version

Summary of OsREG541 (All List)

OrganismOryza sativa  
IDOsREG541  
SequenceCCGATCCG  
Annotation  
PPDB Motif 
PLACE Motif 
Total Entry Count1344  

Entry Sequences (1344 entries)

LocusGene modelSequenceDescription
Os01g0104100AK072797CCGATCCGZinc finger, RING-type domain containing protein. 
AK104280CCGATCCGNONE 
Os01g0140400AK063999CCGTCCGATCCGLeucine rich repeat, N-terminal domain containing protein. 
Os01g0190400AK064011CCGATCCGACSimilar to Hexokinase. 
AK099119CCGATCCGACNONE 
Os01g0212100AK065467CGGATCGGNONE 
AK101456CGGATCGGATP-dependent helicase, DEAH-box family protein. 
Os01g0219500AK106863CCGATCCGNONE 
AK109524CCGATCCGPlant lipid transfer protein/Par allergen family protein. 
J075053J18CCGATCCGNONE 
J080023G09CCGATCCGNONE 
J080051F19CCGATCCGNONE 
J080085H15CCGATCCGNONE 
Os01g0246500AK058984CCGATCCGATCCGTCCCACCSimilar to Minus dominance protein. 
Os01g0262500AK071545CGGATCGGTRAM, LAG1 and CLN8 homology domain containing protein. 
Os01g0315600AK110785CCGATCCGConserved hypothetical protein. 
J075164O07CCGATCCGNONE 
Os01g0323600J023095C13CCGATCCGNONE 
Os01g0347100AK100716CCGATCCGProtein of unknown function DUF1399 family protein. 
AK100716CGGATCGGACGGCTProtein of unknown function DUF1399 family protein. 
Os01g0360150009-008-B03CCGATCCGNONE 
009-080-C11CCGATCCGNONE 
AK062321CCGATCCGConserved hypothetical protein. 
Os01g0512200J013067C10CCGATCCGNONE 
Os01g0578800AK111466CGGATCGGConserved hypothetical protein. 
Os01g0663400016-054-B01CCGATCCGACGGNONE 
AK072283CCGATCCGACGGSimilar to Aspartic proteinase oryzasin 1 precursor (EC 3.4.23.-). 
AK072645CCGATCCGACGGNONE 
J065180A21CCGATCCGACGGNONE 
J075026E13CCGATCCGACGGNONE 
J075109M23CCGATCCGACGGNONE 
J075151A02CCGATCCGACGGNONE 
J090004B07CCGATCCGACGGNONE 
J090023O22CCGATCCGACGGNONE 
J090054G09CCGATCCGACGGNONE 
J090058H13CCGATCCGACGGNONE 
J090076G13CCGATCCGACGGNONE 
J100057F11CCGATCCGACGGNONE 
Os01g0667200AK067930CCGATCCGSimilar to Glyoxalase II. 
AK104104CCGATCCGNONE 
AK104749CCGATCCGNONE 
J013059D24CCGATCCGNONE 
J013127E08CCGATCCGNONE 
Os01g0760600011-038-B09CGGATCGGNONE 
AB110193CGGATCGGNONE 
AK067557CGGATCGGNONE 
AK099338CGGATCGGNONE 
AK103133CGGATCGGNONE 
AK103586CGGATCGGAspartate aminotransferase, cytoplasmic (EC 2.6.1.1) (Transaminase A). 
AK104829CGGATCGGNONE 
D14673CGGATCGGNONE 
J023030P20CGGATCGGNONE 
J023110C16CGGATCGGNONE 
J033025N16CGGATCGGNONE 
J033026K01CGGATCGGNONE 
J033026M02CGGATCGGNONE 
J033028M22CGGATCGGNONE 
J033036D08CGGATCGGNONE 
J033038A21CGGATCGGNONE 
J033044D24CGGATCGGNONE 
J033051F18CGGATCGGNONE 
J033095C16CGGATCGGNONE 
J090003F07CGGATCGGNONE 
J090009P10CGGATCGGNONE 
J090012D16CGGATCGGNONE 
J090023K01CGGATCGGNONE 
J090030J17CGGATCGGNONE 
J090033G02CGGATCGGNONE 
J090037I22CGGATCGGNONE 
J090038A17CGGATCGGNONE 
J090048K09CGGATCGGNONE 
J090069N01CGGATCGGNONE 
J090078C19CGGATCGGNONE 
J090089P15CGGATCGGNONE 
J090093D07CGGATCGGNONE 
J090095H01CGGATCGGNONE 
J100057J03CGGATCGGNONE 
Os01g0764000006-021-G03CCGATCCGNONE 
006-025-C07CCGATCCGNONE 
006-029-G11CCGATCCGNONE 
006-030-C04CCGATCCGNONE 
006-035-E05CCGATCCGNONE 
006-037-G01CCGATCCGNONE 
006-038-C01CCGATCCGNONE 
006-039-G05CCGATCCGNONE 
006-042-E11CCGATCCGNONE 
006-044-H04CCGATCCGNONE 
006-045-A10CCGATCCGNONE 
006-045-C05CCGATCCGNONE 
006-047-A11CCGATCCGNONE 
006-048-H10CCGATCCGNONE 
006-050-C01CCGATCCGNONE 
006-050-H11CCGATCCGNONE 
006-051-G10CCGATCCGNONE 
006-051-G11CCGATCCGNONE 
006-056-B04CCGATCCGNONE 
006-063-F04CCGATCCGNONE 
006-063-H12CCGATCCGNONE 
006-065-G09CCGATCCGNONE 
006-067-F11CCGATCCGNONE 
006-073-D10CCGATCCGNONE 
006-074-G09CCGATCCGNONE 
006-075-D04CCGATCCGNONE 
006-077-C10CCGATCCGNONE 
006-082-A10CCGATCCGNONE 
006-084-C12CCGATCCGNONE 
006-085-F05CCGATCCGNONE 
006-087-H12CCGATCCGNONE 
006-092-E10CCGATCCGNONE 
006-094-C06CCGATCCGNONE 
006-096-G11CCGATCCGNONE 
006-097-H11CCGATCCGNONE 
006-101-A07CCGATCCGNONE 
006-101-G08CCGATCCGNONE 
006-110-E08CCGATCCGNONE 
006-111-D04CCGATCCGNONE 
006-116-H04CCGATCCGNONE 
AK058894CCGATCCGNONE 
AK059818CCGATCCGSimilar to Glutathione S-transferase I (EC 2.5.1.18) (GST-I) (GST-29) (GST class- phi). 
AK099142CCGATCCGNONE 
J013119N15CCGATCCGNONE 
J013123P15CCGATCCGNONE 
J023055F24CCGATCCGNONE 
J023125K17CCGATCCGNONE 
J053050A20CCGATCCGNONE 
J053056P10CCGATCCGNONE 
J053074D19CCGATCCGNONE 
J053078A14CCGATCCGNONE 
J053086P10CCGATCCGNONE 
J053094N23CCGATCCGNONE 
J053095M23CCGATCCGNONE 
J065006D02CCGATCCGNONE 
J065030A17CCGATCCGNONE 
J065030K04CCGATCCGNONE 
J065035L12CCGATCCGNONE 
J065046E12CCGATCCGNONE 
J065065H19CCGATCCGNONE 
J065073C01CCGATCCGNONE 
J065105F01CCGATCCGNONE 
J065131N16CCGATCCGNONE 
J065144O13CCGATCCGNONE 
J065160E12CCGATCCGNONE 
J065160K02CCGATCCGNONE 
J065163F09CCGATCCGNONE 
J065165E18CCGATCCGNONE 
J065174E04CCGATCCGNONE 
J065175O08CCGATCCGNONE 
J065191N24CCGATCCGNONE 
J065193D19CCGATCCGNONE 
J065198D04CCGATCCGNONE 
J065200G09CCGATCCGNONE 
J075016L06CCGATCCGNONE 
J075017J11CCGATCCGNONE 
J075019L08CCGATCCGNONE 
J075028M08CCGATCCGNONE 
J075029K05CCGATCCGNONE 
J075039K04CCGATCCGNONE 
J075047J22CCGATCCGNONE 
J075079H13CCGATCCGNONE 
J075095K14CCGATCCGNONE 
J075111D21CCGATCCGNONE 
J075131A19CCGATCCGNONE 
J075147G20CCGATCCGNONE 
J075158F11CCGATCCGNONE 
J075166N10CCGATCCGNONE 
J075196G09CCGATCCGNONE 
J075198I24CCGATCCGNONE 
J090001L08CCGATCCGNONE 
J090026G07CCGATCCGNONE 
J090050M15CCGATCCGNONE 
J090071A01CCGATCCGNONE 
J090072P16CCGATCCGNONE 
J090078D22CCGATCCGNONE 
J090089C18CCGATCCGNONE 
J100019B07CCGATCCGNONE 
J100019H15CCGATCCGNONE 
J100019P09CCGATCCGNONE 
J100023A16CCGATCCGNONE 
J100023B09CCGATCCGNONE 
J100026O18CCGATCCGNONE 
J100027E09CCGATCCGNONE 
J100028F22CCGATCCGNONE 
J100029P05CCGATCCGNONE 
J100031M19CCGATCCGNONE 
J100032A11CCGATCCGNONE 
J100036G19CCGATCCGNONE 
J100038E22CCGATCCGNONE 
J100040A12CCGATCCGNONE 
J100040L02CCGATCCGNONE 
J100043O13CCGATCCGNONE 
J100045E20CCGATCCGNONE 
J100046H18CCGATCCGNONE 
J100047E08CCGATCCGNONE 
J100050E08CCGATCCGNONE 
J100050P14CCGATCCGNONE 
J100051G10CCGATCCGNONE 
J100052L12CCGATCCGNONE 
J100056G24CCGATCCGNONE 
J100066B15CCGATCCGNONE 
J100068O15CCGATCCGNONE 
J100070J16CCGATCCGNONE 
J100074I22CCGATCCGNONE 
J100075M12CCGATCCGNONE 
J100077M09CCGATCCGNONE 
J100077O14CCGATCCGNONE 
J100079J08CCGATCCGNONE 
J100080I16CCGATCCGNONE 
Os01g0764600AK060621CGGATCGGGCCGAGFosfomycin resistance kinase FomA family protein. 
