCGGGCCGNONE 
AK104785CCCGGGCCGNONE 
AK119587CCCGGGCCGChloroplast translational elongation factor Tu. 
J013000P03CCCGGGCCGNONE 
Os02g0600200009-154-A06CCCACCCGGGCCCACACNONE 
AK058978CCCACCCGGGCCCACACNONE 
AK066974CCCACCCGGGCCCACACIQ calmodulin-binding region domain containing protein. 
Os02g0601800AB060276TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
AK099539TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
AK101873TCGGCCCGGGTGGGGCCCACGCCCAGATBromodomain containing protein. 
AK106801TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
AK121758TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
AK121891TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J013059H01TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J013092F08TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J013146J04TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J023001K12TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J023002H16TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J023013B10TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J023081I22TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J023084K19TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J023150E24TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J033023B18TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J033025F18TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J033048P08TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J033060M24TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J033070G06TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J033088P12TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J033105C13TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J043009N18TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J065103G21TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J075039H15TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090014K10TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090022N02TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090033F18TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090033I04TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090041F11TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090045P20TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090054B01TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090055M12TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090071K09TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090098O16TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090099P15TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J100050I16TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
Os02g0606800AK073760CCCGGGCCCACAIsochorismatase hydrolase family protein. 
J100033B19CCCGGGCCCACANONE 
J100047E15CCCGGGCCCACANONE 
J100058A18CCCGGGCCCACANONE 
J100068L14CCCGGGCCCACANONE 
J100089I02CCCGGGCCCACANONE 
Os02g0625500011-025-C06CCCGGGCCCGCANONE 
AB050624CCCGGGCCCGCANONE 
AK059188CCCGGGCCCGCANONE 
AK059771CCCGGGCCCGCANONE 
AK101791CCCGGGCCCGCASimilar to Adenosine kinase-like protein (Fragment). 
AY224510CCCGGGCCCGCANONE 
J013152H02CCCGGGCCCGCANONE 
J023012P09CCCGGGCCCGCANONE 
J023127D16CCCGGGCCCGCANONE 
J033024G01CCCGGGCCCGCANONE 
J033025L19CCCGGGCCCGCANONE 
J033080M04CCCGGGCCCGCANONE 
J033101A08CCCGGGCCCGCANONE 
J033121L12CCCGGGCCCGCANONE 
J043017N15CCCGGGCCCGCANONE 
J065207J01CCCGGGCCCGCANONE 
J090049G12CCCGGGCCCGCANONE 
J100036A07CCCGGGCCCGCANONE 
J100076C04CCCGGGCCCGCANONE 
J100080N22CCCGGGCCCGCANONE 
Os02g0629000009-047-E10CCCGGGCCCCACCCGNONE 
AK062480CCCGGGCCCCACCCGProtein of unknown function DUF584 family protein. 
Os02g0630300AK108598GTCGCGCGCGCCGGCCCGGGCCNONE 
Os02g0652800AK063448CCCGGGCCGGCMajor facilitator superfamily MFS_1 protein. 
Os02g0679700AK108178GACGGCCCGGGProtein of unknown function DUF623, plant domain containing protein. 
J075112F23GACGGCCCGGGNONE 
Os02g0701300AK063983GGCCCGGGSimilar to Transcription activator GRF2 (Fragment). 
Os02g0741300AK105716CCCGGGCCCNONE 
AK120667CCCGGGCCCGlycoside hydrolase, family 47 protein. 
Os02g0792900AK068367TCGGCCCGGGTMS membrane protein/tumour differentially expressed protein family protein. 
AK104731TCGGCCCGGGNONE 
AK106174TCGGCCCGGGNONE 
AK119191TCGGCCCGGGNONE 
Os03g0171700J065192H12CCCGGGCCCACTBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
Os03g0191200AK070228CCCGGGCCWW/Rsp5/WWP domain containing protein. 
Os03g0199500J065099N05CCCGGGCCCCNONE 
J065152P14CCCGGGCCCCConserved hypothetical protein. 
J080009C14CCCGGGCCCCNONE 
J080011K01CCCGGGCCCCNONE 
J080015H12CCCGGGCCCCNONE 
J080022K05CCCGGGCCCCNONE 
J080034G01CCCGGGCCCCNONE 
J080038I04CCCGGGCCCCNONE 
J080039F20CCCGGGCCCCNONE 
J080042J22CCCGGGCCCCNONE 
J080042N23CCCGGGCCCCNONE 
J080043E07CCCGGGCCCCNONE 
J080050A12CCCGGGCCCCNONE 
J080050C11CCCGGGCCCCNONE 
J080052B01CCCGGGCCCCNONE 
J080052H22CCCGGGCCCCNONE 
J080060E02CCCGGGCCCCNONE 
J080063K24CCCGGGCCCCNONE 
J080067I07CCCGGGCCCCNONE 
J080081H22CCCGGGCCCCNONE 
J080085J10CCCGGGCCCCNONE 
J080089E20CCCGGGCCCCNONE 
J080092N04CCCGGGCCCCNONE 
J080093B01CCCGGGCCCCNONE 
J080093N04CCCGGGCCCCNONE 
J080097B03CCCGGGCCCCNONE 
Os03g0205500Os03g0205500CCCGGGCCCGGCCCACTGGCCCAGTCytochrome b5 domain containing protein. 
