version

Summary of OsREG540 (All List)

OrganismOryza sativa  
IDOsREG540  
SequenceCCGAGCCG  
Annotation  
PPDB Motif 
PLACE Motif 
Total Entry Count1232  

Entry Sequences (1232 entries)

LocusGene modelSequenceDescription
Os01g0104600AK058683CCGAGCCGNONE 
AK058683CCGAGCCGNONE 
AK058683CCGAGCCGNONE 
AK100613CCGAGCCGSimilar to Light-mediated development protein DET1 (Deetiolated1 homolog) (tDET1) (High pigmentation protein 2) (Protein dark green). 
AK100613CCGAGCCGSimilar to Light-mediated development protein DET1 (Deetiolated1 homolog) (tDET1) (High pigmentation protein 2) (Protein dark green). 
AK100613CCGAGCCGSimilar to Light-mediated development protein DET1 (Deetiolated1 homolog) (tDET1) (High pigmentation protein 2) (Protein dark green). 
J075195M06CCGAGCCGNONE 
J075195M06CCGAGCCGNONE 
J090042G02CCGAGCCGNONE 
J090042G02CCGAGCCGNONE 
Os01g0214500AK062484CAACGGCTCGGConserved hypothetical protein. 
Os01g0235700AK064943CGGCTCGGCTCGGCTCGGCTCGGSimilar to BHLH transcription factor (Fragment). 
AK121013CGGCTCGGCTCGGCTCGGCTCGGNONE 
J023007F05CGGCTCGGCTCGGCTCGGCTCGGNONE 
J023044J06CGGCTCGGCTCGGCTCGGCTCGGNONE 
J023047A22CGGCTCGGCTCGGCTCGGCTCGGNONE 
J023047M20CGGCTCGGCTCGGCTCGGCTCGGNONE 
J023058B22CGGCTCGGCTCGGCTCGGCTCGGNONE 
J023126K20CGGCTCGGCTCGGCTCGGCTCGGNONE 
J023145K20CGGCTCGGCTCGGCTCGGCTCGGNONE 
J090039P10CGGCTCGGCTCGGCTCGGCTCGGNONE 
Os01g0242600AK067756CCGAGCCGC2 calcium/lipid-binding region, CaLB domain containing protein. 
AK098860CCGAGCCGNONE 
J013000N23CCGAGCCGNONE 
J013026B16CCGAGCCGNONE 
J013030A09CCGAGCCGNONE 
J013066I04CCGAGCCGNONE 
J013066P03CCGAGCCGNONE 
J013090L14CCGAGCCGNONE 
J013102C20CCGAGCCGNONE 
J013124H07CCGAGCCGNONE 
J023061K20CCGAGCCGNONE 
J043026K09CCGAGCCGNONE 
J090015G19CCGAGCCGNONE 
J100070B02CCGAGCCGNONE 
Os01g0246100AK120732CCGAGCCGProtein of unknown function DUF902, CREBbp domain containing protein. 
Os01g0277500AK066984CCGAGCCGSimilar to Dof3 gene (Fragment). 
J013074F19CCGAGCCGNONE 
J013091E10CCGAGCCGNONE 
J023077C19CCGAGCCGNONE 
J033068A02CCGAGCCGNONE 
J065137O05CCGAGCCGNONE 
Os01g0290100011-010-D10CCGAGCCGNONE 
011-010-D10CCGAGCCGAGCCGNONE 
011-010-D10CCGAGCCGAGCCGAGCCGAGCCGNONE 
AK069735CCGAGCCGAminotransferase, class V family protein. 
AK069735CCGAGCCGAGCCGAminotransferase, class V family protein. 
AK069735CCGAGCCGAGCCGAGCCGAGCCGAminotransferase, class V family protein. 
J023030G13CCGAGCCGNONE 
J023030G13CCGAGCCGAGCCGNONE 
J023030G13CCGAGCCGAGCCGAGCCGAGCCGNONE 
J023114N11CCGAGCCGNONE 
J023114N11CCGAGCCGAGCCGNONE 
J023114N11CCGAGCCGAGCCGAGCCGAGCCGNONE 
J033076N13CCGAGCCGNONE 
J033076N13CCGAGCCGAGCCGNONE 
J033076N13CCGAGCCGAGCCGAGCCGAGCCGNONE 
J080047J23CCGAGCCGNONE 
J080047J23CCGAGCCGAGCCGNONE 
J080047J23CCGAGCCGAGCCGAGCCGAGCCGNONE 
J080072C21CCGAGCCGNONE 
J080072C21CCGAGCCGAGCCGNONE 
J080072C21CCGAGCCGAGCCGAGCCGAGCCGNONE 
J080092I22CCGAGCCGNONE 
J080092I22CCGAGCCGAGCCGNONE 
J080092I22CCGAGCCGAGCCGAGCCGAGCCGNONE 
J080093A17CCGAGCCGNONE 
J080093A17CCGAGCCGAGCCGNONE 
J080093A17CCGAGCCGAGCCGAGCCGAGCCGNONE 
J080094H02CCGAGCCGNONE 
J080094H02CCGAGCCGAGCCGNONE 
J080094H02CCGAGCCGAGCCGAGCCGAGCCGNONE 
Os01g0305900Os01g0305900CCGAGCCGSimilar to A-type R2R3 Myb protein (Fragment). 
Os01g0391100012-001-B05CCGAGCCGNONE 
012-053-F01CCGAGCCGNONE 
AK063499CCGAGCCGNONE 
J065021A04CCGAGCCGNONE 
J065076H06CCGAGCCGNONE 
J065181E05CCGAGCCGNONE 
J065187A05CCGAGCCGNONE 
J075036C17CCGAGCCGNONE 
J075051C18CCGAGCCGNONE 
J075063L16CCGAGCCGNONE 
J075079M08CCGAGCCGNONE 
J075112H15CCGAGCCGNONE 
J075135F10CCGAGCCGNONE 
J075164H06CCGAGCCGNONE 
J075195N02CCGAGCCGNONE 
Os01g0510600006-075-H02CGGCTCGGCTCTCCGCNONE 
AK072814CGGCTCGGCTCTCCGCTetratricopeptide-like helical domain containing protein. 
AK104796CGGCTCGGCTCTCCGCNONE 
J013028A13CGGCTCGGCTCTCCGCNONE 
J013109A12CGGCTCGGCTCTCCGCNONE 
J023141A19CGGCTCGGCTCTCCGCNONE 
Os01g0539400004-019-C07CGGCTCGGNONE 
AK059524CGGCTCGGConserved hypothetical protein. 
AK106137CGGCTCGGNONE 
J065099M02CGGCTCGGNONE 
J075170M12CGGCTCGGNONE 
Os01g0550300006-081-F12CCGAGCCGAGCCGCGTCGCNONE 
006-114-A02CCGAGCCGAGCCGCGTCGCNONE 
006-117-A04CCGAGCCGAGCCGCGTCGCNONE 
011-003-H03CCGAGCCGAGCCGCGTCGCNONE 
011-025-B09CCGAGCCGAGCCGCGTCGCNONE 
011-069-B06CCGAGCCGAGCCGCGTCGCNONE 
011-074-D07CCGAGCCGAGCCGCGTCGCNONE 
012-029-E03CCGAGCCGAGCCGCGTCGCNONE 
012-050-F04CCGAGCCGAGCCGCGTCGCNONE 
012-072-D11CCGAGCCGAGCCGCGTCGCNONE 
013-093-E04CCGAGCCGAGCCGCGTCGCNONE 
015-070-C10CCGAGCCGAGCCGCGTCGCNONE 
015-089-A01CCGAGCCGAGCCGCGTCGCNONE 
015-095-H06CCGAGCCGAGCCGCGTCGCNONE 
016-014-H08CCGAGCCGAGCCGCGTCGCNONE 
016-056-E07CCGAGCCGAGCCGCGTCGCNONE 
016-089-A01CCGAGCCGAGCCGCGTCGCNONE 
AK061870CCGAGCCGAGCCGCGTCGCSimilar to Gda-1 protein. 