J013111L18CGGATCGGGCCGAGNONE 
J013134N08CGGATCGGGCCGAGNONE 
Os01g0800300006-097-C12CCGATCCGNONE 
014-070-C12CCGATCCGNONE 
AK072549CCGATCCGNONE 
AK100942CCGATCCGNONE 
AK100951CCGATCCGConserved hypothetical protein. 
AK106023CCGATCCGNONE 
J023138D05CCGATCCGNONE 
J075097P16CCGATCCGNONE 
J075099F23CCGATCCGNONE 
Os01g0830100AK069755CGGATCGGACGGAPyridine nucleotide-disulphide oxidoreductase, NAD-binding region domain containing protein. 
Os01g0834200AK069188CCGATCCGNONE 
AK100543CCGATCCGSimilar to T-cell immune regulator 1 transcript variant 3 (Fragment). 
Os01g0847900006-030-E09CCGATCCGACNONE 
AK059798CCGATCCGACPrenylated rab acceptor PRA1 family protein. 
AK073643CCGATCCGACNONE 
J065091G23CCGATCCGACNONE 
Os01g0852900J033066K09CCGATCCGNONE 
Os01g0862800AK071274CCGATCCGNo apical meristem (NAM) protein domain containing protein. 
Os01g0967800012-074-C04CCGATCCGNONE 
012-100-F12CCGATCCGNONE 
015-061-F12CCGATCCGNONE 
AK064854CCGATCCGConserved hypothetical protein. 
J013000H07CCGATCCGNONE 
J013050A03CCGATCCGNONE 
J013063M22CCGATCCGNONE 
J013070I04CCGATCCGNONE 
J013075C08CCGATCCGNONE 
J013104B08CCGATCCGNONE 
J013122F05CCGATCCGNONE 
J013151F19CCGATCCGNONE 
J023093A07CCGATCCGNONE 
J023097E21CCGATCCGNONE 
J023108P06CCGATCCGNONE 
J023138O04CCGATCCGNONE 
J033025A05CCGATCCGNONE 
J033060A07CCGATCCGNONE 
J033060M15CCGATCCGNONE 
J033087J19CCGATCCGNONE 
J033094F16CCGATCCGNONE 
J043009J11CCGATCCGNONE 
J043040A12CCGATCCGNONE 
J090002D12CCGATCCGNONE 
J090024D15CCGATCCGNONE 
J090067C12CCGATCCGNONE 
J090079G19CCGATCCGNONE 
J090090N17CCGATCCGNONE 
Os01g0976200006-044-A09CCGATCCGNONE 
AK061022CCGATCCG11-S plant seed storage protein family protein. 
J023012H20CCGATCCGNONE 
J023025O07CCGATCCGNONE 
J023082A14CCGATCCGNONE 
J023115H15CCGATCCGNONE 
J023133H14CCGATCCGNONE 
J023133L21CCGATCCGNONE 
J023136B16CCGATCCGNONE 
J023145P17CCGATCCGNONE 
J023146N03CCGATCCGNONE 
Os02g0149700AK103492CCGATCCGExo70 exocyst complex subunit family protein. 
Os02g0177700AK119941CGGATCGGProtein of unknown function DUF588 family protein. 
Os02g0190950J075001E02CGGATCGGConserved hypothetical protein. 
J075117E23CGGATCGGNONE 
J075117F23CGGATCGGNONE 
J075144M12CGGATCGGNONE 
J075145H10CGGATCGGNONE 
J075186B15CGGATCGGNONE 
Os02g0219900004-018-E11CCGATCCGATCCGNONE 
AK060915CCGATCCGATCCGNONE 
AK099194CCGATCCGATCCGNONE 
AK104206CCGATCCGATCCGNONE 
AK104393CCGATCCGATCCGSimilar to Epstein-Barr nuclear antigen-1 (EBNA-1). 
J023109D07CCGATCCGATCCGNONE 
Os02g0272600AK060159CCGATCCGAph-1 family protein. 
AK104758CCGATCCGNONE 
Os02g0465400AK100199CCGATCCGCGCGAGSimilar to 7-dehydrocholesterol reductase (EC 1.3.1.21) (7-DHC reductase) (Sterol delta-7-reductase) (Dwarf5 protein). 
J090036B02CCGATCCGCGCGAGNONE 
Os02g0471100AK121179CCGATCCGConserved hypothetical protein. 
J023083J24CCGATCCGNONE 
Os02g0533900AB062681CGGATCGGACGGNONE 
AK061722CGGATCGGACGGNONE 
AK106147CGGATCGGACGGNONE 
AK121892CGGATCGGACGGSimilar to Carbon-nitrogen hydrolase family protein. 
Os02g0556100006-100-D03CCGATCCGNONE 
AK059938CCGATCCGNONE 
AK103125CCGATCCGNAD-dependent epimerase/dehydratase family protein. 
J033107B22CCGATCCGNONE 
J033119M03CCGATCCGNONE 
J033120L06CCGATCCGNONE 
J043007B02CCGATCCGNONE 
J043012G03CCGATCCGNONE 
J043024A02CCGATCCGNONE 
J043027J18CCGATCCGNONE 
J100019E06CCGATCCGNONE 
J100069C22CCGATCCGNONE 
Os02g0633400AK073723CCGATCCGSimilar to 61 kDa protein homolog. 
J100031K17CCGATCCGNONE 
Os02g0703800AK120025CGGATCGGConserved hypothetical protein. 
Os02g0717600J090003H19CCCCCGCGACGCGGATCGGACGGCTNONE 
J100090A12CCCCCGCGACGCGGATCGGACGGCTConserved hypothetical protein. 
Os02g0755900011-077-A03CGGATCGGNONE 
015-066-D06CGGATCGGNONE 
AK073587CGGATCGGNONE 
AK104985CGGATCGGSimilar to Glucosyltransferase (Fragment). 
J033052B15CGGATCGGNONE 
Os02g0762400AK103084CCGTCGGATCGGCyclin-dependent kinase inhibitor family protein. 
Os02g0805900AK073740CGGATCGGDcp2, box A domain containing protein. 
J013068E03CGGATCGGNONE 
J033066K03CGGATCGGNONE 
J033092C14CGGATCGGNONE 
J065020G11CGGATCGGNONE 
J065098E16CGGATCGGNONE 
J065124L06CGGATCGGNONE 
J065134M23CGGATCGGNONE 
J065187M23CGGATCGGNONE 
J065208G07CGGATCGGNONE 
J075002G10CGGATCGGNONE 
J075004L01CGGATCGGNONE 
J075051K23CGGATCGGNONE 
J090063C03CGGATCGGNONE 
J090071J21CGGATCGGNONE 
J100078K12CGGATCGGNONE 
Os02g0832200AK108268CCGATCCGConserved hypothetical protein. 
J065053F07CCGATCCGNONE 
J065095B09CCGATCCGNONE 
J065137I11CCGATCCGNONE 
J065187O12CCGATCCGNONE 
J075193O05CCGATCCGNONE 
Os02g0832600013-010-E02CCGATCCGATCCGNONE 
AK058645CCGATCCGATCCGConserved hypothetical protein. 