Os03g0206400AK066494CCCGGGCCCGCAConserved hypothetical protein. 
AK107011CCCGGGCCCGCANONE 
J065162G04CCCGGGCCCGCANONE 
Os03g0222100AK070688CCCGGGCCCACTSimilar to Topoisomerase-like protein. 
J023057E15CCCGGGCCCACTNONE 
J023099M24CCCGGGCCCACTNONE 
J023147F14CCCGGGCCCACTNONE 
Os03g0278400015-014-G10GCTGGGCCCGGGNONE 
AK070052GCTGGGCCCGGGSimilar to ADP ribosylation GTPase-like protein (Fragment). 
AY224461GCTGGGCCCGGGNONE 
J065218E15GCTGGGCCCGGGNONE 
J075115A06GCTGGGCCCGGGNONE 
J075134I05GCTGGGCCCGGGNONE 
J100032D08GCTGGGCCCGGGNONE 
J100044O13GCTGGGCCCGGGNONE 
J100051G15GCTGGGCCCGGGNONE 
J100052O21GCTGGGCCCGGGNONE 
J100071A12GCTGGGCCCGGGNONE 
Os03g0294200AK069285CCCGGGCCCACASimilar to Fructose-6-phosphate-2-kinase/fructose-2, 6-bisphosphatase. 
Os03g0383100AK107106CCCGGGCCGAAAConserved hypothetical protein. 
Os03g0397400AB112772CGTGTGGGCCCGGGCCCGGANONE 
AK069928CGTGTGGGCCCGGGCCCGGASimilar to Low affinity calcium transporter CAX2 (Fragment). 
J023014O18CGTGTGGGCCCGGGCCCGGANONE 
J023036P06CGTGTGGGCCCGGGCCCGGANONE 
J023145E24CGTGTGGGCCCGGGCCCGGANONE 
J033142I11CGTGTGGGCCCGGGCCCGGANONE 
J043003A10CGTGTGGGCCCGGGCCCGGANONE 
J075023H21CGTGTGGGCCCGGGCCCGGANONE 
J075145O10CGTGTGGGCCCGGGCCCGGANONE 
J075149A03CGTGTGGGCCCGGGCCCGGANONE 
J090099B09CGTGTGGGCCCGGGCCCGGANONE 
J100017L14CGTGTGGGCCCGGGCCCGGANONE 
J100050K18CGTGTGGGCCCGGGCCCGGANONE 
J100063P16CGTGTGGGCCCGGGCCCGGANONE 
Os03g0578200003-117-B07GGCCCGGGNONE 
009-175-C06GGCCCGGGNONE 
009-179-H05GGCCCGGGNONE 
013-078-G11GGCCCGGGNONE 
AK062224GGCCCGGGNONE 
AK120432GGCCCGGGConserved hypothetical protein. 
J013096L16GGCCCGGGNONE 
J100042G12GGCCCGGGNONE 
J100069F04GGCCCGGGNONE 
J100073H14GGCCCGGGNONE 
Os03g0609500Os03g0609500GGCCCGGGSimilar to LOB domain protein 39. 
Os03g0628900009-062-G01ATTTGGGCCCGGGNONE 
AK103619ATTTGGGCCCGGGPrefoldin domain containing protein. 
J033133L23ATTTGGGCCCGGGNONE 
J100039C17ATTTGGGCCCGGGNONE 
J100048I07ATTTGGGCCCGGGNONE 
J100062E19ATTTGGGCCCGGGNONE 
J100063B11ATTTGGGCCCGGGNONE 
Os03g0633800AK073044CCCGGGCCCCACCTGTCSimilar to IAA6 (Fragment). 
J065038L22CCCGGGCCCCACCTGTCNONE 
J065185C13CCCGGGCCCCACCTGTCNONE 
Os03g0648400005-003-D07CCCGGGCCCAGCNONE 
006-048-C12CCCGGGCCCAGCNONE 
006-049-A03CCCGGGCCCAGCNONE 
011-008-F07CCCGGGCCCAGCNONE 
011-039-A07CCCGGGCCCAGCNONE 
011-044-D10CCCGGGCCCAGCNONE 
011-099-C01CCCGGGCCCAGCNONE 
012-051-B09CCCGGGCCCAGCNONE 
012-051-D08CCCGGGCCCAGCNONE 
012-056-G07CCCGGGCCCAGCNONE 
012-062-A01CCCGGGCCCAGCNONE 
012-079-C03CCCGGGCCCAGCNONE 
014-003-A06CCCGGGCCCAGCNONE 
015-010-D02CCCGGGCCCAGCNONE 
AK102263CCCGGGCCCAGCSimilar to DnaJ protein homolog (DNAJ-1). 