AK067529CCGAGCCGAGCCGCGTCGCNONE 
AK106151CCGAGCCGAGCCGCGTCGCNONE 
J013039D11CCGAGCCGAGCCGCGTCGCNONE 
J013050K19CCGAGCCGAGCCGCGTCGCNONE 
J013069F08CCGAGCCGAGCCGCGTCGCNONE 
J013108E24CCGAGCCGAGCCGCGTCGCNONE 
J013132D19CCGAGCCGAGCCGCGTCGCNONE 
J023039B18CCGAGCCGAGCCGCGTCGCNONE 
J023088C10CCGAGCCGAGCCGCGTCGCNONE 
J023121M13CCGAGCCGAGCCGCGTCGCNONE 
J033034I21CCGAGCCGAGCCGCGTCGCNONE 
J033118N14CCGAGCCGAGCCGCGTCGCNONE 
J033150M22CCGAGCCGAGCCGCGTCGCNONE 
J043004F18CCGAGCCGAGCCGCGTCGCNONE 
J043005J04CCGAGCCGAGCCGCGTCGCNONE 
J043020E12CCGAGCCGAGCCGCGTCGCNONE 
J065063C02CCGAGCCGAGCCGCGTCGCNONE 
J065102D15CCGAGCCGAGCCGCGTCGCNONE 
J065200P03CCGAGCCGAGCCGCGTCGCNONE 
J065208C22CCGAGCCGAGCCGCGTCGCNONE 
J065215B03CCGAGCCGAGCCGCGTCGCNONE 
J075013N21CCGAGCCGAGCCGCGTCGCNONE 
J075024P21CCGAGCCGAGCCGCGTCGCNONE 
J075027L19CCGAGCCGAGCCGCGTCGCNONE 
J075037F12CCGAGCCGAGCCGCGTCGCNONE 
J075084P15CCGAGCCGAGCCGCGTCGCNONE 
J075086M06CCGAGCCGAGCCGCGTCGCNONE 
J075116A02CCGAGCCGAGCCGCGTCGCNONE 
J075136P18CCGAGCCGAGCCGCGTCGCNONE 
J075181A01CCGAGCCGAGCCGCGTCGCNONE 
J075198O11CCGAGCCGAGCCGCGTCGCNONE 
J080002B20CCGAGCCGAGCCGCGTCGCNONE 
J080003E05CCGAGCCGAGCCGCGTCGCNONE 
J080005A18CCGAGCCGAGCCGCGTCGCNONE 
J080005E02CCGAGCCGAGCCGCGTCGCNONE 
J080005O18CCGAGCCGAGCCGCGTCGCNONE 
J080007B04CCGAGCCGAGCCGCGTCGCNONE 
J080007L18CCGAGCCGAGCCGCGTCGCNONE 
J080008C17CCGAGCCGAGCCGCGTCGCNONE 
J080011I03CCGAGCCGAGCCGCGTCGCNONE 
J080014B07CCGAGCCGAGCCGCGTCGCNONE 
J080014B09CCGAGCCGAGCCGCGTCGCNONE 
J080015A11CCGAGCCGAGCCGCGTCGCNONE 
J080016B07CCGAGCCGAGCCGCGTCGCNONE 
J080017H23CCGAGCCGAGCCGCGTCGCNONE 
J080020G09CCGAGCCGAGCCGCGTCGCNONE 
J080020I23CCGAGCCGAGCCGCGTCGCNONE 
J080021E15CCGAGCCGAGCCGCGTCGCNONE 
J080023O13CCGAGCCGAGCCGCGTCGCNONE 
J080024H17CCGAGCCGAGCCGCGTCGCNONE 
J080029P12CCGAGCCGAGCCGCGTCGCNONE 
J080030A15CCGAGCCGAGCCGCGTCGCNONE 
J080032I03CCGAGCCGAGCCGCGTCGCNONE 
J080032P18CCGAGCCGAGCCGCGTCGCNONE 
J080034E10CCGAGCCGAGCCGCGTCGCNONE 
J080038I23CCGAGCCGAGCCGCGTCGCNONE 
J080040B22CCGAGCCGAGCCGCGTCGCNONE 
J080040M13CCGAGCCGAGCCGCGTCGCNONE 
J080041E07CCGAGCCGAGCCGCGTCGCNONE 
J080042C08CCGAGCCGAGCCGCGTCGCNONE 
J080042H08CCGAGCCGAGCCGCGTCGCNONE 
J080043H10CCGAGCCGAGCCGCGTCGCNONE 
J080046J02CCGAGCCGAGCCGCGTCGCNONE 
J080050D12CCGAGCCGAGCCGCGTCGCNONE 
J080052C17CCGAGCCGAGCCGCGTCGCNONE 
J080054A05CCGAGCCGAGCCGCGTCGCNONE 
J080054J23CCGAGCCGAGCCGCGTCGCNONE 
J080056A15CCGAGCCGAGCCGCGTCGCNONE 
J080056F18CCGAGCCGAGCCGCGTCGCNONE 
J080059P07CCGAGCCGAGCCGCGTCGCNONE 
J080063J18CCGAGCCGAGCCGCGTCGCNONE 
J080066F15CCGAGCCGAGCCGCGTCGCNONE 
J080067G12CCGAGCCGAGCCGCGTCGCNONE 
J080070G15CCGAGCCGAGCCGCGTCGCNONE 
J080071B08CCGAGCCGAGCCGCGTCGCNONE 
J080071M08CCGAGCCGAGCCGCGTCGCNONE 
J080071N03CCGAGCCGAGCCGCGTCGCNONE 
J080074C01CCGAGCCGAGCCGCGTCGCNONE 
J080076F22CCGAGCCGAGCCGCGTCGCNONE 
J080076N23CCGAGCCGAGCCGCGTCGCNONE 
J080077F23CCGAGCCGAGCCGCGTCGCNONE 
J080077P10CCGAGCCGAGCCGCGTCGCNONE 
J080078A19CCGAGCCGAGCCGCGTCGCNONE 
J080078H07CCGAGCCGAGCCGCGTCGCNONE 
J080079G16CCGAGCCGAGCCGCGTCGCNONE 
J080079N23CCGAGCCGAGCCGCGTCGCNONE 
J080084L04CCGAGCCGAGCCGCGTCGCNONE 
J080084N12CCGAGCCGAGCCGCGTCGCNONE 
J080084N17CCGAGCCGAGCCGCGTCGCNONE 
J080086H08CCGAGCCGAGCCGCGTCGCNONE 
J080088M01CCGAGCCGAGCCGCGTCGCNONE 
J080090M14CCGAGCCGAGCCGCGTCGCNONE 
J080092F06CCGAGCCGAGCCGCGTCGCNONE 
J080095B14CCGAGCCGAGCCGCGTCGCNONE 
J080095C09CCGAGCCGAGCCGCGTCGCNONE 
J080095F20CCGAGCCGAGCCGCGTCGCNONE 
J080095H12CCGAGCCGAGCCGCGTCGCNONE 
J080096H22CCGAGCCGAGCCGCGTCGCNONE 
J090010O21CCGAGCCGAGCCGCGTCGCNONE 
J090012K22CCGAGCCGAGCCGCGTCGCNONE 
J090051I21CCGAGCCGAGCCGCGTCGCNONE 
J090065G14CCGAGCCGAGCCGCGTCGCNONE 
J090077H03CCGAGCCGAGCCGCGTCGCNONE 
J100035M10CCGAGCCGAGCCGCGTCGCNONE 
J100049C19CCGAGCCGAGCCGCGTCGCNONE 
J100051K11CCGAGCCGAGCCGCGTCGCNONE 
J100064C12CCGAGCCGAGCCGCGTCGCNONE 
J100064F13CCGAGCCGAGCCGCGTCGCNONE 
J100084H08CCGAGCCGAGCCGCGTCGCNONE 
Os01g0650000009-079-D11CCGAGCCGNONE 
AK062640CCGAGCCGLipolytic enzyme, G-D-S-L family protein. 
AK072891CCGAGCCGNONE 
J075163B04CCGAGCCGNONE 
J075182F14CCGAGCCGNONE 
Os01g0681200AK066286CCGAGCCGSimilar to Acyl-CoA synthetase (EC 6.2.1.3). 
AK101149CCGAGCCGNONE 
Os01g0683400AB110983CGGCTCGGNONE 
AK102997CGGCTCGGSimilar to Origin recognition complex 4. 
J033116E22CGGCTCGGNONE 
J090087A03CGGCTCGGNONE 
Os01g0731000009-180-B08CGGCTCGGNONE 
J043004N04CGGCTCGGConserved hypothetical protein. 
Os01g0736600009-105-F04CCGAGCCGNONE 
014-035-D08CCGAGCCGNONE 
AK099546CCGAGCCGZinc finger, RING-type domain containing protein. 
AK105189CCGAGCCGNONE 
J065155B14CCGAGCCGNONE 
J075007F01CCGAGCCGNONE 
Os01g0743400AK059177CCGAGCCGGCCCSimilar to Tryptophanyl-tRNA synthetase (Fragment). 
AK069114CCGAGCCGGCCCNONE 
J065070E07CCGAGCCGGCCCNONE 
J065152G11CCGAGCCGGCCCNONE 
Os01g0749400AK064990CCGAGCCGNONE 
AK067731CCGAGCCGHAD-superfamily hydrolase subfamily IIB protein. 
AK103775CCGAGCCGNONE 
J023001B06CCGAGCCGNONE 
Os01g0758400AK059301CCGAGCCGNONE 
AK071777CCGAGCCGSimilar to Phosphatidate cytidylyltransferase (EC 2.7.7.41) (CDP-diglyceride synthetase) (CDP-diglyceride pyrophosphorylase) (CDP-diacylglycerol synthase) (CDS) (CTP:phosphatidate cytidylyltransferase) (CDP-DAG synthase) (CDP-DG synthetase). 
Os01g0776700J065046N20CGCGTCTCGTCGCGTCGGCTCGGConserved hypothetical protein. 
J100086L02CGCGTCTCGTCGCGTCGGCTCGGNONE 
Os01g0782300AK109175CGGCTCGGCTCGGCTCGGConserved hypothetical protein. 