AK072277CCGATCCGATCCGNONE 
AK100140CCGATCCGATCCGNONE 
J023002O20CCGATCCGATCCGNONE 
J023010P10CCGATCCGATCCGNONE 
J023019M07CCGATCCGATCCGNONE 
J023074F03CCGATCCGATCCGNONE 
J023087J05CCGATCCGATCCGNONE 
J033088K14CCGATCCGATCCGNONE 
J065031P06CCGATCCGATCCGNONE 
J075040C24CCGATCCGATCCGNONE 
J075047H12CCGATCCGATCCGNONE 
J075065F16CCGATCCGATCCGNONE 
J075074D03CCGATCCGATCCGNONE 
J075109G24CCGATCCGATCCGNONE 
J075124E09CCGATCCGATCCGNONE 
J075190M20CCGATCCGATCCGNONE 
J075195M23CCGATCCGATCCGNONE 
J100027H12CCGATCCGATCCGNONE 
J100029K12CCGATCCGATCCGNONE 
Os02g0832700AK099439CCGATCCGSimilar to Metal tolerance protein C2 (AtMTPc2). 
Os03g0115400003-126-D04CGTCCGATCCGNONE 
AK103356CGTCCGATCCGWD40-like domain containing protein. 
AK103522CGTCCGATCCGNONE 
J033126K20CGTCCGATCCGNONE 
J033131K03CGTCCGATCCGNONE 
J033131K05CGTCCGATCCGNONE 
J033136B16CGTCCGATCCGNONE 
J033147E04CGTCCGATCCGNONE 
J043027H03CGTCCGATCCGNONE 
J065173H02CGTCCGATCCGNONE 
J075032C10CGTCCGATCCGNONE 
J075040D19CGTCCGATCCGNONE 
J075060L18CGTCCGATCCGNONE 
J075084N07CGTCCGATCCGNONE 
J075112M18CGTCCGATCCGNONE 
J075132I01CGTCCGATCCGNONE 
J075195E06CGTCCGATCCGNONE 
J090016B20CGTCCGATCCGNONE 
J090063F20CGTCCGATCCGNONE 
J100061H04CGTCCGATCCGNONE 
J100089D15CGTCCGATCCGNONE 
Os03g0119900AK058741CGCCACGTCACCGATCCGhistone H4 [Oryza sativa (japonica cultivar-group)]. 
J065035O07CGCCACGTCACCGATCCGNONE 
J065165C24CGCCACGTCACCGATCCGNONE 
J075039M05CGCCACGTCACCGATCCGNONE 
Os03g0130400AK070255CGGATCGGAdenylate kinase, subfamily protein. 
Os03g0146300011-078-E08CCGATCCGNONE 
014-009-B07CCGATCCGNONE 
AK121395CCGATCCGSimilar to Cyclin-dependent kinases regulatory subunit. 
AY583319CCGATCCGNONE 
J013104I06CCGATCCGNONE 
J023130M16CCGATCCGNONE 
J053037E13CCGATCCGNONE 
J075104M08CCGATCCGNONE 
J075144I22CCGATCCGNONE 
J100057B09CCGATCCGNONE 
Os03g0161900AK066844CCGATCCGNONE 
AY344489CCGATCCGSimilar to Heat shock factor 1 (Fragment). 
J013088J01CCGATCCGNONE 
J023114N08CCGATCCGNONE 
Os03g0179400AK107046CGGATCGGSimilar to Avr9/Cf-9 induced kinase 1. 
Os03g0188000J043012N12CCGATCCGNONE 
J075019M05CCGATCCGNONE 
J075094K24CCGATCCGNONE 
J075099J07CCGATCCGNONE 
J075131A06CCGATCCGNONE 
J075144N09CCGATCCGConserved hypothetical protein. 
Os03g0217900AK119980CGGATCGGConserved hypothetical protein. 
AK119980CGGATCGGConserved hypothetical protein. 
J053089K18CGGATCGGNONE 
J053089K18CGGATCGGNONE 
J090058B20CGGATCGGNONE 
J090058B20CGGATCGGNONE 
J090081L09CGGATCGGNONE 
J090081L09CGGATCGGNONE 
Os03g0219400AK100702CGGATCGGGlycoside hydrolase, family 20 protein. 
AK121985CGGATCGGNONE 
J023114O06CGGATCGGNONE 
J100043M20CGGATCGGNONE 
Os03g0259700015-018-F05CCGATCCGProtein of unknown function DUF1630 family protein. 
J065023N06CCGATCCGNONE 
J065121K01CCGATCCGNONE 
J075142D15CCGATCCGNONE 
J100029H23CCGATCCGNONE 
Os03g0296300AK100042CGGATCGGACGGMitochondrial import inner membrane translocase, subunit Tim17/22 family protein. 
Os03g0296400AK073460CCGTCCGATCCGSimilar to Eukaryotic translation initiation factor 2 subunit 1 (Eukaryotic translation initiation factor 2 alpha subunit) (eIF-2-alpha) (EIF- 2alpha) (EIF-2A) (Fragment). 
AK073460CGGATCGGSimilar to Eukaryotic translation initiation factor 2 subunit 1 (Eukaryotic translation initiation factor 2 alpha subunit) (eIF-2-alpha) (EIF- 2alpha) (EIF-2A) (Fragment). 
AK104149CCGTCCGATCCGNONE 
AK104149CGGATCGGNONE 
AK105818CCGTCCGATCCGNONE 
AK105818CGGATCGGNONE 
Os03g0321000AK103653CCGATCCGSimilar to Steroid membrane binding protein-like. 
Os03g0335100AK107094CCGATCCGACConserved hypothetical protein. 
Os03g0344100009-166-F10CCGATCCGNONE 
AK061903CCGATCCGNONE 
AK065547CCGATCCGSimilar to ASF/SF2-like pre-mRNA splicing factor SRP32''. 
J023095G24CCGATCCGNONE 
J033087C06CCGATCCGNONE 
J053073I09CCGATCCGNONE 
J065189D11CCGATCCGNONE 
J090032B15CCGATCCGNONE 
Os03g0353400006-092-E01CCGATCCGNONE 
006-120-A08CCGATCCGNONE 
009-098-A01CCGATCCGNONE 
009-139-G01CCGATCCGNONE 
013-041-E01CCGATCCGNONE 
013-068-C06CCGATCCGNONE 
014-014-G01CCGATCCGNONE 
014-088-E11CCGATCCGNONE 
AB110172CCGATCCGNONE 
AK062176CCGATCCGSimilar to Poly(A)-binding protein C-terminal interacting protein 6. 
AK068753CCGATCCGNONE 
AY656247CCGATCCGNONE 
J013049N20CCGATCCGNONE 
J013072F18CCGATCCGNONE 
J013089L05CCGATCCGNONE 
J013099L20CCGATCCGNONE 
J013131G13CCGATCCGNONE 
J013157B15CCGATCCGNONE 
J013158E09CCGATCCGNONE 
J023013I18CCGATCCGNONE 
J023019G19CCGATCCGNONE 
J023027C18CCGATCCGNONE 
J023052J24CCGATCCGNONE 
J023080N08CCGATCCGNONE 
J033043F21CCGATCCGNONE 
J033044C08CCGATCCGNONE 
J033086N04CCGATCCGNONE 
J065041E07CCGATCCGNONE 
J065067N17CCGATCCGNONE 
J065082H19CCGATCCGNONE 
J065104D20CCGATCCGNONE 
J065105P09CCGATCCGNONE 
J065114D01CCGATCCGNONE 
J065119D15CCGATCCGNONE 
J065134G02CCGATCCGNONE 
J065143D06CCGATCCGNONE 
J065170G14CCGATCCGNONE 
J065178K06CCGATCCGNONE 
J065208P11CCGATCCGNONE 
J075004A10CCGATCCGNONE 
J075034E12CCGATCCGNONE 
J075035P22CCGATCCGNONE 
J075065O16CCGATCCGNONE 
J075070M03CCGATCCGNONE 
J075115B03CCGATCCGNONE 
J075190B04CCGATCCGNONE 
J080002C13CCGATCCGNONE 
J080010I08CCGATCCGNONE 
J080017L24CCGATCCGNONE 
J080023D11CCGATCCGNONE 
J080025A02CCGATCCGNONE 
J080025N09CCGATCCGNONE 
J080035D22CCGATCCGNONE 
J080038L13CCGATCCGNONE 
J080042F06CCGATCCGNONE 
J080043H05CCGATCCGNONE 
J080048K17CCGATCCGNONE 
J080053M20CCGATCCGNONE 
J080056I23CCGATCCGNONE 
J080057J06CCGATCCGNONE 
J080058C18CCGATCCGNONE 
J080062I15CCGATCCGNONE 
J080080E19CCGATCCGNONE 
J080096K12CCGATCCGNONE 
J090004M12CCGATCCGNONE 
J090055H05CCGATCCGNONE 
J090062J17CCGATCCGNONE 
J100044K10CCGATCCGNONE 
J100047I15CCGATCCGNONE 
J100047K03CCGATCCGNONE 
J100058I20CCGATCCGNONE 
J100067P14CCGATCCGNONE 
J100074F02CCGATCCGNONE 
Os03g0364400AK066529CGGATCGGSimilar to Phytosulfokine receptor-like protein. 