AK103763CCCGGGCCCAGCNONE 
AK105028CCCGGGCCCAGCNONE 
AY224432CCCGGGCCCAGCNONE 
J013043H01CCCGGGCCCAGCNONE 
J013134K10CCCGGGCCCAGCNONE 
J023037D18CCCGGGCCCAGCNONE 
J023077K20CCCGGGCCCAGCNONE 
J023105M19CCCGGGCCCAGCNONE 
J023131M09CCCGGGCCCAGCNONE 
J033022F05CCCGGGCCCAGCNONE 
J033051J22CCCGGGCCCAGCNONE 
J033061D03CCCGGGCCCAGCNONE 
J033084H04CCCGGGCCCAGCNONE 
J033088M01CCCGGGCCCAGCNONE 
J033119H12CCCGGGCCCAGCNONE 
J033131C18CCCGGGCCCAGCNONE 
J043030C06CCCGGGCCCAGCNONE 
J080032A08CCCGGGCCCAGCNONE 
J090008C11CCCGGGCCCAGCNONE 
J090014D24CCCGGGCCCAGCNONE 
J090024C20CCCGGGCCCAGCNONE 
J090024H08CCCGGGCCCAGCNONE 
J090029F10CCCGGGCCCAGCNONE 
J090032K16CCCGGGCCCAGCNONE 
J090034L14CCCGGGCCCAGCNONE 
J090035C20CCCGGGCCCAGCNONE 
J090044H05CCCGGGCCCAGCNONE 
J090048M09CCCGGGCCCAGCNONE 
J090056I15CCCGGGCCCAGCNONE 
J090062B01CCCGGGCCCAGCNONE 
J090076F06CCCGGGCCCAGCNONE 
J090077A02CCCGGGCCCAGCNONE 
J090084E21CCCGGGCCCAGCNONE 
J090084J09CCCGGGCCCAGCNONE 
J090086G11CCCGGGCCCAGCNONE 
J090092C20CCCGGGCCCAGCNONE 
J100018G14CCCGGGCCCAGCNONE 
J100018I22CCCGGGCCCAGCNONE 
J100024N14CCCGGGCCCAGCNONE 
J100032K09CCCGGGCCCAGCNONE 
J100036F09CCCGGGCCCAGCNONE 
J100041M04CCCGGGCCCAGCNONE 
J100042H05CCCGGGCCCAGCNONE 
J100043P19CCCGGGCCCAGCNONE 
J100044B04CCCGGGCCCAGCNONE 
J100049L24CCCGGGCCCAGCNONE 
J100050M21CCCGGGCCCAGCNONE 
J100057F24CCCGGGCCCAGCNONE 
J100063I11CCCGGGCCCAGCNONE 
J100064J24CCCGGGCCCAGCNONE 
J100070B13CCCGGGCCCAGCNONE 
J100076A13CCCGGGCCCAGCNONE 
J100081C20CCCGGGCCCAGCNONE 
J100081L09CCCGGGCCCAGCNONE 
J100084G23CCCGGGCCCAGCNONE 
J100088H02CCCGGGCCCAGCNONE 
Os03g0701000J075172J23CCCGGGCCCACCCGNONE 
Os03g0745000AK109590CCCGGGCCNONE 
AY332465CCCGGGCCNONE 
AY344486CCCGGGCCNONE 
AY998118CCCGGGCCWinged helix repressor DNA-binding domain containing protein. 
Os03g0752800AB041020GGGGCCCGGGCCGGCNONE 
AF058697GGGGCCCGGGCCGGCMADS14 protein. 
AF139664GGGGCCCGGGCCGGCNONE 
AK121171GGGGCCCGGGCCGGCNONE 
AY332478GGGGCCCGGGCCGGCNONE 
AY551916GGGGCCCGGGCCGGCNONE 
J023081C04GGGGCCCGGGCCGGCNONE 
Os03g0780800AK059874GGCCCGGGCCCACCACNONE 
AK103085GGCCCGGGCCCACCACFatty acid hydroxylase domain containing protein. 
J065214L21GGCCCGGGCCCACCACNONE 
J075178I24GGCCCGGGCCCACCACNONE 
J075197K14GGCCCGGGCCCACCACNONE 
Os03g0789200015-015-H03CCCGGGCCCACCANONE 
AK071787CCCGGGCCCACCAProtein of unknown function DUF593 family protein. 
AY224542CCCGGGCCCACCANONE 
J023110P10CCCGGGCCCACCANONE 
J075039H19CCCGGGCCCACCANONE 
Os03g0796600003-113-D10CCCGGGCCCAGCGCACCGCCACGTCNONE 
011-076-B12CCCGGGCCCAGCGCACCGCCACGTCNONE 
AK105257CCCGGGCCCAGCGCACCGCCACGTCProtein of unknown function DUF506, plant family protein. 
J075105C03CCCGGGCCCAGCGCACCGCCACGTCNONE 
J080036O17CCCGGGCCCAGCGCACCGCCACGTCNONE 
J080064E16CCCGGGCCCAGCGCACCGCCACGTCNONE 
J080069E03CCCGGGCCCAGCGCACCGCCACGTCNONE 
J080079E23CCCGGGCCCAGCGCACCGCCACGTCNONE 
J090036H20CCCGGGCCCAGCGCACCGCCACGTCNONE 
J100029L10CCCGGGCCCAGCGCACCGCCACGTCNONE 
J100055G09CCCGGGCCCAGCGCACCGCCACGTCNONE 
Os03g0796800J065024O22GCCACGTGGGCCCGGGConserved hypothetical protein. 