Os01g0803200009-028-E02CGGCTCGGNONE 
AF435976CGGCTCGGNONE 
AK072206CGGCTCGGNONE 
AK121632CGGCTCGGNONE 
D29717CGGCTCGGNONE 
J013088C04CGGCTCGGNONE 
J023110F17CGGCTCGGNONE 
J033029J21CGGCTCGGNONE 
J033050G08CGGCTCGGNONE 
J033121L08CGGCTCGGNONE 
J03469CGGCTCGGNONE 
J043040J18CGGCTCGGNONE 
J065009B11CGGCTCGGNONE 
J065037D05CGGCTCGGNONE 
J065046C08CGGCTCGGNONE 
J065051M08CGGCTCGGNONE 
J065059H24CGGCTCGGNONE 
J065060A10CGGCTCGGNONE 
J065075N07CGGCTCGGNONE 
J065088G17CGGCTCGGNONE 
J065111I03CGGCTCGGNONE 
J065122A02CGGCTCGGNONE 
J065128L10CGGCTCGGNONE 
J065134A09CGGCTCGGNONE 
J065162H09CGGCTCGGNONE 
J065178F05CGGCTCGGNONE 
J065209J08CGGCTCGGNONE 
J065217F08CGGCTCGGNONE 
J075023A10CGGCTCGGNONE 
J075023H20CGGCTCGGNONE 
J075048H09CGGCTCGGNONE 
J075062K16CGGCTCGGNONE 
J075074F03CGGCTCGGNONE 
J075080G02CGGCTCGGNONE 
J075125J09CGGCTCGGNONE 
J075125L15CGGCTCGGNONE 
J075152L15CGGCTCGGNONE 
J075173B03CGGCTCGGNONE 
J075177M22CGGCTCGGNONE 
J080001B16CGGCTCGGNONE 
J080005K01CGGCTCGGNONE 
J080005L08CGGCTCGGNONE 
J080005N22CGGCTCGGNONE 
J080007B02CGGCTCGGNONE 
J080008E24CGGCTCGGNONE 
J080008L18CGGCTCGGNONE 
J080009H13CGGCTCGGNONE 
J080010E21CGGCTCGGNONE 
J080011D21CGGCTCGGNONE 
J080011P22CGGCTCGGNONE 
J080013A16CGGCTCGGNONE 
J080016M01CGGCTCGGNONE 
J080017A09CGGCTCGGNONE 
J080020A09CGGCTCGGNONE 
J080023B21CGGCTCGGNONE 
J080023L04CGGCTCGGNONE 
J080023M10CGGCTCGGNONE 
J080028B02CGGCTCGGNONE 
J080031E01CGGCTCGGNONE 
J080036N13CGGCTCGGNONE 
J080036N17CGGCTCGGNONE 
J080037M05CGGCTCGGNONE 
J080043K21CGGCTCGGNONE 
J080043M11CGGCTCGGNONE 
J080044I08CGGCTCGGNONE 
J080044N16CGGCTCGGNONE 
J080049L02CGGCTCGGNONE 
J080050H04CGGCTCGGNONE 
J080054G17CGGCTCGGNONE 
J080054G21CGGCTCGGNONE 
J080057A13CGGCTCGGNONE 
J080057G02CGGCTCGGNONE 
J080057G23CGGCTCGGNONE 
J080061A19CGGCTCGGNONE 
J080062A13CGGCTCGGNONE 
J080062J22CGGCTCGGNONE 
J080063G15CGGCTCGGNONE 
J080066A18CGGCTCGGNONE 
J080066E03CGGCTCGGNONE 
J080067E10CGGCTCGGNONE 
J080069L14CGGCTCGGNONE 
J080071I09CGGCTCGGNONE 
J080076E22CGGCTCGGNONE 
J080078L03CGGCTCGGNONE 
J080078L15CGGCTCGGNONE 
J080081G17CGGCTCGGNONE 
J080083C20CGGCTCGGNONE 
J080083J03CGGCTCGGNONE 
J080086C02CGGCTCGGNONE 
J080088E16CGGCTCGGNONE 
J080090A03CGGCTCGGNONE 
J080090C14CGGCTCGGNONE 
J080090F11CGGCTCGGNONE 
J080093N06CGGCTCGGNONE 
J080094B22CGGCTCGGNONE 
J080094C11CGGCTCGGNONE 
J080096E22CGGCTCGGNONE 
J080096F18CGGCTCGGNONE 
J080301K11CGGCTCGGNONE 
J080302C22CGGCTCGGNONE 
J080304K12CGGCTCGGNONE 
J080317G06CGGCTCGGNONE 
J080318L23CGGCTCGGNONE 
J090047A06CGGCTCGGNONE 
J100025M24CGGCTCGGNONE 
J100026O09CGGCTCGGNONE 
J100027D03CGGCTCGGNONE 
J100028C19CGGCTCGGNONE 
J100028D07CGGCTCGGNONE 
J100031H13CGGCTCGGNONE 
J100054J03CGGCTCGGNONE 
J100055D24CGGCTCGGNONE 
J100059L24CGGCTCGGNONE 
J100062D23CGGCTCGGNONE 
J100062F02CGGCTCGGNONE 
J100063G22CGGCTCGGNONE 
J100064A04CGGCTCGGNONE 
J100064P17CGGCTCGGNONE 
J100065F17CGGCTCGGNONE 
J100072F05CGGCTCGGNONE 
J100077D21CGGCTCGGNONE 
J100081B17CGGCTCGGNONE 
J100087G09CGGCTCGGNONE 
J100090G01CGGCTCGGNONE 
U54702CGGCTCGGNONE 
Os01g0805000009-045-H11CAACGGCCGGCTCGGNONE 
009-196-H08CAACGGCCGGCTCGGNONE 
J013094D22CAACGGCCGGCTCGGRibosomal protein L34 family protein. 
J013119F23CAACGGCCGGCTCGGNONE 
J065128B11CAACGGCCGGCTCGGNONE 
Os01g0818000AK069848CGGCTCGGCTCAGCTNONE 
AK070194CGGCTCGGCTCAGCTAuxin Efflux Carrier family protein. 
J023041H12CGGCTCGGCTCAGCTNONE 
Os01g0824900006-026-B01CGGCTCGGNONE 
AK061414CGGCTCGGConserved hypothetical protein. 
Os01g0827400AK108526CGGCTCGGPrenylated rab acceptor PRA1 family protein. 
J065099C03CGGCTCGGNONE 
J075090E23CGGCTCGGNONE 
Os01g0834200AK069188CCGAGCCGNONE 
AK100543CCGAGCCGSimilar to T-cell immune regulator 1 transcript variant 3 (Fragment). 
Os01g0853400AK121543CCGAGCCGNONE 
AY168645CCGAGCCGNONE 
Os01g0863166J065007F23CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
J065124H21CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGConserved hypothetical protein. 
Os01g0870100AK067564CGGCTCGGProtein of unknown function DUF1012 family protein. 
AK072312CGGCTCGGNONE 
AK103428CGGCTCGGNONE 
Os01g0902300Os01g0902300CGGCTCGGCTCGGEsterase/lipase/thioesterase domain containing protein. 
Os01g0904200AK068432GGACGGCTCGGProtein kinase-like domain containing protein. 
J100027C22GGACGGCTCGGNONE 
J100064A19GGACGGCTCGGNONE 
Os01g0950900AK101121CCGAGCCGAGCCGProtein of unknown function DUF221 domain containing protein. 
AK101121CCGAGCCGCGTCGCProtein of unknown function DUF221 domain containing protein. 
J023036H24CCGAGCCGAGCCGNONE 
J023036H24CCGAGCCGCGTCGCNONE 
J023084G23CCGAGCCGAGCCGNONE 
J023084G23CCGAGCCGCGTCGCNONE 
J033025J04CCGAGCCGAGCCGNONE 
J033025J04CCGAGCCGCGTCGCNONE 
J033139J18CCGAGCCGAGCCGNONE 
J033139J18CCGAGCCGCGTCGCNONE 
J090006A09CCGAGCCGAGCCGNONE 
J090006A09CCGAGCCGCGTCGCNONE 
J090036D02CCGAGCCGAGCCGNONE 
J090036D02CCGAGCCGCGTCGCNONE 
Os01g0972000006-090-C11CCGAGCCGNONE 
AK106003CCGAGCCGZinc finger, RING-type domain containing protein. 
J065184F12CCGAGCCGNONE 
J075085O21CCGAGCCGNONE 
Os01g0973400AK060011AGATGGGCCGGGCCGGGCCGAGCCGNONE 
AK068879AGATGGGCCGGGCCGGGCCGAGCCGConserved hypothetical protein 48 family protein. 
AK099210AGATGGGCCGGGCCGGGCCGAGCCGNONE 
AK104863AGATGGGCCGGGCCGGGCCGAGCCGNONE 
J013170C09AGATGGGCCGGGCCGGGCCGAGCCGNONE 
J033106K13AGATGGGCCGGGCCGGGCCGAGCCGNONE 
J075018P18AGATGGGCCGGGCCGGGCCGAGCCGNONE 
J075039C18AGATGGGCCGGGCCGGGCCGAGCCGNONE 
J075104L18AGATGGGCCGGGCCGGGCCGAGCCGNONE 
Os02g0135700AK100570CGGCTCGGDNA polymerase V family protein. 