AK071963CGGATCGGNONE 
J013073L01CGGATCGGNONE 
J100037H12CGGATCGGNONE 
Os03g0376000AK059565CCGATCCGACemp24/gp25L/p24 family protein. 
Os03g0390600009-122-E09CCGATCCGNONE 
J065165K04CCGATCCGNONE 
Os03g0421800AK099491CCGATCCGACCGTTGVirulence factor, pectin lyase fold family protein. 
J065198F08CCGATCCGACCGTTGNONE 
Os03g0445700AK071624CCGATCCGACGGCCCGSimilar to LOB domain protein 39. 
J023106M18CCGATCCGACGGCCCGNONE 
J065178J05CCGATCCGACGGCCCGNONE 
J065196F10CCGATCCGACGGCCCGNONE 
Os03g0577200006-030-H11GGACGGACGGATCGGNONE 
AK061735GGACGGACGGATCGGSimilar to Mps one binder kinase activator-like 1A (Mob1 homolog 1A) (Mob1A) (Mob1B) (Protein Mob4A). 
AK098953GGACGGACGGATCGGNONE 
AK099558GGACGGACGGATCGGNONE 
AK104547GGACGGACGGATCGGNONE 
J013034B14GGACGGACGGATCGGNONE 
J013066J17GGACGGACGGATCGGNONE 
J090033N14GGACGGACGGATCGGNONE 
Os03g0594900AK069017CCGATCCGCytochrome P450 family protein. 
Os03g0646300AK069229CGGATCGGACGGSimilar to Cyclic nucleotide-gated channel A (Fragment). 
Os03g0658800009-157-G02CGGATCGGNONE 
AK063030CGGATCGGNONE 
AK065238CGGATCGGCytochrome P450 family protein. 
AK104705CGGATCGGNONE 
J013057F05CGGATCGGNONE 
J065201I16CGGATCGGNONE 
Os03g0666850J065037F06CCGATCCGConserved hypothetical protein. 
Os03g0670200011-069-G05TGTGGGCCCCACCGATCCGNONE 
AK069553TGTGGGCCCCACCGATCCGSimilar to YJR013Wp (Fragment). 
J023020O11TGTGGGCCCCACCGATCCGNONE 
J023114J22TGTGGGCCCCACCGATCCGNONE 
J100084F17TGTGGGCCCCACCGATCCGNONE 
J100087A11TGTGGGCCCCACCGATCCGNONE 
Os03g0684400AK100086CCGTCCGATCCGMg2+ transporter protein, CorA-like family protein. 
Os03g0708400006-108-F11CGGATCGGNONE 
AK066216CGGATCGGProtein of unknown function DUF1295 family protein. 
Os03g0722500AK099926CCGTCGGATCGGGlycoside hydrolase, family 17 protein. 
AK100108CCGTCGGATCGGNONE 
J023004N24CCGTCGGATCGGNONE 
J100018K24CCGTCGGATCGGNONE 
J100032B22CCGTCGGATCGGNONE 
J100036K14CCGTCGGATCGGNONE 
J100043B05CCGTCGGATCGGNONE 
Os03g0734100AK064199CCGATCCGNONE 
AK119903CCGATCCGConserved hypothetical protein. 
J065099L19CCGATCCGNONE 
J065112A13CCGATCCGNONE 
J065169A15CCGATCCGNONE 
J075015D19CCGATCCGNONE 
J075074G10CCGATCCGNONE 
J075147D22CCGATCCGNONE 
J075156O15CCGATCCGNONE 
J100027O19CCGATCCGNONE 
J100031J01CCGATCCGNONE 
J100031O04CCGATCCGNONE 
J100033J11CCGATCCGNONE 
J100037G16CCGATCCGNONE 
J100072C13CCGATCCGNONE 
J100074I19CCGATCCGNONE 
Os03g0753500005-012-D10GTCGGATCGGNONE 
016-012-D03GTCGGATCGGNONE 
016-078-D06GTCGGATCGGNONE 
016-079-A05GTCGGATCGGNONE 
AK070136GTCGGATCGGProtein of unknown function DUF1618 domain containing protein. 
AK100468GTCGGATCGGNONE 
AK103935GTCGGATCGGNONE 
J013089F06GTCGGATCGGNONE 
J013111N14GTCGGATCGGNONE 
J023004F15GTCGGATCGGNONE 
J023049P09GTCGGATCGGNONE 
J023084E09GTCGGATCGGNONE 
J023085A02GTCGGATCGGNONE 
J023092H12GTCGGATCGGNONE 
J023109O13GTCGGATCGGNONE 
J033045G16GTCGGATCGGNONE 
J033050A05GTCGGATCGGNONE 
J033060G05GTCGGATCGGNONE 
J033100F08GTCGGATCGGNONE 
J033103M12GTCGGATCGGNONE 
J033105K21GTCGGATCGGNONE 
J033125H09GTCGGATCGGNONE 
J033138H14GTCGGATCGGNONE 
J043012H09GTCGGATCGGNONE 
J090051L22GTCGGATCGGNONE 
J090066M07GTCGGATCGGNONE 
J090070J09GTCGGATCGGNONE 
J090077M02GTCGGATCGGNONE 
J100019P19GTCGGATCGGNONE 
J100024M18GTCGGATCGGNONE 
J100035E21GTCGGATCGGNONE 
J100050C07GTCGGATCGGNONE 
Os03g0799000013-010-A07CGGATCGGNONE 
013-081-H02CGGATCGGNONE 
AK067840CGGATCGGSimilar to Histone H1. 
AK099211CGGATCGGNONE 
J065066F23CGGATCGGNONE 
J065138O20CGGATCGGNONE 
J065163G22CGGATCGGNONE 
J065211J01CGGATCGGNONE 
J080027D02CGGATCGGNONE 
J080029E20CGGATCGGNONE 
J080045D03CGGATCGGNONE 
J080060G13CGGATCGGNONE 
J080067E14CGGATCGGNONE 
J080067J04CGGATCGGNONE 
J080067J21CGGATCGGNONE 
J080068L09CGGATCGGNONE 
J080077E15CGGATCGGNONE 
J080078B03CGGATCGGNONE 
J080086H09CGGATCGGNONE 
J090095G02CGGATCGGNONE 
J100058H04CGGATCGGNONE 
Os03g0846400AK067706GCAGCCCATGGGCCGGATCGGCCCGGCNONE 
AK070549GCAGCCCATGGGCCGGATCGGCCCGGCPeptidase, trypsin-like serine and cysteine domain containing protein. 
Os04g0244400006-089-A08CCGATCCGNONE 
AK061168CCGATCCGNONE 
AK103892CCGATCCGGlutaredoxin domain containing protein. 
J033150E08CCGATCCGNONE 
J065063D07CCGATCCGNONE 
J065070L22CCGATCCGNONE 
J075022J16CCGATCCGNONE 
J075136O21CCGATCCGNONE 
J075150O05CCGATCCGNONE 
J075197O15CCGATCCGNONE 
J080307A14CCGATCCGNONE 
J100080A07CCGATCCGNONE 
Os04g0253000005-012-H08CGGATCGGNONE 
009-095-D01CGGATCGGNONE 
016-090-D11CGGATCGGNONE 
AK073668CGGATCGGSimilar to Histone H1. 
J013088G23CGGATCGGNONE 
J013162C07CGGATCGGNONE 
J023031N06CGGATCGGNONE 
J023039N07CGGATCGGNONE 
J023083I01CGGATCGGNONE 
J023083O14CGGATCGGNONE 
J023122B19CGGATCGGNONE 
J023133L08CGGATCGGNONE 
J033052L06CGGATCGGNONE 
J033080E10CGGATCGGNONE 
J090032L14CGGATCGGNONE 
J100022N05CGGATCGGNONE 
J100029A08CGGATCGGNONE 
J100029H18CGGATCGGNONE 
J100066D09CGGATCGGNONE 
J100077M22CGGATCGGNONE 
Os04g0269900J065139P11CGTCGGATCGGNONE 
J100034P12CGTCGGATCGGNONE 
J100045D21CGTCGGATCGGNONE 
Os04g0278900AK073070CGGATCGGACDihydrouridine synthase, DuS family protein. 
AK108886CGGATCGGACNONE 
Os04g0306800AK058450GGGCCGGATCGGNONE 
Os04g0398400AK111123CGGATCGGHypothetical protein. 
Os04g0401800AB197127AGCCGTCCGATCCGDNA repair metallo-beta-lactamase domain containing protein. 
