version

Summary of OsREG542 (All List)

OrganismOryza sativa  
IDOsREG542  
SequenceCCGGCCCA  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count5129  

Entry Sequences (5129 entries)

LocusGene modelSequenceDescription
Os01g0100700006-066-G10CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
009-108-B10CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
AK059844CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
AK121523CCTGGGCCGGGCCCGGCCCAGCCCAACASimilar to 40S ribosomal protein S5-1. 
J023037D16CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J033028P14CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J033064M07CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J033123M01CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J065026O07CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J065082A05CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J075003I02CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J075170J15CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J100040D18CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
Os01g0134200AK102394AATTGGGCCGGCConserved hypothetical protein. 
Os01g0147200016-005-F02ATTTGGGCCGGANONE 
016-005-F02GGGCCCGGCCCATCANONE 
AK106463ATTTGGGCCGGANONE 
AK106463GGGCCCGGCCCATCANONE 
AK121921ATTTGGGCCGGAIWS1, C-terminal family protein. 
AK121921GGGCCCGGCCCATCAIWS1, C-terminal family protein. 
J033098O16ATTTGGGCCGGANONE 
J033098O16GGGCCCGGCCCATCANONE 
J033106E16ATTTGGGCCGGANONE 
J033106E16GGGCCCGGCCCATCANONE 
J043026D12ATTTGGGCCGGANONE 
J043026D12GGGCCCGGCCCATCANONE 
J065070B04ATTTGGGCCGGANONE 
J065070B04GGGCCCGGCCCATCANONE 
J065162L03ATTTGGGCCGGANONE 
J065162L03GGGCCCGGCCCATCANONE 
J065166F01ATTTGGGCCGGANONE 
J065166F01GGGCCCGGCCCATCANONE 
J075030A13ATTTGGGCCGGANONE 
J075030A13GGGCCCGGCCCATCANONE 
J075093O12ATTTGGGCCGGANONE 
J075093O12GGGCCCGGCCCATCANONE 
J075106K15ATTTGGGCCGGANONE 
J075106K15GGGCCCGGCCCATCANONE 
J075107F20ATTTGGGCCGGANONE 
J075107F20GGGCCCGGCCCATCANONE 
J090031F21ATTTGGGCCGGANONE 
J090031F21GGGCCCGGCCCATCANONE 
J090079E17ATTTGGGCCGGANONE 
J090079E17GGGCCCGGCCCATCANONE 
Os01g0157900AK072658CTTGGGCTGGGCCGGCTGGGCCTTProtein of unknown function Cys-rich family protein. 
Os01g0158000AK058679TCCGGCCCAGTNONE 
AK103127TCCGGCCCAGTImportin alpha-2 subunit. 
D78504TCCGGCCCAGTNONE 
Os01g0166800AK073783ATATGGGCCGGAConserved hypothetical protein. 
AK099378ATATGGGCCGGANONE 
J033026H10ATATGGGCCGGANONE 
J033067O18ATATGGGCCGGANONE 
J033108A17ATATGGGCCGGANONE 
J065015J11ATATGGGCCGGANONE 
J065204P09ATATGGGCCGGANONE 
Os01g0169800006-062-A02GGTGGGCCGGCNONE 
AK061054GGTGGGCCGGCAllinase, C-terminal domain containing protein. 
Os01g0172000012-070-G06GGTTGGGCCGGANONE 
AK068405GGTTGGGCCGGAALG3 family protein. 
J013149A07GGTTGGGCCGGANONE 
J053047H05GGTTGGGCCGGANONE 
J065075N03GGTTGGGCCGGANONE 
J065093G22GGTTGGGCCGGANONE 
J065130N21GGTTGGGCCGGANONE 
J065143P05GGTTGGGCCGGANONE 
J065216H07GGTTGGGCCGGANONE 
J075013B06GGTTGGGCCGGANONE 
J075196M05GGTTGGGCCGGANONE 
J100039G24GGTTGGGCCGGANONE 
J100041B11GGTTGGGCCGGANONE 
J100069A16GGTTGGGCCGGANONE 
J100069L12GGTTGGGCCGGANONE 
J100074P16GGTTGGGCCGGANONE 
Os01g0172200AK100326TGTGGGCTGGGCCGGAWW/Rsp5/WWP domain containing protein. 
Os01g0191100009-011-A02TCCGGCCCACGANONE 
009-028-D05TCCGGCCCACGANONE 
009-058-B11TCCGGCCCACGANONE 
009-151-D09TCCGGCCCACGANONE 
013-026-G03TCCGGCCCACGANONE 
013-063-F04TCCGGCCCACGANONE 
013-069-B05TCCGGCCCACGANONE 
014-029-E04TCCGGCCCACGANONE 
014-072-H04TCCGGCCCACGANONE 
014-089-E09TCCGGCCCACGANONE 
015-047-G05TCCGGCCCACGANONE 
016-033-G06TCCGGCCCACGANONE 
AK058815TCCGGCCCACGASimilar to Acidic ribosomal protein P2a-4 (Fragment). 
J023069C08TCCGGCCCACGANONE 
J023077K21TCCGGCCCACGANONE 
J023081F19TCCGGCCCACGANONE 
J033052N11TCCGGCCCACGANONE 
J033058N11TCCGGCCCACGANONE 
J033114G05TCCGGCCCACGANONE 
J033114O17TCCGGCCCACGANONE 
J033129L14TCCGGCCCACGANONE 
J053029I12TCCGGCCCACGANONE 
J065067N19TCCGGCCCACGANONE 
J065084I19TCCGGCCCACGANONE 
J065099O03TCCGGCCCACGANONE 
J065201I08TCCGGCCCACGANONE 
J075035B08TCCGGCCCACGANONE 
J075037B22TCCGGCCCACGANONE 
J075054L16TCCGGCCCACGANONE 
J075059D15TCCGGCCCACGANONE 
J075164I08TCCGGCCCACGANONE 
J075185J01TCCGGCCCACGANONE 
J090042O06TCCGGCCCACGANONE 
J090044F12TCCGGCCCACGANONE 
J090063L02TCCGGCCCACGANONE 
J090073I10TCCGGCCCACGANONE 
J090078E18TCCGGCCCACGANONE 
J100072K16TCCGGCCCACGANONE 
Os01g0193400AK069948ATCTGGGCCGGANONE 
AK099271ATCTGGGCCGGANONE 
AK107005ATCTGGGCCGGAConserved hypothetical protein. 
Os01g0203300015-045-F03ACCGGCCCATCTNONE 
015-045-F03ACCGGCCCATTNONE 
AK106329ACCGGCCCATCTConserved hypothetical protein. 
AK106329ACCGGCCCATTConserved hypothetical protein. 
Os01g0206200AK102840CCAGGCCCGGCCCGGCCCATAAConserved hypothetical protein. 
J065099M13CCAGGCCCGGCCCGGCCCATAANONE 
Os01g0220300009-063-C12TCCGGCCCANONE 
AK105167TCCGGCCCAConserved hypothetical protein. 
J065124E17TCCGGCCCANONE 
J090096L11TCCGGCCCANONE 
Os01g0231700012-002-F11ATATGGGCCGGGCCGAGNONE 
012-002-F11GCCGGCCCAAGTAGGCCCAGCNONE 
013-082-F05ATATGGGCCGGGCCGAGNONE 
013-082-F05GCCGGCCCAAGTAGGCCCAGCNONE 
AK107453ATATGGGCCGGGCCGAGSimilar to 60S acidic ribosomal protein P2-B (CaRP2B). 
AK107453GCCGGCCCAAGTAGGCCCAGCSimilar to 60S acidic ribosomal protein P2-B (CaRP2B). 
J065005L22ATATGGGCCGGGCCGAGNONE 
J065005L22GCCGGCCCAAGTAGGCCCAGCNONE 
J065023E21ATATGGGCCGGGCCGAGNONE 
J065023E21GCCGGCCCAAGTAGGCCCAGCNONE 
J065036H21ATATGGGCCGGGCCGAGNONE 
J065036H21GCCGGCCCAAGTAGGCCCAGCNONE 
J065037M24ATATGGGCCGGGCCGAGNONE 
J065037M24GCCGGCCCAAGTAGGCCCAGCNONE 
J065049L04ATATGGGCCGGGCCGAGNONE 
J065049L04GCCGGCCCAAGTAGGCCCAGCNONE 
J065072F17ATATGGGCCGGGCCGAGNONE 
J065072F17GCCGGCCCAAGTAGGCCCAGCNONE 
J065085H10ATATGGGCCGGGCCGAGNONE 
J065085H10GCCGGCCCAAGTAGGCCCAGCNONE 
J065109N19ATATGGGCCGGGCCGAGNONE 
J065109N19GCCGGCCCAAGTAGGCCCAGCNONE 
J065117M19ATATGGGCCGGGCCGAGNONE 
J065117M19GCCGGCCCAAGTAGGCCCAGCNONE 
J065144C15ATATGGGCCGGGCCGAGNONE 
J065144C15GCCGGCCCAAGTAGGCCCAGCNONE 
J065159G24ATATGGGCCGGGCCGAGNONE 
J065159G24GCCGGCCCAAGTAGGCCCAGCNONE 
J065164N14ATATGGGCCGGGCCGAGNONE 
J065164N14GCCGGCCCAAGTAGGCCCAGCNONE 
J075025K16ATATGGGCCGGGCCGAGNONE 
J075025K16GCCGGCCCAAGTAGGCCCAGCNONE 
J075057L05ATATGGGCCGGGCCGAGNONE 
J075057L05GCCGGCCCAAGTAGGCCCAGCNONE 
J075070I16ATATGGGCCGGGCCGAGNONE 
J075070I16GCCGGCCCAAGTAGGCCCAGCNONE 
J075089D10ATATGGGCCGGGCCGAGNONE 
J075089D10GCCGGCCCAAGTAGGCCCAGCNONE 
J075138F10ATATGGGCCGGGCCGAGNONE 
J075138F10GCCGGCCCAAGTAGGCCCAGCNONE 
J090018C11ATATGGGCCGGGCCGAGNONE 
J090018C11GCCGGCCCAAGTAGGCCCAGCNONE 
J100018L19ATATGGGCCGGGCCGAGNONE 
J100018L19GCCGGCCCAAGTAGGCCCAGCNONE 
J100024B14ATATGGGCCGGGCCGAGNONE 
J100024B14GCCGGCCCAAGTAGGCCCAGCNONE 
J100048L02ATATGGGCCGGGCCGAGNONE 
J100048L02GCCGGCCCAAGTAGGCCCAGCNONE 
J100055A22ATATGGGCCGGGCCGAGNONE 
J100055A22GCCGGCCCAAGTAGGCCCAGCNONE 
J100069K01ATATGGGCCGGGCCGAGNONE 
J100069K01GCCGGCCCAAGTAGGCCCAGCNONE 
Os01g0246100AK120732CAAGTGGGCCGGCProtein of unknown function DUF902, CREBbp domain containing protein. 
Os01g0270100006-096-H09TCCGGCCCAAGNONE 
009-009-C10TCCGGCCCAAGNONE 
009-054-E06TCCGGCCCAAGNONE 
014-085-F09TCCGGCCCAAGNONE 
AK073275TCCGGCCCAAGNONE 
AK104155TCCGGCCCAAGNONE 
AK119511TCCGGCCCAAGSimilar to Cysteine protease inhibitor. 
J033025K21TCCGGCCCAAGNONE 
J075065H10TCCGGCCCAAGNONE 
J075143G10TCCGGCCCAAGNONE 
J100059J02TCCGGCCCAAGNONE 
Os01g0276700011-014-A12CCCGGCCCACACNONE 
012-092-G12CCCGGCCCACACNONE 
AK103164CCCGGCCCACACNONE 
AK103465CCCGGCCCACACSimilar to Pyruvate kinase, cytosolic isozyme (EC 2.7.1.40) (PK). 
J023019H09CCCGGCCCACACNONE 
J023084I02CCCGGCCCACACNONE 
J033027F20CCCGGCCCACACNONE 
J033029M06CCCGGCCCACACNONE 
J033039K13CCCGGCCCACACNONE 
J033057C24CCCGGCCCACACNONE 
J033058G20CCCGGCCCACACNONE 
J033060A14CCCGGCCCACACNONE 
J033061M21CCCGGCCCACACNONE 
J033068M10CCCGGCCCACACNONE 
J033074K16CCCGGCCCACACNONE 
J033076C11CCCGGCCCACACNONE 
J033093O13CCCGGCCCACACNONE 
J033119H20CCCGGCCCACACNONE 
J033121D22CCCGGCCCACACNONE 
J033129N11CCCGGCCCACACNONE 
J033131E12CCCGGCCCACACNONE 
J033150L07CCCGGCCCACACNONE 
J053024N17CCCGGCCCACACNONE 
J053034G19CCCGGCCCACACNONE 
J053035E18CCCGGCCCACACNONE 
J053046M01CCCGGCCCACACNONE 
J053047P04CCCGGCCCACACNONE 
J053048B06CCCGGCCCACACNONE 
J053050M22CCCGGCCCACACNONE 
J053053E09CCCGGCCCACACNONE 
J053053I07CCCGGCCCACACNONE 
J053059K03CCCGGCCCACACNONE 
J053059P12CCCGGCCCACACNONE 
J053060C12CCCGGCCCACACNONE 
J053060H24CCCGGCCCACACNONE 
J053064D19CCCGGCCCACACNONE 
J053066L15CCCGGCCCACACNONE 
J053073I02CCCGGCCCACACNONE 
J053083E15CCCGGCCCACACNONE 
J053094D05CCCGGCCCACACNONE 
J053094P18CCCGGCCCACACNONE 
J053095C15CCCGGCCCACACNONE 
J053095C21CCCGGCCCACACNONE 
J053099N16CCCGGCCCACACNONE 
J090025O19CCCGGCCCACACNONE 
J090049N22CCCGGCCCACACNONE 
J090050F17CCCGGCCCACACNONE 
Os01g0286000AK109824AGATGGGCCGGGCCCSnf7 family protein. 
Os01g0303300J053035N19ACCGGCCCACGCNONE 
J075042F02ACCGGCCCACGCNONE 
J075068E10ACCGGCCCACGCNONE 
J075116E19ACCGGCCCACGCNONE 
J075131C10ACCGGCCCACGCNONE 
J075145J11ACCGGCCCACGCNONE 
J075157P20ACCGGCCCACGCMitochondrial import inner membrane translocase, subunit Tim17/22 family protein. 
J075164G12ACCGGCCCACGCNONE 
Os01g0316800009-188-E08ACCGGCCCATAANONE 
AK058821ACCGGCCCATAANONE 
AK119788ACCGGCCCATAASimilar to 26 proteasome complex subunit DSS1 (Deleted in split hand/split foot protein 1) (Split hand/foot deleted protein 1). 
J065098A09ACCGGCCCATAANONE 
J065102J21ACCGGCCCATAANONE 
J065173M10ACCGGCCCATAANONE 
J075066K08ACCGGCCCATAANONE 
J080302B04ACCGGCCCATAANONE 
J080310P14ACCGGCCCATAANONE 
J080311I23ACCGGCCCATAANONE 
J080319N12ACCGGCCCATAANONE 
J100024D14ACCGGCCCATAANONE 
J100055N12ACCGGCCCATAANONE 
Os01g0346400J100032G11ACCGGCCCATTConserved hypothetical protein. 
Os01g0358300AK060388GTGGTGGGCCGGTTTGGGCTTTTNONE 
AK072081GTGGTGGGCCGGTTTGGGCTTTTTetratricopeptide-like helical domain containing protein. 
Os01g0358400006-031-B11AAAAGCCCAAACCGGCCCACCACNONE 
006-083-B11AAAAGCCCAAACCGGCCCACCACNONE 
006-083-C09AAAAGCCCAAACCGGCCCACCACNONE 
006-088-H03AAAAGCCCAAACCGGCCCACCACNONE 
006-102-H05AAAAGCCCAAACCGGCCCACCACNONE 
AK061826AAAAGCCCAAACCGGCCCACCACSimilar to 40S ribosomal protein S4. 
J013105M07AAAAGCCCAAACCGGCCCACCACNONE 
J013155A16AAAAGCCCAAACCGGCCCACCACNONE 
J033025C03AAAAGCCCAAACCGGCCCACCACNONE 
J033072L20AAAAGCCCAAACCGGCCCACCACNONE 
J033095I15AAAAGCCCAAACCGGCCCACCACNONE 
J033105E03AAAAGCCCAAACCGGCCCACCACNONE 
J033112G18AAAAGCCCAAACCGGCCCACCACNONE 
J033125D09AAAAGCCCAAACCGGCCCACCACNONE 
J065100L16AAAAGCCCAAACCGGCCCACCACNONE 
J065176I05AAAAGCCCAAACCGGCCCACCACNONE 
J090001C14AAAAGCCCAAACCGGCCCACCACNONE 
J090058E15AAAAGCCCAAACCGGCCCACCACNONE 
J090068F07AAAAGCCCAAACCGGCCCACCACNONE 
Os01g0508000AK069177TCCGGCCCACGCSimilar to Beta-glucosidase. 
Os01g0513700AK058445ACCGGCCCATGGNONE 
AK068877ACCGGCCCATGGSybindin-like protein family protein. 
J023001F01ACCGGCCCATGGNONE 
J065065I18ACCGGCCCATGGNONE 
J065165A09ACCGGCCCATGGNONE 
J065184N12ACCGGCCCATGGNONE 
J065205M05ACCGGCCCATGGNONE 
J075172I17ACCGGCCCATGGNONE 
J090025O09ACCGGCCCATGGNONE 
J100087H03ACCGGCCCATGGNONE 
Os01g0514300AK121086ATATGGGCCGGCLissencephaly type-1-like homology motif domain containing protein. 
Os01g0527700006-102-G07AACGGGCCCGGCCCATGNONE 
012-094-B11AACGGGCCCGGCCCATGNONE 
015-096-C04AACGGGCCCGGCCCATGNONE 
AK061861AACGGGCCCGGCCCATGProtoheme IX farnesyltransferase family protein. 
AK099005AACGGGCCCGGCCCATGNONE 
J013109B04AACGGGCCCGGCCCATGNONE 
J033057L14AACGGGCCCGGCCCATGNONE 
J090072H04AACGGGCCCGGCCCATGNONE 
J100030A14AACGGGCCCGGCCCATGNONE 
Os01g0530366J075001P06GCCGGCCCATATAACGGGCCNONE 
J075006K21GCCGGCCCATATAACGGGCCRNA polymerase Rbp10 domain containing protein. 
J075030G13GCCGGCCCATATAACGGGCCNONE 
Os01g0551000006-104-A04CCCAGCCCGGCCCAACCNONE 
009-183-B08CCCAGCCCGGCCCAACCNONE 
AK071219CCCAGCCCGGCCCAACCConserved hypothetical protein. 
AK106034CCCAGCCCGGCCCAACCNONE 
Os01g0558600006-120-G12ATCTCGGCCCGGCCCGGCCCAACTNONE 
J013100N20ATCTCGGCCCGGCCCGGCCCAACTNONE 
J033043P09ATCTCGGCCCGGCCCGGCCCAACTNONE 
J033125M18ATCTCGGCCCGGCCCGGCCCAACTNONE 
J053043N11ATCTCGGCCCGGCCCGGCCCAACTNONE 
J065008E07ATCTCGGCCCGGCCCGGCCCAACTNONE 
J065080O16ATCTCGGCCCGGCCCGGCCCAACTNONE 
J075002G24ATCTCGGCCCGGCCCGGCCCAACTNONE 
J075123C09ATCTCGGCCCGGCCCGGCCCAACTNONE 
S66160ATCTCGGCCCGGCCCGGCCCAACTRas-related protein RIC1. 
Os01g0581300AK066182TCCGGCCCATAGCAGCCCATATSimilar to Lycopene epsilon-cyclase (Fragment). 
AK072015TCCGGCCCATAGCAGCCCATATNONE 
Os01g0582400AK069484TGGATGGGCCGGASimilar to Multidomain cyclophilin type peptidyl-prolyl cis-trans isomerase. 
J023019D12TGGATGGGCCGGANONE 
J023036F15TGGATGGGCCGGANONE 
J023095O16TGGATGGGCCGGANONE 
J033102M15TGGATGGGCCGGANONE 
J043013I06TGGATGGGCCGGANONE 
J065083M21TGGATGGGCCGGANONE 
J065176A17TGGATGGGCCGGANONE 
Os01g0590200011-100-E06GTTGGGCCGGGGCCCATTANONE 
012-005-A05GTTGGGCCGGGGCCCATTANONE 
AK063416GTTGGGCCGGGGCCCATTAConserved hypothetical protein. 
AK099235GTTGGGCCGGGGCCCATTANONE 
AK105022GTTGGGCCGGGGCCCATTANONE 
J065030D21GTTGGGCCGGGGCCCATTANONE 
J065031C10GTTGGGCCGGGGCCCATTANONE 
J065105A22GTTGGGCCGGGGCCCATTANONE 
J065173M19GTTGGGCCGGGGCCCATTANONE 
J075188F15GTTGGGCCGGGGCCCATTANONE 
J090050C15GTTGGGCCGGGGCCCATTANONE 
J100058K07GTTGGGCCGGGGCCCATTANONE 
Os01g0590300014-089-E04CGGGTGGGCCGGGNONE 
AK063740CGGGTGGGCCGGGConserved hypothetical protein. 
Os01g0592500AK111253GCCGGCCCAGCProtein of unknown function DUF1070 family protein. 
Os01g0606900AK065697ACCGGCCCACGGHeat shock protein DnaJ, N-terminal domain containing protein. 
Os01g0613900014-018-D04ACCGGCCCACAANONE 
AK119181ACCGGCCCACAAProtein of unknown function UPF0052 and CofD family protein. 
J023119M14ACCGGCCCACAANONE 
J065019A15ACCGGCCCACAANONE 
J075090J10ACCGGCCCACAANONE 
J075195H12ACCGGCCCACAANONE 
Os01g0674500013-062-A08CCCGGCCCATCCNONE 
AK072815CCCGGCCCATCCNONE 
J023142B02CCCGGCCCATCCNONE 
Os01g0679000AK058515ACCGGCCCATGARNA polymerase III subunit RPC82, C -terminal domain containing protein. 
J013149O08ACCGGCCCATGANONE 
J033064N24ACCGGCCCATGANONE 
J043022M20ACCGGCCCATGANONE 
J065075K20ACCGGCCCATGANONE 
J065081K04ACCGGCCCATGANONE 
J065128K13ACCGGCCCATGANONE 
J065131K12ACCGGCCCATGANONE 
J065137H20ACCGGCCCATGANONE 
J065205A09ACCGGCCCATGANONE 
J090030C13ACCGGCCCATGANONE 
J090053I08ACCGGCCCATGANONE 
J090054O22ACCGGCCCATGANONE 
J090082C15ACCGGCCCATGANONE 
J090097P12ACCGGCCCATGANONE 
Os01g0680400AK067914CCCGGCCCAAAATAFII28-like protein family protein. 
J065039K13CCCGGCCCAAAANONE 
J065042K22CCCGGCCCAAAANONE 
J080016E23CCCGGCCCAAAANONE 
J080064E22CCCGGCCCAAAANONE 
Os01g0706100AK072799CTTGGGCCGGTConserved hypothetical protein. 
J013049G14CTTGGGCCGGTNONE 
J023136E17CTTGGGCCGGTNONE 
Os01g0720600016-050-G11AGAGTGGGCCGGTNONE 
AK066808AGAGTGGGCCGGTNONE 
AK100976AGAGTGGGCCGGTNONE 
AK106541AGAGTGGGCCGGTStarch synthase IVa (Glycogen (Starch) synthase-like). 
AY373257AGAGTGGGCCGGTNONE 
J100039H11AGAGTGGGCCGGTNONE 
J100072K02AGAGTGGGCCGGTNONE 
Os01g0748100AK071261TCTGGGCCGGAHypothetical protein. 
J023084C08TCTGGGCCGGANONE 
J065058A07TCTGGGCCGGANONE 
Os01g0749900AK103588TGGATGGGCCGGTProtein of unknown function DUF250 domain containing protein. 
J033090O22TGGATGGGCCGGTNONE 
J033133C05TGGATGGGCCGGTNONE 
J065122N01TGGATGGGCCGGTNONE 
J065188K04TGGATGGGCCGGTNONE 
J090012D18TGGATGGGCCGGTNONE 
J100074N02TGGATGGGCCGGTNONE 
Os01g0764600AK060621ACCGGCCCAGCFosfomycin resistance kinase FomA family protein. 
AK060621TGATGGGCCGGAFosfomycin resistance kinase FomA family protein. 
J013111L18ACCGGCCCAGCNONE 
J013111L18TGATGGGCCGGANONE 
J013134N08ACCGGCCCAGCNONE 
J013134N08TGATGGGCCGGANONE 
Os01g0767100AK109493TGATGGGCCGGCSimilar to Lysosomal Pro-X carboxypeptidase. 
Os01g0770400006-112-B08GTGCGGTGGGCCGGTNONE 
AK061253GTGCGGTGGGCCGGTNONE 
AK061585GTGCGGTGGGCCGGTCyclin-like F-box domain containing protein. 
Os01g0773500009-029-F02TCCGGCCCAAATNONE 
AK062417TCCGGCCCAAATConserved hypothetical protein. 
Os01g0800800AK108093ACCGGCCCACAConserved hypothetical protein. 
Os01g0801000AK064082ACATGGGCCGGGCCGGANONE 
AK101426ACATGGGCCGGGCCGGASimilar to Apurinic endonuclease-redox protein (DNA-(apurinic or apyrimidinic site) lyase) (EC 4.2.99.18). 