Os04g0126800AK107895CCCGGGCCCACGGGHypothetical protein. 
Os04g0206200015-013-E04CCCGGGCCGANONE 
AK109506CCCGGGCCGANONE 
AK110950CCCGGGCCGANONE 
Os04g0282400AK120187CCCGGGCCCCACACSimilar to FPF1 protein-like (RAA1). 
J013034O10CCCGGGCCCCACACNONE 
J013071G20CCCGGGCCCCACACNONE 
Os04g0387600009-148-E01GGCCCGGGNONE 
009-155-A11GGCCCGGGNONE 
009-175-F04GGCCCGGGNONE 
AK063862GGCCCGGGConserved hypothetical protein. 
J065035F12GGCCCGGGNONE 
J065162C13GGCCCGGGNONE 
J065169L19GGCCCGGGNONE 
Os04g0413500AK072276CCCGGGCCSimilar to Cell wall invertase 2. 
AY340072CCCGGGCCNONE 
AY578159CCCGGGCCNONE 
Os04g0435700AK100857CCCACCCGGGCCCACCCGSimilar to UVB-resistance protein UVR8. 
Os04g0561200AK107862CCCGGGCCCCCACCellular retinaldehyde-binding/triple function, C-terminal domain containing protein. 
J065028J03CCCGGGCCCCCACNONE 
J065042H13CCCGGGCCCCCACNONE 
J065079N01CCCGGGCCCCCACNONE 
J065190N16CCCGGGCCCCCACNONE 
J065191H22CCCGGGCCCCCACNONE 
Os04g0660600009-113-A11CCCGGGCCCAATTNONE 
AK120899CCCGGGCCCAATTATPase, V0 complex, subunit H family protein. 
J023030J05CCCGGGCCCAATTNONE 
J065068M07CCCGGGCCCAATTNONE 
J065120G22CCCGGGCCCAATTNONE 
J065168J18CCCGGGCCCAATTNONE 
J065211M10CCCGGGCCCAATTNONE 
J075175E21CCCGGGCCCAATTNONE 
J090021C06CCCGGGCCCAATTNONE 
J090032P15CCCGGGCCCAATTNONE 
J090082E05CCCGGGCCCAATTNONE 
J100090O11CCCGGGCCCAATTNONE 
Os04g0684500AK066014TCCGGCCCACCCGGGCCRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os04g0685800AK070891GGCCCGGGSimilar to Diadenosine 5',5'''-P1,P4-tetraphosphate hydrolase (EC 3.6.1.17). 
AK071345GGCCCGGGNONE 
J023069G19GGCCCGGGNONE 
J023097E09GGCCCGGGNONE 
J065071A01GGCCCGGGNONE 
J065186F08GGCCCGGGNONE 
J075044B21GGCCCGGGNONE 
J075120N18GGCCCGGGNONE 
J075131B22GGCCCGGGNONE 
J100041H18GGCCCGGGNONE 
J100042P13GGCCCGGGNONE 
Os05g0148300009-031-A08CCCGGGCCNONE 
AK062421CCCGGGCCRibosomal protein S27, mitochondrial family protein. 
Os05g0176100AF030052CCCGGGCCCACCCNONE 
AK067850CCCGGGCCCACCCNONE 
AK067967CCCGGGCCCACCCNONE 
AK098978CCCGGGCCCACCCNONE 
AK099228CCCGGGCCCACCCNONE 
AK099281CCCGGGCCCACCCNONE 
AK100188CCCGGGCCCACCCSimilar to RSW1-like cellulose synthase catalytic subunit (Fragment). 
AK102140CCCGGGCCCACCCNONE 
Os05g0350500013-071-D05CCCGGGCCGNONE 
AF020787CCCGGGCCGNONE 
AK061712CCCGGGCCGNONE 
AK102897CCCGGGCCGProliferation-associated protein 1 family protein. 
J033060G23CCCGGGCCGNONE 
J033112P14CCCGGGCCGNONE 
J033127J04CCCGGGCCGNONE 
J090015L18CCCGGGCCGNONE 
J090047K03CCCGGGCCGNONE 
J090097J17CCCGGGCCGNONE 
Os05g0350600AK066244CCCGGGCCGGCSimilar to Atranbp1b protein. 
J075100E12CCCGGGCCGGCNONE 
J090024D03CCCGGGCCGGCNONE 
J100027C02CCCGGGCCGGCNONE 
J100053P05CCCGGGCCGGCNONE 
J100055P22CCCGGGCCGGCNONE 
Os05g0429700AK059651CCCGGGCCNONE 
AK069203CCCGGGCCNONE 
Os05g0455200AK100916CCCGGGCCSimilar to Homeodomain protein JUBEL2. 
Os05g0543800AK072185CCCGGGCCCATATConserved hypothetical protein. 