AK103868AGCCGTCCGATCCGNONE 
J033149H08AGCCGTCCGATCCGNONE 
J065020C11AGCCGTCCGATCCGNONE 
J075179J09AGCCGTCCGATCCGNONE 
J090034B13AGCCGTCCGATCCGNONE 
Os04g0412100AK108223CCGATCCGCGTGCGConserved hypothetical protein. 
Os04g0448200AK068842CGTCCGATCCGConserved hypothetical protein. 
Os04g0469000009-089-B06CCGATCCGNONE 
009-111-A10CCGATCCGNONE 
AK062816CCGATCCGHeavy metal transport/detoxification protein domain containing protein. 
J080004F04CCGATCCGNONE 
J080021H03CCGATCCGNONE 
J080038F20CCGATCCGNONE 
J080066G20CCGATCCGNONE 
J080084E17CCGATCCGNONE 
Os04g0490000AK108365CCGATCCGSimilar to Glutamate synthase [NADH], chloroplast precursor (EC 1.4.1.14) (NADH- GOGAT). 
Os04g0491500AK068089GTCGGATCGGNONE 
AK101116GTCGGATCGGTGF-beta receptor, type I/II extracellular region family protein. 
Os04g0530300009-053-E04CGTCGGATCGGNONE 
009-074-E03CGTCGGATCGGNONE 
AK066705CGTCGGATCGGConserved hypothetical protein. 
Os04g0643100014-026-F09CCGATCCGNONE 
AK067501CCGATCCGSimilar to Vacuolar ATP synthase subunit D (EC 3.6.3.14) (V-ATPase D subunit) (Vacuolar proton pump D subunit). 
AK106989CCGATCCGNONE 
J013110H12CCGATCCGNONE 
J090089E23CCGATCCGNONE 
J100033G14CCGATCCGNONE 
J100033L15CCGATCCGNONE 
J100041J24CCGATCCGNONE 
J100041M14CCGATCCGNONE 
J100057A03CCGATCCGNONE 
J100059C11CCGATCCGNONE 
J100072B15CCGATCCGNONE 
J100073N24CCGATCCGNONE 
Os04g0647800AK065350CGGATCGGSimilar to Glycerol kinase 2 (EC 2.7.1.30). 
AK069876CGGATCGGNONE 
AK104069CGGATCGGNONE 
Os04g0649500009-071-C01CCGATCCGNONE 
AK120461CCGATCCGConserved hypothetical protein. 
J013107G06CCGATCCGNONE 
J033082B16CCGATCCGNONE 
J065027G19CCGATCCGNONE 
J065132D10CCGATCCGNONE 
Os04g0661300AK070723CGGATCGGACGGConserved hypothetical protein. 
AK103942CGGATCGGACGGNONE 
Os04g0671200006-103-F11CCGATCCGNONE 
AK106044CCGATCCGNONE 
Os04g0689300AK100293CGGATCGGPhosphatidylinositol-specific phospholipase C, X region domain containing protein. 
Os05g0102000AK064690CGGATCGGSAM dependent carboxyl methyltransferase family protein. 
J065086M17CGGATCGGNONE 
J065128C12CGGATCGGNONE 
Os05g0127300AK106429CCGATCCGACGCGTCCGTCCGNONE 
AK121766CCGATCCGACGCGTCCGTCCGRegulator of chromosome condensation/beta-lactamase-inhibitor protein II domain containing protein. 
J065021F23CCGATCCGACGCGTCCGTCCGNONE 
J100041J04CCGATCCGACGCGTCCGTCCGNONE 
Os05g0169400AK073439GCTGGGCCGGATCGGGCCGAProtein of unknown function DUF1421 family protein. 
J013110E15GCTGGGCCGGATCGGGCCGANONE 
J033044H02GCTGGGCCGGATCGGGCCGANONE 
Os05g0170000003-129-C04CCGATCCGACGGCCCAGANONE 
AK100216CCGATCCGACGGCCCAGAProtein of unknown function DUF266, plant family protein. 
AK103412CCGATCCGACGGCCCAGANONE 
J023045H21CCGATCCGACGGCCCAGANONE 
J033128G01CCGATCCGACGGCCCAGANONE 
J065017O10CCGATCCGACGGCCCAGANONE 
J065032H11CCGATCCGACGGCCCAGANONE 
J065120G09CCGATCCGACGGCCCAGANONE 
Os05g0176500006-077-A12CGGATCGGNONE 
AK059866CGGATCGGATP10 family protein. 
AK099352CGGATCGGNONE 
Os05g0413200006-067-C03GCCGTCCGATCCGNONE 
006-080-C03GCCGTCCGATCCGNONE 
006-095-G10GCCGTCCGATCCGNONE 
006-115-G11GCCGTCCGATCCGNONE 
013-040-E05GCCGTCCGATCCGNONE 
AB104732GCCGTCCGATCCGNONE 
AK122099GCCGTCCGATCCGBeta-tubulin. 
J033087H20GCCGTCCGATCCGNONE 
J033117C18GCCGTCCGATCCGNONE 
J033125G10GCCGTCCGATCCGNONE 
Os05g0428600AK106696CCGATCCGSimilar to HSP70 precursor. 
Os05g0446000AK070640CCGATCCGSimilar to Transcriptional activator DEMETER (DNA glycosylase-related protein DME). 
Os05g0453700009-171-G06CCGATCCGNONE 
015-019-F02CCGATCCGNONE 
AB110169CCGATCCGNONE 
AK063881CCGATCCGSimilar to ENOD18 protein (Fragment). 
AK073600CCGATCCGNONE 
J033048I03CCGATCCGNONE 
J065026A09CCGATCCGNONE 
J065028M08CCGATCCGNONE 
J075140N01CCGATCCGNONE 
Os05g0458400AK069936CGGATCGGSimilar to AAA-metalloprotease FtsH. 
Os05g0466600009-088-F09CCGATCCGNONE 
009-105-C11CCGATCCGNONE 
009-156-C06CCGATCCGNONE 
AK119240CCGATCCGhistone H4 [Oryza sativa (japonica cultivar-group)]. 
Os05g0480000AK061052CGGATCGGProtein kinase domain containing protein. 
Os05g0547850009-102-F03CGGATCGGACGGCCNONE 
013-076-H08CGGATCGGACGGCCNONE 
AK058330CGGATCGGACGGCCNONE 
AK122158CGGATCGGACGGCCDNA-binding TFAR19-related protein family protein. 
AY626826CGGATCGGACGGCCNONE 
J043012O19CGGATCGGACGGCCNONE 
J043038O15CGGATCGGACGGCCNONE 
J053094L06CGGATCGGACGGCCNONE 
Os05g0548100AK060333AGCCGTCCGATCCGConserved hypothetical protein. 
AK100682AGCCGTCCGATCCGNONE 
J013151E01AGCCGTCCGATCCGNONE 
J023113L22AGCCGTCCGATCCGNONE 
J043027A19AGCCGTCCGATCCGNONE 
J075093E06AGCCGTCCGATCCGNONE 
J090060D15AGCCGTCCGATCCGNONE 
J090082J03AGCCGTCCGATCCGNONE 
J100050E01AGCCGTCCGATCCGNONE 
Os05g0560600011-097-B07CACGTCTCCGATCCGNONE 
AK067862CACGTCTCCGATCCGNONE 
AK122091CACGTCTCCGATCCGHomeodomain-like containing protein. 
J013124K11CACGTCTCCGATCCGNONE 
J033124C04CACGTCTCCGATCCGNONE 
J065013L06CACGTCTCCGATCCGNONE 
J065117J23CACGTCTCCGATCCGNONE 
Os05g0574500006-021-A08CCGATCCGNONE 
006-049-A11CCGATCCGNONE 
006-086-F03CCGATCCGNONE 
009-051-F06CCGATCCGNONE 
AB015287CCGATCCGNONE 
AB015972CCGATCCGNONE 
AK061714CCGATCCGNONE 
AK098889CCGATCCGNONE 
AK121699CCGATCCGSimilar to GTP-binding nuclear protein Ran1B (Fragment). 
J013001L15CCGATCCGNONE 
J013072D17CCGATCCGNONE 
J023028M04CCGATCCGNONE 
J023031F01CCGATCCGNONE 
J023114L22CCGATCCGNONE 
J033058L12CCGATCCGNONE 
J033073D17CCGATCCGNONE 
J043031D08CCGATCCGNONE 
J043036G01CCGATCCGNONE 
J065144O04CCGATCCGNONE 
J065181O08CCGATCCGNONE 
J080066B20CCGATCCGNONE 
Os05g0586600AB096011CCGTCCGATCCGPlastid sigma factor SIG5. 
AB096071CCGTCCGATCCGNONE 
AK105697CCGTCCGATCCGNONE 
Os06g0103400009-138-H04CCGATCCGATCCGNONE 
AK067021CCGATCCGATCCGNucleic acid-binding, OB-fold domain containing protein. 