Os01g0805800006-057-H04GCCGGCCCAAGNONE 
006-106-H01GCCGGCCCAAGNONE 
AK059963GCCGGCCCAAGNONE 
AK103408GCCGGCCCAAGRNA polymerase Rpb5, N-terminal domain containing protein. 
Os01g0813400006-025-B06TGTTGGGCTGGGCCGGGNONE 
006-030-C07TGTTGGGCTGGGCCGGGNONE 
006-068-F06TGTTGGGCTGGGCCGGGNONE 
006-096-E09TGTTGGGCTGGGCCGGGNONE 
006-097-B11TGTTGGGCTGGGCCGGGNONE 
006-104-H02TGTTGGGCTGGGCCGGGNONE 
AK062251TGTTGGGCTGGGCCGGGNONE 
AK065370TGTTGGGCTGGGCCGGGSimilar to ADP-ribosylation factor 1. 
J013022G24TGTTGGGCTGGGCCGGGNONE 
J013104C07TGTTGGGCTGGGCCGGGNONE 
J023074M17TGTTGGGCTGGGCCGGGNONE 
J043027C07TGTTGGGCTGGGCCGGGNONE 
J065026K05TGTTGGGCTGGGCCGGGNONE 
J065103I01TGTTGGGCTGGGCCGGGNONE 
J090025M17TGTTGGGCTGGGCCGGGNONE 
J100027L03TGTTGGGCTGGGCCGGGNONE 
J100054I20TGTTGGGCTGGGCCGGGNONE 
Os01g0813800AK063065CCTGGGCCGGTNONE 
Os01g0816700AK100654GCCGGCCCAGASimilar to L-ascorbate oxidase homolog precursor (EC 1.10.3.3) (Ascorbase). 
Os01g0830500006-117-F06TCCGGCCCATCCNONE 
AK061475TCCGGCCCATCCNONE 
AK105801TCCGGCCCATCC2OG-Fe(II) oxygenase domain containing protein. 
J065168H17TCCGGCCCATCCNONE 
J065211O10TCCGGCCCATCCNONE 
Os01g0838800AK066366TTATGGGCCGTTGTTTGGGCTTTGGGCCGGANONE 
AK073775TTATGGGCCGTTGTTTGGGCTTTGGGCCGGAClathrin adaptor complex, small chain family protein. 
J013067M01TTATGGGCCGTTGTTTGGGCTTTGGGCCGGANONE 
J033030I24TTATGGGCCGTTGTTTGGGCTTTGGGCCGGANONE 
J090089A10TTATGGGCCGTTGTTTGGGCTTTGGGCCGGANONE 
Os01g0848300AK120668TCCGGCCCATGProtein prenyltransferase domain containing protein. 
Os01g0855600003-004-C02GGGCCCGGCCCACCCGNONE 
016-023-G11GGGCCCGGCCCACCCGNONE 
AK099776GGGCCCGGCCCACCCGSimilar to Hs1pro-1 protein. 
AY224522GGGCCCGGCCCACCCGNONE 
J013095E24GGGCCCGGCCCACCCGNONE 
J023041J04GGGCCCGGCCCACCCGNONE 
J065130B09GGGCCCGGCCCACCCGNONE 
J075031B02GGGCCCGGCCCACCCGNONE 
J075069H11GGGCCCGGCCCACCCGNONE 
J100026O10GGGCCCGGCCCACCCGNONE 
J100050J01GGGCCCGGCCCACCCGNONE 
J100052G04GGGCCCGGCCCACCCGNONE 
J100053D07GGGCCCGGCCCACCCGNONE 
J100054K16GGGCCCGGCCCACCCGNONE 
J100067A06GGGCCCGGCCCACCCGNONE 
J100067G01GGGCCCGGCCCACCCGNONE 
J100088C18GGGCCCGGCCCACCCGNONE 
Os01g0863166J065007F23CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
J065124H21CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGConserved hypothetical protein. 
Os01g0865100016-066-A05CCCGGCCCATCNONE 
AK065779CCCGGCCCATCNONE 
AK071410CCCGGCCCATCSimilar to Uricase (Fragment). 
J013039E23CCCGGCCCATCNONE 
J023024I07CCCGGCCCATCNONE 
J065160J15CCCGGCCCATCNONE 
J090052J17CCCGGCCCATCNONE 
Os01g0888700AK073376ACCGGCCCACGCCTCProtein of unknown function RIO1 family protein. 
AK073376ACTGGGCCGGCCCAATProtein of unknown function RIO1 family protein. 
J033030B16ACCGGCCCACGCCTCNONE 
J033030B16ACTGGGCCGGCCCAATNONE 
J033098D06ACCGGCCCACGCCTCNONE 
J033098D06ACTGGGCCGGCCCAATNONE 
J033112A12ACCGGCCCACGCCTCNONE 
J033112A12ACTGGGCCGGCCCAATNONE 
J043003L24ACCGGCCCACGCCTCNONE 
J043003L24ACTGGGCCGGCCCAATNONE 
Os01g0889000AK103621TTGTGGGCCGGTTetratricopeptide-like helical domain containing protein. 
Os01g0913800011-060-B02ATTGGGCCGGGCCGANONE 
016-088-H02ATTGGGCCGGGCCGAProtein prenyltransferase domain containing protein. 
Os01g0915800AK103859TTTTGGGCCGGGCCCAAACSimilar to FK506-binding protein 2-2 precursor (EC 5.2.1.8) (Peptidyl-prolyl cis- trans isomerase) (PPIase) (Rotamase) (15 kDa FKBP) (FKBP-15-2). 
J090051E20TTTTGGGCCGGGCCCAAACNONE 
J090056H03TTTTGGGCCGGGCCCAAACNONE 
J090058L14TTTTGGGCCGGGCCCAAACNONE 
J090058P16TTTTGGGCCGGGCCCAAACNONE 
J090076C19TTTTGGGCCGGGCCCAAACNONE 
J100086P14TTTTGGGCCGGGCCCAAACNONE 
Os01g0921600AK071344GGTGGGCTGGGCCGGGSimilar to Mitochondrial import receptor subunit TOM20 (Translocase of outer membrane 20 kDa subunit). 
J013039J22GGTGGGCTGGGCCGGGNONE 
J013109E03GGTGGGCTGGGCCGGGNONE 
J023081J12GGTGGGCTGGGCCGGGNONE 
J023091E24GGTGGGCTGGGCCGGGNONE 
J033022A01GGTGGGCTGGGCCGGGNONE 
J033074C13GGTGGGCTGGGCCGGGNONE 
J065199E03GGTGGGCTGGGCCGGGNONE 
J075172O04GGTGGGCTGGGCCGGGNONE 
J090007G18GGTGGGCTGGGCCGGGNONE 
J090052B17GGTGGGCTGGGCCGGGNONE 
J090074H01GGTGGGCTGGGCCGGGNONE 
J100043J09GGTGGGCTGGGCCGGGNONE 
J100059J05GGTGGGCTGGGCCGGGNONE 
Os01g0924000004-020-C09ACGTGGGCCGGANONE 
004-020-C09CCCACGTGCTGGGCCGGCNONE 
004-020-C09GTATGGGCCGGCCCNONE 
005-014-A06ACGTGGGCCGGANONE 
005-014-A06CCCACGTGCTGGGCCGGCNONE 
005-014-A06GTATGGGCCGGCCCNONE 
009-085-G12ACGTGGGCCGGANONE 
009-085-G12CCCACGTGCTGGGCCGGCNONE 
009-085-G12GTATGGGCCGGCCCNONE 
009-123-A08ACGTGGGCCGGANONE 
009-123-A08CCCACGTGCTGGGCCGGCNONE 
009-123-A08GTATGGGCCGGCCCNONE 
009-134-A05ACGTGGGCCGGANONE 
009-134-A05CCCACGTGCTGGGCCGGCNONE 
009-134-A05GTATGGGCCGGCCCNONE 
009-137-F06ACGTGGGCCGGANONE 
009-137-F06CCCACGTGCTGGGCCGGCNONE 
009-137-F06GTATGGGCCGGCCCNONE 
016-016-B08ACGTGGGCCGGANONE 
016-016-B08CCCACGTGCTGGGCCGGCNONE 
016-016-B08GTATGGGCCGGCCCNONE 
AF050674ACGTGGGCCGGANONE 
AF050674CCCACGTGCTGGGCCGGCNONE 
AF050674GTATGGGCCGGCCCNONE 
AK061690ACGTGGGCCGGASimilar to Chloroplast 50S ribosomal protein L27 (Fragment). 
AK061690CCCACGTGCTGGGCCGGCSimilar to Chloroplast 50S ribosomal protein L27 (Fragment). 
AK061690GTATGGGCCGGCCCSimilar to Chloroplast 50S ribosomal protein L27 (Fragment). 
AK120797ACGTGGGCCGGANONE 
AK120797CCCACGTGCTGGGCCGGCNONE 
AK120797GTATGGGCCGGCCCNONE 
J013040A15ACGTGGGCCGGANONE 
J013040A15CCCACGTGCTGGGCCGGCNONE 
J013040A15GTATGGGCCGGCCCNONE 
J013104L20ACGTGGGCCGGANONE 
J013104L20CCCACGTGCTGGGCCGGCNONE 
J013104L20GTATGGGCCGGCCCNONE 
J013127E12ACGTGGGCCGGANONE 
J013127E12CCCACGTGCTGGGCCGGCNONE 
J013127E12GTATGGGCCGGCCCNONE 
J013158O05ACGTGGGCCGGANONE 
J013158O05CCCACGTGCTGGGCCGGCNONE 
J013158O05GTATGGGCCGGCCCNONE 
J023012E09ACGTGGGCCGGANONE 
J023012E09CCCACGTGCTGGGCCGGCNONE 
J023012E09GTATGGGCCGGCCCNONE 
J023126L23ACGTGGGCCGGANONE 
J023126L23CCCACGTGCTGGGCCGGCNONE 
J023126L23GTATGGGCCGGCCCNONE 
J023143B03ACGTGGGCCGGANONE 
J023143B03CCCACGTGCTGGGCCGGCNONE 
J023143B03GTATGGGCCGGCCCNONE 
J065005B16ACGTGGGCCGGANONE 
J065005B16CCCACGTGCTGGGCCGGCNONE 
J065005B16GTATGGGCCGGCCCNONE 
J065101J15ACGTGGGCCGGANONE 
J065101J15CCCACGTGCTGGGCCGGCNONE 
J065101J15GTATGGGCCGGCCCNONE 
J065105K16ACGTGGGCCGGANONE 
J065105K16CCCACGTGCTGGGCCGGCNONE 
J065105K16GTATGGGCCGGCCCNONE 
J065155K16ACGTGGGCCGGANONE 
J065155K16CCCACGTGCTGGGCCGGCNONE 
J065155K16GTATGGGCCGGCCCNONE 
J065171M17ACGTGGGCCGGANONE 
J065171M17CCCACGTGCTGGGCCGGCNONE 
J065171M17GTATGGGCCGGCCCNONE 
J065182F07ACGTGGGCCGGANONE 
J065182F07CCCACGTGCTGGGCCGGCNONE 
J065182F07GTATGGGCCGGCCCNONE 
J065187D10ACGTGGGCCGGANONE 
J065187D10CCCACGTGCTGGGCCGGCNONE 
J065187D10GTATGGGCCGGCCCNONE 
J065194I24ACGTGGGCCGGANONE 
J065194I24CCCACGTGCTGGGCCGGCNONE 
J065194I24GTATGGGCCGGCCCNONE 
J065207E24ACGTGGGCCGGANONE 
J065207E24CCCACGTGCTGGGCCGGCNONE 
J065207E24GTATGGGCCGGCCCNONE 
J075001C24ACGTGGGCCGGANONE 
J075001C24CCCACGTGCTGGGCCGGCNONE 
J075001C24GTATGGGCCGGCCCNONE 
J075090O10ACGTGGGCCGGANONE 
J075090O10CCCACGTGCTGGGCCGGCNONE 
J075090O10GTATGGGCCGGCCCNONE 
J075095H17ACGTGGGCCGGANONE 
J075095H17CCCACGTGCTGGGCCGGCNONE 
J075095H17GTATGGGCCGGCCCNONE 
J075109M24ACGTGGGCCGGANONE 
J075109M24CCCACGTGCTGGGCCGGCNONE 
J075109M24GTATGGGCCGGCCCNONE 
J075123C18ACGTGGGCCGGANONE 
J075123C18CCCACGTGCTGGGCCGGCNONE 
J075123C18GTATGGGCCGGCCCNONE 
J075148G22ACGTGGGCCGGANONE 
J075148G22CCCACGTGCTGGGCCGGCNONE 
J075148G22GTATGGGCCGGCCCNONE 
J090009B09ACGTGGGCCGGANONE 
J090009B09CCCACGTGCTGGGCCGGCNONE 
J090009B09GTATGGGCCGGCCCNONE 
J090075K17ACGTGGGCCGGANONE 
J090075K17CCCACGTGCTGGGCCGGCNONE 
J090075K17GTATGGGCCGGCCCNONE 
J090081H23ACGTGGGCCGGANONE 
J090081H23CCCACGTGCTGGGCCGGCNONE 
J090081H23GTATGGGCCGGCCCNONE 
J090097H21ACGTGGGCCGGANONE 
J090097H21CCCACGTGCTGGGCCGGCNONE 
J090097H21GTATGGGCCGGCCCNONE 
J100063P14ACGTGGGCCGGANONE 
J100063P14CCCACGTGCTGGGCCGGCNONE 
J100063P14GTATGGGCCGGCCCNONE 
Os01g0929500AK111399AGTTGGGCCTTACTGGGCCGGTSimilar to Carbonyl reductase-like protein. 
AK120263AGTTGGGCCTTACTGGGCCGGTNONE 
Os01g0949200AK102412ACCGGCCCAACTNONE 
J033093A04ACCGGCCCAACTNONE 
J065053P06ACCGGCCCAACTNONE 
J100086D18ACCGGCCCAACTNONE 
Os01g0949700AK069037GCCCGGCCCAATNONE 
J023004F17GCCCGGCCCAATNONE 
J065063D04GCCCGGCCCAATNONE 
J065196H02GCCCGGCCCAATNONE 
J075198A05GCCCGGCCCAATNONE 
Os01g0959100009-163-G12ATCTGGGCCGGCNONE 
AK063053ATCTGGGCCGGCSimilar to Abscisic stress ripening protein 1. 
Os01g0973400AK060011AGATGGGCCGGGCCGGGCCGAGCCGNONE 
AK068879AGATGGGCCGGGCCGGGCCGAGCCGConserved hypothetical protein 48 family protein. 
AK099210AGATGGGCCGGGCCGGGCCGAGCCGNONE 
AK104863AGATGGGCCGGGCCGGGCCGAGCCGNONE 
J013170C09AGATGGGCCGGGCCGGGCCGAGCCGNONE 
J033106K13AGATGGGCCGGGCCGGGCCGAGCCGNONE 
J075018P18AGATGGGCCGGGCCGGGCCGAGCCGNONE 
J075039C18AGATGGGCCGGGCCGGGCCGAGCCGNONE 
J075104L18AGATGGGCCGGGCCGGGCCGAGCCGNONE 
Os01g0976200006-044-A09ATCTGGGCCGGCNONE 
AK061022ATCTGGGCCGGC11-S plant seed storage protein family protein. 
J023012H20ATCTGGGCCGGCNONE 
J023025O07ATCTGGGCCGGCNONE 
J023082A14ATCTGGGCCGGCNONE 
J023115H15ATCTGGGCCGGCNONE 
J023133H14ATCTGGGCCGGCNONE 
J023133L21ATCTGGGCCGGCNONE 
J023136B16ATCTGGGCCGGCNONE 
J023145P17ATCTGGGCCGGCNONE 
J023146N03ATCTGGGCCGGCNONE 
Os02g0116900009-017-C02GCCGGCCCAATNONE 
AK121401GCCGGCCCAATSimilar to 15.9 kDa subunit of RNA polymerase II. 
J013105H09GCCGGCCCAATNONE 
J023131N03GCCGGCCCAATNONE 
J033145N08GCCGGCCCAATNONE 
J065105G09GCCGGCCCAATNONE 
J075086L06GCCGGCCCAATNONE 
Os02g0119400AK060055GTTTGGGCCCGGCCCACCTNONE 
AK102774GTTTGGGCCCGGCCCACCTSimilar to Syntaxin 52 (AtSYP52). 
J033107H09GTTTGGGCCCGGCCCACCTNONE 
J075175F09GTTTGGGCCCGGCCCACCTNONE 
J090011H05GTTTGGGCCCGGCCCACCTNONE 
J090091O05GTTTGGGCCCGGCCCACCTNONE 
Os02g0135600AK069843GCCGGCCCAGTTAGGCCCACAConserved hypothetical protein. 
J023034H09GCCGGCCCAGTTAGGCCCACANONE 
J033090D08GCCGGCCCAGTTAGGCCCACANONE 
J100025N07GCCGGCCCAGTTAGGCCCACANONE 
J100075G18GCCGGCCCAGTTAGGCCCACANONE 
Os02g0135700AK100570TGTGGGCCTAACTGGGCCGGCDNA polymerase V family protein. 
Os02g0146700AK105609TTGGCCCACCAGGCCCGGCCCACCCGSimilar to PSMD2 subunit (Fragment). 
AK119490TTGGCCCACCAGGCCCGGCCCACCCGNONE 
AK121963TTGGCCCACCAGGCCCGGCCCACCCGNONE 
Os02g0148400AK070451TCCGGCCCATGANONE 
AK072039TCCGGCCCATGAPyridoxamine 5'-phosphate oxidase-related, FMN-binding domain containing protein. 
J075148J10TCCGGCCCATGANONE 
Os02g0158400006-048-F06TGTTGGGCCGGGNONE 
AK061569TGTTGGGCCGGGssDNA-binding transcriptional regulator family protein. 
AK099479TGTTGGGCCGGGNONE 
AK104768TGTTGGGCCGGGNONE 
J013025B22TGTTGGGCCGGGNONE 
J023009C03TGTTGGGCCGGGNONE 
J033115N14TGTTGGGCCGGGNONE 
J065036F05TGTTGGGCCGGGNONE 
J065191K17TGTTGGGCCGGGNONE 
J065202K16TGTTGGGCCGGGNONE 
J075053E14TGTTGGGCCGGGNONE 
J075101E04TGTTGGGCCGGGNONE 
J075111C06TGTTGGGCCGGGNONE 
J075137O04TGTTGGGCCGGGNONE 
J075139E07TGTTGGGCCGGGNONE 
J075143K07TGTTGGGCCGGGNONE 
J075144K15TGTTGGGCCGGGNONE 
J075164L14TGTTGGGCCGGGNONE 
J075199D06TGTTGGGCCGGGNONE 
J090010G24TGTTGGGCCGGGNONE 
J090017C18TGTTGGGCCGGGNONE 
J090066F01TGTTGGGCCGGGNONE 
J090088G01TGTTGGGCCGGGNONE 
Os02g0162500009-181-F03ACCGGCCCAATTNONE 
AK058907ACCGGCCCAATTNONE 
AK121223ACCGGCCCAATTSimilar to 40S ribosomal protein S14. 
J023090I10ACCGGCCCAATTNONE 
J023136J11ACCGGCCCAATTNONE 
J053097J20ACCGGCCCAATTNONE 
J053098F01ACCGGCCCAATTNONE 
J065065B09ACCGGCCCAATTNONE 
J065082M04ACCGGCCCAATTNONE 
J065188O05ACCGGCCCAATTNONE 
J075057P15ACCGGCCCAATTNONE 
J075061J08ACCGGCCCAATTNONE 
J075061N15ACCGGCCCAATTNONE 
J075131I08ACCGGCCCAATTNONE 
J075141H13ACCGGCCCAATTNONE 
J080062E14ACCGGCCCAATTNONE 
J080062P15ACCGGCCCAATTNONE 
J080318G17ACCGGCCCAATTNONE 
J080319G19ACCGGCCCAATTNONE 
J090001L10ACCGGCCCAATTNONE 
J090024I18ACCGGCCCAATTNONE 
J090033F24ACCGGCCCAATTNONE 
J090036M16ACCGGCCCAATTNONE 
J090040I24ACCGGCCCAATTNONE 
J090048P06ACCGGCCCAATTNONE 
J090049B12ACCGGCCCAATTNONE 
J090068C02ACCGGCCCAATTNONE 
J090069O04ACCGGCCCAATTNONE 
J090084H22ACCGGCCCAATTNONE 
J100022L03ACCGGCCCAATTNONE 
J100028O14ACCGGCCCAATTNONE 
J100028O18ACCGGCCCAATTNONE 
J100032A15ACCGGCCCAATTNONE 
J100033D21ACCGGCCCAATTNONE 
J100034J23ACCGGCCCAATTNONE 
J100043K22ACCGGCCCAATTNONE 
J100052M22ACCGGCCCAATTNONE 
J100053N03ACCGGCCCAATTNONE 
J100074N24ACCGGCCCAATTNONE 
J100082J10ACCGGCCCAATTNONE 
Os02g0169000AK101628TCGGCCCGGCCCATGTConserved hypothetical protein. 
Os02g0175100AB053473ACTGGGCCGGCSimilar to Transcriptional activator protein. 
AK069575ACTGGGCCGGCNONE 
J023025A18ACTGGGCCGGCNONE 
J065001E07ACTGGGCCGGCNONE 
J065171A13ACTGGGCCGGCNONE 
J065208N04ACTGGGCCGGCNONE 
J075098H14ACTGGGCCGGCNONE 
J090026G03ACTGGGCCGGCNONE 
J100031K15ACTGGGCCGGCNONE 
J100032K19ACTGGGCCGGCNONE 
J100041D18ACTGGGCCGGCNONE 
J100061K06ACTGGGCCGGCNONE 
Os02g0178400009-151-B08TAGGCCCATGGGCCGGANONE 
AK063815TAGGCCCATGGGCCGGAProtein transport protein SEC61 gamma subunit. 
AK121516TAGGCCCATGGGCCGGANONE 
J033026A17TAGGCCCATGGGCCGGANONE 
J065011K14TAGGCCCATGGGCCGGANONE 
J065056D01TAGGCCCATGGGCCGGANONE 
J065061L22TAGGCCCATGGGCCGGANONE 
J065076M01TAGGCCCATGGGCCGGANONE 
J075092E14TAGGCCCATGGGCCGGANONE 
Os02g0179100AK058557CACGCCACCGGCCCATACMetal-dependent phosphohydrolase, HD region domain containing protein. 
AK058557TCCGGCCCAACAMetal-dependent phosphohydrolase, HD region domain containing protein. 
J080311O10CACGCCACCGGCCCATACNONE 
J080311O10TCCGGCCCAACANONE 
Os02g0190900AK111037GCCCAATTTGGGCCGGGCCGTGPhytoene dehydrogenase-like protein. 
AK111037TTTTGGGCCGGGCCCATTAPhytoene dehydrogenase-like protein. 
Os02g0190950J075001E02CACGGCCCGGCCCAAATTGGGCConserved hypothetical protein. 
J075117E23CACGGCCCGGCCCAAATTGGGCNONE 
J075117F23CACGGCCCGGCCCAAATTGGGCNONE 
J075144M12CACGGCCCGGCCCAAATTGGGCNONE 
J075145H10CACGGCCCGGCCCAAATTGGGCNONE 
J075186B15CACGGCCCGGCCCAAATTGGGCNONE 
Os02g0192700004-020-H12CCCGTGGGCCGGCNONE 
006-024-H06CCCGTGGGCCGGCNONE 
006-042-F06CCCGTGGGCCGGCNONE 
006-050-D04CCCGTGGGCCGGCNONE 
006-059-E10CCCGTGGGCCGGCNONE 
006-070-B02CCCGTGGGCCGGCNONE 
006-084-A09CCCGTGGGCCGGCNONE 
006-114-E11CCCGTGGGCCGGCNONE 
006-117-E05CCCGTGGGCCGGCNONE 
009-126-D11CCCGTGGGCCGGCNONE 
AK061629CCCGTGGGCCGGCSimilar to Thioredoxin peroxidase. 
AK065909CCCGTGGGCCGGCNONE 
J013043E11CCCGTGGGCCGGCNONE 
J065038I09CCCGTGGGCCGGCNONE 
J065078C12CCCGTGGGCCGGCNONE 
J065122O14CCCGTGGGCCGGCNONE 
J065198H04CCCGTGGGCCGGCNONE 
Os02g0205300006-050-H03ACATGGGCCGGCNONE 
011-057-B04ACATGGGCCGGCNONE 
AB033537ACATGGGCCGGCNONE 
AB052887ACATGGGCCGGCNONE 
AK061762ACATGGGCCGGCNONE 
AK102286ACATGGGCCGGCSimilar to TAT-binding protein homolog (Fragment). 
AK106217ACATGGGCCGGCNONE 
J013000E18ACATGGGCCGGCNONE 
J023030F11ACATGGGCCGGCNONE 
J033030E16ACATGGGCCGGCNONE 
J033061B21ACATGGGCCGGCNONE 
J033086D09ACATGGGCCGGCNONE 
J033089I16ACATGGGCCGGCNONE 
J033132G01ACATGGGCCGGCNONE 
J090003O15ACATGGGCCGGCNONE 
J090004A19ACATGGGCCGGCNONE 
J090054P05ACATGGGCCGGCNONE 
J090083M17ACATGGGCCGGCNONE 
J100039E08ACATGGGCCGGCNONE 
J100058D24ACATGGGCCGGCNONE 
J100066P09ACATGGGCCGGCNONE 
J100086K12ACATGGGCCGGCNONE 
J100088J15ACATGGGCCGGCNONE 
Os02g0208200J023104K09TCCGGCCCACGTNONE 
J033080L20TCCGGCCCACGTNONE 
J033105D08TCCGGCCCACGTNONE 
J090079N16TCCGGCCCACGTNONE 
Os02g0215950J090051K07GCGGCCCATACATTTGGGCCGGGConserved hypothetical protein. 