Os02g0173100AK066680CCGAGCCGNONE 
AK100596CCGAGCCGSimilar to Cytochrome P450 97B3 (EC 1.14.-.-). 
J023106P10CCGAGCCGNONE 
Os02g0245000AK119770CCGAGCCGNONE 
Os02g0287000006-107-B10CCGAGCCGNONE 
006-120-E07CCGAGCCGNONE 
AF052503CCGAGCCGNONE 
AK059647CCGAGCCGSimilar to 40S ribosomal protein S3a (CYC07 protein). 
AK099131CCGAGCCGNONE 
J023048M05CCGAGCCGNONE 
J033107L10CCGAGCCGNONE 
J065019A12CCGAGCCGNONE 
J065064J21CCGAGCCGNONE 
J065071D15CCGAGCCGNONE 
J065094L12CCGAGCCGNONE 
J065095L06CCGAGCCGNONE 
J065097J11CCGAGCCGNONE 
J065099M08CCGAGCCGNONE 
J065104D01CCGAGCCGNONE 
J065107L02CCGAGCCGNONE 
J065110D14CCGAGCCGNONE 
J065135J07CCGAGCCGNONE 
J065137C16CCGAGCCGNONE 
J065150C07CCGAGCCGNONE 
J065165I10CCGAGCCGNONE 
J065189F07CCGAGCCGNONE 
J065205L22CCGAGCCGNONE 
J065214C09CCGAGCCGNONE 
J065217G17CCGAGCCGNONE 
J075029E17CCGAGCCGNONE 
J075054O16CCGAGCCGNONE 
J075068N23CCGAGCCGNONE 
J075135N18CCGAGCCGNONE 
J075152G09CCGAGCCGNONE 
J075162D10CCGAGCCGNONE 
J075164F11CCGAGCCGNONE 
J080036L12CCGAGCCGNONE 
J080049K18CCGAGCCGNONE 
J080060P03CCGAGCCGNONE 
J080062G16CCGAGCCGNONE 
J080062G21CCGAGCCGNONE 
J080064N07CCGAGCCGNONE 
J080075I22CCGAGCCGNONE 
J080086F20CCGAGCCGNONE 
J080087G07CCGAGCCGNONE 
J080088I06CCGAGCCGNONE 
J080302B20CCGAGCCGNONE 
J080303L14CCGAGCCGNONE 
J080309O12CCGAGCCGNONE 
J080317F12CCGAGCCGNONE 
J080317P18CCGAGCCGNONE 
J090013L15CCGAGCCGNONE 
J090043N04CCGAGCCGNONE 
J090085G01CCGAGCCGNONE 
J090085G19CCGAGCCGNONE 
Os02g0532300AK061527CCGAGCCGEsterase/lipase/thioesterase domain containing protein. 
AK099017CCGAGCCGNONE 
AK104452CCGAGCCGNONE 
AK107958CCGAGCCGNONE 
AK119210CCGAGCCGNONE 
J013119A16CCGAGCCGNONE 
J100056C15CCGAGCCGNONE 
J100080G13CCGAGCCGNONE 
Os02g0566300AK066077CGGCTCGGNONE 
Os02g0610500AK058536CGGCTCGGSimilar to CONSTANS-like protein CO9 (Fragment). 
AK100097CGGCTCGGNONE 
J090016D17CGGCTCGGNONE 
J090077O10CGGCTCGGNONE 
J090097J09CGGCTCGGNONE 
J100054K15CGGCTCGGNONE 
J100066N13CGGCTCGGNONE 
J100072H14CGGCTCGGNONE 
Os02g0616600AK106681CCGAGCCGConserved hypothetical protein. 
AK106681CCGAGCCGGCCCAAATCGGCCCACACConserved hypothetical protein. 
J065062G16CCGAGCCGNONE 
J065062G16CCGAGCCGGCCCAAATCGGCCCACACNONE 
Os02g0626100003-107-B06CGGCTCGGNONE 
AK120127CGGCTCGGNONE 
Os02g0639300015-001-B08CGGCTCGGNONE 
015-025-G04CGGCTCGGNONE 
AK101596CGGCTCGGCBS domain containing protein. 
J033051G14CGGCTCGGNONE 
J065045C18CGGCTCGGNONE 
Os02g0654100AK101814CCGAGCCGSimilar to Enoyl-CoA hydratase. 
Os02g0684400008-002-F10CGGCTCGGNONE 
AK065103CGGCTCGGConserved hypothetical protein. 
J013001N07CGGCTCGGNONE 
J065161G12CGGCTCGGNONE 
J100064F24CGGCTCGGNONE 
J100074K01CGGCTCGGNONE 
J100083A09CGGCTCGGNONE 
J100083E03CGGCTCGGNONE 
J100088P03CGGCTCGGNONE 
Os02g0689200011-024-D04CCGAGCCGAGCCGNONE 
AK065336CCGAGCCGAGCCGNONE 
AK071254CCGAGCCGAGCCGNONE 
J013000O22CCGAGCCGAGCCGNONE 
J023087G23CCGAGCCGAGCCGNONE 
J033095E21CCGAGCCGAGCCGNONE 
J033113F12CCGAGCCGAGCCGNONE 
J033124F02CCGAGCCGAGCCGNONE 
J065070A01CCGAGCCGAGCCGNONE 
J065129C05CCGAGCCGAGCCGNONE 
J065165M19CCGAGCCGAGCCGNONE 
J090015K07CCGAGCCGAGCCGNONE 
J090016L11CCGAGCCGAGCCGNONE 
J090066D21CCGAGCCGAGCCGNONE 
J090075M20CCGAGCCGAGCCGNONE 
Os02g0717600J090003H19CGGCTCGGCCCNONE 
J100090A12CGGCTCGGCCCConserved hypothetical protein. 
Os02g0743400AF056027CGGCTCGGNONE 
AK099634CGGCTCGGNONE 
AK102343CGGCTCGGAuxin transport protein REH1. 
Os02g0782100AK065421CGGCTCGGCGGGTCGChorismate synthase family protein. 
J065038A03CGGCTCGGCGGGTCGNONE 
Os02g0801900006-113-E02CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
AK109488CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
AK109498CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGConserved hypothetical protein. 
J065007D19CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
J065035G11CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
J065044E05CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
J065112N01CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
J065143B03CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
J065159A16CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
J090007K23CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
J090045N09CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
J090049L20CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
Os03g0113700AK103835CCGAGCCGSimilar to Heat shock 70 kDa protein, mitochondrial precursor. 
Os03g0125100Os03g0125100CCGAGCCGSimilar to Beta-ring hydroxylase (Fragment). 
Os03g0157700015-011-D01CCGAGCCGAGCCGAGCCGNONE 
AK102075CCGAGCCGAGCCGAGCCGProtein of unknown function DUF639 family protein. 
AK106245CCGAGCCGAGCCGAGCCGNONE 
J075144I02CCGAGCCGAGCCGAGCCGNONE 
Os03g0177100AK068092GGGCCGAGCCGConserved hypothetical protein. 
J100036F01GGGCCGAGCCGNONE 
J100040N06GGGCCGAGCCGNONE 
J100043E08GGGCCGAGCCGNONE 
Os03g0183200AK106987CGGCTCGGConserved hypothetical protein. 
J065001J11CGGCTCGGNONE 
J065013J06CGGCTCGGNONE 
J065025E10CGGCTCGGNONE 
J065039L04CGGCTCGGNONE 
J065041H08CGGCTCGGNONE 
J065046C23CGGCTCGGNONE 
J065049D09CGGCTCGGNONE 
J065057M12CGGCTCGGNONE 
J065083P08CGGCTCGGNONE 
J065096G10CGGCTCGGNONE 
J065132D06CGGCTCGGNONE 
J065139F18CGGCTCGGNONE 
J065159E02CGGCTCGGNONE 
J075161E24CGGCTCGGNONE 
J075182J22CGGCTCGGNONE 
J100053C12CGGCTCGGNONE 
J100085D04CGGCTCGGNONE 
Os03g0201100AK102337CCGAGCCGAGCCGSimilar to Cyclophilin-like protein PPIL3b. 
J033091A16CCGAGCCGAGCCGNONE 
J075063K10CCGAGCCGAGCCGNONE 
J075092L23CCGAGCCGAGCCGNONE 
J075093A14CCGAGCCGAGCCGNONE 
Os03g0222800014-005-F12CCGAGCCGTTGNONE 
AK109454CCGAGCCGTTGNONE 
J065172P19CCGAGCCGTTGNONE 
Os03g0231800AK065032CCGAGCCGSimilar to Squalene monooxygenase 1 (EC 1.14.99.7). 
AK098895CCGAGCCGNONE 
Os03g0238700AK073387CGGCTCGGSimilar to Acid phosphatase type 5. 