AK071627CCGATCCGATCCGNONE 
J080307A01CCGATCCGATCCGNONE 
Os06g0104000AK068490CGGATCGGConserved hypothetical protein. 
Os06g0130800014-002-A12CCGATCCGNONE 
014-002-A12CGGATCGGNONE 
AK069863CCGATCCGHistone H5 family protein. 
AK069863CGGATCGGHistone H5 family protein. 
J023037L12CCGATCCGNONE 
J023037L12CGGATCGGNONE 
J065013F22CCGATCCGNONE 
J065013F22CGGATCGGNONE 
J065021C09CCGATCCGNONE 
J065021C09CGGATCGGNONE 
J065065E23CCGATCCGNONE 
J065065E23CGGATCGGNONE 
J065066L24CCGATCCGNONE 
J065066L24CGGATCGGNONE 
J065093N06CCGATCCGNONE 
J065093N06CGGATCGGNONE 
J065135B12CCGATCCGNONE 
J065135B12CGGATCGGNONE 
J065142J19CCGATCCGNONE 
J065142J19CGGATCGGNONE 
J065163M21CCGATCCGNONE 
J065163M21CGGATCGGNONE 
J065167K01CCGATCCGNONE 
J065167K01CGGATCGGNONE 
J065178F24CCGATCCGNONE 
J065178F24CGGATCGGNONE 
J065179A22CCGATCCGNONE 
J065179A22CGGATCGGNONE 
J065196O19CCGATCCGNONE 
J065196O19CGGATCGGNONE 
J075041I03CCGATCCGNONE 
J075041I03CGGATCGGNONE 
J075071E18CCGATCCGNONE 
J075071E18CGGATCGGNONE 
J075071F17CCGATCCGNONE 
J075071F17CGGATCGGNONE 
J075125K04CCGATCCGNONE 
J075125K04CGGATCGGNONE 
J075141I12CCGATCCGNONE 
J075141I12CGGATCGGNONE 
J075142M02CCGATCCGNONE 
J075142M02CGGATCGGNONE 
J075150G22CCGATCCGNONE 
J075150G22CGGATCGGNONE 
J075151J04CCGATCCGNONE 
J075151J04CGGATCGGNONE 
J075195A03CCGATCCGNONE 
J075195A03CGGATCGGNONE 
J080023G18CCGATCCGNONE 
J080023G18CGGATCGGNONE 
J080076P03CCGATCCGNONE 
J080076P03CGGATCGGNONE 
J090051F21CCGATCCGNONE 
J090051F21CGGATCGGNONE 
J090082L05CCGATCCGNONE 
J090082L05CGGATCGGNONE 
U74296CCGATCCGNONE 
U74296CGGATCGGNONE 
Os06g0308300AK059211CCGTCGGATCGGNONE 
AK101549CCGTCGGATCGGNONE 
AK102553CCGTCGGATCGGSimilar to 65kD microtubule associated protein. 
J090014G18CCGTCGGATCGGNONE 
J090082B01CCGTCGGATCGGNONE 
Os06g0542100AK111086CCGATCCGHypothetical protein. 
J090051D03CCGATCCGNONE 
Os06g0542600J075111K18CGGATCGGProtein of unknown function DUF295 family protein. 
Os06g0560400AK103575CCGATCCGACGTGTCCNONE 
AK108074CCGATCCGACGTGTCCProtein of unknown function DUF862, eukaryotic domain containing protein. 
Os06g0604400AK072121CCGATCCGACSimilar to Phospholipase D. 
Os06g0716100009-080-B12CGGATCGGACGGANONE 
009-192-E07CGGATCGGACGGANONE 
AK068387CGGATCGGACGGANONE 
AK071515CGGATCGGACGGASimilar to Chaperone protein dnaJ. 
J080018J01CGGATCGGACGGANONE 
J080039P07CGGATCGGACGGANONE 
J080068K20CGGATCGGACGGANONE 
Os07g0115300006-039-C05CGGATCGGNONE 
AK061511CGGATCGGSimilar to Peroxidase2 precursor (EC 1.11.1.7). 
Os07g0184800AK059544CCGATCCGACGGSimilar to Variant of histone H1. 
AK099050CCGATCCGACGGNONE 
AK102642CCGATCCGACGGNONE 
AK106132CCGATCCGACGGNONE 
J023037O08CCGATCCGACGGNONE 
J023050M02CCGATCCGACGGNONE 
J023087A10CCGATCCGACGGNONE 
J033027D14CCGATCCGACGGNONE 
J033028N17CCGATCCGACGGNONE 
J033043P10CCGATCCGACGGNONE 
J033051D07CCGATCCGACGGNONE 
J033073M07CCGATCCGACGGNONE 
J033075H01CCGATCCGACGGNONE 
J033084E04CCGATCCGACGGNONE 
J033096D10CCGATCCGACGGNONE 
J033100F04CCGATCCGACGGNONE 
J033114B06CCGATCCGACGGNONE 
J033117C10CCGATCCGACGGNONE 
J033140B21CCGATCCGACGGNONE 
J043034J07CCGATCCGACGGNONE 
J065006F04CCGATCCGACGGNONE 
J065130H16CCGATCCGACGGNONE 
J075020G13CCGATCCGACGGNONE 
J075108M17CCGATCCGACGGNONE 
J080018A06CCGATCCGACGGNONE 
J080037J11CCGATCCGACGGNONE 
J080048F15CCGATCCGACGGNONE 
J080057D16CCGATCCGACGGNONE 
J080069A10CCGATCCGACGGNONE 
J080086L09CCGATCCGACGGNONE 
J080088A17CCGATCCGACGGNONE 
J100046F24CCGATCCGACGGNONE 
Os07g0545400009-136-E03CCGATCCGACGGNONE 
009-136-E03CGCCACGTCACCGATCCGNONE 
013-015-G08CCGATCCGACGGNONE 
013-015-G08CGCCACGTCACCGATCCGNONE 
AK059228CCGATCCGACGGNONE 
AK059228CGCCACGTCACCGATCCGNONE 
J065040D09CCGATCCGACGGNONE 
J065040D09CGCCACGTCACCGATCCGNONE 
J065051C19CCGATCCGACGGNONE 
J065051C19CGCCACGTCACCGATCCGNONE 
J065139B05CCGATCCGACGGNONE 
J065139B05CGCCACGTCACCGATCCGNONE 
J065160E20CCGATCCGACGGNONE 
J065160E20CGCCACGTCACCGATCCGNONE 
J065207I17CCGATCCGACGGNONE 
J065207I17CGCCACGTCACCGATCCGNONE 
J080319M24CCGATCCGACGGNONE 
J080319M24CGCCACGTCACCGATCCGNONE 
Os07g0589000AK069813CCGATCCGACGGCCCGLateral organ boundaries, LOB domain containing protein. 
J023030F23CCGATCCGACGGCCCGNONE 
J065165H21CCGATCCGACGGCCCGNONE 
J065193G01CCGATCCGACGGCCCGNONE 
J075093F03CCGATCCGACGGCCCGNONE 
Os07g0607800012-042-C02CCGATCCGNONE 
015-097-B06CCGATCCGNONE 
AK069010CCGATCCGNONE 
J013170I18CCGATCCGNONE 
J090036G23CCGATCCGNONE 
Os07g0631000AK066723CGGATCGGProtein of unknown function DUF298 family protein. 
Os07g0659300AK069789CGGATCGGConserved hypothetical protein. 
Os07g0674100AB183706CCGATCCGUDP-glucuronic acid decarboxylase. 
AK099614CCGATCCGNONE 
J013050E02CCGATCCGNONE 
J065162F06CCGATCCGNONE 
J065180F10CCGATCCGNONE 
J090049F09CCGATCCGNONE 
J100064L11CCGATCCGNONE 
Os07g0674300AK110511CGGATCGGProtein prenyltransferase domain containing protein. 
Os08g0135900AK072535CCGATCCGGTGGGCCCGGTSimilar to Tryptophan synthase beta chain 1 (EC 4.2.1.20) (Orange pericarp 1) (Fragment). 
Os08g0421900AK064578CGGATCGGBromo adjacent region domain containing protein. 
J065102G01CGGATCGGNONE 
J065164C04CGGATCGGNONE 
J090043M20CGGATCGGNONE 
Os08g0455800006-050-A09CGGATCGGNONE 
AK061573CGGATCGGProtein of unknown function DUF985 family protein. 
AK099156CGGATCGGNONE 
J023067L05CGGATCGGNONE 
J065101A05CGGATCGGNONE 
J065171H09CGGATCGGNONE 
J100022D08CGGATCGGNONE 
J100029K04CGGATCGGNONE 
J100029O10CGGATCGGNONE 
Os08g0469500AK109599CCGATCCGConserved hypothetical protein. 