Os02g0227000J023084F07ACCGGCCCATTTNONE 
J033051H22ACCGGCCCATTTProtein of unknown function UPF0054 family protein. 
Os02g0266200AK099647TTCGTGGGCCGGGCCGGTCACTGACANONE 
AK103371TTCGTGGGCCGGGCCGGTCACTGACAProtein prenyltransferase domain containing protein. 
Os02g0304800Os02g0304800GGCCCGGCCCAAATProtein prenyltransferase domain containing protein. 
Os02g0304800TCCGGCCCATTAProtein prenyltransferase domain containing protein. 
Os02g0326000006-099-D01GCCGGCCCAGCCNONE 
AK059937GCCGGCCCAGCCNONE 
AK102973GCCGGCCCAGCCConserved hypothetical protein. 
J033115K18GCCGGCCCAGCCNONE 
J075069J04GCCGGCCCAGCCNONE 
Os02g0522000AK101294GCTGGGCCGGTGGACGCGTCGCRetrotransposon gag protein family protein. 
Os02g0537500AK068689GGCCCGGCCCACGGGSimilar to E2F homolog. 
AK068689TCCGGCCCATTGGGCCGCSimilar to E2F homolog. 
Os02g0562700006-035-C05GCCGGCCCACGTCGGCCCATCANONE 
AB110167GCCGGCCCACGTCGGCCCATCANONE 
AK071800GCCGGCCCACGTCGGCCCATCASimilar to Gamma hydroxybutyrate dehydrogenase (EC 1.1.1.61). 
AK104168GCCGGCCCACGTCGGCCCATCANONE 
AK109435GCCGGCCCACGTCGGCCCATCANONE 
AY224558GCCGGCCCACGTCGGCCCATCANONE 
J023013M13GCCGGCCCACGTCGGCCCATCANONE 
J023059I08GCCGGCCCACGTCGGCCCATCANONE 
J023084C06GCCGGCCCACGTCGGCCCATCANONE 
J023114G06GCCGGCCCACGTCGGCCCATCANONE 
J023142A09GCCGGCCCACGTCGGCCCATCANONE 
J033026E14GCCGGCCCACGTCGGCCCATCANONE 
J053042M10GCCGGCCCACGTCGGCCCATCANONE 
J053082K21GCCGGCCCACGTCGGCCCATCANONE 
J065105J15GCCGGCCCACGTCGGCCCATCANONE 
J065150F02GCCGGCCCACGTCGGCCCATCANONE 
J075177H05GCCGGCCCACGTCGGCCCATCANONE 
J080040B16GCCGGCCCACGTCGGCCCATCANONE 
J090077J10GCCGGCCCACGTCGGCCCATCANONE 
Os02g0565000AK120665TCCGTCCGGCCCAACAHomeodomain-like containing protein. 
J100070C12TCCGTCCGGCCCAACANONE 
J100074L08TCCGTCCGGCCCAACANONE 
Os02g0593400016-051-C08CCCGGCCCACGGNONE 
016-051-C08CTTGGGCCGGCCCNONE 
AK064226CCCGGCCCACGGNONE 
AK064226CTTGGGCCGGCCCNONE 
AK072362CCCGGCCCACGGConserved hypothetical protein. 
AK072362CTTGGGCCGGCCCConserved hypothetical protein. 
AK109015CCCGGCCCACGGNONE 
AK109015CTTGGGCCGGCCCNONE 
J023063B12CCCGGCCCACGGNONE 
J023063B12CTTGGGCCGGCCCNONE 
J065192M02CCCGGCCCACGGNONE 
J065192M02CTTGGGCCGGCCCNONE 
J075182N05CCCGGCCCACGGNONE 
J075182N05CTTGGGCCGGCCCNONE 
Os02g0600100AK071215TCCGGCCCATGGSimilar to 26S proteasome subunit RPN7. 
AK071215TCCGGCCCATGGGCTGTSimilar to 26S proteasome subunit RPN7. 
Os02g0602300AK065609GCCCGGCCGGCCCACCTGNONE 
AK065609GCCGGCCCACGTGNONE 
AK066929GCCCGGCCGGCCCACCTGSimilar to Myelin transcription factor 1 (MYT1) (MYTI) (Proteolipid protein binding protein) (PLPB1). 
AK066929GCCGGCCCACGTGSimilar to Myelin transcription factor 1 (MYT1) (MYTI) (Proteolipid protein binding protein) (PLPB1). 
J013092L08GCCCGGCCGGCCCACCTGNONE 
J013092L08GCCGGCCCACGTGNONE 
J090040I23GCCCGGCCGGCCCACCTGNONE 
J090040I23GCCGGCCCACGTGNONE 
Os02g0610700014-008-A03TTCGTGGGCCGGCNONE 
AK059205TTCGTGGGCCGGCConserved hypothetical protein. 
AK100281TTCGTGGGCCGGCNONE 
J023074H03TTCGTGGGCCGGCNONE 
J065002J16TTCGTGGGCCGGCNONE 
J065032I20TTCGTGGGCCGGCNONE 
J065076A07TTCGTGGGCCGGCNONE 
J065142O21TTCGTGGGCCGGCNONE 
J065203A03TTCGTGGGCCGGCNONE 
J075017F24TTCGTGGGCCGGCNONE 
J075017G24TTCGTGGGCCGGCNONE 
Os02g0616600AK106681CCGAGCCGGCCCAAATCGGCCCACACConserved hypothetical protein. 
AK106681CTTGGGCTGCCGGCCCAGCConserved hypothetical protein. 
J065062G16CCGAGCCGGCCCAAATCGGCCCACACNONE 
J065062G16CTTGGGCTGCCGGCCCAGCNONE 
Os02g0622400005-010-C04TAATGGGCCGGCCCATTTNONE 
AK061679TAATGGGCCGGCCCATTTConserved hypothetical protein. 
J013058H01TAATGGGCCGGCCCATTTNONE 
J013095D07TAATGGGCCGGCCCATTTNONE 
J023054G05TAATGGGCCGGCCCATTTNONE 
J023093A17TAATGGGCCGGCCCATTTNONE 
J023146P16TAATGGGCCGGCCCATTTNONE 
J033089D16TAATGGGCCGGCCCATTTNONE 
J033099G12TAATGGGCCGGCCCATTTNONE 
J033131N10TAATGGGCCGGCCCATTTNONE 
J053073J04TAATGGGCCGGCCCATTTNONE 
J053074P03TAATGGGCCGGCCCATTTNONE 
J053075M06TAATGGGCCGGCCCATTTNONE 
J053088K13TAATGGGCCGGCCCATTTNONE 
J090039F18TAATGGGCCGGCCCATTTNONE 
J090045M03TAATGGGCCGGCCCATTTNONE 
Os02g0629800AK121915ATTGGGCCGGTSimilar to Defensin precursor. 
J033106C08ATTGGGCCGGTNONE 
J065053G20ATTGGGCCGGTNONE 
J065114P06ATTGGGCCGGTNONE 
J065174H18ATTGGGCCGGTNONE 
J065183J04ATTGGGCCGGTNONE 
J080310C15ATTGGGCCGGTNONE 
Os02g0632500AK101701GCCGGCCCAGCCArf GTPase activating protein family protein. 
Os02g0634800003-004-F03CTTGGGCCGGANONE 
AK059694CTTGGGCCGGAUbiquitin-conjugating enzyme, E2 domain containing protein. 
J013067H17CTTGGGCCGGANONE 
J053077G20CTTGGGCCGGANONE 
J075195F14CTTGGGCCGGANONE 
Os02g0634900006-032-G12TCCGGCCCAAGNONE 
006-033-E09TCCGGCCCAAGNONE 
006-117-F10TCCGGCCCAAGNONE 
006-118-E01TCCGGCCCAAGNONE 
013-056-G08TCCGGCCCAAGNONE 
AK059769TCCGGCCCAAGNONE 
AK068583TCCGGCCCAAGNONE 
AK072855TCCGGCCCAAGProteasome subunit alpha type 2 (EC 3.4.25.1) (20S proteasome alpha subunit B) (20S proteasome subunit alpha-2). 
AK106210TCCGGCCCAAGNONE 
J023138P05TCCGGCCCAAGNONE 
J023143J07TCCGGCCCAAGNONE 
J033022O09TCCGGCCCAAGNONE 
J033111L02TCCGGCCCAAGNONE 
J033135O03TCCGGCCCAAGNONE 
J065005K19TCCGGCCCAAGNONE 
J065044C17TCCGGCCCAAGNONE 
J065116K09TCCGGCCCAAGNONE 
J065119O21TCCGGCCCAAGNONE 
J075014L05TCCGGCCCAAGNONE 
J075109H16TCCGGCCCAAGNONE 
J075117D04TCCGGCCCAAGNONE 
Os02g0636300AK100670TAATGGGCTGGGCCGGGCCGGCDEAD/DEAH box helicase, N-terminal domain containing protein. 
J013149P11TAATGGGCTGGGCCGGGCCGGCNONE 
J023022F15TAATGGGCTGGGCCGGGCCGGCNONE 
J023112J15TAATGGGCTGGGCCGGGCCGGCNONE 
J023145M22TAATGGGCTGGGCCGGGCCGGCNONE 
J043017P16TAATGGGCTGGGCCGGGCCGGCNONE 
Os02g0641800AK066504CCCGGCCCAGCCSimilar to RNA helicase (Fragment). 
AK072124CCCGGCCCAGCCNONE 
Os02g0651900AK101633AATGGGCCGGTNONE 
AK102949AATGGGCCGGTConserved hypothetical protein. 
J080018N20AATGGGCCGGTNONE 
J080062I19AATGGGCCGGTNONE 
J100064N12AATGGGCCGGTNONE 
J100083B11AATGGGCCGGTNONE 
J100089D08AATGGGCCGGTNONE 
Os02g0672500AK109266ACCGGCCCACACNONE 
Os02g0673600009-071-C12TCCGGCCCATGAGGGGCCCAATANONE 
J023037G24TCCGGCCCATGAGGGGCCCAATANONE 
J023038E07TCCGGCCCATGAGGGGCCCAATAORMDL family protein. 
J023142L24TCCGGCCCATGAGGGGCCCAATANONE 
J033115B14TCCGGCCCATGAGGGGCCCAATANONE 
J075004B15TCCGGCCCATGAGGGGCCCAATANONE 
J075067J21TCCGGCCCATGAGGGGCCCAATANONE 
J075072K07TCCGGCCCATGAGGGGCCCAATANONE 
J075147H21TCCGGCCCATGAGGGGCCCAATANONE 
J075154F03TCCGGCCCATGAGGGGCCCAATANONE 
Os02g0697200015-013-B10TGTTGGGCCGGTNONE 
AK059475TGTTGGGCCGGTNONE 
AK102993TGTTGGGCCGGTConserved hypothetical protein. 
J033079I18TGTTGGGCCGGTNONE 
J033082A14TGTTGGGCCGGTNONE 
J065047H08TGTTGGGCCGGTNONE 
J065131M14TGTTGGGCCGGTNONE 
Os02g0698100009-089-H10CAACGGCCCGGCCCATTTNONE 
AK060614CAACGGCCCGGCCCATTTGalactose oxidase, central domain containing protein. 
J090039P20CAACGGCCCGGCCCATTTNONE 
Os02g0705100012-046-E01GCCGGCCCAGCCNONE 
AK063491GCCGGCCCAGCCEpoxide hydrolase family protein. 
J065184H07GCCGGCCCAGCCNONE 
Os02g0725300AK120054GCCGGCCCAGTNONE 
J013000L05GCCGGCCCAGTNONE 
J065194M19GCCGGCCCAGTNONE 
Os02g0736500AK065166GTTTGGGCCGGGCNicastrin family protein. 
J013099D16GTTTGGGCCGGGCNONE 
Os02g0741500AK068867TCCGGCCCAAACRibbon-helix-helix domain containing protein. 
Os02g0744000AK064898TCCGGCCCAAACConserved hypothetical protein. 
AK104827TCCGGCCCAAACNONE 
J013000L12TCCGGCCCAAACNONE 
J013156N02TCCGGCCCAAACNONE 
J065001H14TCCGGCCCAAACNONE 
J065038D18TCCGGCCCAAACNONE 
J065039I18TCCGGCCCAAACNONE 
J065047C13TCCGGCCCAAACNONE 
J065053J09TCCGGCCCAAACNONE 
J065064G03TCCGGCCCAAACNONE 
J065066M05TCCGGCCCAAACNONE 
J065068O10TCCGGCCCAAACNONE 
J065090H22TCCGGCCCAAACNONE 
J065113L19TCCGGCCCAAACNONE 
J065121M02TCCGGCCCAAACNONE 
J065122K23TCCGGCCCAAACNONE 
J065138C12TCCGGCCCAAACNONE 
J065153E14TCCGGCCCAAACNONE 
J065156N12TCCGGCCCAAACNONE 
J065158L20TCCGGCCCAAACNONE 
J065166I06TCCGGCCCAAACNONE 
J065174L15TCCGGCCCAAACNONE 
J065175N03TCCGGCCCAAACNONE 
J090092C23TCCGGCCCAAACNONE 
Os02g0750500AK101960TACGGCCCGGCCCAATASAM (and some other nucleotide) binding motif domain containing protein. 
J033075P05TACGGCCCGGCCCAATANONE 
J065054F02TACGGCCCGGCCCAATANONE 
J065124N03TACGGCCCGGCCCAATANONE 
J090001H12TACGGCCCGGCCCAATANONE 
J100057J01TACGGCCCGGCCCAATANONE 
J100062F12TACGGCCCGGCCCAATANONE 
Os02g0768600006-034-F01AGGTGGGCCGGANONE 
006-034-F01TCTGGCCCGGCCCAAACNONE 
006-046-G07AGGTGGGCCGGANONE 
006-046-G07TCTGGCCCGGCCCAAACNONE 
006-054-C07AGGTGGGCCGGANONE 
006-054-C07TCTGGCCCGGCCCAAACNONE 
006-056-F07AGGTGGGCCGGANONE 
006-056-F07TCTGGCCCGGCCCAAACNONE 
006-100-C02AGGTGGGCCGGANONE 
006-100-C02TCTGGCCCGGCCCAAACNONE 
AK059725AGGTGGGCCGGANONE 
AK059725TCTGGCCCGGCCCAAACNONE 
AK098996AGGTGGGCCGGANONE 
AK098996TCTGGCCCGGCCCAAACNONE 
AK099120AGGTGGGCCGGANONE 
AK099120TCTGGCCCGGCCCAAACNONE 
AK104659AGGTGGGCCGGANONE 
AK104659TCTGGCCCGGCCCAAACNONE 
J065043H04AGGTGGGCCGGANONE 
J065043H04TCTGGCCCGGCCCAAACNONE 
J075034N21AGGTGGGCCGGANONE 
J075034N21TCTGGCCCGGCCCAAACNONE 
J075145C18AGGTGGGCCGGANONE 
J075145C18TCTGGCCCGGCCCAAACNONE 
J080016H01AGGTGGGCCGGANONE 
J080016H01TCTGGCCCGGCCCAAACNONE 
J080040F01AGGTGGGCCGGANONE 
J080040F01TCTGGCCCGGCCCAAACNONE 
J080047L23AGGTGGGCCGGANONE 
J080047L23TCTGGCCCGGCCCAAACNONE 
J080049B22AGGTGGGCCGGANONE 
J080049B22TCTGGCCCGGCCCAAACNONE 
J080062J16AGGTGGGCCGGANONE 
J080062J16TCTGGCCCGGCCCAAACNONE 
J080064C23AGGTGGGCCGGANONE 
J080064C23TCTGGCCCGGCCCAAACNONE 
J080064L22AGGTGGGCCGGANONE 
J080064L22TCTGGCCCGGCCCAAACNONE 
J080077N01AGGTGGGCCGGANONE 
J080077N01TCTGGCCCGGCCCAAACNONE 
J080097G17AGGTGGGCCGGANONE 
J080097G17TCTGGCCCGGCCCAAACNONE 
J100065L15AGGTGGGCCGGANONE 
J100065L15TCTGGCCCGGCCCAAACNONE 
J100066K23AGGTGGGCCGGANONE 
J100066K23TCTGGCCCGGCCCAAACNONE 
J100088C07AGGTGGGCCGGANONE 
J100088C07TCTGGCCCGGCCCAAACNONE 
J100090H09AGGTGGGCCGGANONE 
J100090H09TCTGGCCCGGCCCAAACNONE 
Os02g0771200011-006-B07CCCGGCCCACGTNONE 
011-006-B07GCCGGCCCATAANONE 
AK066823CCCGGCCCACGTConserved hypothetical protein. 
AK066823GCCGGCCCATAAConserved hypothetical protein. 
AK071059CCCGGCCCACGTNONE 
AK071059GCCGGCCCATAANONE 
J013075K03CCCGGCCCACGTNONE 
J013075K03GCCGGCCCATAANONE 
Os02g0775600003-118-H07AAATGGGCCGGGNONE 
009-075-H07AAATGGGCCGGGNONE 
AK058592AAATGGGCCGGGNONE 
AK068762AAATGGGCCGGGZinc finger, C2H2-type domain containing protein. 
Os02g0775900AK119974GGTTGGGCCGGAConserved hypothetical protein. 
Os02g0776800AB042415AGATGGGCCGGCCCACCCGNONE 
AK072308AGATGGGCCGGCCCACCCGReplication protein A 70kDa. 
AK101212AGATGGGCCGGCCCACCCGNONE 
J033031B02AGATGGGCCGGCCCACCCGNONE 
J090004E18AGATGGGCCGGCCCACCCGNONE 
J090084C24AGATGGGCCGGCCCACCCGNONE 
Os02g0778200AK065948ACCGGCCCAAGTTGGCCCAAGAminoacyl-tRNA synthetase, class I family protein. 
Os02g0780500AK072784CCATGGGCCGGACCGTTGGGCCTCNONE 
AK072784CTTGGGCCGGANONE 
AK072784GCTGGGCCGGCCCAACNONE 
AK121143CCATGGGCCGGACCGTTGGGCCTCConserved hypothetical protein. 
AK121143CTTGGGCCGGAConserved hypothetical protein. 
AK121143GCTGGGCCGGCCCAACConserved hypothetical protein. 
J023075M13CCATGGGCCGGACCGTTGGGCCTCNONE 
J023075M13CTTGGGCCGGANONE 
J023075M13GCTGGGCCGGCCCAACNONE 
J023077P14CCATGGGCCGGACCGTTGGGCCTCNONE 
J023077P14CTTGGGCCGGANONE 
J023077P14GCTGGGCCGGCCCAACNONE 
J023123C16CCATGGGCCGGACCGTTGGGCCTCNONE 
J023123C16CTTGGGCCGGANONE 
J023123C16GCTGGGCCGGCCCAACNONE 
J023142P06CCATGGGCCGGACCGTTGGGCCTCNONE 
J023142P06CTTGGGCCGGANONE 
J023142P06GCTGGGCCGGCCCAACNONE 
Os02g0780700AK063558CCCGGCCCACCACCGCACLipase, class 3 family protein. 
Os02g0798700AK101070GCTGGGCCGGANeurochondrin family protein. 
AK103079GCTGGGCCGGANONE 
J090045L09GCTGGGCCGGANONE 
Os02g0801900006-113-E02CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
AK109488CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
AK109498CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGConserved hypothetical protein. 
J065007D19CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
J065035G11CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
J065044E05CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
J065112N01CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
J065143B03CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
J065159A16CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
J090007K23CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
J090045N09CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
J090049L20CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
Os02g0803200AK063404AGATGGGCCGGASimilar to 30S ribosomal protein S15. 
AK063404GCTGGGCCGGCCCACCSimilar to 30S ribosomal protein S15. 
Os02g0804300006-046-D12GCTGGGCCGGGNONE 
AK060165GCTGGGCCGGGNONE 
AK067584GCTGGGCCGGGSAM (and some other nucleotide) binding motif domain containing protein. 
J013112C12GCTGGGCCGGGNONE 
J023098C22GCTGGGCCGGGNONE 
J033123P06GCTGGGCCGGGNONE 
J065060N24GCTGGGCCGGGNONE 
J065069H22GCTGGGCCGGGNONE 
J065155N20GCTGGGCCGGGNONE 
J065170K07GCTGGGCCGGGNONE 
J090033D12GCTGGGCCGGGNONE 
Os02g0815500AK099733CCCGGCCCAATTAlcohol dehydrogenase class III (EC 1.1.1.1) (Glutathione-dependent formaldehyde dehydrogenase) (EC 1.2.1.1) (FDH) (FALDH) (GSH-FDH). 
J013089P19CCCGGCCCAATTNONE 
J043022H19CCCGGCCCAATTNONE 
J065008L14CCCGGCCCAATTNONE 
J065016G09CCCGGCCCAATTNONE 
J065023C22CCCGGCCCAATTNONE 
J065024K13CCCGGCCCAATTNONE 
J065043D14CCCGGCCCAATTNONE 
J065052K16CCCGGCCCAATTNONE 
J065058D17CCCGGCCCAATTNONE 
J065087L03CCCGGCCCAATTNONE 
J065107H15CCCGGCCCAATTNONE 
J065110E12CCCGGCCCAATTNONE 
J065124P14CCCGGCCCAATTNONE 
J065131B20CCCGGCCCAATTNONE 
J065155I10CCCGGCCCAATTNONE 
J065172J02CCCGGCCCAATTNONE 
J065184D04CCCGGCCCAATTNONE 
J065189D21CCCGGCCCAATTNONE 
J065201O14CCCGGCCCAATTNONE 
J065203D20CCCGGCCCAATTNONE 
J065206M13CCCGGCCCAATTNONE 
J065211E14CCCGGCCCAATTNONE 
J065217J21CCCGGCCCAATTNONE 
J090004A20CCCGGCCCAATTNONE 
Os02g0823600AK070498TCCGGCCCAAAConserved hypothetical protein. 
AK070498TCCGGCCCATTTConserved hypothetical protein. 
J065055C02TCCGGCCCAAANONE 
J065055C02TCCGGCCCATTTNONE 
J065098A17TCCGGCCCAAANONE 
J065098A17TCCGGCCCATTTNONE 
J065119B13TCCGGCCCAAANONE 
J065119B13TCCGGCCCATTTNONE 
J065146F10TCCGGCCCAAANONE 
J065146F10TCCGGCCCATTTNONE 
J065209G06TCCGGCCCAAANONE 
J065209G06TCCGGCCCATTTNONE 
J080001K12TCCGGCCCAAANONE 
J080001K12TCCGGCCCATTTNONE 
J080004O17TCCGGCCCAAANONE 
J080004O17TCCGGCCCATTTNONE 
J080005P21TCCGGCCCAAANONE 
J080005P21TCCGGCCCATTTNONE 
J080009M18TCCGGCCCAAANONE 
J080009M18TCCGGCCCATTTNONE 
J080013O18TCCGGCCCAAANONE 
J080013O18TCCGGCCCATTTNONE 
J080014B04TCCGGCCCAAANONE 
J080014B04TCCGGCCCATTTNONE 
J080014O21TCCGGCCCAAANONE 
J080014O21TCCGGCCCATTTNONE 
J080015B04TCCGGCCCAAANONE 
J080015B04TCCGGCCCATTTNONE 
J080016B17TCCGGCCCAAANONE 
J080016B17TCCGGCCCATTTNONE 
J080017G09TCCGGCCCAAANONE 
J080017G09TCCGGCCCATTTNONE 
J080022A17TCCGGCCCAAANONE 
J080022A17TCCGGCCCATTTNONE 
J080024M10TCCGGCCCAAANONE 
J080024M10TCCGGCCCATTTNONE 
J080025F17TCCGGCCCAAANONE 
J080025F17TCCGGCCCATTTNONE 
J080025O16TCCGGCCCAAANONE 
J080025O16TCCGGCCCATTTNONE 
J080029H09TCCGGCCCAAANONE 
J080029H09TCCGGCCCATTTNONE 
J080030G24TCCGGCCCAAANONE 
J080030G24TCCGGCCCATTTNONE 
J080031E02TCCGGCCCAAANONE 
J080031E02TCCGGCCCATTTNONE 
J080032A18TCCGGCCCAAANONE 
J080032A18TCCGGCCCATTTNONE 
J080032G24TCCGGCCCAAANONE 
J080032G24TCCGGCCCATTTNONE 
J080033C05TCCGGCCCAAANONE 
J080033C05TCCGGCCCATTTNONE 
J080033N19TCCGGCCCAAANONE 
J080033N19TCCGGCCCATTTNONE 
J080035H10TCCGGCCCAAANONE 
J080035H10TCCGGCCCATTTNONE 
J080035L05TCCGGCCCAAANONE 
J080035L05TCCGGCCCATTTNONE 
J080042N09TCCGGCCCAAANONE 
J080042N09TCCGGCCCATTTNONE 
J080044C14TCCGGCCCAAANONE 
J080044C14TCCGGCCCATTTNONE 
J080048K16TCCGGCCCAAANONE 
J080048K16TCCGGCCCATTTNONE 
J080050L07TCCGGCCCAAANONE 
J080050L07TCCGGCCCATTTNONE 
J080051L06TCCGGCCCAAANONE 
J080051L06TCCGGCCCATTTNONE 
J080051P22TCCGGCCCAAANONE 
J080051P22TCCGGCCCATTTNONE 
J080053D09TCCGGCCCAAANONE 
J080053D09TCCGGCCCATTTNONE 
J080053J15TCCGGCCCAAANONE 
J080053J15TCCGGCCCATTTNONE 
J080053O12TCCGGCCCAAANONE 
J080053O12TCCGGCCCATTTNONE 
J080057L01TCCGGCCCAAANONE 
J080057L01TCCGGCCCATTTNONE 
J080062E08TCCGGCCCAAANONE 
J080062E08TCCGGCCCATTTNONE 
J080062I09TCCGGCCCAAANONE 
J080062I09TCCGGCCCATTTNONE 
J080063A21TCCGGCCCAAANONE 
J080063A21TCCGGCCCATTTNONE 
J080063E04TCCGGCCCAAANONE 
J080063E04TCCGGCCCATTTNONE 
J080063E08TCCGGCCCAAANONE 
J080063E08TCCGGCCCATTTNONE 
J080064D15TCCGGCCCAAANONE 
J080064D15TCCGGCCCATTTNONE 
J080064N15TCCGGCCCAAANONE 
J080064N15TCCGGCCCATTTNONE 
J080068F13TCCGGCCCAAANONE 
J080068F13TCCGGCCCATTTNONE 
J080070L16TCCGGCCCAAANONE 
J080070L16TCCGGCCCATTTNONE 
J080072O17TCCGGCCCAAANONE 
J080072O17TCCGGCCCATTTNONE 
J080075A07TCCGGCCCAAANONE 
J080075A07TCCGGCCCATTTNONE 
J080076H10TCCGGCCCAAANONE 
J080076H10TCCGGCCCATTTNONE 
J080077K19TCCGGCCCAAANONE 
J080077K19TCCGGCCCATTTNONE 
J080078E19TCCGGCCCAAANONE 
J080078E19TCCGGCCCATTTNONE 
J080082A02TCCGGCCCAAANONE 
J080082A02TCCGGCCCATTTNONE 
J080083O05TCCGGCCCAAANONE 
J080083O05TCCGGCCCATTTNONE 
J080091I07TCCGGCCCAAANONE 
J080091I07TCCGGCCCATTTNONE 
J080094K10TCCGGCCCAAANONE 
J080094K10TCCGGCCCATTTNONE 
J080094N03TCCGGCCCAAANONE 
J080094N03TCCGGCCCATTTNONE 
J080096F09TCCGGCCCAAANONE 
J080096F09TCCGGCCCATTTNONE 
J080097O04TCCGGCCCAAANONE 
J080097O04TCCGGCCCATTTNONE 
J090037B19TCCGGCCCAAANONE 
J090037B19TCCGGCCCATTTNONE 
J100017A13TCCGGCCCAAANONE 
J100017A13TCCGGCCCATTTNONE 
J100068N22TCCGGCCCAAANONE 
J100068N22TCCGGCCCATTTNONE 
J100072C06TCCGGCCCAAANONE 
J100072C06TCCGGCCCATTTNONE 
Os02g0823800AK120318ACCGGCCCATATConserved hypothetical protein. 