J033043K11CGGCTCGGNONE 
Os03g0239200AK068650CCGAGCCGAGCCGNONE 
AK068684CCGAGCCGAGCCGNONE 
AK099748CCGAGCCGAGCCGNONE 
AK100953CCGAGCCGAGCCGArabidopsis thaliana 130.7kDa hypothetical protein family protein. 
J013071G21CCGAGCCGAGCCGNONE 
J013095O16CCGAGCCGAGCCGNONE 
J013159C13CCGAGCCGAGCCGNONE 
J023007I19CCGAGCCGAGCCGNONE 
J023081K03CCGAGCCGAGCCGNONE 
J023112O11CCGAGCCGAGCCGNONE 
J023139M22CCGAGCCGAGCCGNONE 
J033026N14CCGAGCCGAGCCGNONE 
J033058B12CCGAGCCGAGCCGNONE 
J033075E21CCGAGCCGAGCCGNONE 
J033089O14CCGAGCCGAGCCGNONE 
J033093J08CCGAGCCGAGCCGNONE 
J033099E03CCGAGCCGAGCCGNONE 
J033125G09CCGAGCCGAGCCGNONE 
J033138I04CCGAGCCGAGCCGNONE 
J033138K09CCGAGCCGAGCCGNONE 
J033148O03CCGAGCCGAGCCGNONE 
J065138N07CCGAGCCGAGCCGNONE 
J065152H11CCGAGCCGAGCCGNONE 
J065216F23CCGAGCCGAGCCGNONE 
J090008C05CCGAGCCGAGCCGNONE 
J090022K17CCGAGCCGAGCCGNONE 
J090038H09CCGAGCCGAGCCGNONE 
J100027H01CCGAGCCGAGCCGNONE 
J100038E07CCGAGCCGAGCCGNONE 
J100045L24CCGAGCCGAGCCGNONE 
Os03g0255900009-164-C12CGGCTCGGNONE 
AK063057CGGCTCGGConserved hypothetical protein. 
Os03g0261100009-036-C08CGGCTCGGNONE 
AJ238117CGGCTCGGNONE 
AK071135CGGCTCGGPhospholipase A2 family protein. 
J075030I07CGGCTCGGNONE 
Os03g0261800AK060717CCGAGCCGNONE 
AK121181CCGAGCCGConserved hypothetical protein. 
J023084D19CCGAGCCGNONE 
J065127D11CCGAGCCGNONE 
J065179G15CCGAGCCGNONE 
J090050I07CCGAGCCGNONE 
Os03g0275900AK109303CCGAGCCGAGCCGNONE 
AK121978CCGAGCCGAGCCGSimilar to Spotted leaf protein 11 (Spotted leaf11) (Cell death-related protein SPL11). 
Os03g0279200009-097-C06CCGAGCCGTCCNONE 
013-007-B07CCGAGCCGTCCNONE 
AK121750CCGAGCCGTCCSimilar to Histone H2A. 
J033087I02CCGAGCCGTCCNONE 
J065002G20CCGAGCCGTCCNONE 
J065102M04CCGAGCCGTCCNONE 
J065139A02CCGAGCCGTCCNONE 
J075109D21CCGAGCCGTCCNONE 
J075191L12CCGAGCCGTCCNONE 
J090096C03CCGAGCCGTCCNONE 
J100036C23CCGAGCCGTCCNONE 
Os03g0309200AB109892CCGAGCCGNONE 
AK071993CCGAGCCGSimilar to Phytochrome B. 
J065170O20CCGAGCCGNONE 
J065188J12CCGAGCCGNONE 
J100042I03CCGAGCCGNONE 
J100061O20CCGAGCCGNONE 
Os03g0324900014-018-F11CGGCTCGGNONE 
AK068144CGGCTCGGZinc finger, RING-type domain containing protein. 
Os03g0327100006-119-C12CGGCTCGGNONE 
011-018-C10CGGCTCGGNONE 
AK065989CGGCTCGGSimilar to CUC1. 
J013046E14CGGCTCGGNONE 
J065066N20CGGCTCGGNONE 
Os03g0336200AK059473CGGCTCGGNONE 
AK070466CGGCTCGGTranscription factor RF2b. 
AY466471CGGCTCGGNONE 
Os03g0336300AK068503CCGAGCCGTCCPeptidase M16, C-terminal domain containing protein. 
Os03g0410700J065102A22CCGAGCCGACGCGTCCNONE 
Os03g0438400AK070383GCTCAGCTCGTGGGCTCGGCTCGGCTCGGConserved hypothetical protein. 
J023054E02GCTCAGCTCGTGGGCTCGGCTCGGCTCGGNONE 
Os03g0439700AK065720CCGAGCCGProtein of unknown function DUF1230 family protein. 
J013041G12CCGAGCCGNONE 
J065030N09CCGAGCCGNONE 
J065084A03CCGAGCCGNONE 
J065167B14CCGAGCCGNONE 
J100025F06CCGAGCCGNONE 
J100032J16CCGAGCCGNONE 
J100040L01CCGAGCCGNONE 
J100074M13CCGAGCCGNONE 
Os03g0445700AK071624CCGAGCCGSimilar to LOB domain protein 39. 
J023106M18CCGAGCCGNONE 
J065178J05CCGAGCCGNONE 
J065196F10CCGAGCCGNONE 
Os03g0663800011-023-B06CCGAGCCGNONE 
011-033-C06CCGAGCCGNONE 
012-011-E03CCGAGCCGNONE 
012-014-F04CCGAGCCGNONE 
012-027-C01CCGAGCCGNONE 
012-027-H07CCGAGCCGNONE 
012-031-A02CCGAGCCGNONE 
012-044-E05CCGAGCCGNONE 
012-045-G10CCGAGCCGNONE 
012-049-H02CCGAGCCGNONE 
012-053-G08CCGAGCCGNONE 
012-058-D07CCGAGCCGNONE 
012-061-H02CCGAGCCGNONE 
012-066-A02CCGAGCCGNONE 
012-074-F12CCGAGCCGNONE 
012-079-D08CCGAGCCGNONE 
012-081-E05CCGAGCCGNONE 
012-083-F04CCGAGCCGNONE 
012-084-F08CCGAGCCGNONE 
012-086-E08CCGAGCCGNONE 
012-086-F01CCGAGCCGNONE 
012-087-F03CCGAGCCGNONE 
012-087-H02CCGAGCCGNONE 
012-088-E05CCGAGCCGNONE 
012-089-B02CCGAGCCGNONE 
014-016-A04CCGAGCCGNONE 
AK105347CCGAGCCGNONE 
J075032I06CCGAGCCGNONE 
J075041O22CCGAGCCGNONE 
J075093E24CCGAGCCGNONE 
J075094E06CCGAGCCGNONE 
U45322CCGAGCCGCupin region domain containing protein. 
Os03g0699300AK120407CCGAGCCGTCCGATCSimilar to Adenylosuccinate synthetase, chloroplast precursor (EC 6.3.4.4) (IMP-- aspartate ligase) (AdSS) (AMPSase). 
Os03g0703300016-074-H01CGGCTCGGNONE 
AK073831CGGCTCGGCalponin-like actin-binding domain containing protein. 
Os03g0711800AK122108CCGAGCCGSimilar to IRE homolog 1 (Fragment). 
Os03g0712400AK106604CCGAGCCGSimilar to Atypical receptor-like kinase MARK. 
Os03g0737600014-094-E01TACTGGGCCGAGCCGNONE 
AB038234TACTGGGCCGAGCCGNONE 
AK101854TACTGGGCCGAGCCGCyclin H-1. 
AK105468TACTGGGCCGAGCCGNONE 
J033069N12TACTGGGCCGAGCCGNONE 
J043017A22TACTGGGCCGAGCCGNONE 
J065154A20TACTGGGCCGAGCCGNONE 
Os03g0743200J065049G14CGGCTCGGNONE 
J065158O18CGGCTCGGNONE 
Os03g0758800AJ252135CGGGCCGAGCCGAATGGGCCGGCNONE 
AJ312906CGGGCCGAGCCGAATGGGCCGGCNONE 
AK060387CGGGCCGAGCCGAATGGGCCGGCSimilar to Eukaryotic translation initiation factor 5A-2 (eIF-5A-2) (eIF-4D). 