Os05g0594800AK058332CCCGGGCCGGCAdhesion regulating molecule family protein. 
AK068013CCCGGGCCGGCNONE 
J013129L24CCCGGGCCGGCNONE 
Os06g0102300AK071958CCCGGGCCGNONE 
Os06g0114700AK061552GACAGGTGGGCCCGGGProtein of unknown function DUF1218 family protein. 
AK098848GACAGGTGGGCCCGGGNONE 
AK122142GACAGGTGGGCCCGGGNONE 
J013000D16GACAGGTGGGCCCGGGNONE 
Os06g0246500AK105105CCCGGGCCGTGSimilar to Pyruvate dehydrogenase E1 alpha subunit (EC 1.2.4.1). 
Os06g0476200AK065566CCCGGGCCCAGANONE 
AK068502CCCGGGCCCAGASimilar to Phosphoglucomutase precursor (EC 5.4.2.2). 
Os06g0589500AK073322CCCGGGCCCGCAConserved hypothetical protein. 
J033030G15CCCGGGCCCGCANONE 
J033148N18CCCGGGCCCGCANONE 
Os06g0624900006-066-E01GGGGCCCGGGNONE 
AK061790GGGGCCCGGGNONE 
AK065620GGGGCCCGGGConserved hypothetical protein. 
AK067251GGGGCCCGGGNONE 
J013099A07GGGGCCCGGGNONE 
J065029M10GGGGCCCGGGNONE 
J065068B08GGGGCCCGGGNONE 
J065072A12GGGGCCCGGGNONE 
J065075F16GGGGCCCGGGNONE 
J065080C16GGGGCCCGGGNONE 
J075007G04GGGGCCCGGGNONE 
J075027O03GGGGCCCGGGNONE 
J075055A13GGGGCCCGGGNONE 
J075055E01GGGGCCCGGGNONE 
J075110N02GGGGCCCGGGNONE 
J075147P10GGGGCCCGGGNONE 
J075175L20GGGGCCCGGGNONE 
Os07g0158900AK064980CCCGGGCCGCyclin-like F-box domain containing protein. 
Os07g0159800009-100-A07CCCGGGCCCACACGNONE 
009-140-B04CCCGGGCCCACACGNONE 
AK059284CCCGGGCCCACACGNONE 
AK060475CCCGGGCCCACACGE1 protein and Def2/Der2 allergen family protein. 
J023054H06CCCGGGCCCACACGNONE 
J023083L17CCCGGGCCCACACGNONE 
J043005N13CCCGGGCCCACACGNONE 
J065164K01CCCGGGCCCACACGNONE 
J065192C18CCCGGGCCCACACGNONE 
J090058G23CCCGGGCCCACACGNONE 
J100017G10CCCGGGCCCACACGNONE 
J100081F12CCCGGGCCCACACGNONE 
Os07g0164500J013094M18CCCGGGCCGGCCCATTNONE 
J013153L05CCCGGGCCGGCCCATTNONE 
J023011J18CCCGGGCCGGCCCATTNONE 
J023106H21CCCGGGCCGGCCCATTNONE 
J033105F10CCCGGGCCGGCCCATTNONE 
J065210M20CCCGGGCCGGCCCATTSimilar to Dolichyl pyrophosphate Man9GlcNAc2 alpha-1,3-glucosyltransferase (EC 2.4.1.-) (Dolichyl-P-Glc:Man9GlcNAc2-PP-dolichyl glucosyltransferase). 
J090060F05CCCGGGCCGGCCCATTNONE 
J090061C13CCCGGGCCGGCCCATTNONE 
J090074K15CCCGGGCCGGCCCATTNONE 
Os07g0205700AK120553CCCGGGCCGGCCCSimilar to Xaa-Pro dipeptidase (EC 3.4.-.-). 
J065022J24CCCGGGCCGGCCCNONE 
Os07g0422100013-054-G11ACCGGCCCGGGNONE 
AK063592ACCGGCCCGGGNONE 
J065165K10ACCGGCCCGGGNONE 
J075021B01ACCGGCCCGGGNONE 
J075087H22ACCGGCCCGGGNONE 
J075118C10ACCGGCCCGGGNONE 
J075134N03ACCGGCCCGGGNONE 
J075151F23ACCGGCCCGGGNONE 
U57639ACCGGCCCGGGAWPM-19-like family protein. 
Os07g0438800AK060412GCCGGCCCGGGCCCACCCNONE 
AK100065GCCGGCCCGGGCCCACCCSimilar to Phosphate starvation regulator protein (Regulatory protein of P- starvation acclimation response Psr1). 