J075055J16ACCGGCCCATATNONE 
Os02g0827300AK069159GGCCCGGCCCACGAGCCCAACCProtein of unknown function DUF382 domain containing protein. 
Os02g0829900009-044-G07GCCGGCCCAGCCCAACANONE 
AK120917GCCGGCCCAGCCCAACASimilar to BRICK1. 
AY224582GCCGGCCCAGCCCAACANONE 
J023034L01GCCGGCCCAGCCCAACANONE 
J023034M01GCCGGCCCAGCCCAACANONE 
J090010G06GCCGGCCCAGCCCAACANONE 
J090020D07GCCGGCCCAGCCCAACANONE 
J100041L04GCCGGCCCAGCCCAACANONE 
J100061D05GCCGGCCCAGCCCAACANONE 
J100070L18GCCGGCCCAGCCCAACANONE 
Os02g0830000011-075-D11TGTTGGGCTGGGCCGGCNONE 
AK101841TGTTGGGCTGGGCCGGCProtein prenyltransferase domain containing protein. 
J033069G13TGTTGGGCTGGGCCGGCNONE 
Os03g0100400AK068556TCTGGGCCGGCNONE 
AK121880TCTGGGCCGGCSimilar to DNA repair endonuclease UVH1 (EC 3.1.-.-) (Ultraviolet hypersensitive 1) (AtRAD1) (DNA excision repair protein XP-F homolog). 
Os03g0113700AK103835AGTTGGGCCGGGCCGTGGSimilar to Heat shock 70 kDa protein, mitochondrial precursor. 
AK103835CCTGGGCCGGCCCAAAASimilar to Heat shock 70 kDa protein, mitochondrial precursor. 
Os03g0113800AK065925CCACGGCCCGGCCCAACTProtein prenyltransferase domain containing protein. 
AK065925TTTTGGGCCGGCCCAGGProtein prenyltransferase domain containing protein. 
J013047E20CCACGGCCCGGCCCAACTNONE 
J013047E20TTTTGGGCCGGCCCAGGNONE 
J065026F21CCACGGCCCGGCCCAACTNONE 
J065026F21TTTTGGGCCGGCCCAGGNONE 
J065047B03CCACGGCCCGGCCCAACTNONE 
J065047B03TTTTGGGCCGGCCCAGGNONE 
J065054J12CCACGGCCCGGCCCAACTNONE 
J065054J12TTTTGGGCCGGCCCAGGNONE 
J065079M24CCACGGCCCGGCCCAACTNONE 
J065079M24TTTTGGGCCGGCCCAGGNONE 
J065093M07CCACGGCCCGGCCCAACTNONE 
J065093M07TTTTGGGCCGGCCCAGGNONE 
J065153F02CCACGGCCCGGCCCAACTNONE 
J065153F02TTTTGGGCCGGCCCAGGNONE 
J065155E21CCACGGCCCGGCCCAACTNONE 
J065155E21TTTTGGGCCGGCCCAGGNONE 
J065179H15CCACGGCCCGGCCCAACTNONE 
J065179H15TTTTGGGCCGGCCCAGGNONE 
J075019N02CCACGGCCCGGCCCAACTNONE 
J075019N02TTTTGGGCCGGCCCAGGNONE 
J075089E01CCACGGCCCGGCCCAACTNONE 
J075089E01TTTTGGGCCGGCCCAGGNONE 
J090066I18CCACGGCCCGGCCCAACTNONE 
J090066I18TTTTGGGCCGGCCCAGGNONE 
J090087K20CCACGGCCCGGCCCAACTNONE 
J090087K20TTTTGGGCCGGCCCAGGNONE 
J100079F05CCACGGCCCGGCCCAACTNONE 
J100079F05TTTTGGGCCGGCCCAGGNONE 
Os03g0116500AF106844GCCGGCCCAATANONE 
AK101870GCCGGCCCAATAConstitutive photomorphogenic 11. 
J023055L16GCCGGCCCAATANONE 
J023088I16GCCGGCCCAATANONE 
J033070E21GCCGGCCCAATANONE 
J065124N22GCCGGCCCAATANONE 
J075152A19GCCGGCCCAATANONE 
J075181J21GCCGGCCCAATANONE 
J090011F23GCCGGCCCAATANONE 
Os03g0122000AK101458TGCGGGCCCGGCCCATATProtein kinase-like domain containing protein. 
J013035K10TGCGGGCCCGGCCCATATNONE 
J013050E10TGCGGGCCCGGCCCATATNONE 
J033040C13TGCGGGCCCGGCCCATATNONE 
Os03g0128500AB037900AATGGGCCGGANONE 
AB037900TCCGGCCCATTNONE 
AK067991AATGGGCCGGASimilar to DNA polymerase delta small subunit (EC 2.7.7.7). 
AK067991TCCGGCCCATTSimilar to DNA polymerase delta small subunit (EC 2.7.7.7). 
J013124O04AATGGGCCGGANONE 
J013124O04TCCGGCCCATTNONE 
J090032P09AATGGGCCGGANONE 
J090032P09TCCGGCCCATTNONE 
Os03g0130700AK110670GCTGGGCCGGTNONE 
AK110670TCCGGCCCATTTNONE 
Os03g0133300AK064510TGTTGGGCCGGGCCGAConserved hypothetical protein. 
Os03g0135600J065183G03TCCGGCCCAAAAnkyrin repeat containing protein. 
Os03g0143400AK073999TAGGCCCACAACCCGGCCCATTSimilar to mitochondrial chaperonin-60 [Oryza sativa (japonica cultivar-group)]. 
J023025G21TAGGCCCACAACCCGGCCCATTNONE 
J033073C08TAGGCCCACAACCCGGCCCATTNONE 
J033094C19TAGGCCCACAACCCGGCCCATTNONE 
J065017L10TAGGCCCACAACCCGGCCCATTNONE 
J065070H22TAGGCCCACAACCCGGCCCATTNONE 
J065079M09TAGGCCCACAACCCGGCCCATTNONE 
J065091N18TAGGCCCACAACCCGGCCCATTNONE 
J065109N03TAGGCCCACAACCCGGCCCATTNONE 
J065113F05TAGGCCCACAACCCGGCCCATTNONE 
J065135D23TAGGCCCACAACCCGGCCCATTNONE 
J065156L16TAGGCCCACAACCCGGCCCATTNONE 
J065207O04TAGGCCCACAACCCGGCCCATTNONE 
J065208F03TAGGCCCACAACCCGGCCCATTNONE 
J090010M15TAGGCCCACAACCCGGCCCATTNONE 
J090056J18TAGGCCCACAACCCGGCCCATTNONE 
Os03g0145700AK065716AAATGGGCCGGTNONE 
J013039F14AAATGGGCCGGTNONE 
J013091M20AAATGGGCCGGTNONE 
J065059P20AAATGGGCCGGTNONE 
J065128M07AAATGGGCCGGTNONE 
J065136N23AAATGGGCCGGTNONE 
J065163H21AAATGGGCCGGTNONE 
J065176B18AAATGGGCCGGTNONE 
J065177A17AAATGGGCCGGTNONE 
J065201F24AAATGGGCCGGTNONE 
Os03g0161000AK121425CAAGTGGGCCGGGNONE 
AK121425CACTGACAGGTGGGCCGGGGACGGCTNONE 
J023135K12CAAGTGGGCCGGGNONE 
J023135K12CACTGACAGGTGGGCCGGGGACGGCTNONE 
Os03g0172200AK069130AATTGGGCCGGCArmadillo-like helical domain containing protein. 
AK069130TCCGGCCCAGCCACACGArmadillo-like helical domain containing protein. 
Os03g0172700AK111307GCCGGCCCACTHypothetical protein. 
Os03g0181600AK067807TCCGGCCCATAASimilar to GATA transcription factor 25 (ZIM-like 2 protein). 
AK101197TCCGGCCCATAANONE 
Os03g0182600006-028-E05CTTGGGCCGGCCCATGNONE 
006-047-F10CTTGGGCCGGCCCATGNONE 
009-123-C08CTTGGGCCGGCCCATGNONE 
016-033-G05CTTGGGCCGGCCCATGNONE 
AK061289CTTGGGCCGGCCCATGRibosomal protein S2 family protein. 
AK066899CTTGGGCCGGCCCATGNONE 
J013065H05CTTGGGCCGGCCCATGNONE 
J023012F15CTTGGGCCGGCCCATGNONE 
J023065M10CTTGGGCCGGCCCATGNONE 
J033079N15CTTGGGCCGGCCCATGNONE 
J033109E21CTTGGGCCGGCCCATGNONE 
J033148M14CTTGGGCCGGCCCATGNONE 
J043015G23CTTGGGCCGGCCCATGNONE 
J043022M01CTTGGGCCGGCCCATGNONE 
J053060D01CTTGGGCCGGCCCATGNONE 
J053062E24CTTGGGCCGGCCCATGNONE 
J053096N12CTTGGGCCGGCCCATGNONE 
J053098N02CTTGGGCCGGCCCATGNONE 
J090024N09CTTGGGCCGGCCCATGNONE 
J090027G22CTTGGGCCGGCCCATGNONE 
J090043C10CTTGGGCCGGCCCATGNONE 
J090063F05CTTGGGCCGGCCCATGNONE 
J090066J05CTTGGGCCGGCCCATGNONE 
J090073I17CTTGGGCCGGCCCATGNONE 
J090087L04CTTGGGCCGGCCCATGNONE 
J100075O12CTTGGGCCGGCCCATGNONE 
Os03g0184600AK065264ATTTGGGCCCGGCCCACAANAD-dependent epimerase/dehydratase family protein. 
Os03g0192100AK064747ATTTGGGCCGGGCNONE 
AK105523ATTTGGGCCGGGCPeptidase S10, serine carboxypeptidase family protein. 
Os03g0192400009-081-A03AGTTGGGCCGGTNONE 
009-159-B02AGTTGGGCCGGTNONE 
AK070573AGTTGGGCCGGTGRIM-19 family protein. 
J023056B01AGTTGGGCCGGTNONE 
J023075G06AGTTGGGCCGGTNONE 
J033048K16AGTTGGGCCGGTNONE 
J033048L16AGTTGGGCCGGTNONE 
J053031H23AGTTGGGCCGGTNONE 
J065002H14AGTTGGGCCGGTNONE 
J065006G22AGTTGGGCCGGTNONE 
J065032G13AGTTGGGCCGGTNONE 
J065056A09AGTTGGGCCGGTNONE 
J065078I01AGTTGGGCCGGTNONE 
J065095G01AGTTGGGCCGGTNONE 
J065095I18AGTTGGGCCGGTNONE 
J065134M18AGTTGGGCCGGTNONE 
J065158P07AGTTGGGCCGGTNONE 
J065165K17AGTTGGGCCGGTNONE 
J065181J12AGTTGGGCCGGTNONE 
J065189N09AGTTGGGCCGGTNONE 
J065200D13AGTTGGGCCGGTNONE 
J065202H20AGTTGGGCCGGTNONE 
J065215K20AGTTGGGCCGGTNONE 
J075049N19AGTTGGGCCGGTNONE 
J075147J16AGTTGGGCCGGTNONE 
J090081E19AGTTGGGCCGGTNONE 
J100017C16AGTTGGGCCGGTNONE 
J100039M16AGTTGGGCCGGTNONE 
J100043E23AGTTGGGCCGGTNONE 
J100063L12AGTTGGGCCGGTNONE 
J100079F22AGTTGGGCCGGTNONE 
Os03g0195200AK068949TGATGGGCCGGCCCACCCPossible metal-binding region in RNase L inhibitor, RLI domain containing protein. 
Os03g0195900J065063O15GGAGTGGGCCGGTNONE 
Os03g0204900009-041-G04GCCGGCCCAATANONE 
009-041-G04TAATGGGCCGGGNONE 
AK062601GCCGGCCCAATASimilar to TATA-binding protein associated factor 2N (RNA-binding protein 56) (TAFII68) (TAF(II)68). 
AK062601TAATGGGCCGGGSimilar to TATA-binding protein associated factor 2N (RNA-binding protein 56) (TAFII68) (TAF(II)68). 
Os03g0205500Os03g0205500CCCGGGCCCGGCCCACTGGCCCAGTCytochrome b5 domain containing protein. 
Os03g0214100AB111916CGGCCCGGCCCATCTNONE 
AF009179CGGCCCGGCCCATCTReplication protein A1. 
AK060582CGGCCCGGCCCATCTNONE 
Os03g0238700AK073387ATATGGGCCGGATGGGCCTTGSimilar to Acid phosphatase type 5. 
J033043K11ATATGGGCCGGATGGGCCTTGNONE 
Os03g0240700009-086-G10GGCCCGGCCCAACANONE 
009-086-G10TAATGGGCCCGGCCCAAACNONE 
AK071799GGCCCGGCCCAACAConserved hypothetical protein. 
AK071799TAATGGGCCCGGCCCAAACConserved hypothetical protein. 
J023112A13GGCCCGGCCCAACANONE 
J023112A13TAATGGGCCCGGCCCAAACNONE 
J043022A01GGCCCGGCCCAACANONE 
J043022A01TAATGGGCCCGGCCCAAACNONE 
J065106A01GGCCCGGCCCAACANONE 
J065106A01TAATGGGCCCGGCCCAAACNONE 
J075023P22GGCCCGGCCCAACANONE 
J075023P22TAATGGGCCCGGCCCAAACNONE 
J075138I21GGCCCGGCCCAACANONE 
J075138I21TAATGGGCCCGGCCCAAACNONE 
J075173L02GGCCCGGCCCAACANONE 
J075173L02TAATGGGCCCGGCCCAAACNONE 
Os03g0240800006-092-D05GTTTGGGCCGGGCCCATTANONE 
006-092-D05TGTTGGGCCGGGCCNONE 
AK059292GTTTGGGCCGGGCCCATTANONE 
AK059292TGTTGGGCCGGGCCNONE 
AK061178GTTTGGGCCGGGCCCATTASimilar to AGL157Cp. 
AK061178TGTTGGGCCGGGCCSimilar to AGL157Cp. 
AK121552GTTTGGGCCGGGCCCATTANONE 
AK121552TGTTGGGCCGGGCCNONE 
J023131D06GTTTGGGCCGGGCCCATTANONE 
J023131D06TGTTGGGCCGGGCCNONE 
J033033E14GTTTGGGCCGGGCCCATTANONE 
J033033E14TGTTGGGCCGGGCCNONE 
J033105B01GTTTGGGCCGGGCCCATTANONE 
J033105B01TGTTGGGCCGGGCCNONE 
J033114L18GTTTGGGCCGGGCCCATTANONE 
J033114L18TGTTGGGCCGGGCCNONE 
J033132N24GTTTGGGCCGGGCCCATTANONE 
J033132N24TGTTGGGCCGGGCCNONE 
J065032H03GTTTGGGCCGGGCCCATTANONE 
J065032H03TGTTGGGCCGGGCCNONE 
J065115J20GTTTGGGCCGGGCCCATTANONE 
J065115J20TGTTGGGCCGGGCCNONE 
J065150C05GTTTGGGCCGGGCCCATTANONE 
J065150C05TGTTGGGCCGGGCCNONE 
J080302A11GTTTGGGCCGGGCCCATTANONE 
J080302A11TGTTGGGCCGGGCCNONE 
J080302H16GTTTGGGCCGGGCCCATTANONE 
J080302H16TGTTGGGCCGGGCCNONE 
J080305M12GTTTGGGCCGGGCCCATTANONE 
J080305M12TGTTGGGCCGGGCCNONE 
J080306F13GTTTGGGCCGGGCCCATTANONE 
J080306F13TGTTGGGCCGGGCCNONE 
J080312A06GTTTGGGCCGGGCCCATTANONE 
J080312A06TGTTGGGCCGGGCCNONE 
J090088P09GTTTGGGCCGGGCCCATTANONE 
J090088P09TGTTGGGCCGGGCCNONE 
Os03g0251800AK067333TCCGGCCCAGCCCAGCSimilar to Possible OmpA family member precursor. 
AK073337TCCGGCCCAGCCCAGCNONE 
Os03g0271100AB095095TCCGGCCCACGANONE 
AK060821TCCGGCCCACGASimilar to Sigma factor SIG2B. 
AK067693TCCGGCCCACGANONE 
AK099036TCCGGCCCACGANONE 
Os03g0271500AK068546TATGGGCCGGCNONE 
AK109239TATGGGCCGGCConserved hypothetical protein. 
J013157P04TATGGGCCGGCNONE 
J075041K23TATGGGCCGGCNONE 
Os03g0276500011-014-A06ACCGGCCCAACNONE 
012-043-E04ACCGGCCCAACNONE 
012-096-G01ACCGGCCCAACNONE 
014-005-A07ACCGGCCCAACNONE 
014-031-F09ACCGGCCCAACNONE 
014-040-C09ACCGGCCCAACNONE 
014-092-G02ACCGGCCCAACNONE 
AK072830ACCGGCCCAACNONE 
AK099275ACCGGCCCAACNONE 
AK109474ACCGGCCCAACSimilar to Heat shock protein 70. 
J013036E08ACCGGCCCAACNONE 
J013047P03ACCGGCCCAACNONE 
J013048H14ACCGGCCCAACNONE 
J013060E24ACCGGCCCAACNONE 
J013093N10ACCGGCCCAACNONE 
J013123K11ACCGGCCCAACNONE 
J013153C09ACCGGCCCAACNONE 
J023010D20ACCGGCCCAACNONE 
J023027O13ACCGGCCCAACNONE 
J023029B01ACCGGCCCAACNONE 
J023063G14ACCGGCCCAACNONE 
J023083D09ACCGGCCCAACNONE 
J023091M13ACCGGCCCAACNONE 
J023121M10ACCGGCCCAACNONE 
J023126D10ACCGGCCCAACNONE 
J023139H01ACCGGCCCAACNONE 
J023145B18ACCGGCCCAACNONE 
J033029G15ACCGGCCCAACNONE 
J033050K13ACCGGCCCAACNONE 
J033057L09ACCGGCCCAACNONE 
J033092M15ACCGGCCCAACNONE 
J065007N14ACCGGCCCAACNONE 
J065038E07ACCGGCCCAACNONE 
J065043A09ACCGGCCCAACNONE 
J065100C19ACCGGCCCAACNONE 
J065117C02ACCGGCCCAACNONE 
J065213I04ACCGGCCCAACNONE 
J090001F01ACCGGCCCAACNONE 
J090025D07ACCGGCCCAACNONE 
J090037C11ACCGGCCCAACNONE 
J090047N11ACCGGCCCAACNONE 
J090053O05ACCGGCCCAACNONE 
J090070F11ACCGGCCCAACNONE 
J090082O16ACCGGCCCAACNONE 
J090085F20ACCGGCCCAACNONE 
J090096N08ACCGGCCCAACNONE 
Os03g0277000AK100522GCCGGCCCACCACSimilar to GDP dissociation inhibitor protein OsGDI1. 
Os03g0284000Os03g0284000CACGTGGGCCGGAACGGCCCGConserved hypothetical protein. 
Os03g0287900009-074-B07GGCCCGGCCCAAGNONE 
014-027-E07GGCCCGGCCCAAGNONE 
AK063663GGCCCGGCCCAAGSimilar to Protein disulfide isomerase. 
J065009N21GGCCCGGCCCAAGNONE 
Os03g0288900AK100329GGCCCGGCCCACCConserved hypothetical protein. 
J023080H15GGCCCGGCCCACCNONE 
J033136I21GGCCCGGCCCACCNONE 
J065036A16GGCCCGGCCCACCNONE 
J065186A16GGCCCGGCCCACCNONE 
J065187B08GGCCCGGCCCACCNONE 
J065202E24GGCCCGGCCCACCNONE 
Os03g0293100AK060680GGCCCGGCCCAAAConserved hypothetical protein. 
J065193F02GGCCCGGCCCAAANONE 
J075003N10GGCCCGGCCCAAANONE 
Os03g0302700006-099-F12TCCGGCCCACGTNONE 
AK112010TCCGGCCCACGTZinc finger, RING-type domain containing protein. 
AK121656TCCGGCCCACGTNONE 
J075090A19TCCGGCCCACGTNONE 
J075148M06TCCGGCCCACGTNONE 
Os03g0305500AK070638TCCGGCCCATCCAArgininosuccinate lyase domain containing protein. 
Os03g0312600AK073391CTTGGGCCGGCSimilar to XPA-binding protein 1 (HUSSY-23). 
AK073391TGATGGGCCGGCSimilar to XPA-binding protein 1 (HUSSY-23). 
Os03g0326600AK107632AGTGGGCCGGCRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os03g0333300015-069-B02TGTGGGCCGGCNONE 
AK063858TGTGGGCCGGCNONE 
AK073228TGTGGGCCGGCSimilar to Eukaryotic translation initiation factor 2 beta subunit (eIF-2-beta) (P38). 
Os03g0339100AK111641TGATGGGCCGGGSimilar to PRL1 protein. 
Os03g0343900009-077-C03TCCGGCCCAATANONE 
AK105813TCCGGCCCAATAPhotosystem II protein PsbX family protein. 
J100059N03TCCGGCCCAATANONE 
J100079C20TCCGGCCCAATANONE 
Os03g0410700J065102A22CCCGGCCCACGANONE 
Os03g0410900J065067F10TCGTGGGCCGGGNONE 
J065073D08TCGTGGGCCGGGNONE 
J065176C06TCGTGGGCCGGGNONE 
J065189O13TCGTGGGCCGGGNONE 
J065214E05TCGTGGGCCGGGNONE 
J080007H09TCGTGGGCCGGGNONE 
J080012B19TCGTGGGCCGGGNONE 
J080020J16TCGTGGGCCGGGNONE 
J080038J22TCGTGGGCCGGGNONE 
J080045I09TCGTGGGCCGGGNONE 
J080059M16TCGTGGGCCGGGNONE 
J080060C19TCGTGGGCCGGGNONE 
J080080P22TCGTGGGCCGGGNONE 
J080083C03TCGTGGGCCGGGNONE 
J080093M17TCGTGGGCCGGGNONE 
J100029F12TCGTGGGCCGGGLike-Sm ribonucleoprotein, core family protein. 
Os03g0442400Os03g0442400CCCGGCCCATCCNONE 
Os03g0581800009-177-G11TAAGCCCATCCGGCCCAAATNONE 
AK059201TAAGCCCATCCGGCCCAAATNONE 
AK121839TAAGCCCATCCGGCCCAAATHypothetical protein. 