AK121592CGGGCCGAGCCGAATGGGCCGGCNONE 
J023109G09CGGGCCGAGCCGAATGGGCCGGCNONE 
J033038B14CGGGCCGAGCCGAATGGGCCGGCNONE 
J043013C09CGGGCCGAGCCGAATGGGCCGGCNONE 
J053096E21CGGGCCGAGCCGAATGGGCCGGCNONE 
J065026B08CGGGCCGAGCCGAATGGGCCGGCNONE 
J065062B16CGGGCCGAGCCGAATGGGCCGGCNONE 
J065066E03CGGGCCGAGCCGAATGGGCCGGCNONE 
J065091J12CGGGCCGAGCCGAATGGGCCGGCNONE 
J065164A06CGGGCCGAGCCGAATGGGCCGGCNONE 
J075014I20CGGGCCGAGCCGAATGGGCCGGCNONE 
J075117N07CGGGCCGAGCCGAATGGGCCGGCNONE 
J075142M03CGGGCCGAGCCGAATGGGCCGGCNONE 
J075175D04CGGGCCGAGCCGAATGGGCCGGCNONE 
J075188M01CGGGCCGAGCCGAATGGGCCGGCNONE 
J075199I20CGGGCCGAGCCGAATGGGCCGGCNONE 
J090010J12CGGGCCGAGCCGAATGGGCCGGCNONE 
J090025O16CGGGCCGAGCCGAATGGGCCGGCNONE 
J090041H05CGGGCCGAGCCGAATGGGCCGGCNONE 
J090078P07CGGGCCGAGCCGAATGGGCCGGCNONE 
J100031K10CGGGCCGAGCCGAATGGGCCGGCNONE 
J100055F23CGGGCCGAGCCGAATGGGCCGGCNONE 
J100064G05CGGGCCGAGCCGAATGGGCCGGCNONE 
J100080C24CGGGCCGAGCCGAATGGGCCGGCNONE 
J100080O07CGGGCCGAGCCGAATGGGCCGGCNONE 
J100090F01CGGGCCGAGCCGAATGGGCCGGCNONE 
Os03g0797000AK073440CCGAGCCGSimilar to Indole synthase. 
Os03g0824500AK058990TCATGGGCCGAGCCGConserved hypothetical protein. 
J065057L18TCATGGGCCGAGCCGNONE 
J065083L02TCATGGGCCGAGCCGNONE 
J065086L24TCATGGGCCGAGCCGNONE 
J065121L10TCATGGGCCGAGCCGNONE 
J065168N03TCATGGGCCGAGCCGNONE 
J100035J22TCATGGGCCGAGCCGNONE 
J100050G18TCATGGGCCGAGCCGNONE 
J100055F15TCATGGGCCGAGCCGNONE 
Os04g0149400AK062765CCGAGCCGHypothetical protein. 
J065025G02CCGAGCCGNONE 
J065031L04CCGAGCCGNONE 
J065032K03CCGAGCCGNONE 
J065067F14CCGAGCCGNONE 
J065085J20CCGAGCCGNONE 
J065117C04CCGAGCCGNONE 
J065132D11CCGAGCCGNONE 
J065138G05CCGAGCCGNONE 
J065165O20CCGAGCCGNONE 
J100024F23CCGAGCCGNONE 
J100073N03CCGAGCCGNONE 
Os04g0259800AK111548CCGAGCCGConserved hypothetical protein. 
Os04g0275966J065015F20CCGAGCCGConserved hypothetical protein. 
J065118M18CCGAGCCGNONE 
Os04g0293600AK063003CGGCTCGGHypothetical protein. 
Os04g0408900009-183-E05CGGCTCGGCTCGGNONE 
AK058627CGGCTCGGCTCGGSimilar to DNA-binding protein S1FA. 
J023014N01CGGCTCGGCTCGGNONE 
J023088K23CGGCTCGGCTCGGNONE 
J065086B17CGGCTCGGCTCGGNONE 
J065095F08CGGCTCGGCTCGGNONE 
J065119N11CGGCTCGGCTCGGNONE 
J100032H17CGGCTCGGCTCGGNONE 
Os04g0490700AK072099CGGCTCGGConserved hypothetical protein. 
J065140P05CGGCTCGGNONE 
J100055M05CGGCTCGGNONE 
J100071P15CGGCTCGGNONE 
Os04g0507100AK061905AGCTGAGCCGAGCCGNONE 
Os04g0530400AK067634CCGAGCCGt-snare domain containing protein. 
Os04g0535200012-036-D08CGGCTCGGNONE 
AK060585CGGCTCGGNONE 
AK101505CGGCTCGGNONE 
AK119767CGGCTCGGPeptidase A1, pepsin family protein. 
J033044F04CGGCTCGGNONE 
J065167K19CGGCTCGGNONE 
J075017H22CGGCTCGGNONE 
J075180E03CGGCTCGGNONE 
J080025H04CGGCTCGGNONE 
J080026P04CGGCTCGGNONE 
J080029A01CGGCTCGGNONE 
J080034L18CGGCTCGGNONE 
J080038J07CGGCTCGGNONE 
J080053L24CGGCTCGGNONE 
J080071P08CGGCTCGGNONE 
J080093F09CGGCTCGGNONE 
Os04g0584100012-063-E01CGGCTCGGNONE 
AK105292CGGCTCGGConserved hypothetical protein. 
Os04g0594500015-024-B07CGGCTCGGNONE 
AK106269CGGCTCGGProtein of unknown function DUF674 family protein. 
Os04g0659400AK070174CCGAGCCGAGCCGAGCTGAGCENT domain containing protein. 
Os04g0690100AK105834CCGAGCCGNONE 
J075154D02CCGAGCCGNONE 
Os05g0125900009-168-E11CGGCTCGGNONE 
AK063078CGGCTCGGConserved hypothetical protein. 
AK119230CGGCTCGGNONE 
Os05g0170000003-129-C04CCGAGCCGTTGNONE 
AK100216CCGAGCCGTTGProtein of unknown function DUF266, plant family protein. 
AK103412CCGAGCCGTTGNONE 
J023045H21CCGAGCCGTTGNONE 
J033128G01CCGAGCCGTTGNONE 
J065017O10CCGAGCCGTTGNONE 
J065032H11CCGAGCCGTTGNONE 
J065120G09CCGAGCCGTTGNONE 
Os05g0279300AK103741CCGAGCCGSimilar to tRNA pseudouridine synthase A (EC 5.4.99.12) (tRNA-uridine isomerase I) (tRNA pseudouridylate synthase I). 
J033120A13CCGAGCCGNONE 
J033138L06CCGAGCCGNONE 
J065118I08CCGAGCCGNONE 
J080301G23CCGAGCCGNONE 
J080306C13CCGAGCCGNONE 
J080307E03CCGAGCCGNONE 
J080310E08CCGAGCCGNONE 
J080310O15CCGAGCCGNONE 
J090007M03CCGAGCCGNONE 
J090029F24CCGAGCCGNONE 
Os05g0322900006-057-H12CCGAGCCGNONE 
014-051-A08CCGAGCCGNONE 
AK063697CCGAGCCGNONE 
AK066255CCGAGCCGSimilar to WRKY transcription factor 45. 
AK103959CCGAGCCGNONE 
AY870611CCGAGCCGNONE 
J100068H13CCGAGCCGNONE 
Os05g0349800011-076-D06CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
014-037-D12CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
AK063677CCGAGCCGTCCGCGTCGCCGCGCGACACGTEmbryonic abundant protein 1. 
AK119674CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J053027D20CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J053039D11CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J053047P16CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J053048F05CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J053058E11CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J053060C03CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J053082N12CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J065017B15CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J065117G02CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J065212K21CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J075001H18CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J075003F20CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J075026F11CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J075035F13CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J075055C12CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J075067L20CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J075067O13CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J075070A12CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J075089E05CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J075128J17CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J075134M19CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J075192L11CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J075199D14CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
Os05g0368700AK064686CGGCTCGGSimilar to Subtilisin-like protease (Fragment). 
Os05g0388500AK065313CGGCTCGGSimilar to 50S ribosomal protein L1. 
AK098990CGGCTCGGNONE 
AK104689CGGCTCGGNONE 
J013094L23CGGCTCGGNONE 
J065118O04CGGCTCGGNONE 
Os05g0429700AK069203CCACTGACGGCTCGGCCCCACCNONE 
AK103559CCACTGACGGCTCGGCCCCACCC2 calcium/lipid-binding region, CaLB domain containing protein. 
Os05g0447200AK111659CGGCTCGGCTCGGNONE 
AK111849CGGCTCGGCTCGGSimilar to AUX1-like protein. 
Os05g0450300AK071191CCGAGCCGConserved hypothetical protein. 
J023084G11CCGAGCCGNONE 
Os05g0459700Os05g0459700CGGCTCGGBeta-Ig-H3/fasciclin domain containing protein. 
Os05g0469900AK109700CGGCTCGGConserved hypothetical protein. 
Os05g0510700AK070308GATCGGACGGCTCGGBSD domain containing protein. 
Os05g0519800AK069435CCGAGCCGTCCProtein of unknown function DUF28 family protein. 
J023024L22CCGAGCCGTCCNONE 
Os05g0571100006-092-E08CCGAGCCGNONE 
006-120-A03CCGAGCCGNONE 
015-030-F01CCGAGCCGNONE 
AK068658CCGAGCCGProtein of unknown function DUF860, plant family protein. 
AK104438CCGAGCCGNONE 
Os06g0118000006-039-F07CGGCTCGGCCCNONE 
AK061513CGGCTCGGCCCPeptidase A1, pepsin family protein. 
J065075J23CGGCTCGGCCCNONE 
Os06g0146900AK071352CGGCTCGGHypothetical protein. 
J065068D05CGGCTCGGNONE 
J075036G17CGGCTCGGNONE 
Os06g0153600AK099903CCGAGCCGTCGGATNONE 
AK109685CCGAGCCGTCGGATConserved hypothetical protein. 
Os06g0171700AK103771CCGAGCCGCdk-activating kinase assembly factor (MAT1) family protein. 