AK103195GCCGGCCCGGGCCCACCCNONE 
AY224478GCCGGCCCGGGCCCACCCNONE 
J013160O05GCCGGCCCGGGCCCACCCNONE 
J023030C05GCCGGCCCGGGCCCACCCNONE 
J033025O04GCCGGCCCGGGCCCACCCNONE 
J033121P15GCCGGCCCGGGCCCACCCNONE 
J043034I23GCCGGCCCGGGCCCACCCNONE 
J065022N01GCCGGCCCGGGCCCACCCNONE 
J065022N02GCCGGCCCGGGCCCACCCNONE 
J065023M01GCCGGCCCGGGCCCACCCNONE 
J065101G13GCCGGCCCGGGCCCACCCNONE 
J075058P13GCCGGCCCGGGCCCACCCNONE 
J075186K10GCCGGCCCGGGCCCACCCNONE 
J075199F17GCCGGCCCGGGCCCACCCNONE 
Os07g0546100AK058282TCCGGGCCCGGGNONE 
Os07g0568000AK069485CCCGGGCCCCNONE 
AK072783CCCGGGCCCCApolipophorin III-like domain containing protein. 
Os07g0568300AK067784CCCGGGCCCNONE 
AK067895CCCGGGCCCSimilar to ZF protein (Fragment). 
J013119M01CCCGGGCCCNONE 
J013120B09CCCGGGCCCNONE 
J013123G12CCCGGGCCCNONE 
J023012C12CCCGGGCCCNONE 
J023020G17CCCGGGCCCNONE 
J023037E23CCCGGGCCCNONE 
J033076I01CCCGGGCCCNONE 
J033108A07CCCGGGCCCNONE 
J033138J02CCCGGGCCCNONE 
J075033L09CCCGGGCCCNONE 
J075049E02CCCGGGCCCNONE 
J075060N23CCCGGGCCCNONE 
J075094H13CCCGGGCCCNONE 
J075179L18CCCGGGCCCNONE 
J080005P09CCCGGGCCCNONE 
J080044J03CCCGGGCCCNONE 
J080062G20CCCGGGCCCNONE 
J080063L23CCCGGGCCCNONE 
J080065B16CCCGGGCCCNONE 
J080071K09CCCGGGCCCNONE 
J080089C23CCCGGGCCCNONE 
J090008P21CCCGGGCCCNONE 
J090046B22CCCGGGCCCNONE 
J090094C19CCCGGGCCCNONE 
J090096B19CCCGGGCCCNONE 
J100060G03CCCGGGCCCNONE 
J100082D16CCCGGGCCCNONE 
Os07g0569100013-067-E02CCCGGGCCCACCTNONE 
013-081-C06CCCGGGCCCACCTNONE 
014-030-G06CCCGGGCCCACCTNONE 
014-034-H09CCCGGGCCCACCTNONE 
AK120160CCCGGGCCCACCTRemorin, C-terminal region domain containing protein. 
J090034F20CCCGGGCCCACCTNONE 
Os07g0573400006-035-G11CCCGGGCCGAGNONE 
AK061739CCCGGGCCGAGNONE 
AK065116CCCGGGCCGAGNONE 
AK102732CCCGGGCCGAGProtein of unknown function DUF239, plant domain containing protein. 
AK119637CCCGGGCCGAGNONE 
AK121705CCCGGGCCGAGNONE 
Os07g0586700AK102792CCAGGCCCGGGTCGGATCConserved hypothetical protein. 
Os07g0661600006-050-D12ACGCGTGGGCCCGGGNONE 
009-124-B10ACGCGTGGGCCCGGGNONE 
AK061123ACGCGTGGGCCCGGGNONE 
AK066432ACGCGTGGGCCCGGGSimilar to RNA-binding protein-like protein. 
AK104664ACGCGTGGGCCCGGGNONE 
J013064M13ACGCGTGGGCCCGGGNONE 
J013122O12ACGCGTGGGCCCGGGNONE 
J033044A16ACGCGTGGGCCCGGGNONE 
J033144D14ACGCGTGGGCCCGGGNONE 
J090078P13ACGCGTGGGCCCGGGNONE 
Os08g0119500J080315K03CCCGGGCCMethyltransferase type 11 domain containing protein. 
Os08g0120000006-042-E02CCCGGGCCCACANONE 
006-051-F06CCCGGGCCCACANONE 
006-052-G03CCCGGGCCCACANONE 
006-095-B11CCCGGGCCCACANONE 
AB017427CCCGGGCCCACANONE 
AB017428CCCGGGCCCACANONE 
AK059789CCCGGGCCCACANONE 
AK059815CCCGGGCCCACASuccinate dehydrogenase iron-protein subunit (SDHB). 
AK099077CCCGGGCCCACANONE 
AK102607CCCGGGCCCACANONE 
AK104303CCCGGGCCCACANONE 
AK104304CCCGGGCCCACANONE 
AK104421CCCGGGCCCACANONE 
D10414CCCGGGCCCACANONE 
J013170D08CCCGGGCCCACANONE 
J023086D16CCCGGGCCCACANONE 
J033099B04CCCGGGCCCACANONE 
J065042P05CCCGGGCCCACANONE 
J065144E22CCCGGGCCCACANONE 
J065162J20CCCGGGCCCACANONE 
J065196N13CCCGGGCCCACANONE 
J090013B11CCCGGGCCCACANONE 
Os08g0128200AK120428CGTGTGGGCCCGGGConserved hypothetical protein. 
Os08g0160600AK106763CCCGGGCCCCACCTGTConserved hypothetical protein. 