J023022K06TAAGCCCATCCGGCCCAAATNONE 
J023110K21TAAGCCCATCCGGCCCAAATNONE 
J033100N18TAAGCCCATCCGGCCCAAATNONE 
J033120D11TAAGCCCATCCGGCCCAAATNONE 
J065044P15TAAGCCCATCCGGCCCAAATNONE 
J065102G22TAAGCCCATCCGGCCCAAATNONE 
J065149N14TAAGCCCATCCGGCCCAAATNONE 
J065201L18TAAGCCCATCCGGCCCAAATNONE 
J065205K10TAAGCCCATCCGGCCCAAATNONE 
J075035D19TAAGCCCATCCGGCCCAAATNONE 
J075073E06TAAGCCCATCCGGCCCAAATNONE 
J075134M11TAAGCCCATCCGGCCCAAATNONE 
J090004P12TAAGCCCATCCGGCCCAAATNONE 
J090070H20TAAGCCCATCCGGCCCAAATNONE 
J090087B04TAAGCCCATCCGGCCCAAATNONE 
J100028F10TAAGCCCATCCGGCCCAAATNONE 
J100036M18TAAGCCCATCCGGCCCAAATNONE 
J100065C24TAAGCCCATCCGGCCCAAATNONE 
J100080O13TAAGCCCATCCGGCCCAAATNONE 
Os03g0606200009-030-E09CCCGGCCCATGTNONE 
009-076-H10CCCGGCCCATGTNONE 
009-122-H12CCCGGCCCATGTNONE 
009-153-F09CCCGGCCCATGTNONE 
AB055076CCCGGCCCATGTMitochondrial ATP synthase 6 KD subunit. 
AK072384CCCGGCCCATGTNONE 
AK107928CCCGGCCCATGTNONE 
J023078E13CCCGGCCCATGTNONE 
J053031N01CCCGGCCCATGTNONE 
J053046K19CCCGGCCCATGTNONE 
J053062P07CCCGGCCCATGTNONE 
J053091C23CCCGGCCCATGTNONE 
J053099N19CCCGGCCCATGTNONE 
J065005E06CCCGGCCCATGTNONE 
J065030N03CCCGGCCCATGTNONE 
J065138O21CCCGGCCCATGTNONE 
J065159K03CCCGGCCCATGTNONE 
J075030M08CCCGGCCCATGTNONE 
J080006E23CCCGGCCCATGTNONE 
J080010D10CCCGGCCCATGTNONE 
J080016N17CCCGGCCCATGTNONE 
J080024N09CCCGGCCCATGTNONE 
J080028E23CCCGGCCCATGTNONE 
J080035I11CCCGGCCCATGTNONE 
J080038D15CCCGGCCCATGTNONE 
J080040H08CCCGGCCCATGTNONE 
J080043L04CCCGGCCCATGTNONE 
J080047C06CCCGGCCCATGTNONE 
J080061G04CCCGGCCCATGTNONE 
J080066E10CCCGGCCCATGTNONE 
J080067P03CCCGGCCCATGTNONE 
J080082D07CCCGGCCCATGTNONE 
J080089M13CCCGGCCCATGTNONE 
J080094O09CCCGGCCCATGTNONE 
J080095C24CCCGGCCCATGTNONE 
J080309E21CCCGGCCCATGTNONE 
J090016G15CCCGGCCCATGTNONE 
J090031C20CCCGGCCCATGTNONE 
J090033A15CCCGGCCCATGTNONE 
J090037L07CCCGGCCCATGTNONE 
J090038I10CCCGGCCCATGTNONE 
J090072P19CCCGGCCCATGTNONE 
J100040J02CCCGGCCCATGTNONE 
J100047N05CCCGGCCCATGTNONE 
J100048M10CCCGGCCCATGTNONE 
J100076C02CCCGGCCCATGTNONE 
J100077G23CCCGGCCCATGTNONE 
J100080O08CCCGGCCCATGTNONE 
J100085C06CCCGGCCCATGTNONE 
J100085F16CCCGGCCCATGTNONE 
Os03g0634000014-034-A03GTATGGGCCGGGACCCANONE 
AK063673GTATGGGCCGGGACCCASimilar to THA4. 
Os03g0647800003-103-H03ACCGGCCCACCAACNONE 
006-104-G09ACCGGCCCACCAACNONE 
AK070243ACCGGCCCACCAACConserved hypothetical protein. 
J100056F22ACCGGCCCACCAACNONE 
Os03g0656900AK066416ATATGGGCCGGTNusB/RsmB/TIM44 domain containing protein. 
J065157L23ATATGGGCCGGTNONE 
J065166P22ATATGGGCCGGTNONE 
Os03g0681900006-042-F08GGGCCGGCCCACGANONE 
009-043-F12GGGCCGGCCCACGANONE 
AK061750GGGCCGGCCCACGANONE 
AK062094GGGCCGGCCCACGASimilar to RGP-3 (Fragment). 
J033034F01GGGCCGGCCCACGANONE 
J033131F11GGGCCGGCCCACGANONE 
J033143N03GGGCCGGCCCACGANONE 
Os03g0685600AK111863CCTGGGCCGGGWD40-like domain containing protein. 
Os03g0685900009-026-A09TATTGGGCCGGTNONE 
009-145-C09TATTGGGCCGGTNONE 
AK062981TATTGGGCCGGTConserved hypothetical protein. 
J065001D12TATTGGGCCGGTNONE 
J065023B10TATTGGGCCGGTNONE 
J065041E10TATTGGGCCGGTNONE 
J065046C01TATTGGGCCGGTNONE 
J065146I22TATTGGGCCGGTNONE 
J065184F20TATTGGGCCGGTNONE 
J075011E15TATTGGGCCGGTNONE 
J075048H17TATTGGGCCGGTNONE 
J075070H15TATTGGGCCGGTNONE 
J075133C01TATTGGGCCGGTNONE 
J075170D02TATTGGGCCGGTNONE 
J090001G08TATTGGGCCGGTNONE 
J090026B09TATTGGGCCGGTNONE 
J100055M03TATTGGGCCGGTNONE 
Os03g0695600006-103-C09ACCGGCCCACTNONE 
014-029-B11ACCGGCCCACTNONE 
AB026566ACCGGCCCACTNONE 
AK061228ACCGGCCCACTProteasome subunit beta type 2 (EC 3.4.25.1) (20S proteasome alpha subunit D) (20S proteasome subunit beta-4). 
AK099128ACCGGCCCACTNONE 
J023041C17ACCGGCCCACTNONE 
J043030L19ACCGGCCCACTNONE 
J065002E17ACCGGCCCACTNONE 
J065042H23ACCGGCCCACTNONE 
J065110P10ACCGGCCCACTNONE 
J065112D10ACCGGCCCACTNONE 
J065114B21ACCGGCCCACTNONE 
J065124B02ACCGGCCCACTNONE 
J065138P08ACCGGCCCACTNONE 
J065182O20ACCGGCCCACTNONE 
J065216N05ACCGGCCCACTNONE 
J075060D19ACCGGCCCACTNONE 
J075097M03ACCGGCCCACTNONE 
J075098I11ACCGGCCCACTNONE 
J075142I15ACCGGCCCACTNONE 
J090018B21ACCGGCCCACTNONE 
J090034E12ACCGGCCCACTNONE 
J090042N01ACCGGCCCACTNONE 
Os03g0701900AK068404CCCGGCCCATTConserved hypothetical protein. 
Os03g0709000009-027-F11CTTGGGCCGGANONE 
009-147-F02CTTGGGCCGGANONE 
015-068-A04CTTGGGCCGGANONE 
AK062406CTTGGGCCGGAMembrane-associated proteins in eicosanoid and glutathione metabolism (MAPEG) family protein. 
Os03g0725000AK059294CCTGGGCCGGGNONE 
J043026H11CCTGGGCCGGGNONE 
J065187O06CCTGGGCCGGGNONE 
J090066M23CCTGGGCCGGGNONE 
Os03g0734700AK072060GCTGGGCCGGCMitochondrial substrate carrier family protein. 
AK120533GCTGGGCCGGCNONE 
J043026E20GCTGGGCCGGCNONE 
Os03g0737600014-094-E01TACTGGGCCGGGCCGANONE 
AB038234TACTGGGCCGGGCCGANONE 
AK101854TACTGGGCCGGGCCGACyclin H-1. 
AK105468TACTGGGCCGGGCCGANONE 
J033069N12TACTGGGCCGGGCCGANONE 
J043017A22TACTGGGCCGGGCCGANONE 
J065154A20TACTGGGCCGGGCCGANONE 
Os03g0740700011-093-H12GGCCCGGCCCATCCNONE 
AK102723GGCCCGGCCCATCCProtein similar to CwfJ, C-terminal 1 domain containing protein. 
J013059N19GGCCCGGCCCATCCNONE 
J013126N16GGCCCGGCCCATCCNONE 
J033105J16GGCCCGGCCCATCCNONE 
J090059D19GGCCCGGCCCATCCNONE 
Os03g0744700AK071178CGATGGGCCGGCConserved hypothetical protein. 
AK071178TCCGGCCCATTTConserved hypothetical protein. 
J075006D24CGATGGGCCGGCNONE 
J075006D24TCCGGCCCATTTNONE 
J075165F21CGATGGGCCGGCNONE 
J075165F21TCCGGCCCATTTNONE 
Os03g0746800AK101718TCATGGGCCGGGCWD-40 repeat containing protein. 
Os03g0754800AK101584ACATGGGCCGGAMitochondrial substrate carrier family protein. 
J080305A09ACATGGGCCGGANONE 
J080310E24ACATGGGCCGGANONE 
J080310O12ACATGGGCCGGANONE 
J080311N04ACATGGGCCGGANONE 
J080313N20ACATGGGCCGGANONE 
J080317H24ACATGGGCCGGANONE 
Os03g0756800009-100-H11CCGTGGGCCGGTGGGCCCGNONE 
AK120423CCGTGGGCCGGTGGGCCCGProtein of unknown function UPF0139 family protein. 
J013095D02CCGTGGGCCGGTGGGCCCGNONE 
J023091G12CCGTGGGCCGGTGGGCCCGNONE 
J065207J17CCGTGGGCCGGTGGGCCCGNONE 
J100067G13CCGTGGGCCGGTGGGCCCGNONE 
J100089L11CCGTGGGCCGGTGGGCCCGNONE 
Os03g0758800AJ252135CGGGCCGAGCCGAATGGGCCGGCNONE 
AJ312906CGGGCCGAGCCGAATGGGCCGGCNONE 
AK060387CGGGCCGAGCCGAATGGGCCGGCSimilar to Eukaryotic translation initiation factor 5A-2 (eIF-5A-2) (eIF-4D). 
AK121592CGGGCCGAGCCGAATGGGCCGGCNONE 
J023109G09CGGGCCGAGCCGAATGGGCCGGCNONE 
J033038B14CGGGCCGAGCCGAATGGGCCGGCNONE 
J043013C09CGGGCCGAGCCGAATGGGCCGGCNONE 
J053096E21CGGGCCGAGCCGAATGGGCCGGCNONE 
J065026B08CGGGCCGAGCCGAATGGGCCGGCNONE 
J065062B16CGGGCCGAGCCGAATGGGCCGGCNONE 
J065066E03CGGGCCGAGCCGAATGGGCCGGCNONE 
J065091J12CGGGCCGAGCCGAATGGGCCGGCNONE 
J065164A06CGGGCCGAGCCGAATGGGCCGGCNONE 
J075014I20CGGGCCGAGCCGAATGGGCCGGCNONE 
J075117N07CGGGCCGAGCCGAATGGGCCGGCNONE 
J075142M03CGGGCCGAGCCGAATGGGCCGGCNONE 
J075175D04CGGGCCGAGCCGAATGGGCCGGCNONE 
J075188M01CGGGCCGAGCCGAATGGGCCGGCNONE 
J075199I20CGGGCCGAGCCGAATGGGCCGGCNONE 
J090010J12CGGGCCGAGCCGAATGGGCCGGCNONE 
J090025O16CGGGCCGAGCCGAATGGGCCGGCNONE 
J090041H05CGGGCCGAGCCGAATGGGCCGGCNONE 
J090078P07CGGGCCGAGCCGAATGGGCCGGCNONE 
J100031K10CGGGCCGAGCCGAATGGGCCGGCNONE 
J100055F23CGGGCCGAGCCGAATGGGCCGGCNONE 
J100064G05CGGGCCGAGCCGAATGGGCCGGCNONE 
J100080C24CGGGCCGAGCCGAATGGGCCGGCNONE 
J100080O07CGGGCCGAGCCGAATGGGCCGGCNONE 
J100090F01CGGGCCGAGCCGAATGGGCCGGCNONE 
Os03g0761200011-038-H02AAATGGGCCGGAAAATGGGCCNONE 
015-055-D12AAATGGGCCGGAAAATGGGCCNONE 
016-032-B01AAATGGGCCGGAAAATGGGCCNONE 
AK064205AAATGGGCCGGAAAATGGGCCNONE 
AK101534AAATGGGCCGGAAAATGGGCCAnkyrin repeat containing protein. 
J075033L23AAATGGGCCGGAAAATGGGCCNONE 
J075046K09AAATGGGCCGGAAAATGGGCCNONE 
J075134K18AAATGGGCCGGAAAATGGGCCNONE 
J075157I10AAATGGGCCGGAAAATGGGCCNONE 
Os03g0766000AK070596AGTTGGGCCGGGNONE 
AK104743AGTTGGGCCGGGNONE 
AK106079AGTTGGGCCGGGNONE 
J013063M09AGTTGGGCCGGGNONE 
J023056A03AGTTGGGCCGGGNONE 
J043038L07AGTTGGGCCGGGNONE 
J053067N16AGTTGGGCCGGGNONE 
J053073G09AGTTGGGCCGGGNONE 
J053075I19AGTTGGGCCGGGNONE 
Os03g0766900AK066137TCCGGCCCATTTAllene oxide synthase. 
AK071361TCCGGCCCATTTNONE 
AK103989TCCGGCCCATTTNONE 
J023090K09TCCGGCCCATTTNONE 
J043022H11TCCGGCCCATTTNONE 
J053078F12TCCGGCCCATTTNONE 
Os03g0769600AK100054ACCGGCCCATCTResB-like family protein. 
AK100054TCCGGCCCAGTTResB-like family protein. 
Os03g0776900AK107941CCCGGCCCAATTSimilar to DNAJ protein-like. 
J053100E14CCCGGCCCAATTNONE 
J075111A12CCCGGCCCAATTNONE 
Os03g0784000AK067337GCTGGGCCGGANONE 
AK100003GCTGGGCCGGAFAD dependent oxidoreductase family protein. 
J013102O14GCTGGGCCGGANONE 
J013135F18GCTGGGCCGGANONE 
Os03g0784900006-053-H11TCCGGCCCACTNONE 
009-165-F11TCCGGCCCACTNONE 
AK060949TCCGGCCCACTConserved hypothetical protein. 
AK099097TCCGGCCCACTNONE 
J023019M19TCCGGCCCACTNONE 
J065024O11TCCGGCCCACTNONE 
J065106D20TCCGGCCCACTNONE 
J065201L15TCCGGCCCACTNONE 
J075031B04TCCGGCCCACTNONE 
J075033C19TCCGGCCCACTNONE 
J075035F11TCCGGCCCACTNONE 
J075074K14TCCGGCCCACTNONE 
J075083A22TCCGGCCCACTNONE 
J075120O10TCCGGCCCACTNONE 
J075153L20TCCGGCCCACTNONE 
J075159G02TCCGGCCCACTNONE 
J080001J18TCCGGCCCACTNONE 
J080015I03TCCGGCCCACTNONE 
J080027E23TCCGGCCCACTNONE 
J080046D24TCCGGCCCACTNONE 
J080053B17TCCGGCCCACTNONE 
J080070P07TCCGGCCCACTNONE 
J080076D18TCCGGCCCACTNONE 
J080078E13TCCGGCCCACTNONE 
J080090H03TCCGGCCCACTNONE 
J100024F19TCCGGCCCACTNONE 
J100052D15TCCGGCCCACTNONE 
J100079B14TCCGGCCCACTNONE 
Os03g0785500AK067718AGATGGGCCGGGCProtein of unknown function DUF284, transmembrane eukaryotic family protein. 
Os03g0795800AK102207TCCGGCCCATATProtein of unknown function UPF0005 family protein. 
J023014M02TCCGGCCCATATNONE 
J023026E12TCCGGCCCATATNONE 
J023036I07TCCGGCCCATATNONE 
J023079M08TCCGGCCCATATNONE 
J023129D24TCCGGCCCATATNONE 
J033087H03TCCGGCCCATATNONE 
J033115G02TCCGGCCCATATNONE 
J033122G06TCCGGCCCATATNONE 
J033150J15TCCGGCCCATATNONE 
J065064L16TCCGGCCCATATNONE 
J065065H20TCCGGCCCATATNONE 
J065096I18TCCGGCCCATATNONE 
J065114A10TCCGGCCCATATNONE 
J065164G10TCCGGCCCATATNONE 
J065178L20TCCGGCCCATATNONE 
J075071D20TCCGGCCCATATNONE 
Os03g0795900012-092-G05ATATGGGCCGGANONE 
015-043-D09ATATGGGCCGGANONE 
016-078-G11ATATGGGCCGGANONE 
AK068660ATATGGGCCGGASimilar to Heat shock transcription factor 31 (Fragment). 
J013162K14ATATGGGCCGGANONE 
J023001L04ATATGGGCCGGANONE 
J053032K11ATATGGGCCGGANONE 
J065059E10ATATGGGCCGGANONE 
J065095H19ATATGGGCCGGANONE 
J065181M06ATATGGGCCGGANONE 
J100047D11ATATGGGCCGGANONE 
J100068G04ATATGGGCCGGANONE 
Os03g0797000AK073440TCCGGCCCATATSimilar to Indole synthase. 
AK073440TCCGGCCCATATSimilar to Indole synthase. 
Os03g0803800012-043-D10TCCGGCCCAATTNONE 
AK063484TCCGGCCCAATTConserved hypothetical protein. 
Os03g0807200011-031-F07CCCGGCCCAGCNONE 
011-031-F07GTTTGGGCCGGGCCGTCNONE 
AK063932CCCGGCCCAGCNONE 
AK063932GTTTGGGCCGGGCCGTCNONE 
AK103496CCCGGCCCAGCProtein of unknown function DUF1639 family protein. 
AK103496GTTTGGGCCGGGCCGTCProtein of unknown function DUF1639 family protein. 
J033131A04CCCGGCCCAGCNONE 
J033131A04GTTTGGGCCGGGCCGTCNONE 
J065109O03CCCGGCCCAGCNONE 
J065109O03GTTTGGGCCGGGCCGTCNONE 
J080001M11CCCGGCCCAGCNONE 
J080001M11GTTTGGGCCGGGCCGTCNONE 
J080002H18CCCGGCCCAGCNONE 
J080002H18GTTTGGGCCGGGCCGTCNONE 
J080005I08CCCGGCCCAGCNONE 
J080005I08GTTTGGGCCGGGCCGTCNONE 
J080006B05CCCGGCCCAGCNONE 
J080006B05GTTTGGGCCGGGCCGTCNONE 
J080006D17CCCGGCCCAGCNONE 
J080006D17GTTTGGGCCGGGCCGTCNONE 
J080007M19CCCGGCCCAGCNONE 
J080007M19GTTTGGGCCGGGCCGTCNONE 
J080011E07CCCGGCCCAGCNONE 
J080011E07GTTTGGGCCGGGCCGTCNONE 
J080012H06CCCGGCCCAGCNONE 
J080012H06GTTTGGGCCGGGCCGTCNONE 
J080014D08CCCGGCCCAGCNONE 
J080014D08GTTTGGGCCGGGCCGTCNONE 
J080017D06CCCGGCCCAGCNONE 
J080017D06GTTTGGGCCGGGCCGTCNONE 
J080017K17CCCGGCCCAGCNONE 
J080017K17GTTTGGGCCGGGCCGTCNONE 
J080020B17CCCGGCCCAGCNONE 
J080020B17GTTTGGGCCGGGCCGTCNONE 
J080021O05CCCGGCCCAGCNONE 
J080021O05GTTTGGGCCGGGCCGTCNONE 
J080021O15CCCGGCCCAGCNONE 
J080021O15GTTTGGGCCGGGCCGTCNONE 
J080023I18CCCGGCCCAGCNONE 
J080023I18GTTTGGGCCGGGCCGTCNONE 
J080025A21CCCGGCCCAGCNONE 
J080025A21GTTTGGGCCGGGCCGTCNONE 
J080027P22CCCGGCCCAGCNONE 
J080027P22GTTTGGGCCGGGCCGTCNONE 
J080028M22CCCGGCCCAGCNONE 
J080028M22GTTTGGGCCGGGCCGTCNONE 
J080029B09CCCGGCCCAGCNONE 
J080029B09GTTTGGGCCGGGCCGTCNONE 
J080029M07CCCGGCCCAGCNONE 
J080029M07GTTTGGGCCGGGCCGTCNONE 
J080029M17CCCGGCCCAGCNONE 
J080029M17GTTTGGGCCGGGCCGTCNONE 
J080030H23CCCGGCCCAGCNONE 
J080030H23GTTTGGGCCGGGCCGTCNONE 
J080030K16CCCGGCCCAGCNONE 
J080030K16GTTTGGGCCGGGCCGTCNONE 
J080030L19CCCGGCCCAGCNONE 
J080030L19GTTTGGGCCGGGCCGTCNONE 
J080031A12CCCGGCCCAGCNONE 
J080031A12GTTTGGGCCGGGCCGTCNONE 
J080031N21CCCGGCCCAGCNONE 
J080031N21GTTTGGGCCGGGCCGTCNONE 
J080032G05CCCGGCCCAGCNONE 
J080032G05GTTTGGGCCGGGCCGTCNONE 
J080032P20CCCGGCCCAGCNONE 
J080032P20GTTTGGGCCGGGCCGTCNONE 
J080033H20CCCGGCCCAGCNONE 
J080033H20GTTTGGGCCGGGCCGTCNONE 
J080034H22CCCGGCCCAGCNONE 
J080034H22GTTTGGGCCGGGCCGTCNONE 
J080034J03CCCGGCCCAGCNONE 
J080034J03GTTTGGGCCGGGCCGTCNONE 
J080034J16CCCGGCCCAGCNONE 
J080034J16GTTTGGGCCGGGCCGTCNONE 
J080034N01CCCGGCCCAGCNONE 
J080034N01GTTTGGGCCGGGCCGTCNONE 
J080035K20CCCGGCCCAGCNONE 
J080035K20GTTTGGGCCGGGCCGTCNONE 
J080036I04CCCGGCCCAGCNONE 
J080036I04GTTTGGGCCGGGCCGTCNONE 
J080036I19CCCGGCCCAGCNONE 
J080036I19GTTTGGGCCGGGCCGTCNONE 
J080036O21CCCGGCCCAGCNONE 
J080036O21GTTTGGGCCGGGCCGTCNONE 
J080038D06CCCGGCCCAGCNONE 
J080038D06GTTTGGGCCGGGCCGTCNONE 
J080039J15CCCGGCCCAGCNONE 
J080039J15GTTTGGGCCGGGCCGTCNONE 
J080039P18CCCGGCCCAGCNONE 
J080039P18GTTTGGGCCGGGCCGTCNONE 
J080041H20CCCGGCCCAGCNONE 
J080041H20GTTTGGGCCGGGCCGTCNONE 
J080041M11CCCGGCCCAGCNONE 
J080041M11GTTTGGGCCGGGCCGTCNONE 
J080042F14CCCGGCCCAGCNONE 
J080042F14GTTTGGGCCGGGCCGTCNONE 
J080043G10CCCGGCCCAGCNONE 
J080043G10GTTTGGGCCGGGCCGTCNONE 
J080043J02CCCGGCCCAGCNONE 
J080043J02GTTTGGGCCGGGCCGTCNONE 
J080044C19CCCGGCCCAGCNONE 
J080044C19GTTTGGGCCGGGCCGTCNONE 
J080044G11CCCGGCCCAGCNONE 
J080044G11GTTTGGGCCGGGCCGTCNONE 
J080045M03CCCGGCCCAGCNONE 
J080045M03GTTTGGGCCGGGCCGTCNONE 
J080045N07CCCGGCCCAGCNONE 
J080045N07GTTTGGGCCGGGCCGTCNONE 
J080047K14CCCGGCCCAGCNONE 
J080047K14GTTTGGGCCGGGCCGTCNONE 
J080049I21CCCGGCCCAGCNONE 
J080049I21GTTTGGGCCGGGCCGTCNONE 
J080050A06CCCGGCCCAGCNONE 
J080050A06GTTTGGGCCGGGCCGTCNONE 
J080050I16CCCGGCCCAGCNONE 
J080050I16GTTTGGGCCGGGCCGTCNONE 
J080050N16CCCGGCCCAGCNONE 
J080050N16GTTTGGGCCGGGCCGTCNONE 
J080052C23CCCGGCCCAGCNONE 
J080052C23GTTTGGGCCGGGCCGTCNONE 
J080052D18CCCGGCCCAGCNONE 
J080052D18GTTTGGGCCGGGCCGTCNONE 
J080052F20CCCGGCCCAGCNONE 
J080052F20GTTTGGGCCGGGCCGTCNONE 
J080052F23CCCGGCCCAGCNONE 
J080052F23GTTTGGGCCGGGCCGTCNONE 
J080053M03CCCGGCCCAGCNONE 
J080053M03GTTTGGGCCGGGCCGTCNONE 
J080054G13CCCGGCCCAGCNONE 
J080054G13GTTTGGGCCGGGCCGTCNONE 
J080054H12CCCGGCCCAGCNONE 
J080054H12GTTTGGGCCGGGCCGTCNONE 
J080055N03CCCGGCCCAGCNONE 
J080055N03GTTTGGGCCGGGCCGTCNONE 
J080056E07CCCGGCCCAGCNONE 
J080056E07GTTTGGGCCGGGCCGTCNONE 
J080057L04CCCGGCCCAGCNONE 
J080057L04GTTTGGGCCGGGCCGTCNONE 
J080063O19CCCGGCCCAGCNONE 
J080063O19GTTTGGGCCGGGCCGTCNONE 
J080064E21CCCGGCCCAGCNONE 
J080064E21GTTTGGGCCGGGCCGTCNONE 
J080065D18CCCGGCCCAGCNONE 
J080065D18GTTTGGGCCGGGCCGTCNONE 
J080065F18CCCGGCCCAGCNONE 
J080065F18GTTTGGGCCGGGCCGTCNONE 
J080065H14CCCGGCCCAGCNONE 
J080065H14GTTTGGGCCGGGCCGTCNONE 
J080065K15CCCGGCCCAGCNONE 
J080065K15GTTTGGGCCGGGCCGTCNONE 
J080065M24CCCGGCCCAGCNONE 
J080065M24GTTTGGGCCGGGCCGTCNONE 
J080066B18CCCGGCCCAGCNONE 
J080066B18GTTTGGGCCGGGCCGTCNONE 
J080066B19CCCGGCCCAGCNONE 
J080066B19GTTTGGGCCGGGCCGTCNONE 
J080071H19CCCGGCCCAGCNONE 
J080071H19GTTTGGGCCGGGCCGTCNONE 
J080072E18CCCGGCCCAGCNONE 
J080072E18GTTTGGGCCGGGCCGTCNONE 
J080074K21CCCGGCCCAGCNONE 
J080074K21GTTTGGGCCGGGCCGTCNONE 
J080075B06CCCGGCCCAGCNONE 
J080075B06GTTTGGGCCGGGCCGTCNONE 
J080076H07CCCGGCCCAGCNONE 
J080076H07GTTTGGGCCGGGCCGTCNONE 
J080079D16CCCGGCCCAGCNONE 
J080079D16GTTTGGGCCGGGCCGTCNONE 
J080082B20CCCGGCCCAGCNONE 
J080082B20GTTTGGGCCGGGCCGTCNONE 
J080084N16CCCGGCCCAGCNONE 
J080084N16GTTTGGGCCGGGCCGTCNONE 
J080085L07CCCGGCCCAGCNONE 
J080085L07GTTTGGGCCGGGCCGTCNONE 
J080086L04CCCGGCCCAGCNONE 
J080086L04GTTTGGGCCGGGCCGTCNONE 
J080086M07CCCGGCCCAGCNONE 
J080086M07GTTTGGGCCGGGCCGTCNONE 
J080087D02CCCGGCCCAGCNONE 
J080087D02GTTTGGGCCGGGCCGTCNONE 
J080087D15CCCGGCCCAGCNONE 
J080087D15GTTTGGGCCGGGCCGTCNONE 
J080087J19CCCGGCCCAGCNONE 
J080087J19GTTTGGGCCGGGCCGTCNONE 
J080088G20CCCGGCCCAGCNONE 
J080088G20GTTTGGGCCGGGCCGTCNONE 
J080092M15CCCGGCCCAGCNONE 
J080092M15GTTTGGGCCGGGCCGTCNONE 
J080093O10CCCGGCCCAGCNONE 
J080093O10GTTTGGGCCGGGCCGTCNONE 
J080095L09CCCGGCCCAGCNONE 
J080095L09GTTTGGGCCGGGCCGTCNONE 
J080096A18CCCGGCCCAGCNONE 
J080096A18GTTTGGGCCGGGCCGTCNONE 
J080097C03CCCGGCCCAGCNONE 
J080097C03GTTTGGGCCGGGCCGTCNONE 
J090019J07CCCGGCCCAGCNONE 
J090019J07GTTTGGGCCGGGCCGTCNONE 
J090024N12CCCGGCCCAGCNONE 
J090024N12GTTTGGGCCGGGCCGTCNONE 
J090049I09CCCGGCCCAGCNONE 
J090049I09GTTTGGGCCGGGCCGTCNONE 
Os03g0819900006-058-B05TAATGGGCCTGAATGGGCCGGGCCNONE 
AK111912TAATGGGCCTGAATGGGCCGGGCCNONE 
AK112029TAATGGGCCTGAATGGGCCGGGCCSimilar to RAB8C. 