J033143J20CCGAGCCGNONE 
Os06g0210500AK066979CCGAGCCGSimilar to Mitochondrial phosphate transporter. 
Os06g0215600006-037-G11CCGAGCCGNONE 
006-098-D08CCGAGCCGNONE 
006-106-G02CCGAGCCGNONE 
AK061212CCGAGCCGSimilar to Oxo-phytodienoic acid reductase. 
AK104039CCGAGCCGNONE 
AK104193CCGAGCCGNONE 
AK104256CCGAGCCGNONE 
Os06g0217300AK111859CGGCTCGGSimilar to Transcription factor MADS55. 
AY345223CGGCTCGGNONE 
Os06g0226950J065070E21CCGAGCCGSterol desaturase family protein. 
J065218I08CCGAGCCGNONE 
Os06g0229800AB115915CCGAGCCGNONE 
AB115916CCGAGCCGNONE 
AB115917CCGAGCCGNONE 
AB115918CCGAGCCGNONE 
AF419099CCGAGCCGSimilar to Starch synthase IIA. 
AK101978CCGAGCCGNONE 
Os06g0291100J043017O10CCGAGCCGGCCCAAGTCAGCCCACAAHypothetical protein. 
Os06g0294950J065167C16CCGAGCCGConserved hypothetical protein. 
Os06g0335900J065112L04CCGAGCCGNONE 
J065216L13CCGAGCCGNONE 
Os06g0353700J065177D24CCGAGCCGConserved hypothetical protein. 
Os06g0552300011-011-G12CGGCTCGGCTCGGNONE 
AK101229CGGCTCGGCTCGGBZR1, transcriptional repressor family protein. 
J023061O03CGGCTCGGCTCGGNONE 
J033031H19CGGCTCGGCTCGGNONE 
J075103K14CGGCTCGGCTCGGNONE 
J075108I16CGGCTCGGCTCGGNONE 
J075194I23CGGCTCGGCTCGGNONE 
J090008K01CGGCTCGGCTCGGNONE 
J100062P15CGGCTCGGCTCGGNONE 
Os06g0585200016-065-C02CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCNONE 
AK068592CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCNONE 
AK073844CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCNONE 
AK106549CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCConserved hypothetical protein. 
J013154A14CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCNONE 
J100049K24CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCNONE 
J100059C18CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCNONE 
J100082N13CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCNONE 
Os06g0602600AK121619CCGAGCCGAlba, DNA/RNA-binding protein family protein. 
J033044O03CCGAGCCGNONE 
J043036G04CCGAGCCGNONE 
J075107E08CCGAGCCGNONE 
J090060N14CCGAGCCGNONE 
J090094K04CCGAGCCGNONE 
Os06g0683800AK110639CCGAGCCGConserved hypothetical protein. 
AK110639CGGCTCGGCCCAAATConserved hypothetical protein. 
Os06g0697000AK105513CCGAGCCGSimilar to Xyloglucan endotransglycosylase (Fragment). 
AK120345CCGAGCCGNONE 
J013063H05CCGAGCCGNONE 
Os06g0716700AB037681CCGAGCCGTCCGATCSimilar to Endoplasmin homolog precursor (GRP94 homolog). 
AK063385CCGAGCCGTCCGATCNONE 
AK102478CCGAGCCGTCCGATCNONE 
J013030D18CCGAGCCGTCCGATCNONE 
J090091L06CCGAGCCGTCCGATCNONE 
Os06g0725400J065086O07CCGAGCCGSimilar to BLE1 protein. 
J065114J19CCGAGCCGNONE 
Os07g0124600AK073437CCGAGCCGTCCATCCCCCRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J033042K24CCGAGCCGTCCATCCCCCNONE 
J033136G07CCGAGCCGTCCATCCCCCNONE 
J065092I12CCGAGCCGTCCATCCCCCNONE 
J065132F04CCGAGCCGTCCATCCCCCNONE 
J065143I11CCGAGCCGTCCATCCCCCNONE 
Os07g0182100AK066734CGGCTCGGNONE 
AK104002CGGCTCGGSimilar to Tryptophan synthase alpha chain. 
Os07g0459200AK066819GCTGGGCTTGGGCCAACCGAGCCGNONE 
AK102099GCTGGGCTTGGGCCAACCGAGCCGSimilar to Possible kinase. 
Os07g0468100006-055-B07CGGCTCGGNONE 
AK069604CGGCTCGGSimilar to Glutathione S-transferase GST 19 (EC 2.5.1.18). 
AK105890CGGCTCGGNONE 
J013055E21CGGCTCGGNONE 
J013146L19CGGCTCGGNONE 
J023011H19CGGCTCGGNONE 
J023025D08CGGCTCGGNONE 
J075002J22CGGCTCGGNONE 
J075017E02CGGCTCGGNONE 
J075067E08CGGCTCGGNONE 
J075104M22CGGCTCGGNONE 
J075116B13CGGCTCGGNONE 
J075119H05CGGCTCGGNONE 
J075185L23CGGCTCGGNONE 
Os07g0490300AK068288CCGAGCCGSimilar to Preproacrosin. 
J013149P03CCGAGCCGNONE 
J065039L14CCGAGCCGNONE 
J100024A06CCGAGCCGNONE 
Os07g0490400AK067941CGGCTCGGPeptidylprolyl isomerase, FKBP-type domain containing protein. 
J013121F22CGGCTCGGNONE 
Os07g0531600015-098-E11CCGAGCCGGCCCATGTNONE 
AK067845CCGAGCCGGCCCATGTPhospholipid/glycerol acyltransferase domain containing protein. 
J013124G01CCGAGCCGGCCCATGTNONE 
J065008E15CCGAGCCGGCCCATGTNONE 
J065052K14CCGAGCCGGCCCATGTNONE 
J065052L13CCGAGCCGGCCCATGTNONE 
J065058M02CCGAGCCGGCCCATGTNONE 
J065069M10CCGAGCCGGCCCATGTNONE 
J065135A14CCGAGCCGGCCCATGTNONE 
J065168O18CCGAGCCGGCCCATGTNONE 
J075070D14CCGAGCCGGCCCATGTNONE 
J075169B16CCGAGCCGGCCCATGTNONE 
Os07g0586900AK120959GCTCAGCTCGGCTCGGCTCGGGRAS transcription factor domain containing protein. 
J090067N13GCTCAGCTCGGCTCGGCTCGGNONE 
J100035G19GCTCAGCTCGGCTCGGCTCGGNONE 
J100042K16GCTCAGCTCGGCTCGGCTCGGNONE 
J100075G15GCTCAGCTCGGCTCGGCTCGGNONE 
Os07g0588800015-027-E02CCGAGCCGNONE 
AK070635CCGAGCCGNONE 
AK103183CCGAGCCGConserved hypothetical protein. 
J023058H18CCGAGCCGNONE 
Os07g0622200AB122058CCGAGCCGAGCCGNONE 
AK069968CCGAGCCGAGCCGNONE 
AK105687CCGAGCCGAGCCGSimilar to M-160-u1_1 (Fragment). 
J075095A10CCGAGCCGAGCCGNONE 
Os07g0633000Os07g0633000CGGCTCGGConserved hypothetical protein. 
Os07g0637300AF323611CGGCTCGGNONE 
AK069157CGGCTCGGNONE 
J023007C01CGGCTCGGNONE 
Os07g0639900J080305F09CCGAGCCGNONE 
J080305J22CCGAGCCGThymidylate kinase domain containing protein. 
J080311G07CCGAGCCGNONE 
J080315B14CCGAGCCGNONE 
J080317C02CCGAGCCGNONE 
Os07g0683900004-013-C10CCGAGCCGNONE 
006-064-B09CCGAGCCGNONE 
006-084-B03CCGAGCCGNONE 
006-102-F10CCGAGCCGNONE 
011-057-F12CCGAGCCGNONE 
011-098-A02CCGAGCCGNONE 
012-012-H02CCGAGCCGNONE 
013-099-D06CCGAGCCGNONE 
AK060899CCGAGCCGNONE 
AK103324CCGAGCCGRicin B-related lectin domain containing protein. 