Os08g0544800009-168-G01CCCGGGCCNONE 
011-046-D09CCCGGGCCNONE 
012-003-C08CCCGGGCCNONE 
012-042-B06CCCGGGCCNONE 
013-035-H12CCCGGGCCNONE 
013-072-A10CCCGGGCCNONE 
014-010-B11CCCGGGCCNONE 
014-097-E06CCCGGGCCNONE 
015-003-E12CCCGGGCCNONE 
015-040-B04CCCGGGCCNONE 
AK060536CCCGGGCCNONE 
AK102666CCCGGGCCNONE 
AK119660CCCGGGCCPCF2. 
D87261CCCGGGCCNONE 
J090049N23CCCGGGCCNONE 
J090084G06CCCGGGCCNONE 
Os09g0360400009-192-H06AAGGCCCACCCGGCCCGGGNONE 
AK071395AAGGCCCACCCGGCCCGGGConserved hypothetical protein. 
J013045J21AAGGCCCACCCGGCCCGGGNONE 
J023095O09AAGGCCCACCCGGCCCGGGNONE 
J065207K01AAGGCCCACCCGGCCCGGGNONE 
Os09g0424600AK073882CCCGGGCCHAD superfamily (subfamily IG) hydrolase, 5'-Nucleotidase protein. 
AK073882CGGCCCGGGHAD superfamily (subfamily IG) hydrolase, 5'-Nucleotidase protein. 
Os09g0461500006-107-E02GGCCCGGGCCGNONE 
011-089-D02GGCCCGGGCCGNONE 
AK063400GGCCCGGGCCGNONE 
AK102328GGCCCGGGCCGEsterase/lipase/thioesterase domain containing protein. 
J033090L22GGCCCGGGCCGNONE 
J065031O14GGCCCGGGCCGNONE 
J065083D22GGCCCGGGCCGNONE 
J065182N14GGCCCGGGCCGNONE 
J065190H22GGCCCGGGCCGNONE 
J065219H11GGCCCGGGCCGNONE 
J075007O22GGCCCGGGCCGNONE 
J075025E09GGCCCGGGCCGNONE 
J075041K24GGCCCGGGCCGNONE 
J075046F11GGCCCGGGCCGNONE 
J090032E12GGCCCGGGCCGNONE 
Os09g0465600AB107218CCCGGGCCCACCTNONE 
AK068061CCCGGGCCCACCTSimilar to Glucose-6-phosphate isomerase-like protein (Fragment). 
AY224509CCCGGGCCCACCTNONE 
Os09g0468900AK120990CCCGGGCCConserved hypothetical protein. 
J013123P13CCCGGGCCNONE 
J023013I09CCCGGGCCNONE 
J023023G08CCCGGGCCNONE 
J023043E08CCCGGGCCNONE 
J033124D24CCCGGGCCNONE 
J065047I07CCCGGGCCNONE 
J065093C16CCCGGGCCNONE 
J090088O03CCCGGGCCNONE 
J100032M21CCCGGGCCNONE 
Os09g0491772011-007-H10CCCGGGCCCACCNONE 
012-015-C11CCCGGGCCCACCNONE 
012-060-G11CCCGGGCCCACCNONE 
015-020-F09CCCGGGCCCACCNONE 
015-035-F07CCCGGGCCCACCNONE 
016-035-G11CCCGGGCCCACCNONE 
AK069787CCCGGGCCCACCSimilar to Heat shock protein 70 (Hsc70-5). 
J023030H18CCCGGGCCCACCNONE 
J023060K21CCCGGGCCCACCNONE 
J023079I08CCCGGGCCCACCNONE 
J023111B17CCCGGGCCCACCNONE 
J023123E03CCCGGGCCCACCNONE 
J023125B22CCCGGGCCCACCNONE 
J023126H24CCCGGGCCCACCNONE 
J023131N16CCCGGGCCCACCNONE 
J023149M09CCCGGGCCCACCNONE 
J033022H04CCCGGGCCCACCNONE 
J033022L09CCCGGGCCCACCNONE 
J033038H14CCCGGGCCCACCNONE 
J033044M15CCCGGGCCCACCNONE 
J033044O04CCCGGGCCCACCNONE 
J033050E01CCCGGGCCCACCNONE 
J033066L09CCCGGGCCCACCNONE 
J033075I19CCCGGGCCCACCNONE 
J033079F17CCCGGGCCCACCNONE 
J033093L14CCCGGGCCCACCNONE 
J033094C14CCCGGGCCCACCNONE 
J033094G07CCCGGGCCCACCNONE 
J033101G06CCCGGGCCCACCNONE 
J033103D07CCCGGGCCCACCNONE 
J033105K18CCCGGGCCCACCNONE 
J033112M23CCCGGGCCCACCNONE 
J033119D21CCCGGGCCCACCNONE 
J033121G18CCCGGGCCCACCNONE 
J033124B01CCCGGGCCCACCNONE 
J033126C07CCCGGGCCCACCNONE 
J033140K24CCCGGGCCCACCNONE 
J033141P13CCCGGGCCCACCNONE 
J033142K24CCCGGGCCCACCNONE 
J043024P12CCCGGGCCCACCNONE 
J043031P09CCCGGGCCCACCNONE 
J043039O09CCCGGGCCCACCNONE 
J065101K22CCCGGGCCCACCNONE 
J065136K09CCCGGGCCCACCNONE 
J090004J08CCCGGGCCCACCNONE 
J090010F03CCCGGGCCCACCNONE 
J090014L23CCCGGGCCCACCNONE 
J090020E05CCCGGGCCCACCNONE 
J090032D02CCCGGGCCCACCNONE 
J090048A04CCCGGGCCCACCNONE 
J090061G05CCCGGGCCCACCNONE 
Os09g0516600AK070780CCCGGGCCCACCAGCCCAGNONE 
AK103563CCCGGGCCCACCAGCCCAGNONE 
AY054407CCCGGGCCCACCAGCCCAGGlyoxalase II. 