Os08g0512700AK060545CCGATCCGSimilar to 3-hydroxy-3-methylglutaryl coenzyme A reductase (EC 1.1.1.34) (Fragment). 
Os09g0110300AK061798CCGATCCGPutative cyclase family protein. 
AK098934CCGATCCGNONE 
Os09g0241100AK109602CCGATCCGNONE 
Os09g0251800006-100-E12CCGATCCGNONE 
AK061218CCGATCCGC2 calcium/lipid-binding region, CaLB domain containing protein. 
AK104010CCGATCCGNONE 
J065048A02CCGATCCGNONE 
J065073P10CCGATCCGNONE 
J065075B09CCGATCCGNONE 
J065112B05CCGATCCGNONE 
J090014H10CCGATCCGNONE 
Os09g0281900AK121112CGGATCGGACGGCTThyroid hormone receptor-associated protein complex component TRAP170- like protein. 
J023073I01CGGATCGGACGGCTNONE 
Os09g0358500Os09g0358500CGGATCGGNONE 
Os09g0367900011-030-A03CCGATCCGACGGCCCAGATNONE 
AK061601CCGATCCGACGGCCCAGATNONE 
AK063310CCGATCCGACGGCCCAGATHypothetical protein. 
J100063G01CCGATCCGACGGCCCAGATNONE 
Os09g0381100AK064905CCGATCCGNONE 
AK121778CCGATCCGXanthine/uracil/vitamin C permease family protein. 
J013000L20CCGATCCGNONE 
J033113A02CCGATCCGNONE 
J090050N04CCGATCCGNONE 
Os09g0512900006-066-A10CCGATCCGATCCGACNONE 
AK061814CCGATCCGATCCGACConserved hypothetical protein. 
AK066925CCGATCCGATCCGACNONE 
AK104595CCGATCCGATCCGACNONE 
J013092F14CCGATCCGATCCGACNONE 
J023148N20CCGATCCGATCCGACNONE 
J033131F06CCGATCCGATCCGACNONE 
J053025L20CCGATCCGATCCGACNONE 
J075003B20CCGATCCGATCCGACNONE 
J075019N18CCGATCCGATCCGACNONE 
J075032D10CCGATCCGATCCGACNONE 
J075037G14CCGATCCGATCCGACNONE 
J075098D24CCGATCCGATCCGACNONE 
J075106M13CCGATCCGATCCGACNONE 
J075122N14CCGATCCGATCCGACNONE 
J075146E22CCGATCCGATCCGACNONE 
J075187E06CCGATCCGATCCGACNONE 
J075198I17CCGATCCGATCCGACNONE 
J090023O05CCGATCCGATCCGACNONE 
J100040E10CCGATCCGATCCGACNONE 
J100080P12CCGATCCGATCCGACNONE 
J100088B06CCGATCCGATCCGACNONE 
Os09g0513700015-070-E12GTCCGATCCGNONE 
AK071999GTCCGATCCGRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
AK099033GTCCGATCCGNONE 
J075060C23GTCCGATCCGNONE 
J075170L17GTCCGATCCGNONE 
Os09g0542200006-092-A09CCGATCCGATCCGNONE 
AK064887CCGATCCGATCCGThioredoxin fold domain containing protein. 
AK104804CCGATCCGATCCGNONE 
J013000K12CCGATCCGATCCGNONE 
J013170A19CCGATCCGATCCGNONE 
J033103B02CCGATCCGATCCGNONE 
J065196J20CCGATCCGATCCGNONE 
J075037H17CCGATCCGATCCGNONE 
J075069H14CCGATCCGATCCGNONE 
J075071C16CCGATCCGATCCGNONE 
J075095N02CCGATCCGATCCGNONE 
J075136N03CCGATCCGATCCGNONE 
J075192L16CCGATCCGATCCGNONE 
J100057N23CCGATCCGATCCGNONE 
J100060O07CCGATCCGATCCGNONE 
J100062F10CCGATCCGATCCGNONE 
J100077I08CCGATCCGATCCGNONE 
J100086B07CCGATCCGATCCGNONE 
J100088L14CCGATCCGATCCGNONE 
Os09g0548100009-134-B12GTCGGATCGGNONE 
AK062925GTCGGATCGGHypothetical protein. 
Os09g0548700Os09g0548700CGGATCGGFAD dependent oxidoreductase family protein. 
Os09g0551600005-020-H08CGGATCGGTGACGTGGCGNONE 
006-043-E02CGGATCGGTGACGTGGCGNONE 
013-043-F03CGGATCGGTGACGTGGCGNONE 
AK066658CGGATCGGTGACGTGGCGSimilar to HMGd1 protein (Nucleasome/chromatin assembly factor D protein NFD101). 
J013071N11CGGATCGGTGACGTGGCGNONE 
J065177J20CGGATCGGTGACGTGGCGNONE 
J075041D06CGGATCGGTGACGTGGCGNONE 
J075199H24CGGATCGGTGACGTGGCGNONE 
J080001G07CGGATCGGTGACGTGGCGNONE 
J080024A12CGGATCGGTGACGTGGCGNONE 
J080025B15CGGATCGGTGACGTGGCGNONE 
J090017G07CGGATCGGTGACGTGGCGNONE 
J090050G23CGGATCGGTGACGTGGCGNONE 
J090083G11CGGATCGGTGACGTGGCGNONE 
Os11g0146700AK065900CGGATCGGNONE 
AK072412CGGATCGGRED-like, C-terminal family protein. 
Os11g0206600AK121822CGGATCGGNONE 
Os11g0557700AK071694CCGATCCGACGNONE 
AK107593CCGATCCGACGSAM (and some other nucleotide) binding motif domain containing protein. 
J023108E23CCGATCCGACGNONE 
Os12g0170400012-013-C12CCGATCCGNONE 
012-078-F04CCGATCCGNONE 
016-038-B08CCGATCCGNONE 
AK121826CCGATCCGZinc finger, C2H2-type domain containing protein. 
J033086P08CCGATCCGNONE 
J033099G14CCGATCCGNONE 
J065019L01CCGATCCGNONE 
J065093E18CCGATCCGNONE 
J065138J04CCGATCCGNONE 
J065139B14CCGATCCGNONE 
J065193K21CCGATCCGNONE 
J075005D01CCGATCCGNONE 
J075057B19CCGATCCGNONE 
J075061A15CCGATCCGNONE 
J075105N16CCGATCCGNONE 
J075146K15CCGATCCGNONE 
J100026B22CCGATCCGNONE 
Os12g0210200AF309381CCGATCCGACGNONE 
AK069105CCGATCCGACGSimilar to Glutathione S-transferase GST 18 (EC 2.5.1.18). 
J023004I03CCGATCCGACGNONE 
J033069C11CCGATCCGACGNONE 
J065087E20CCGATCCGACGNONE 
J065097G21CCGATCCGACGNONE 
Os12g0274700003-008-G09CCGATCCGNONE 
006-028-B09CCGATCCGNONE 
006-029-D12CCGATCCGNONE 
006-034-G05CCGATCCGNONE 
006-036-A02CCGATCCGNONE 
006-039-A08CCGATCCGNONE 
006-057-H10CCGATCCGNONE 
006-064-D08CCGATCCGNONE 
006-064-G03CCGATCCGNONE 
006-071-B05CCGATCCGNONE 
006-089-D01CCGATCCGNONE 
006-095-G02CCGATCCGNONE 
006-098-H02CCGATCCGNONE 
006-109-H01CCGATCCGNONE 
006-115-H09CCGATCCGNONE 
006-120-B02CCGATCCGNONE 
009-005-E08CCGATCCGNONE 
009-027-E04CCGATCCGNONE 
009-028-A10CCGATCCGNONE 
009-050-G03CCGATCCGNONE 
009-070-E05CCGATCCGNONE 
009-095-D10CCGATCCGNONE 
009-103-A05CCGATCCGNONE 
009-113-G09CCGATCCGNONE 
009-116-E08CCGATCCGNONE 
009-125-F02CCGATCCGNONE 
009-125-F09CCGATCCGNONE 
009-129-F03CCGATCCGNONE 
009-130-F01CCGATCCGNONE 
009-140-F07CCGATCCGNONE 
009-151-F07CCGATCCGNONE 
009-153-D04CCGATCCGNONE 
009-165-D08CCGATCCGNONE 
009-170-E11CCGATCCGNONE 
009-171-C01CCGATCCGNONE 
009-171-G05CCGATCCGNONE 
009-189-F07CCGATCCGNONE 
009-193-H05CCGATCCGNONE 
009-194-D08CCGATCCGNONE 
AF017364CCGATCCGNONE 
AF052305CCGATCCGNONE 
AK061611CCGATCCGNONE 
AK119219CCGATCCGNONE 
AK121444CCGATCCGSimilar to Petunia ribulose 1,5-bisphosphate carboxylase small subunit mRNA (clone pSSU 51), partial cds. (Fragment). 