AY576526TAATGGGCCTGAATGGGCCGGGCCNONE 
AY579410TAATGGGCCTGAATGGGCCGGGCCNONE 
J075041G24TAATGGGCCTGAATGGGCCGGGCCNONE 
J100070N08TAATGGGCCTGAATGGGCCGGGCCNONE 
Os03g0820400009-042-F06GCCGGCCCAAGNONE 
009-046-E08GCCGGCCCAAGNONE 
009-079-B08GCCGGCCCAAGNONE 
009-111-H09GCCGGCCCAAGNONE 
009-150-D10GCCGGCCCAAGNONE 
015-073-H11GCCGGCCCAAGNONE 
AK119690GCCGGCCCAAGSimilar to ZPT2-13. 
AY286473GCCGGCCCAAGNONE 
AY305864GCCGGCCCAAGNONE 
J100051O21GCCGGCCCAAGNONE 
Os03g0822100AK101094GGGCCGGCCCATATSimilar to Transposase (Fragment). 
J033024N05GGGCCGGCCCATATNONE 
Os03g0822200AK069405GCTGGGCCGGANAD-dependent epimerase/dehydratase family protein. 
AK104151GCTGGGCCGGANONE 
AK104209GCTGGGCCGGANONE 
J065107D01GCTGGGCCGGANONE 
J065191L23GCTGGGCCGGANONE 
J065217B05GCTGGGCCGGANONE 
Os03g0822300AK060050TCCGGCCCAGCRibosomal RNA methyltransferase RrmJ/FtsJ domain containing protein. 
J065198I20TCCGGCCCAGCNONE 
Os03g0822900AK099787GGCTGGGCCGGTZinc finger, BED-type predicted domain containing protein. 
J013042C24GGCTGGGCCGGTNONE 
J013096O21GGCTGGGCCGGTNONE 
J023109I23GGCTGGGCCGGTNONE 
J033106N09GGCTGGGCCGGTNONE 
J033107H03GGCTGGGCCGGTNONE 
J033118G03GGCTGGGCCGGTNONE 
J033145I24GGCTGGGCCGGTNONE 
J065138D15GGCTGGGCCGGTNONE 
J065140L13GGCTGGGCCGGTNONE 
J065179M13GGCTGGGCCGGTNONE 
J065200F05GGCTGGGCCGGTNONE 
J075104F20GGCTGGGCCGGTNONE 
J075143A15GGCTGGGCCGGTNONE 
J075197J11GGCTGGGCCGGTNONE 
Os03g0835400AK061773TCCGGCCCATTTSimilar to Uvs101. 
AK098986TCCGGCCCATTTNONE 
AK105896TCCGGCCCATTTNONE 
Os03g0843400009-195-F11CCCGGCCCAACANONE 
AK061198CCCGGCCCAACASimilar to 30S ribosomal protein S6, chloroplast precursor (Fragment). 
AK099076CCCGGCCCAACANONE 
Os03g0846400AK067706GCAGCCCATGGGCCGGATCGGCCCGGCNONE 
AK067706GCTGGGCCGTGTCTGGGCCGGGCCGTGNONE 
AK070549GCAGCCCATGGGCCGGATCGGCCCGGCPeptidase, trypsin-like serine and cysteine domain containing protein. 
AK070549GCTGGGCCGTGTCTGGGCCGGGCCGTGPeptidase, trypsin-like serine and cysteine domain containing protein. 
Os03g0846900016-055-F06CCCGGCCCATCCNONE 
AK059297CCCGGCCCATCCConserved hypothetical protein. 
J090028J16CCCGGCCCATCCNONE 
Os03g0848300AK059137TCTGGGCCGGCNONE 
J065110J17TCTGGGCCGGCNONE 
Os03g0850600AK067191AGTTGGGCCGGGACGGCCACGTGGCGConserved hypothetical protein. 
AK067191TATTGGGCCGGAConserved hypothetical protein. 
J013095N12AGTTGGGCCGGGACGGCCACGTGGCGNONE 
J013095N12TATTGGGCCGGANONE 
J065214L06AGTTGGGCCGGGACGGCCACGTGGCGNONE 
J065214L06TATTGGGCCGGANONE 
J075093J10AGTTGGGCCGGGACGGCCACGTGGCGNONE 
J075093J10TATTGGGCCGGANONE 
Os03g0851000006-098-C01TTGTGGGCCGGGCCCAAACNONE 
006-098-C01TTTGGGCCGGCNONE 
AK060496TTGTGGGCCGGGCCCAAACSimilar to Transcription factor homolog BTF3-like protein. 
AK060496TTTGGGCCGGCSimilar to Transcription factor homolog BTF3-like protein. 
AK102202TTGTGGGCCGGGCCCAAACNONE 
AK102202TTTGGGCCGGCNONE 
AK104157TTGTGGGCCGGGCCCAAACNONE 
AK104157TTTGGGCCGGCNONE 
J033087F19TTGTGGGCCGGGCCCAAACNONE 
J033087F19TTTGGGCCGGCNONE 
J065087I16TTGTGGGCCGGGCCCAAACNONE 
J065087I16TTTGGGCCGGCNONE 
J065113G04TTGTGGGCCGGGCCCAAACNONE 
J065113G04TTTGGGCCGGCNONE 
J090026M02TTGTGGGCCGGGCCCAAACNONE 
J090026M02TTTGGGCCGGCNONE 
J090027I04TTGTGGGCCGGGCCCAAACNONE 
J090027I04TTTGGGCCGGCNONE 
J100073E19TTGTGGGCCGGGCCCAAACNONE 
J100073E19TTTGGGCCGGCNONE 
Os03g0854800J090007D13GCCGGCCCACGGGNONE 
J090085N22GCCGGCCCACGGGNONE 
Os03g0860600AK071828CCCGGCCCATTTSimilar to 2-oxoglutarate-dependent oxygenase. 
J023118E08CCCGGCCCATTTNONE 
J100032J11CCCGGCCCATTTNONE 
Os03g0861700AK066129CAAGTGGGCCGGCCCACCTRhodanese-like domain containing protein. 
J013051M12CAAGTGGGCCGGCCCACCTNONE 
J013104N13CAAGTGGGCCGGCCCACCTNONE 
J065052E12CAAGTGGGCCGGCCCACCTNONE 
Os03g0861800AF358762AGGTGGGCCGGCCCACTTGNONE 
AK068434AGGTGGGCCGGCCCACTTGCyclin-like F-box domain containing protein. 
AK109388AGGTGGGCCGGCCCACTTGNONE 
J013154L15AGGTGGGCCGGCCCACTTGNONE 
J013170I23AGGTGGGCCGGCCCACTTGNONE 
J023031D05AGGTGGGCCGGCCCACTTGNONE 
J023082E07AGGTGGGCCGGCCCACTTGNONE 
J023095M10AGGTGGGCCGGCCCACTTGNONE 
J023127D14AGGTGGGCCGGCCCACTTGNONE 
J023138M15AGGTGGGCCGGCCCACTTGNONE 
J023138M16AGGTGGGCCGGCCCACTTGNONE 
J033060B18AGGTGGGCCGGCCCACTTGNONE 
J033060F13AGGTGGGCCGGCCCACTTGNONE 
J033096J11AGGTGGGCCGGCCCACTTGNONE 
J033122C07AGGTGGGCCGGCCCACTTGNONE 
J053029A10AGGTGGGCCGGCCCACTTGNONE 
J053062O16AGGTGGGCCGGCCCACTTGNONE 
J053064J08AGGTGGGCCGGCCCACTTGNONE 
J053086F22AGGTGGGCCGGCCCACTTGNONE 
J065036C04AGGTGGGCCGGCCCACTTGNONE 
J065072J23AGGTGGGCCGGCCCACTTGNONE 
J065120D04AGGTGGGCCGGCCCACTTGNONE 
J065161D04AGGTGGGCCGGCCCACTTGNONE 
J065172H02AGGTGGGCCGGCCCACTTGNONE 
J065207B01AGGTGGGCCGGCCCACTTGNONE 
J075019H18AGGTGGGCCGGCCCACTTGNONE 
J075082E16AGGTGGGCCGGCCCACTTGNONE 
J075089A10AGGTGGGCCGGCCCACTTGNONE 
J075099G02AGGTGGGCCGGCCCACTTGNONE 
J075134M04AGGTGGGCCGGCCCACTTGNONE 
J075144K19AGGTGGGCCGGCCCACTTGNONE 
J075147F17AGGTGGGCCGGCCCACTTGNONE 
J090004O14AGGTGGGCCGGCCCACTTGNONE 
J090013A07AGGTGGGCCGGCCCACTTGNONE 
J090047K14AGGTGGGCCGGCCCACTTGNONE 
Os04g0105700004-005-E05AATGGGCCGGCNONE 
006-037-C11AATGGGCCGGCNONE 
006-039-E07AATGGGCCGGCNONE 
006-049-A02AATGGGCCGGCNONE 
006-076-D05AATGGGCCGGCNONE 
006-089-E04AATGGGCCGGCNONE 
006-097-F12AATGGGCCGGCNONE 
AK060872AATGGGCCGGCNONE 
AK065082AATGGGCCGGCNONE 
AK104254AATGGGCCGGCConserved hypothetical protein. 
AK104546AATGGGCCGGCNONE 
AK104634AATGGGCCGGCNONE 
AY224557AATGGGCCGGCNONE 
J013001L09AATGGGCCGGCNONE 
J013151B18AATGGGCCGGCNONE 
J023054G18AATGGGCCGGCNONE 
Os04g0117100009-025-D02CCCGGCCCAACANONE 
009-025-D02GGGACCCACCCCACCCGGCCCAAGNONE 
009-056-D03CCCGGCCCAACANONE 
009-056-D03GGGACCCACCCCACCCGGCCCAAGNONE 
009-145-F01CCCGGCCCAACANONE 
009-145-F01GGGACCCACCCCACCCGGCCCAAGNONE 
009-146-C06CCCGGCCCAACANONE 
009-146-C06GGGACCCACCCCACCCGGCCCAAGNONE 
009-186-C05CCCGGCCCAACANONE 
009-186-C05GGGACCCACCCCACCCGGCCCAAGNONE 
AK060395CCCGGCCCAACANONE 
AK060395GGGACCCACCCCACCCGGCCCAAGNONE 
AK121763CCCGGCCCAACAConserved hypothetical protein. 
AK121763GGGACCCACCCCACCCGGCCCAAGConserved hypothetical protein. 
J033090J17CCCGGCCCAACANONE 
J033090J17GGGACCCACCCCACCCGGCCCAAGNONE 
J065058O06CCCGGCCCAACANONE 
J065058O06GGGACCCACCCCACCCGGCCCAAGNONE 
J065058P05CCCGGCCCAACANONE 
J065058P05GGGACCCACCCCACCCGGCCCAAGNONE 
J065141C14CCCGGCCCAACANONE 
J065141C14GGGACCCACCCCACCCGGCCCAAGNONE 
J065162F07CCCGGCCCAACANONE 
J065162F07GGGACCCACCCCACCCGGCCCAAGNONE 
J065199N16CCCGGCCCAACANONE 
J065199N16GGGACCCACCCCACCCGGCCCAAGNONE 
J065214I05CCCGGCCCAACANONE 
J065214I05GGGACCCACCCCACCCGGCCCAAGNONE 
J075003L04CCCGGCCCAACANONE 
J075003L04GGGACCCACCCCACCCGGCCCAAGNONE 
J075014C14CCCGGCCCAACANONE 
J075014C14GGGACCCACCCCACCCGGCCCAAGNONE 
J075063K14CCCGGCCCAACANONE 
J075063K14GGGACCCACCCCACCCGGCCCAAGNONE 
J075111N19CCCGGCCCAACANONE 
J075111N19GGGACCCACCCCACCCGGCCCAAGNONE 
J075138E13CCCGGCCCAACANONE 
J075138E13GGGACCCACCCCACCCGGCCCAAGNONE 
J075189E23CCCGGCCCAACANONE 
J075189E23GGGACCCACCCCACCCGGCCCAAGNONE 
J080304J23CCCGGCCCAACANONE 
J080304J23GGGACCCACCCCACCCGGCCCAAGNONE 
J080310L07CCCGGCCCAACANONE 
J080310L07GGGACCCACCCCACCCGGCCCAAGNONE 
J080318A16CCCGGCCCAACANONE 
J080318A16GGGACCCACCCCACCCGGCCCAAGNONE 
J100054P14CCCGGCCCAACANONE 
J100054P14GGGACCCACCCCACCCGGCCCAAGNONE 
Os04g0208400AK069629CACGTGGGCCGGCCyclin-like F-box domain containing protein. 
AK069629GCTGGGCCGGGCCGCyclin-like F-box domain containing protein. 
AK069629TGGGCCGGCCyclin-like F-box domain containing protein. 
Os04g0253000005-012-H08ACCGGCCCACCNONE 
009-095-D01ACCGGCCCACCNONE 
016-090-D11ACCGGCCCACCNONE 
AK073668ACCGGCCCACCSimilar to Histone H1. 
J013088G23ACCGGCCCACCNONE 
J013162C07ACCGGCCCACCNONE 
J023031N06ACCGGCCCACCNONE 
J023039N07ACCGGCCCACCNONE 
J023083I01ACCGGCCCACCNONE 
J023083O14ACCGGCCCACCNONE 
J023122B19ACCGGCCCACCNONE 
J023133L08ACCGGCCCACCNONE 
J033052L06ACCGGCCCACCNONE 
J033080E10ACCGGCCCACCNONE 
J090032L14ACCGGCCCACCNONE 
J100022N05ACCGGCCCACCNONE 
J100029A08ACCGGCCCACCNONE 
J100029H18ACCGGCCCACCNONE 
J100066D09ACCGGCCCACCNONE 
J100077M22ACCGGCCCACCNONE 
Os04g0258900009-146-B02CCCGGCCCATTTNONE 
AK062983CCCGGCCCATTTCyclin-like F-box domain containing protein. 
Os04g0378200AK103076ACCGGCCCAAACSterile alpha motif SAM domain containing protein. 
J033118E02ACCGGCCCAAACNONE 
J065065F15ACCGGCCCAAACNONE 
J090080I24ACCGGCCCAAACNONE 
Os04g0388900AK063224CAAGGCCCGGCCCATCASimilar to U6 snRNA-associated Sm-like protein LSm6 (Sm protein F). 
J065037N19CAAGGCCCGGCCCATCANONE 
J065148P22CAAGGCCCGGCCCATCANONE 
J075040G12CAAGGCCCGGCCCATCANONE 
Os04g0428900009-068-A06CCTGGGCCGGANONE 
AK061355CCTGGGCCGGASimilar to CSN8. 
AK099153CCTGGGCCGGANONE 
AY336991CCTGGGCCGGANONE 
J023069F08CCTGGGCCGGANONE 
J065112H12CCTGGGCCGGANONE 
J075022F23CCTGGGCCGGANONE 
J090045D23CCTGGGCCGGANONE 
J090067E18CCTGGGCCGGANONE 
J090099H14CCTGGGCCGGANONE 
Os04g0440100AK101324ATTGGGCCGGCNONE 
AK105415ATTGGGCCGGCNonsense-mediated decay UPF3 domain containing protein. 
Os04g0443000011-022-G04TACTGGGCCGGNONE 
AK100533TACTGGGCCGGFAR1 domain containing protein. 
J023101L24TACTGGGCCGGNONE 
Os04g0447400AK070858CTTGGGCTTTTATATGGGCCGGTSimilar to Glutamate decarboxylase 2 (EC 4.1.1.15) (GAD 2). 
J023002M09CTTGGGCTTTTATATGGGCCGGTNONE 
J023003G16CTTGGGCTTTTATATGGGCCGGTNONE 
J023006F16CTTGGGCTTTTATATGGGCCGGTNONE 
J023008D10CTTGGGCTTTTATATGGGCCGGTNONE 
J023010A01CTTGGGCTTTTATATGGGCCGGTNONE 
J023012M16CTTGGGCTTTTATATGGGCCGGTNONE 
J023023H17CTTGGGCTTTTATATGGGCCGGTNONE 
J023029B12CTTGGGCTTTTATATGGGCCGGTNONE 
J023030F09CTTGGGCTTTTATATGGGCCGGTNONE 
J023034K03CTTGGGCTTTTATATGGGCCGGTNONE 
J023045A16CTTGGGCTTTTATATGGGCCGGTNONE 
J023048I04CTTGGGCTTTTATATGGGCCGGTNONE 
J023056C09CTTGGGCTTTTATATGGGCCGGTNONE 
J023056F05CTTGGGCTTTTATATGGGCCGGTNONE 
J023058B21CTTGGGCTTTTATATGGGCCGGTNONE 
J023058N06CTTGGGCTTTTATATGGGCCGGTNONE 
J023059F03CTTGGGCTTTTATATGGGCCGGTNONE 
J023059M19CTTGGGCTTTTATATGGGCCGGTNONE 
J023060P05CTTGGGCTTTTATATGGGCCGGTNONE 
J023062D07CTTGGGCTTTTATATGGGCCGGTNONE 
J023063F16CTTGGGCTTTTATATGGGCCGGTNONE 
J023068K15CTTGGGCTTTTATATGGGCCGGTNONE 
J023069L04CTTGGGCTTTTATATGGGCCGGTNONE 
J023075I24CTTGGGCTTTTATATGGGCCGGTNONE 
J023086H01CTTGGGCTTTTATATGGGCCGGTNONE 
J023086I24CTTGGGCTTTTATATGGGCCGGTNONE 
J023091M08CTTGGGCTTTTATATGGGCCGGTNONE 
J023095A07CTTGGGCTTTTATATGGGCCGGTNONE 
J023110K06CTTGGGCTTTTATATGGGCCGGTNONE 
J023113D07CTTGGGCTTTTATATGGGCCGGTNONE 
J023126J05CTTGGGCTTTTATATGGGCCGGTNONE 
J023140F04CTTGGGCTTTTATATGGGCCGGTNONE 
J023141N19CTTGGGCTTTTATATGGGCCGGTNONE 
Os04g0461100009-136-H10ATCTGGGCCGGGCCGTTTNONE 
009-147-H12ATCTGGGCCGGGCCGTTTNONE 
AK068022ATCTGGGCCGGGCCGTTTPlastid and cyanobacterial ribosomal protein PSRP-3/Ycf65 family protein. 
J013130N24ATCTGGGCCGGGCCGTTTNONE 
J065019D10ATCTGGGCCGGGCCGTTTNONE 
J065168O21ATCTGGGCCGGGCCGTTTNONE 
J075051G06ATCTGGGCCGGGCCGTTTNONE 
J075148G11ATCTGGGCCGGGCCGTTTNONE 
Os04g0486500AK111976TCCGGCCCACCTSimilar to Mitotic spindle checkpoint protein MAD2. 
Os04g0491500AK068089TTTCGGCCCGGCCCAACCNONE 
AK101116TTTCGGCCCGGCCCAACCTGF-beta receptor, type I/II extracellular region family protein. 
Os04g0503800J065116G03GCCGGCCCAGCCCAGTANONE 
Os04g0527700AK072980AACGGGCCGGGCCGGCCCAGTACHCH domain containing protein. 
J023117E20AACGGGCCGGGCCGGCCCAGTANONE 
J023150D11AACGGGCCGGGCCGGCCCAGTANONE 
Os04g0528100009-090-G06TCCGGCCCATATNONE 
009-168-C11TCCGGCCCATATNONE 
AK065957TCCGGCCCATATConserved hypothetical protein. 
J013039G20TCCGGCCCATATNONE 
J013044D08TCCGGCCCATATNONE 
J065013L14TCCGGCCCATATNONE 
J065143H08TCCGGCCCATATNONE 
J065146C14TCCGGCCCATATNONE 
J065149K22TCCGGCCCATATNONE 
J065156B18TCCGGCCCATATNONE 
J065201A04TCCGGCCCATATNONE 
J065209A04TCCGGCCCATATNONE 
Os04g0531300016-006-E10GCCCGGCCCATATNONE 
AK072647GCCCGGCCCATATDihydrouridine synthase, DuS family protein. 
AK103911GCCCGGCCCATATNONE 
J013038P22GCCCGGCCCATATNONE 
J023130D01GCCCGGCCCATATNONE 
J033150P13GCCCGGCCCATATNONE 
J043026L14GCCCGGCCCATATNONE 
J065049A08GCCCGGCCCATATNONE 
J065215C17GCCCGGCCCATATNONE 
Os04g0551800016-049-G12GTTTGGGCCGGTNONE 
AK121568GTTTGGGCCGGTSimilar to T-complex protein 1, alpha subunit (TCP-1-alpha) (CCT-alpha). 