J013058P06CCCGGGCCCACCAGCCCAGNONE 
J013093G04CCCGGGCCCACCAGCCCAGNONE 
J023007G05CCCGGGCCCACCAGCCCAGNONE 
J023091A08CCCGGGCCCACCAGCCCAGNONE 
J023136K23CCCGGGCCCACCAGCCCAGNONE 
J023138D20CCCGGGCCCACCAGCCCAGNONE 
J033022N20CCCGGGCCCACCAGCCCAGNONE 
J033065N15CCCGGGCCCACCAGCCCAGNONE 
J033109L23CCCGGGCCCACCAGCCCAGNONE 
J053073C08CCCGGGCCCACCAGCCCAGNONE 
J075094J24CCCGGGCCCACCAGCCCAGNONE 
J075106P21CCCGGGCCCACCAGCCCAGNONE 
Os09g0521700014-005-C08GGCCCGGGNONE 
AK063628GGCCCGGGSimilar to H/ACA ribonucleoprotein complex subunit 1 (Nucleolar protein family A member 1) (snoRNP protein GAR1). 
AK064507GGCCCGGGNONE 
Os09g0547200016-021-H03CCCGGGCCCACACACCNONE 
AK073078CCCGGGCCCACACACCProtein of unknown function DUF292, eukaryotic domain containing protein. 
AK104984CCCGGGCCCACACACCNONE 
J065005L05CCCGGGCCCACACACCNONE 
J065039C06CCCGGGCCCACACACCNONE 
J065116H17CCCGGGCCCACACACCNONE 
J100046A17CCCGGGCCCACACACCNONE 
Os11g0216100AK059179ACGTGGGCCCGGGSimilar to Chaperone protein dnaJ. 
Os11g0424400AK071783CCCGGGCCConserved hypothetical protein. 
J023099L19CCCGGGCCNONE 
J023110G02CCCGGGCCNONE 
J023149M21CCCGGGCCNONE 
Os11g0429000AK067370CCCGGGCCCACGCConserved hypothetical protein. 
Os11g0544700AF464904CCCGGGCCCCNONE 
AK072844CCCGGGCCCCRepressor protein. 
J023143I16CCCGGGCCCCNONE 
Os11g0630900AK107482GGCCCGGGMATH domain containing protein. 
Os11g0660000AK066709CCCGGGCCGSodium/calcium exchanger membrane region domain containing protein. 
J013074O18CCCGGGCCGNONE 
J023081H12CCCGGGCCGNONE 
J065072E24CCCGGGCCGNONE 
J065186K08CCCGGGCCGNONE 
J075079E19CCCGGGCCGNONE 
J075093J05CCCGGGCCGNONE 
J075124I21CCCGGGCCGNONE 
J075187F09CCCGGGCCGNONE 
J090037O16CCCGGGCCGNONE 
Os12g0158700J065021C04TGTGGGCCCGGGNONE 
J090082H20TGTGGGCCCGGGConserved hypothetical protein. 
Os12g0210200AF309381TGTGGGCCCGGGNONE 
AK069105TGTGGGCCCGGGSimilar to Glutathione S-transferase GST 18 (EC 2.5.1.18). 
J023004I03TGTGGGCCCGGGNONE 
J033069C11TGTGGGCCCGGGNONE 
J065087E20TGTGGGCCCGGGNONE 
J065097G21TGTGGGCCCGGGNONE 
Os12g0541400AK101210CCCGGGCCCCPrefoldin domain containing protein. 
J033031A17CCCGGGCCCCNONE 
J090051F01CCCGGGCCCCNONE 
Os12g0560300AK060332CCCGGGCCCACGTGTCSimilar to NTGB2 (Fragment). 
AK099125CCCGGGCCCACGTGTCNONE 
AK099149CCCGGGCCCACGTGTCNONE 
J023044P12CCCGGGCCCACGTGTCNONE 
J023063C05CCCGGGCCCACGTGTCNONE 
J043006H11CCCGGGCCCACGTGTCNONE 
J065055C21CCCGGGCCCACGTGTCNONE 
J065104A14CCCGGGCCCACGTGTCNONE 
J075156I06CCCGGGCCCACGTGTCNONE 
J090083J19CCCGGGCCCACGTGTCNONE 
J100069A17CCCGGGCCCACGTGTCNONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.