D00643CCGATCCGNONE 
J013031F15CCGATCCGNONE 
J013037P20CCGATCCGNONE 
J013050D13CCGATCCGNONE 
J013056J24CCGATCCGNONE 
J013063C09CCGATCCGNONE 
J013071M01CCGATCCGNONE 
J013074G12CCGATCCGNONE 
J013120E19CCGATCCGNONE 
J013124M17CCGATCCGNONE 
J013127I18CCGATCCGNONE 
J013129G13CCGATCCGNONE 
J013132L16CCGATCCGNONE 
J013146M05CCGATCCGNONE 
J023044F05CCGATCCGNONE 
J023056E16CCGATCCGNONE 
J023141B14CCGATCCGNONE 
J065008E12CCGATCCGNONE 
J065010I24CCGATCCGNONE 
J065013B01CCGATCCGNONE 
J065019L16CCGATCCGNONE 
J065021E19CCGATCCGNONE 
J065027G11CCGATCCGNONE 
J065039B19CCGATCCGNONE 
J065039K03CCGATCCGNONE 
J065044I07CCGATCCGNONE 
J065047B10CCGATCCGNONE 
J065050A16CCGATCCGNONE 
J065050B15CCGATCCGNONE 
J065052H09CCGATCCGNONE 
J065053K05CCGATCCGNONE 
J065061H12CCGATCCGNONE 
J065061M13CCGATCCGNONE 
J065078M16CCGATCCGNONE 
J065083L13CCGATCCGNONE 
J065084L01CCGATCCGNONE 
J065091O21CCGATCCGNONE 
J065095D06CCGATCCGNONE 
J065095J12CCGATCCGNONE 
J065097I18CCGATCCGNONE 
J065114N19CCGATCCGNONE 
J065118P09CCGATCCGNONE 
J065123D11CCGATCCGNONE 
J065123F08CCGATCCGNONE 
J065124B04CCGATCCGNONE 
J065128C04CCGATCCGNONE 
J065137J07CCGATCCGNONE 
J065165K23CCGATCCGNONE 
J065183D22CCGATCCGNONE 
J065195B17CCGATCCGNONE 
J065201N18CCGATCCGNONE 
J065204K15CCGATCCGNONE 
J065208F08CCGATCCGNONE 
J075011P21CCGATCCGNONE 
J075020D18CCGATCCGNONE 
J075028H08CCGATCCGNONE 
J075065H14CCGATCCGNONE 
J075069O11CCGATCCGNONE 
J075071P10CCGATCCGNONE 
J075177C11CCGATCCGNONE 
J080002E12CCGATCCGNONE 
J080002F23CCGATCCGNONE 
J080002J09CCGATCCGNONE 
J080003L11CCGATCCGNONE 
J080004C05CCGATCCGNONE 
J080004E12CCGATCCGNONE 
J080004L13CCGATCCGNONE 
J080006E06CCGATCCGNONE 
J080006H14CCGATCCGNONE 
J080008B07CCGATCCGNONE 
J080008C21CCGATCCGNONE 
J080008G01CCGATCCGNONE 
J080008I09CCGATCCGNONE 
J080008J10CCGATCCGNONE 
J080008O08CCGATCCGNONE 
J080009C10CCGATCCGNONE 
J080009M22CCGATCCGNONE 
J080009O11CCGATCCGNONE 
J080009P22CCGATCCGNONE 
J080010B11CCGATCCGNONE 
J080010K04CCGATCCGNONE 
J080011F13CCGATCCGNONE 
J080013K07CCGATCCGNONE 
J080014H24CCGATCCGNONE 
J080015A13CCGATCCGNONE 
J080015G11CCGATCCGNONE 
J080015N21CCGATCCGNONE 
J080016N04CCGATCCGNONE 
J080018I15CCGATCCGNONE 
J080018O22CCGATCCGNONE 
J080020N07CCGATCCGNONE 
J080021F19CCGATCCGNONE 
J080021K02CCGATCCGNONE 
J080023E20CCGATCCGNONE 
J080025M08CCGATCCGNONE 
J080026E10CCGATCCGNONE 
J080027M18CCGATCCGNONE 
J080029C04CCGATCCGNONE 
J080030A07CCGATCCGNONE 
J080030A13CCGATCCGNONE 
J080030D14CCGATCCGNONE 
J080030D18CCGATCCGNONE 
J080031H14CCGATCCGNONE 
J080031N07CCGATCCGNONE 
J080032B12CCGATCCGNONE 
J080036N19CCGATCCGNONE 
J080036O03CCGATCCGNONE 
J080038J23CCGATCCGNONE 
J080040D10CCGATCCGNONE 
J080040E08CCGATCCGNONE 
J080041K04CCGATCCGNONE 
J080042F24CCGATCCGNONE 
J080042H22CCGATCCGNONE 
J080042H23CCGATCCGNONE 
J080044N24CCGATCCGNONE 
J080045F16CCGATCCGNONE 
J080046C04CCGATCCGNONE 
J080046C19CCGATCCGNONE 
J080046L07CCGATCCGNONE 
J080046M19CCGATCCGNONE 
J080048N16CCGATCCGNONE 
J080048P05CCGATCCGNONE 
J080049N15CCGATCCGNONE 
J080050G22CCGATCCGNONE 
J080052A09CCGATCCGNONE 
J080052J01CCGATCCGNONE 
J080053N04CCGATCCGNONE 
J080055K09CCGATCCGNONE 
J080056N06CCGATCCGNONE 
J080057G09CCGATCCGNONE 
J080058E22CCGATCCGNONE 
J080059E04CCGATCCGNONE 
J080061F19CCGATCCGNONE 
J080062C19CCGATCCGNONE 
J080062E15CCGATCCGNONE 
J080063M12CCGATCCGNONE 
J080063P12CCGATCCGNONE 
J080064F02CCGATCCGNONE 
J080064O16CCGATCCGNONE 
J080065E22CCGATCCGNONE 
J080066C18CCGATCCGNONE 
J080068E10CCGATCCGNONE 
J080068O13CCGATCCGNONE 
J080069A09CCGATCCGNONE 
J080069M24CCGATCCGNONE 
J080071B21CCGATCCGNONE 
J080071C23CCGATCCGNONE 
J080072H01CCGATCCGNONE 
J080072I16CCGATCCGNONE 
J080074D12CCGATCCGNONE 
J080075F18CCGATCCGNONE 
J080075J08CCGATCCGNONE 
J080075N24CCGATCCGNONE 
J080076L02CCGATCCGNONE 
J080076L21CCGATCCGNONE 
J080077E23CCGATCCGNONE 
J080079M18CCGATCCGNONE 
J080080B19CCGATCCGNONE 
J080080H19CCGATCCGNONE 
J080080L11CCGATCCGNONE 
J080081L18CCGATCCGNONE 
J080082N16CCGATCCGNONE 
J080083M19CCGATCCGNONE 
J080084C20CCGATCCGNONE 
J080084M05CCGATCCGNONE 
J080085O19CCGATCCGNONE 
J080086E02CCGATCCGNONE 
J080087B17CCGATCCGNONE 
J080088G21CCGATCCGNONE 
J080088M20CCGATCCGNONE 
J080089H02CCGATCCGNONE 
J080090F01CCGATCCGNONE 
J080090O03CCGATCCGNONE 
J080091F10CCGATCCGNONE 
J080091F21CCGATCCGNONE 
J080091G07CCGATCCGNONE 
J080091H02CCGATCCGNONE 
J080092C01CCGATCCGNONE 
J080092C08CCGATCCGNONE 
J080092H03CCGATCCGNONE 
J080092L08CCGATCCGNONE 
J080094F04CCGATCCGNONE 
J080094H13CCGATCCGNONE 
J080095B19CCGATCCGNONE 
J080096G21CCGATCCGNONE 
J080096M14CCGATCCGNONE 
J080097M21CCGATCCGNONE 
J080308I23CCGATCCGNONE 
J080319A21CCGATCCGNONE 
J090009G07CCGATCCGNONE 
J090015E19CCGATCCGNONE 
L22155CCGATCCGNONE 
Os12g0457500015-025-F11CGGATCGGNONE 
AK073212CGGATCGGHypothetical protein. 
Os12g0485500AK071132CGGATCGGATCCGACGGSimilar to HesB/YadR/YfhF family protein. 
AK099510CGGATCGGATCCGACGGNONE 
J065024D15CGGATCGGATCCGACGGNONE 
J075168O15CGGATCGGATCCGACGGNONE 
J075190F06CGGATCGGATCCGACGGNONE 
Os12g0498800AK067767CGGATCGGACConserved hypothetical protein. 
J065073G03CGGATCGGACNONE 
J065102I05CGGATCGGACNONE 
Os12g0636600AK111056CCGATCCGConserved hypothetical protein. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.