J013098G05CCGAGCCGNONE 
J023138L02CCGAGCCGNONE 
J033030M14CCGAGCCGNONE 
J033111J21CCGAGCCGNONE 
J033125K07CCGAGCCGNONE 
J033131O15CCGAGCCGNONE 
J033135I19CCGAGCCGNONE 
J043016G14CCGAGCCGNONE 
J043020F07CCGAGCCGNONE 
J043022F24CCGAGCCGNONE 
J043022J03CCGAGCCGNONE 
J065005N24CCGAGCCGNONE 
J065083B02CCGAGCCGNONE 
J065093J20CCGAGCCGNONE 
J065096G16CCGAGCCGNONE 
J065096H24CCGAGCCGNONE 
J065111H06CCGAGCCGNONE 
J065128C09CCGAGCCGNONE 
J065136L13CCGAGCCGNONE 
J065137I02CCGAGCCGNONE 
J065147B15CCGAGCCGNONE 
J065163I16CCGAGCCGNONE 
J075013E11CCGAGCCGNONE 
J075018H08CCGAGCCGNONE 
J075019C23CCGAGCCGNONE 
J075051C07CCGAGCCGNONE 
J075062A21CCGAGCCGNONE 
J075065K07CCGAGCCGNONE 
J075095E05CCGAGCCGNONE 
J075128H08CCGAGCCGNONE 
J075137J06CCGAGCCGNONE 
J075180M24CCGAGCCGNONE 
J075193A04CCGAGCCGNONE 
J075198J06CCGAGCCGNONE 
J075199C21CCGAGCCGNONE 
J090003A20CCGAGCCGNONE 
J090021J16CCGAGCCGNONE 
J090029K24CCGAGCCGNONE 
J090055L04CCGAGCCGNONE 
J090058E17CCGAGCCGNONE 
J090069J18CCGAGCCGNONE 
J090081H06CCGAGCCGNONE 
J100028P13CCGAGCCGNONE 
J100034E19CCGAGCCGNONE 
J100046H21CCGAGCCGNONE 
J100048P04CCGAGCCGNONE 
J100052M01CCGAGCCGNONE 
J100066L01CCGAGCCGNONE 
J100078H20CCGAGCCGNONE 
J100081K17CCGAGCCGNONE 
Y08987CCGAGCCGNONE 
Os08g0120200AK103562CCGAGCCGDNA polymerase III, delta family protein. 
AK103562CCGAGCCGAGCCGDNA polymerase III, delta family protein. 
Os08g0192900AK103422CCGAGCCGAGCCGRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
AY644645CCGAGCCGAGCCGNONE 
Os08g0243900011-052-H03CCGAGCCGNONE 
AK102707CCGAGCCGNONE 
AK121452CCGAGCCGMu2 adaptin subunit (AP50) of AP2 domain containing protein. 
J023142L20CCGAGCCGNONE 
J065168E04CCGAGCCGNONE 
Os08g0278100014-004-D02CCGAGCCGNONE 
014-004-D02CCGAGCCGNONE 
014-004-D02CCGAGCCGAGCCGAGCCGNONE 
AK063626CCGAGCCGConserved hypothetical protein. 
AK063626CCGAGCCGConserved hypothetical protein. 
AK063626CCGAGCCGAGCCGAGCCGConserved hypothetical protein. 
Os08g0387050J043038F21GAAGCCCAGCCGAGCCGGCCCACAGCCCAGCCConserved hypothetical protein. 
Os08g0389733J065044M19CCGAGCCGNONE 
J065104D10CCGAGCCGNONE 
J065110F18CCGAGCCGNONE 
Os08g0390700009-094-H10CGGCTCGGNONE 
AK062714CGGCTCGGSimilar to 2-oxoglutarate-dependent oxygenase. 
Os08g0440000006-056-A06CGGCTCGGNONE 
AK060959CGGCTCGGNONE 
AK102539CGGCTCGGVesicle transport v-SNARE family protein. 
J065012O03CGGCTCGGNONE 
Os08g0467400AK070501CCGAGCCGZinc/iron permease family protein. 
AK102279CCGAGCCGNONE 
AK105607CCGAGCCGNONE 
Os08g0475100AK105839CCGAGCCGEsterase/lipase/thioesterase domain containing protein. 
Os08g0530000AK065712CGGCTCGGSimilar to Uridine kinase-like protein. 
Os09g0251800006-100-E12CCGAGCCGNONE 
AK061218CCGAGCCGC2 calcium/lipid-binding region, CaLB domain containing protein. 
AK104010CCGAGCCGNONE 
J065048A02CCGAGCCGNONE 
J065073P10CCGAGCCGNONE 
J065075B09CCGAGCCGNONE 
J065112B05CCGAGCCGNONE 
J090014H10CCGAGCCGNONE 
Os09g0325300011-005-H08CCGAGCCGTCCGATNONE 
AK068435CCGAGCCGTCCGATConserved hypothetical protein. 
AK073998CCGAGCCGTCCGATNONE 
J033071H21CCGAGCCGTCCGATNONE 
J065214H05CCGAGCCGTCCGATNONE 
Os09g0382400009-125-E12GATCGGACGGCTCGGNONE 
AK062891GATCGGACGGCTCGGConserved hypothetical protein. 
J065069H20GATCGGACGGCTCGGNONE 
J065137I22GATCGGACGGCTCGGNONE 
J065218O10GATCGGACGGCTCGGNONE 
Os09g0438000AK109935CCGAGCCGNONE 
AK120739CCGAGCCGSimilar to RbohAOsp (Fragment). 
Os09g0480600AK107853CACGTCACCGAGCCGHypothetical protein. 
Os09g0482740006-098-F12CGGCTCGGNONE 
AK061852CGGCTCGGProtein of unknown function DUF1664 family protein. 
J013032I17CGGCTCGGNONE 
J013119L22CGGCTCGGNONE 
J065114C06CGGCTCGGNONE 
J090059O06CGGCTCGGNONE 
J090062K09CGGCTCGGNONE 
J100031O03CGGCTCGGNONE 
J100038P06CGGCTCGGNONE 
J100051M18CGGCTCGGNONE 
J100075H20CGGCTCGGNONE 
J100077O11CGGCTCGGNONE 
Os09g0518500003-013-C12CGGCTCGGNONE 
J013051A18CGGCTCGGNONE 
J023024G04CGGCTCGGNONE 
J023122L09CGGCTCGGNONE 
J033074K15CGGCTCGGNONE 
J075057E09CGGCTCGGNONE 
J075058M15CGGCTCGGNONE 
J075059L23CGGCTCGGNONE 
J075060H23CGGCTCGGNONE 
J075062I18CGGCTCGGNONE 
J075099F20CGGCTCGGNONE 
J075151K06CGGCTCGGNONE 
J075151L05CGGCTCGGNONE 
J075162B17CGGCTCGGNONE 
J075174J03CGGCTCGGNONE 
J090060C15CGGCTCGGNONE 
J090084N22CGGCTCGGNONE 
J090087P14CGGCTCGGNONE 
Os09g0534800009-128-G09CGCGACGCGACCGAGCCGNONE 
AF464908CGCGACGCGACCGAGCCGNONE 
AK068941CGCGACGCGACCGAGCCGTranscription initiation factor IIB (General transcription factor TFIIB). 
J013170A08CGCGACGCGACCGAGCCGNONE 
J023123L05CGCGACGCGACCGAGCCGNONE 
J043020O05CGCGACGCGACCGAGCCGNONE 
Os09g0547200016-021-H03AGTTGGGCCGAGCCGNONE 
AK073078AGTTGGGCCGAGCCGProtein of unknown function DUF292, eukaryotic domain containing protein. 
AK104984AGTTGGGCCGAGCCGNONE 
J065005L05AGTTGGGCCGAGCCGNONE 
J065039C06AGTTGGGCCGAGCCGNONE 
J065116H17AGTTGGGCCGAGCCGNONE 
J100046A17AGTTGGGCCGAGCCGNONE 
Os09g0568500AK108987CCGAGCCGGermin family protein. 
Os09g0569400AK063384CCGAGCCGBeta-lactamase-like domain containing protein. 
AK070608CCGAGCCGNONE 
Os11g0166800AK070928CGGCTCGGRNA polymerase II transcription factor SIII subunit A family protein. 
Os12g0145700AK071391CGGCTCGGCCCACCACPyruvate kinase family protein. 
J023013N02CGGCTCGGCCCACCACNONE 
J033085D15CGGCTCGGCCCACCACNONE 
J043021I09CGGCTCGGCCCACCACNONE 
J100055L05CGGCTCGGCCCACCACNONE 
Os12g0236500AK071207CGGCTCGGSimilar to Aspartyl aminopeptidase-like protein. 
AK103925CGGCTCGGNONE 
J033037F05CGGCTCGGNONE 
J033068F01CGGCTCGGNONE 
J033122K09CGGCTCGGNONE 
Os12g0273700AK071152CCGAGCCGConserved hypothetical protein. 
Os12g0466550J080016C07CCGAGCCGNONE 
J080064H06CCGAGCCGNONE 
J080075D07CCGAGCCGNONE 
J080094M13CCGAGCCGNONE 
Os12g0535400004-008-H02CTCGCGCGGCTCGGNONE 
AK065318CTCGCGCGGCTCGGHypothetical protein. 
J013002P10CTCGCGCGGCTCGGNONE 
Os12g0535900006-061-F02CGGCTCGGNONE 
AK069422CGGCTCGGPlus-3 domain containing protein. 
AK109358CGGCTCGGNONE 
Os12g0540000AK108630CCAAGCCCGAGCCGConserved hypothetical protein. 
AK108630CCGAGCCGConserved hypothetical protein. 
AK108630CGGCTCGGConserved hypothetical protein. 
J065046N02CCAAGCCCGAGCCGNONE 
J065046N02CCGAGCCGNONE 
J065046N02CGGCTCGGNONE 
J065100H24CCAAGCCCGAGCCGNONE 
J065100H24CCGAGCCGNONE 
J065100H24CGGCTCGGNONE 
J065142M24CCAAGCCCGAGCCGNONE 
J065142M24CCGAGCCGNONE 
J065142M24CGGCTCGGNONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.