J013073O06GTTTGGGCCGGTNONE 
J013111B11GTTTGGGCCGGTNONE 
J013121H23GTTTGGGCCGGTNONE 
J023012A17GTTTGGGCCGGTNONE 
J023092M05GTTTGGGCCGGTNONE 
J033026P14GTTTGGGCCGGTNONE 
J033033C10GTTTGGGCCGGTNONE 
J033033M10GTTTGGGCCGGTNONE 
J033035C24GTTTGGGCCGGTNONE 
J033052E19GTTTGGGCCGGTNONE 
J033140K19GTTTGGGCCGGTNONE 
J065036F18GTTTGGGCCGGTNONE 
J065067L12GTTTGGGCCGGTNONE 
J065095G09GTTTGGGCCGGTNONE 
J065115B08GTTTGGGCCGGTNONE 
J065218E24GTTTGGGCCGGTNONE 
J090002N13GTTTGGGCCGGTNONE 
J090008B12GTTTGGGCCGGTNONE 
J090016F24GTTTGGGCCGGTNONE 
J090019H14GTTTGGGCCGGTNONE 
J090020G20GTTTGGGCCGGTNONE 
J090029L18GTTTGGGCCGGTNONE 
J090057C23GTTTGGGCCGGTNONE 
J090073H23GTTTGGGCCGGTNONE 
J090081C16GTTTGGGCCGGTNONE 
J090081E21GTTTGGGCCGGTNONE 
J090084L14GTTTGGGCCGGTNONE 
J090086M01GTTTGGGCCGGTNONE 
J090089E16GTTTGGGCCGGTNONE 
J100031P12GTTTGGGCCGGTNONE 
J100090N23GTTTGGGCCGGTNONE 
Os04g0562000006-096-A05AAATGGGCCGGANONE 
006-105-B08AAATGGGCCGGANONE 
AK060894AAATGGGCCGGANONE 
AK072630AAATGGGCCGGAZinc finger, DHHC-type domain containing protein. 
AK104521AAATGGGCCGGANONE 
J023038A11AAATGGGCCGGANONE 
J023130P03AAATGGGCCGGANONE 
J090006F10AAATGGGCCGGANONE 
J090007M22AAATGGGCCGGANONE 
Os04g0563300AK100487CAGGTGGGCCCGGCCCATACyclin-like F-box domain containing protein. 
AK100487CCCGGCCCACGCCyclin-like F-box domain containing protein. 
J023097O18CAGGTGGGCCCGGCCCATANONE 
J023097O18CCCGGCCCACGCNONE 
J065100E16CAGGTGGGCCCGGCCCATANONE 
J065100E16CCCGGCCCACGCNONE 
J075022C23CAGGTGGGCCCGGCCCATANONE 
J075022C23CCCGGCCCACGCNONE 
J075023L18CAGGTGGGCCCGGCCCATANONE 
J075023L18CCCGGCCCACGCNONE 
J075040N10CAGGTGGGCCCGGCCCATANONE 
J075040N10CCCGGCCCACGCNONE 
J075061L14CAGGTGGGCCCGGCCCATANONE 
J075061L14CCCGGCCCACGCNONE 
J075069B15CAGGTGGGCCCGGCCCATANONE 
J075069B15CCCGGCCCACGCNONE 
J075106C16CAGGTGGGCCCGGCCCATANONE 
J075106C16CCCGGCCCACGCNONE 
J075138P13CAGGTGGGCCCGGCCCATANONE 
J075138P13CCCGGCCCACGCNONE 
J075139H18CAGGTGGGCCCGGCCCATANONE 
J075139H18CCCGGCCCACGCNONE 
J075139L06CAGGTGGGCCCGGCCCATANONE 
J075139L06CCCGGCCCACGCNONE 
J075149B07CAGGTGGGCCCGGCCCATANONE 
J075149B07CCCGGCCCACGCNONE 
J075177N21CAGGTGGGCCCGGCCCATANONE 
J075177N21CCCGGCCCACGCNONE 
Os04g0564600009-038-A02CCCGGCCCATAAGGCCCACGTNONE 
AK105145CCCGGCCCATAAGGCCCACGTNONE 
AK120614CCCGGCCCATAAGGCCCACGTSimilar to HMG1 protein. 
J013102D16CCCGGCCCATAAGGCCCACGTNONE 
J013151P06CCCGGCCCATAAGGCCCACGTNONE 
J033082C11CCCGGCCCATAAGGCCCACGTNONE 
J065073N13CCCGGCCCATAAGGCCCACGTNONE 
J065142E11CCCGGCCCATAAGGCCCACGTNONE 
J065187I19CCCGGCCCATAAGGCCCACGTNONE 
J065204K02CCCGGCCCATAAGGCCCACGTNONE 
J090089P22CCCGGCCCATAAGGCCCACGTNONE 
J100060B16CCCGGCCCATAAGGCCCACGTNONE 
Os04g0570600AK106747GCCGGCCCATCCCytochrome P450 family protein. 
J080319G08GCCGGCCCATCCNONE 
Os04g0577000AK073711AACTGGGCCGGAUbiquitin fusion degradation protein UFD1 family protein. 
AK119957AACTGGGCCGGANONE 
J013127H04AACTGGGCCGGANONE 
J033035G06AACTGGGCCGGANONE 
J033061G23AACTGGGCCGGANONE 
J033127L07AACTGGGCCGGANONE 
J065015F17AACTGGGCCGGANONE 
J065062G08AACTGGGCCGGANONE 
J065132M07AACTGGGCCGGANONE 
J065155C12AACTGGGCCGGANONE 
J075055I08AACTGGGCCGGANONE 
J075140D07AACTGGGCCGGANONE 
J090055B21AACTGGGCCGGANONE 
J100031D23AACTGGGCCGGANONE 
Os04g0577500006-039-C03CCCGGCCCACAANONE 
006-043-H01CCCGGCCCACAANONE 
AK061538CCCGGCCCACAANONE 
AK065648CCCGGCCCACAATatD-related deoxyribonuclease family protein. 
AK104763CCCGGCCCACAANONE 
J013035E21CCCGGCCCACAANONE 
J013066M11CCCGGCCCACAANONE 
J100026B02CCCGGCCCACAANONE 
Os04g0581000AK061337TGATGGGCCGGCSimilar to Flavanone 3-hydroxylase-like protein. 
AK104142TGATGGGCCGGCNONE 
Os04g0595000AK106907TCCGGCCCATGAPeptidase A1, pepsin family protein. 
Os04g0611300009-006-G08GCCCGGCCCAAGNONE 
009-011-C01GCCCGGCCCAAGNONE 
009-036-B09GCCCGGCCCAAGNONE 
009-116-G09GCCCGGCCCAAGNONE 
009-126-E09GCCCGGCCCAAGNONE 
009-132-F09GCCCGGCCCAAGNONE 
009-151-G07GCCCGGCCCAAGNONE 
009-155-C07GCCCGGCCCAAGNONE 
009-163-G01GCCCGGCCCAAGNONE 
009-169-G08GCCCGGCCCAAGNONE 
009-191-B02GCCCGGCCCAAGNONE 
009-196-A08GCCCGGCCCAAGNONE 
009-198-E07GCCCGGCCCAAGNONE 
014-015-F04GCCCGGCCCAAGNONE 
015-087-H04GCCCGGCCCAAGNONE 
AK062605GCCCGGCCCAAGNONE 
AK063022GCCCGGCCCAAGConserved hypothetical protein. 
AK066749GCCCGGCCCAAGNONE 
AK104924GCCCGGCCCAAGNONE 
J065002M20GCCCGGCCCAAGNONE 
J065045L23GCCCGGCCCAAGNONE 
J065101E05GCCCGGCCCAAGNONE 
J065140J23GCCCGGCCCAAGNONE 
J065179G11GCCCGGCCCAAGNONE 
J065191B18GCCCGGCCCAAGNONE 
J065192E03GCCCGGCCCAAGNONE 
J065199H21GCCCGGCCCAAGNONE 
J075067F01GCCCGGCCCAAGNONE 
J075089L01GCCCGGCCCAAGNONE 
J075147K22GCCCGGCCCAAGNONE 
J080069G23GCCCGGCCCAAGNONE 
J100053D10GCCCGGCCCAAGNONE 
J100078C10GCCCGGCCCAAGNONE 
Os04g0625600AK070994TTTTGGGCCGGATRAF-like domain containing protein. 
J023080H04TTTTGGGCCGGANONE 
J023086H15TTTTGGGCCGGANONE 
J033037L21TTTTGGGCCGGANONE 
J033044P14TTTTGGGCCGGANONE 
J065075C23TTTTGGGCCGGANONE 
J065167C18TTTTGGGCCGGANONE 
J100024E02TTTTGGGCCGGANONE 
J100068N24TTTTGGGCCGGANONE 
J100070G20TTTTGGGCCGGANONE 
Os04g0635800006-033-E07AATGGGCCGGCCCATCAAGGCCCATTANONE 
011-067-A08AATGGGCCGGCCCATCAAGGCCCATTANONE 
AK060110AATGGGCCGGCCCATCAAGGCCCATTANONE 
AK099507AATGGGCCGGCCCATCAAGGCCCATTAGCN5-related N-acetyltransferase domain containing protein. 
AK104741AATGGGCCGGCCCATCAAGGCCCATTANONE 
AK120021AATGGGCCGGCCCATCAAGGCCCATTANONE 
J013029B17AATGGGCCGGCCCATCAAGGCCCATTANONE 
J013134M07AATGGGCCGGCCCATCAAGGCCCATTANONE 
J013149N18AATGGGCCGGCCCATCAAGGCCCATTANONE 
J013153L10AATGGGCCGGCCCATCAAGGCCCATTANONE 
J033131F08AATGGGCCGGCCCATCAAGGCCCATTANONE 
J043010E02AATGGGCCGGCCCATCAAGGCCCATTANONE 
J065031J05AATGGGCCGGCCCATCAAGGCCCATTANONE 
J065031J06AATGGGCCGGCCCATCAAGGCCCATTANONE 
J075030K04AATGGGCCGGCCCATCAAGGCCCATTANONE 
J075178K05AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080001B10AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080003N19AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080005F20AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080005G16AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080007N02AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080009J04AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080017D04AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080020M22AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080021A15AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080021F21AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080023P05AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080024P22AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080027C20AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080029K03AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080035M18AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080039F22AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080039J03AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080039L03AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080039P14AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080042E12AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080047D19AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080047M21AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080049N03AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080056J12AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080060B10AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080062K08AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080064L07AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080069C15AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080074H06AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080086O14AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080090C20AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080090L14AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080095G08AATGGGCCGGCCCATCAAGGCCCATTANONE 
J080097C07AATGGGCCGGCCCATCAAGGCCCATTANONE 
J090011F03AATGGGCCGGCCCATCAAGGCCCATTANONE 
J090082O17AATGGGCCGGCCCATCAAGGCCCATTANONE 
Os04g0640800AK065522TATTGGGCCGGAProgrammed cell death protein 2, C-terminal domain containing protein. 
Os04g0650500AK066690ACATGGGCCGGTConserved hypothetical protein. 
AK104273ACATGGGCCGGTNONE 
Os04g0658300AK067399TAATGGGCCGGTSimilar to Ribulose bisphosphate carboxylase/oxygenase activase, chloroplast precursor (RuBisCO activase) (RA). 
Os04g0658600AK064729TGTGGGCCGGCNONE 
AK119253TGTGGGCCGGCNucleolar, Nop52 family protein. 
J075132J07TGTGGGCCGGCNONE 
J075157N21TGTGGGCCGGCNONE 
Os04g0659400AK070174GGCTGGGCCGGCENT domain containing protein. 
Os04g0665000009-149-A12TCCGGCCCAAAANONE 
AK062995TCCGGCCCAAAACHCH domain containing protein. 
J065017G19TCCGGCCCAAAANONE 
J080301G12TCCGGCCCAAAANONE 
Os04g0668900AF085174ACCGGCCCACCNONE 
AK067891ACCGGCCCACCSimilar to Plastid terminal oxidase. 
Os04g0670400012-048-A10TACGGCCCGGCCCATTTGGCCCACGAANONE 
AK103099TACGGCCCGGCCCATTTGGCCCACGAAOvarian tumour, otubain domain containing protein. 
J033118N06TACGGCCCGGCCCATTTGGCCCACGAANONE 
J100019K03TACGGCCCGGCCCATTTGGCCCACGAANONE 
Os04g0670500AK107506TTCGTGGGCCAAATGGGCCGGGCCGTACysteine protease 1 precursor (EC 3.4.22.-) (OsCP1). 
Os04g0670600AK064255AAAAGCCCGGCCCAGTTNONE 
Os04g0682300AK061384TTGTGGGCCGGTSimilar to Phosphomannomutase 2 (EC 5.4.2.8) (PMM 2). 
AK104004TTGTGGGCCGGTNONE 
J033102P12TTGTGGGCCGGTNONE 
J100038F01TTGTGGGCCGGTNONE 
Os04g0682800AK121846GCCGGCCCATTSodium/hydrogen exchanger family protein. 
Os04g0684500AK066014TCCGGCCCACCCGGGCCRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os05g0110300AK067116TCCGGCCCACANONE 
AK071038TCCGGCCCACANAD-dependent epimerase/dehydratase family protein. 
J065060E20TCCGGCCCACANONE 
J065093K05TCCGGCCCACANONE 
Os05g0110500AK060179TCCGGCCCACTNONE 
AK066175TCCGGCCCACTSimilar to RNA helicase (Fragment). 
J013055E22TCCGGCCCACTNONE 
J090056E03TCCGGCCCACTNONE 
Os05g0120800AK066865TCCGGCCCAACAConserved hypothetical protein. 
Os05g0122900009-052-C11TCCGGCCCACTNONE 
009-132-C12TCCGGCCCACTNONE 
014-091-G03TCCGGCCCACTNONE 
AB072977TCCGGCCCACTNONE 
AK071296TCCGGCCCACTNONE 
AK099375TCCGGCCCACTNONE 
AK104970TCCGGCCCACTBLE1 protein. 
J065007I09TCCGGCCCACTNONE 
J065081H07TCCGGCCCACTNONE 
J065122B18TCCGGCCCACTNONE 
J065181G15TCCGGCCCACTNONE 
J065182J07TCCGGCCCACTNONE 
J065197D23TCCGGCCCACTNONE 
J065197G08TCCGGCCCACTNONE 
J065201H20TCCGGCCCACTNONE 
J090034E11TCCGGCCCACTNONE 
J100077M04TCCGGCCCACTNONE 
Os05g0126200AK059554CCCGGCCCATCTConserved hypothetical protein. 
AK059554GTCGAGTCATTGGGCCGGGCCCATATConserved hypothetical protein. 
AK121734CCCGGCCCATCTNONE 
AK121734GTCGAGTCATTGGGCCGGGCCCATATNONE 
J033084B09CCCGGCCCATCTNONE 
J033084B09GTCGAGTCATTGGGCCGGGCCCATATNONE 
J090010I10CCCGGCCCATCTNONE 
J090010I10GTCGAGTCATTGGGCCGGGCCCATATNONE 
Os05g0128100009-051-B07CTTGGGCCGCCGGCCCATCTNONE 
009-127-B08CTTGGGCCGCCGGCCCATCTNONE 
009-144-H03CTTGGGCCGCCGGCCCATCTNONE 
009-176-B05CTTGGGCCGCCGGCCCATCTNONE 
AK108556CTTGGGCCGCCGGCCCATCTNONE 
AK119308CTTGGGCCGCCGGCCCATCTNONE 
AK120934CTTGGGCCGCCGGCCCATCTConserved hypothetical protein. 
J023036J15CTTGGGCCGCCGGCCCATCTNONE 
J065122L01CTTGGGCCGCCGGCCCATCTNONE 
J075104P10CTTGGGCCGCCGGCCCATCTNONE 
Os05g0155100006-075-B02CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
006-075-B02CCGTGGGCCGGANONE 
AK061929CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
AK061929CCGTGGGCCGGANONE 
AK102810CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
AK102810CCGTGGGCCGGANONE 
AK120877CCCACCACTCCGGCCCACGAGGCCCACCACSimilar to 60S ribosomal protein L18. 
AK120877CCGTGGGCCGGASimilar to 60S ribosomal protein L18. 
J013023E03CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J013023E03CCGTGGGCCGGANONE 
J013038C16CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J013038C16CCGTGGGCCGGANONE 
J013120M14CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J013120M14CCGTGGGCCGGANONE 
J013153B04CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J013153B04CCGTGGGCCGGANONE 
J013159B07CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J013159B07CCGTGGGCCGGANONE 
J023012A02CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J023012A02CCGTGGGCCGGANONE 
J023027F08CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J023027F08CCGTGGGCCGGANONE 
J023027I12CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J023027I12CCGTGGGCCGGANONE 
J023120F05CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J023120F05CCGTGGGCCGGANONE 
J023138O03CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J023138O03CCGTGGGCCGGANONE 
J023142H13CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J023142H13CCGTGGGCCGGANONE 
J023143P06CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J023143P06CCGTGGGCCGGANONE 
J033023P09CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033023P09CCGTGGGCCGGANONE 
J033035O14CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033035O14CCGTGGGCCGGANONE 
J033042N19CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033042N19CCGTGGGCCGGANONE 
J033043B12CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033043B12CCGTGGGCCGGANONE 
J033065D10CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033065D10CCGTGGGCCGGANONE 
J033081A12CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033081A12CCGTGGGCCGGANONE 
J033084N05CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033084N05CCGTGGGCCGGANONE 
J033085M03CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033085M03CCGTGGGCCGGANONE 
J033112D15CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033112D15CCGTGGGCCGGANONE 
J033114O07CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033114O07CCGTGGGCCGGANONE 
J033119D15CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033119D15CCGTGGGCCGGANONE 
J033140E06CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033140E06CCGTGGGCCGGANONE 
J033141K23CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033141K23CCGTGGGCCGGANONE 
J043040I22CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J043040I22CCGTGGGCCGGANONE 
J053050B21CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J053050B21CCGTGGGCCGGANONE 
J053065I18CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J053065I18CCGTGGGCCGGANONE 
J053074O16CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J053074O16CCGTGGGCCGGANONE 
J065072K13CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J065072K13CCGTGGGCCGGANONE 
J065211I09CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J065211I09CCGTGGGCCGGANONE 
J090004K04CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J090004K04CCGTGGGCCGGANONE 
J090016L06CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J090016L06CCGTGGGCCGGANONE 
J090040F22CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J090040F22CCGTGGGCCGGANONE 
J090063F22CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J090063F22CCGTGGGCCGGANONE 
J090081J09CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J090081J09CCGTGGGCCGGANONE 
J100032A10CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J100032A10CCGTGGGCCGGANONE 
J100037G20CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J100037G20CCGTGGGCCGGANONE 
J100056O10CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J100056O10CCGTGGGCCGGANONE 
J100071D10CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J100071D10CCGTGGGCCGGANONE 
J100075K13CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J100075K13CCGTGGGCCGGANONE 
J100079F16CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J100079F16CCGTGGGCCGGANONE 
J100080O16CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J100080O16CCGTGGGCCGGANONE 
J100086N05CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J100086N05CCGTGGGCCGGANONE 
Os05g0156200AK071622GCCGGCCCAATTConserved hypothetical protein. 
J023099E19GCCGGCCCAATTNONE 
J090025C09GCCGGCCCAATTNONE 
J090071K23GCCGGCCCAATTNONE 
Os05g0169400AK073439GCTGGGCCGGATCGGGCCGAProtein of unknown function DUF1421 family protein. 
AK073439TCCGGCCCAACProtein of unknown function DUF1421 family protein. 
J013110E15GCTGGGCCGGATCGGGCCGANONE 
J013110E15TCCGGCCCAACNONE 
J033044H02GCTGGGCCGGATCGGGCCGANONE 
J033044H02TCCGGCCCAACNONE 
Os05g0180700J100062K04GCTGGGCCGGTConserved hypothetical protein. 
Os05g0182700003-102-E07CCCGGCCCATGANONE 
011-019-D04CCCGGCCCATGANONE 
013-068-D09CCCGGCCCATGANONE 
014-032-G03CCCGGCCCATGANONE 
AK065911CCCGGCCCATGAProtein of unknown function DUF1664 family protein. 
AK104343CCCGGCCCATGANONE 
J013045E01CCCGGCCCATGANONE 
J013156L15CCCGGCCCATGANONE 
J023029P17CCCGGCCCATGANONE 
J023134I24CCCGGCCCATGANONE 
J033099A10CCCGGCCCATGANONE 
J033115L16CCCGGCCCATGANONE 
J090007M24CCCGGCCCATGANONE 
J090019F02CCCGGCCCATGANONE 
Os05g0223300AK069616ACCGGCCCATTTSimilar to RNA-binding protein. 
J080093O15ACCGGCCCATTTNONE 
J090061N02ACCGGCCCATTTNONE 
Os05g0227700AK067567AATTGGGCCGGCCCATTAGGTGGATGGGCCCACTConserved hypothetical protein. 
AK068760AATTGGGCCGGCCCATTAGGTGGATGGGCCCACTNONE 
J013108C14AATTGGGCCGGCCCATTAGGTGGATGGGCCCACTNONE 
Os05g0227800AK110997AGTGGGCCCATCCACCTAATGGGCCGGCCCAATTHomeodomain-like containing protein. 
Os05g0241400AK107803ATATGGGCCTATTGGGCCGGGCConserved hypothetical protein. 
Os05g0283600AK100359GCGTGGGCCGGTConserved hypothetical protein. 
AK106958GCGTGGGCCGGTNONE 
AK109539GCGTGGGCCGGTNONE 
J023083K23GCGTGGGCCGGTNONE 
Os05g0295900AK069962AACTGGGCCGGTConserved hypothetical protein. 
Os05g0347000009-013-E04AGTTGGGCCGGANONE 
AK109444AGTTGGGCCGGATAFII55 protein conserved region domain containing protein. 
J065049M12AGTTGGGCCGGANONE 
J065190K18AGTTGGGCCGGANONE 
J075169G13AGTTGGGCCGGANONE 
Os05g0377000Os05g0377000ACCGGCCCATCASimilar to Acyl carrier protein (ACP). 
Os05g0377000GCTGGGCCAGATGGGCCGGASimilar to Acyl carrier protein (ACP). 
Os05g0383100AK121835CCATGGGCCGGCCCATTClathrin adaptor complex, medium chain family protein. 
Os05g0395600Os05g0395600TGTGGGCCGGANONE 
Os05g0400600AK072045TCCGGCCCAACTCobalt transport protein family protein. 
Os05g0412800AF402803GCCCGGCCGGCCCAAATSimilar to Glutathione S-transferase GST 41 (EC 2.5.1.18). 
Os05g0424700AK107848GCCGGCCCAGCSimilar to Copper transporter 1. 
Os05g0437800015-045-B10CCAGGCCCGGCCCACANONE 
AK106328CCAGGCCCGGCCCACAConserved hypothetical protein. 
Os05g0445500009-021-C05TCCGGCCCATGGGCCGTGGGCCTCNONE 
009-129-D11TCCGGCCCATGGGCCGTGGGCCTCNONE 
009-147-E04TCCGGCCCATGGGCCGTGGGCCTCNONE 
009-169-C11TCCGGCCCATGGGCCGTGGGCCTCNONE 
AK121459TCCGGCCCATGGGCCGTGGGCCTCSimilar to 60S acidic ribosomal protein P2B. 
D21114TCCGGCCCATGGGCCGTGGGCCTCNONE 
J023001K23TCCGGCCCATGGGCCGTGGGCCTCNONE 
J023107J19TCCGGCCCATGGGCCGTGGGCCTCNONE 
J023143J09TCCGGCCCATGGGCCGTGGGCCTCNONE 
J065049D04TCCGGCCCATGGGCCGTGGGCCTCNONE 
J065092I06TCCGGCCCATGGGCCGTGGGCCTCNONE 
J065188H04TCCGGCCCATGGGCCGTGGGCCTCNONE 
Os05g0451200AK073037ACCGGCCCACGTConserved hypothetical protein. 
AK073037GCTGGGCCGGAConserved hypothetical protein. 
Os05g0451300AK108341AGTGGGCCACCTCGCCCGGCCCAACCConserved hypothetical protein. 
Os05g0456000AK058420TCCGGCCCAACATGGATGGGCCTAMitochondrial glycoprotein family protein. 
AK102036TCCGGCCCAACATGGATGGGCCTANONE 
J065066F02TCCGGCCCAACATGGATGGGCCTANONE 
Os05g0461000006-113-A06TCCGGCCCAATTNONE 
AB042259TCCGGCCCAATTNONE 
AK059189TCCGGCCCAATTNONE 
AK066739TCCGGCCCAATTClathrin adaptor complex, small chain family protein. 
AK099044TCCGGCCCAATTNONE 
AK104166TCCGGCCCAATTNONE 
Os05g0465000AK111286CCCGGCCCAGAConserved hypothetical protein. 
Os05g0480700AK100850AGTGGGCCGGCSimilar to Vacuolar ATP synthase subunit E (EC 3.6.3.14) (V-ATPase E subunit) (Vacuolar proton pump E subunit). 
J023123I11AGTGGGCCGGCNONE 
Os05g0488900AK071883CCCGGCCCATACSimilar to Cytochrome b5 reductase. 
AK071883TTTTGGGCCTAAAATGGGCCATACATGGGCCGGASimilar to Cytochrome b5 reductase. 
AK073699CCCGGCCCATACNONE 
AK073699TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
AK105459CCCGGCCCATACNONE 
AK105459TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
J080009C06CCCGGCCCATACNONE 
J080009C06TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
J080021N09CCCGGCCCATACNONE 
J080021N09TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
J080041K24CCCGGCCCATACNONE 
J080041K24TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
J080058H15CCCGGCCCATACNONE 
J080058H15TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
J080064P06CCCGGCCCATACNONE 
J080064P06TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
J080077B16CCCGGCCCATACNONE 
J080077B16TTTTGGGCCTAAAATGGGCCATACATGGGCCGGANONE 
Os05g0490800J065037L19CCAGCCCACGGCCCGGCCCACCTNONE 
J065037L19TCCGGCCCAACTNONE 
Os05g0503000AK068335GCCGGCCCACACSimilar to Secretory carrier membrane protein. 
AK104049GCCGGCCCACACNONE 
J013149D04GCCGGCCCACACNONE 
J075085A06GCCGGCCCACACNONE 
Os05g0509200AK061566ACTGGGCCGGTNADH dehydrogenase (ubiquinone), 24 kDa subunit family protein. 
AK099007ACTGGGCCGGTNONE 
AK100226ACTGGGCCGGTNONE 
J013114B12ACTGGGCCGGTNONE 
J023048D09ACTGGGCCGGTNONE 
Os05g0512500009-036-D05GTGGTGGGCCGGTNONE 
AK062441GTGGTGGGCCGGTCT20 family protein. 
J080003C10GTGGTGGGCCGGTNONE 
J080046G11GTGGTGGGCCGGTNONE 
Os05g0536900009-033-D11AGATGGGCCGGGCCGGTNONE 
AK105140AGATGGGCCGGGCCGGTSimilar to RAB7A. 
Os05g0539300Os05g0539300AGATGGGCCGGAProtein of unknown function DUF295 family protein. 
Os05g0540800AK060731AGTTGGGCCGGCCCAATANONE 
AK071090AGTTGGGCCGGCCCAATAHomeodomain-like containing protein. 
J013095F03AGTTGGGCCGGCCCAATANONE 
J023079C11AGTTGGGCCGGCCCAATANONE 
J033080E08AGTTGGGCCGGCCCAATANONE 
Os05g0542300009-050-C12ATTTGGGCCGGCNONE 
009-185-D06ATTTGGGCCGGCNONE 
AK062488ATTTGGGCCGGCConserved hypothetical protein. 
Os05g0552900AK102095GCCCGGCCCAGTAMAP65/ASE1 family protein. 
Os05g0565000AK102673TCCGGCCCAAACSimilar to 60S ribosomal protein L18a-1. 
J033102C12TCCGGCCCAAACNONE 
J033124C13TCCGGCCCAAACNONE 
J043003L04TCCGGCCCAAACNONE 
J043006N08TCCGGCCCAAACNONE 
Os05g0565200004-015-E06TCCGGCCCAACCNONE 
AK067090TCCGGCCCAACCSimilar to Urease accessory protein G. 
AK104200TCCGGCCCAACCNONE 
AK104368TCCGGCCCAACCNONE 
Os05g0566500AK073468TGTGGGCCGGGCNONE 
AK099052TGTGGGCCGGGCSimilar to Initiation factor 3d (Fragment). 
AK104093TGTGGGCCGGGCNONE 
J090025I18TGTGGGCCGGGCNONE 
Os05g0567300013-039-F11CCATGGGCTTTGTTGGGCCGGTNONE 
013-039-F11TATTGGGCCGGCCCAAGNONE 
AK112068CCATGGGCTTTGTTGGGCCGGTGTP-binding protein, HSR1-related domain containing protein. 
AK112068TATTGGGCCGGCCCAAGGTP-binding protein, HSR1-related domain containing protein. 
Os05g0571400009-019-B04GACGGCCCGGCCCAGTTNONE 
009-043-H02GACGGCCCGGCCCAGTTNONE 
AK062369GACGGCCCGGCCCAGTTConserved hypothetical protein. 
Os05g0577200AK069756GCCCGGCCCACTCarboxylesterase, type B family protein. 
Os05g0577900016-028-C02TTGTGGGCCTACATGGGCCGGGCCCATGGNONE 
AK064201TTGTGGGCCTACATGGGCCGGGCCCATGGConserved hypothetical protein. 
Os05g0578000AK065040CCATGGGCCCGGCCCATGTAGGCCCACAASimilar to PEX14 protein. 
J013001H17CCATGGGCCCGGCCCATGTAGGCCCACAANONE 
J013036A06CCATGGGCCCGGCCCATGTAGGCCCACAANONE 
J033122K08CCATGGGCCCGGCCCATGTAGGCCCACAANONE 
Os05g0587400AK102121TCCGGCCCATCPrefoldin domain containing protein. 
J033084N12TCCGGCCCATCNONE 
Os06g0101600AF093636TCCGGCCCAGANONE 
AK070447TCCGGCCCAGAPlastocyanin, chloroplast precursor. 
J065001A20TCCGGCCCAGANONE 
J065019M17TCCGGCCCAGANONE 
J065021H18TCCGGCCCAGANONE 
J065061A17TCCGGCCCAGANONE 
J065073L02TCCGGCCCAGANONE 
J065099F17TCCGGCCCAGANONE 
J065101C23TCCGGCCCAGANONE 
J065121E23TCCGGCCCAGANONE 
J065122N04TCCGGCCCAGANONE 
J065141N05TCCGGCCCAGANONE 
J065143N21TCCGGCCCAGANONE 
J065161H09TCCGGCCCAGANONE 
J065161J04TCCGGCCCAGANONE 
J065162P20TCCGGCCCAGANONE 
J065182K10TCCGGCCCAGANONE 
J065184M05TCCGGCCCAGANONE 
J065186H24TCCGGCCCAGANONE 
J065189G21TCCGGCCCAGANONE 
J065190N14TCCGGCCCAGANONE 
J065191H08TCCGGCCCAGANONE 
J065205H17TCCGGCCCAGANONE 
J075001E03TCCGGCCCAGANONE 
J075001H21TCCGGCCCAGANONE 
J075003J23TCCGGCCCAGANONE 
J075003K01TCCGGCCCAGANONE 
J075005I11TCCGGCCCAGANONE 
J075007F16TCCGGCCCAGANONE 
J075017I11TCCGGCCCAGANONE 
J075018O05TCCGGCCCAGANONE 
J075019G24TCCGGCCCAGANONE 
J075032D04TCCGGCCCAGANONE 
J075032N13TCCGGCCCAGANONE 
J075033C09TCCGGCCCAGANONE 
J075033D11TCCGGCCCAGANONE 
J075039A20TCCGGCCCAGANONE 
J075058P12TCCGGCCCAGANONE 
J075062E10TCCGGCCCAGANONE 
J075062P16TCCGGCCCAGANONE 
J075063C17TCCGGCCCAGANONE 
J075066E07TCCGGCCCAGANONE 
J075066I20TCCGGCCCAGANONE 
J075075K21TCCGGCCCAGANONE 
J075078F03TCCGGCCCAGANONE 
J075082F10TCCGGCCCAGANONE 
J075086G16TCCGGCCCAGANONE 
J075087E07TCCGGCCCAGANONE 
J075087K06TCCGGCCCAGANONE 
J075087L04TCCGGCCCAGANONE 
J075088B16TCCGGCCCAGANONE 
J075088D02TCCGGCCCAGANONE 
J075094H21TCCGGCCCAGANONE 
J075094I24TCCGGCCCAGANONE 
J075094K10TCCGGCCCAGANONE 
J075095C18TCCGGCCCAGANONE 
J075097B05TCCGGCCCAGANONE 
J075099C13TCCGGCCCAGANONE 
J075099H22TCCGGCCCAGANONE 
J075099L16TCCGGCCCAGANONE 
J075104K08TCCGGCCCAGANONE 
J075118O06TCCGGCCCAGANONE 
J075119E15TCCGGCCCAGANONE 
J075124N06TCCGGCCCAGANONE 
J075126G02TCCGGCCCAGANONE 
J075127L24TCCGGCCCAGANONE 
J075131E23TCCGGCCCAGANONE 
J075140H06TCCGGCCCAGANONE 
J075146I20TCCGGCCCAGANONE 
J075146N24TCCGGCCCAGANONE 
J075147I19TCCGGCCCAGANONE 
J075155K07TCCGGCCCAGANONE 
J075156C05TCCGGCCCAGANONE 
J075161G07TCCGGCCCAGANONE 
J075164G01TCCGGCCCAGANONE 
J075170J18TCCGGCCCAGANONE 
J075172G17TCCGGCCCAGANONE 
J075176G10TCCGGCCCAGANONE 
J075178C05TCCGGCCCAGANONE 
J075179G01TCCGGCCCAGANONE 
J075181E24TCCGGCCCAGANONE 
J080029D19TCCGGCCCAGANONE 
J080034L11TCCGGCCCAGANONE 
J080039G07TCCGGCCCAGANONE 
J080062M23TCCGGCCCAGANONE 
J080302A01TCCGGCCCAGANONE 
J100042I15TCCGGCCCAGANONE 
J100043G22TCCGGCCCAGANONE 
J100056L12TCCGGCCCAGANONE 
J100061A12TCCGGCCCAGANONE 
J100073O20TCCGGCCCAGANONE 
J100082I08TCCGGCCCAGANONE 
Os06g0104000AK068490GCCACGTGCCACGGCCCGGCCCGGCCCATGAConserved hypothetical protein. 
Os06g0106100009-197-E09TGTGGGCCGGCNONE 
AK111784TGTGGGCCGGCCwf15/Cwc15 cell cycle control protein family protein. 
AK112060TGTGGGCCGGCNONE 
Os06g0111800AK102134GCCGGCCCAGTNONE 
AK105393GCCGGCCCAGTSimilar to CSLD2 (Fragment). 
Os06g0113600016-067-E03ATTTGGGCCGGANONE 
AK062095ATTTGGGCCGGANONE 
AK101235ATTTGGGCCGGACyclin-like F-box domain containing protein. 
AK122025ATTTGGGCCGGANONE 
J013022O19ATTTGGGCCGGANONE 
J023045P05ATTTGGGCCGGANONE 
J033031K01ATTTGGGCCGGANONE 
J033034I09ATTTGGGCCGGANONE 
J033041O04ATTTGGGCCGGANONE 
J033071K03ATTTGGGCCGGANONE 
J033075K16ATTTGGGCCGGANONE 
J033097M01ATTTGGGCCGGANONE 
J033099M22ATTTGGGCCGGANONE 
J033108N15ATTTGGGCCGGANONE 
J033121D18ATTTGGGCCGGANONE 
J033125O06ATTTGGGCCGGANONE 
J033139M16ATTTGGGCCGGANONE 
J033145P18ATTTGGGCCGGANONE 
J033149D05ATTTGGGCCGGANONE 
Os06g0114600015-077-E06CCTGGGCCGGGCCNONE 
015-077-E06TCCGGCCCAGTANONE 
AK067972CCTGGGCCGGGCCConserved hypothetical protein. 
AK067972TCCGGCCCAGTAConserved hypothetical protein. 
Os06g0131100AK112079CCAGGCCCAGCCCTCCGGCCCACTWD40-like domain containing protein. 
J033066L01CCAGGCCCAGCCCTCCGGCCCACTNONE 
J100044P22CCAGGCCCAGCCCTCCGGCCCACTNONE 
Os06g0134000AK102796TCCGGCCCAACCGGCCCACCCNONE 
Os06g0136000AK060303ACCGGCCCAATSimilar to Hypersensitive-induced reaction protein 4. 
AK102678ACCGGCCCAATNONE 
J075185K19ACCGGCCCAATNONE 
J090028C16ACCGGCCCAATNONE 
J090099N12ACCGGCCCAATNONE 
J100070O10ACCGGCCCAATNONE 
Os06g0137500AK072896CCCGGCCCACTBrix domain containing protein. 
AK121945CCCGGCCCACTNONE 
Os06g0140100011-063-A02TGTTGGGCCGGGCCGTGNONE 
AK063371TGTTGGGCCGGGCCGTGLeucine carboxyl methyltransferase family protein. 
Os06g0152800003-125-D04ATTTGGGCCGGCCCAGGNONE 
AK099578ATTTGGGCCGGCCCAGGConserved hypothetical protein. 
Os06g0156700AK107226GCCGGCCCAGCCCLipolytic enzyme, G-D-S-L family protein. 
J075021O05GCCGGCCCAGCCCNONE 
J075023M12GCCGGCCCAGCCCNONE 
J075041C14GCCGGCCCAGCCCNONE 
J075041C19GCCGGCCCAGCCCNONE 
J075064F08GCCGGCCCAGCCCNONE 
J075116I03GCCGGCCCAGCCCNONE 
J075123I02GCCGGCCCAGCCCNONE 
Os06g0157800AK121504TATTGGGCCGGCCCSimilar to CG7224 (Fragment). 
AK121504TCATGGGCCGGASimilar to CG7224 (Fragment). 
AK121504TCGGCCCGGCCCAGTTSimilar to CG7224 (Fragment). 
J033022L20TATTGGGCCGGCCCNONE 
J033022L20TCATGGGCCGGANONE 
J033022L20TCGGCCCGGCCCAGTTNONE 
J075033D09TATTGGGCCGGCCCNONE 
J075033D09TCATGGGCCGGANONE 
J075033D09TCGGCCCGGCCCAGTTNONE 
Os06g0168000AK059250CTTGGGCCGGGCCNONE 
AK059250TGTGGGCCGGANONE 
AK099356CTTGGGCCGGGCCGlutathione S-transferase, C-terminal-like domain containing protein. 
AK099356TGTGGGCCGGAGlutathione S-transferase, C-terminal-like domain containing protein. 
J033040E19CTTGGGCCGGGCCNONE 
J033040E19TGTGGGCCGGANONE 
J033097H04CTTGGGCCGGGCCNONE 
J033097H04TGTGGGCCGGANONE 
J075087M11CTTGGGCCGGGCCNONE 
J075087M11TGTGGGCCGGANONE 
J075146H06CTTGGGCCGGGCCNONE 
J075146H06TGTGGGCCGGANONE 
J075188H11CTTGGGCCGGGCCNONE 
J075188H11TGTGGGCCGGANONE 
J090071D03CTTGGGCCGGGCCNONE 
J090071D03TGTGGGCCGGANONE 
J090097L20CTTGGGCCGGGCCNONE 
J090097L20TGTGGGCCGGANONE 
J100051M05CTTGGGCCGGGCCNONE 
J100051M05TGTGGGCCGGANONE 
J100082H13CTTGGGCCGGGCCNONE 
J100082H13TGTGGGCCGGANONE 
Os06g0174350J043034B05AGTGGGCCTAGTTGGGCCGGAConserved hypothetical protein. 
J043034B05CCCGGCCCACTConserved hypothetical protein. 
Os06g0232000006-109-B11ACCGGCCCACCNONE 
011-080-C04ACCGGCCCACCNONE 
016-019-G01ACCGGCCCACCNONE 
AB110192ACCGGCCCACCNONE 
AK068966ACCGGCCCACCNONE 
AK071776ACCGGCCCACCConserved hypothetical protein. 
AK106053ACCGGCCCACCNONE 
J013146K14ACCGGCCCACCNONE 
J023013A10ACCGGCCCACCNONE 
J023029O20ACCGGCCCACCNONE 
J023110G05ACCGGCCCACCNONE 
J023135H04ACCGGCCCACCNONE 
J033125H14ACCGGCCCACCNONE 
J043009N01ACCGGCCCACCNONE 
J090096E06ACCGGCCCACCNONE 
J100070G19ACCGGCCCACCNONE 
Os06g0236200J075111M01ACCGGCCCACACConserved hypothetical protein. 
J075171D01ACCGGCCCACACNONE 
Os06g0247800AK102187GGCCCGGCCCAACCSimilar to Dynamin-like protein (Fragment). 
AY224491GGCCCGGCCCAACCNONE 
Os06g0251000J033111L12GCCGGCCCATCANONE 
J043001C08GCCGGCCCATCAMolybdenum cofactor biosynthesis domain containing protein. 
Os06g0275500AK111743AATGGGCCGGGSimilar to Polycomb protein EZ1 (Enhancer of zeste protein 1). 
Os06g0291100J043017O10CCGAGCCGGCCCAAGTCAGCCCACAAHypothetical protein. 
J043017O10CTTGGGCTTCCGGCCCAGCHypothetical protein. 
Os06g0316100011-089-C01ACATGGGCCGGGCCCAGGNONE 
015-030-D11ACATGGGCCGGGCCCAGGNONE 
015-044-H10ACATGGGCCGGGCCCAGGNONE 
AK105260ACATGGGCCGGGCCCAGGConserved hypothetical protein. 
AK119646ACATGGGCCGGGCCCAGGNONE 
Os06g0319700AK120884GGCCCGGCCCAACGCCCAGCCCSimilar to 60S ribosomal protein L31. 
J013089A14GGCCCGGCCCAACGCCCAGCCCNONE 
J023028N24GGCCCGGCCCAACGCCCAGCCCNONE 
J033098H21GGCCCGGCCCAACGCCCAGCCCNONE 
J033118G04GGCCCGGCCCAACGCCCAGCCCNONE 
J090056P15GGCCCGGCCCAACGCCCAGCCCNONE 
J090062B02GGCCCGGCCCAACGCCCAGCCCNONE 
J100024B09GGCCCGGCCCAACGCCCAGCCCNONE 
J100060I04GGCCCGGCCCAACGCCCAGCCCNONE 
J100078H11GGCCCGGCCCAACGCCCAGCCCNONE 
J100080A14GGCCCGGCCCAACGCCCAGCCCNONE 
J100086F18GGCCCGGCCCAACGCCCAGCCCNONE 
Os06g0332500009-108-G06ACCGGCCCAGTNONE 
009-119-F06ACCGGCCCAGTNONE 
AK121262ACCGGCCCAGTConserved hypothetical protein. 
J023104L05ACCGGCCCAGTNONE 
J033022F22ACCGGCCCAGTNONE 
Os06g0332600AK121615GCCGGCCCACCAConserved hypothetical protein. 
J033044B19GCCGGCCCACCANONE 
Os06g0334600AK064993CCCGGCCCACGCGHypothetical protein. 
J013001D16CCCGGCCCACGCGNONE 
J043009I09CCCGGCCCACGCGNONE 
Os06g0498500AK099764GCAGCCCACCCGACTGGGCCGGTNONE 
AK103794GCAGCCCACCCGACTGGGCCGGTNucleolar complex-associated family protein. 
AK121899GCAGCCCACCCGACTGGGCCGGTNONE 
Os06g0499900J065053E01CGATGGGCCGGCCGATGGGCTNONE 
J065078C19CGATGGGCCGGCCGATGGGCTNONE 
J065122P11CGATGGGCCGGCCGATGGGCTNONE 
J065209B15CGATGGGCCGGCCGATGGGCTNONE 
J065218E19CGATGGGCCGGCCGATGGGCTNONE 
Os06g0530200009-042-B02ACCGGCCCAGCNONE 
009-042-B02TGTTGGGCCGGGCCNONE 
009-050-E10ACCGGCCCAGCNONE 
009-050-E10TGTTGGGCCGGGCCNONE 
009-060-F07ACCGGCCCAGCNONE 
009-060-F07TGTTGGGCCGGGCCNONE 
009-117-H08ACCGGCCCAGCNONE 
009-117-H08TGTTGGGCCGGGCCNONE 
009-129-C10ACCGGCCCAGCNONE 
009-129-C10TGTTGGGCCGGGCCNONE 
AK073116ACCGGCCCAGCConserved hypothetical protein. 
AK073116TGTTGGGCCGGGCCConserved hypothetical protein. 
AK104077ACCGGCCCAGCNONE 
AK104077TGTTGGGCCGGGCCNONE 
J065032N16ACCGGCCCAGCNONE 
J065032N16TGTTGGGCCGGGCCNONE 
J065153K07ACCGGCCCAGCNONE 
J065153K07TGTTGGGCCGGGCCNONE 
J065169N18ACCGGCCCAGCNONE 
J065169N18TGTTGGGCCGGGCCNONE 
J065190H18ACCGGCCCAGCNONE 
J065190H18TGTTGGGCCGGGCCNONE 
J075127E14ACCGGCCCAGCNONE 
J075127E14TGTTGGGCCGGGCCNONE 
J090008F20ACCGGCCCAGCNONE 
J090008F20TGTTGGGCCGGGCCNONE 
Os06g0551400009-003-D11CCCACCCGGCCCGGCCCACANONE 
011-025-C09CCCACCCGGCCCGGCCCACANONE 
AK066548CCCACCCGGCCCGGCCCACARas-related protein RIC2. 
D13758CCCACCCGGCCCGGCCCACANONE 
J013069H14CCCACCCGGCCCGGCCCACANONE 
J053037J07CCCACCCGGCCCGGCCCACANONE 
J065011J03CCCACCCGGCCCGGCCCACANONE 
J065078L15CCCACCCGGCCCGGCCCACANONE 
J065103H24CCCACCCGGCCCGGCCCACANONE 
J065157A07CCCACCCGGCCCGGCCCACANONE 
J065213P12CCCACCCGGCCCGGCCCACANONE 
J090007P04CCCACCCGGCCCGGCCCACANONE 
J090052N23CCCACCCGGCCCGGCCCACANONE 
Os06g0560400AK103575GCCGGCCCATCGNONE 
AK108074GCCGGCCCATCGProtein of unknown function DUF862, eukaryotic domain containing protein. 
Os06g0567000009-166-G12CCCACCTGTTGGGCCGGGCCCACTNONE 
AK121337CCCACCTGTTGGGCCGGGCCCACTProtein of unknown function UPF0197 family protein. 
J013122F01CCCACCTGTTGGGCCGGGCCCACTNONE 
J023080N12CCCACCTGTTGGGCCGGGCCCACTNONE 
J023120F03CCCACCTGTTGGGCCGGGCCCACTNONE 
J065013B18CCCACCTGTTGGGCCGGGCCCACTNONE 
J065039P21CCCACCTGTTGGGCCGGGCCCACTNONE 
J065089E06CCCACCTGTTGGGCCGGGCCCACTNONE 
J065095N19CCCACCTGTTGGGCCGGGCCCACTNONE 
J065119H03CCCACCTGTTGGGCCGGGCCCACTNONE 
J065121D18CCCACCTGTTGGGCCGGGCCCACTNONE 
J065149G04CCCACCTGTTGGGCCGGGCCCACTNONE 
J075012J04CCCACCTGTTGGGCCGGGCCCACTNONE 
J075021G13CCCACCTGTTGGGCCGGGCCCACTNONE 
J075106I23CCCACCTGTTGGGCCGGGCCCACTNONE 
J075107F19CCCACCTGTTGGGCCGGGCCCACTNONE 
J075152J22CCCACCTGTTGGGCCGGGCCCACTNONE 
J075186J20CCCACCTGTTGGGCCGGGCCCACTNONE 
J075188F16CCCACCTGTTGGGCCGGGCCCACTNONE 
J080001G06CCCACCTGTTGGGCCGGGCCCACTNONE 
J080002O09CCCACCTGTTGGGCCGGGCCCACTNONE 
J080006E10CCCACCTGTTGGGCCGGGCCCACTNONE 
J080006F24CCCACCTGTTGGGCCGGGCCCACTNONE 
J080012L07CCCACCTGTTGGGCCGGGCCCACTNONE 
J080016A10CCCACCTGTTGGGCCGGGCCCACTNONE 
J080017D11CCCACCTGTTGGGCCGGGCCCACTNONE 
J080017I04CCCACCTGTTGGGCCGGGCCCACTNONE 
J080017I10CCCACCTGTTGGGCCGGGCCCACTNONE 
J080020P06CCCACCTGTTGGGCCGGGCCCACTNONE 
J080024A20CCCACCTGTTGGGCCGGGCCCACTNONE 
J080027B10CCCACCTGTTGGGCCGGGCCCACTNONE 
J080027E03CCCACCTGTTGGGCCGGGCCCACTNONE 
J080027I01CCCACCTGTTGGGCCGGGCCCACTNONE 
J080027K20CCCACCTGTTGGGCCGGGCCCACTNONE 
J080041L12CCCACCTGTTGGGCCGGGCCCACTNONE 
J080043D21CCCACCTGTTGGGCCGGGCCCACTNONE 
J080044K11CCCACCTGTTGGGCCGGGCCCACTNONE 
J080048I08CCCACCTGTTGGGCCGGGCCCACTNONE 
J080049M12CCCACCTGTTGGGCCGGGCCCACTNONE 
J080050C14CCCACCTGTTGGGCCGGGCCCACTNONE 
J080050N21CCCACCTGTTGGGCCGGGCCCACTNONE 
J080053F04CCCACCTGTTGGGCCGGGCCCACTNONE 
J080054O16CCCACCTGTTGGGCCGGGCCCACTNONE 
J080058O21CCCACCTGTTGGGCCGGGCCCACTNONE 
J080059M11CCCACCTGTTGGGCCGGGCCCACTNONE 
J080061A11CCCACCTGTTGGGCCGGGCCCACTNONE 
J080063B15CCCACCTGTTGGGCCGGGCCCACTNONE 
J080063F22CCCACCTGTTGGGCCGGGCCCACTNONE 
J080066M18CCCACCTGTTGGGCCGGGCCCACTNONE 
J080068D12CCCACCTGTTGGGCCGGGCCCACTNONE 
J080070D22CCCACCTGTTGGGCCGGGCCCACTNONE 
J080071B06CCCACCTGTTGGGCCGGGCCCACTNONE 
J080072B17CCCACCTGTTGGGCCGGGCCCACTNONE 
J080081O04CCCACCTGTTGGGCCGGGCCCACTNONE 
J080089H05CCCACCTGTTGGGCCGGGCCCACTNONE 
J080093K13CCCACCTGTTGGGCCGGGCCCACTNONE 
J080095I05CCCACCTGTTGGGCCGGGCCCACTNONE 
J080097F19CCCACCTGTTGGGCCGGGCCCACTNONE 
J080304C03CCCACCTGTTGGGCCGGGCCCACTNONE 
J080304H11CCCACCTGTTGGGCCGGGCCCACTNONE 
J080308M21CCCACCTGTTGGGCCGGGCCCACTNONE 
J080313O15CCCACCTGTTGGGCCGGGCCCACTNONE 
J090020N23CCCACCTGTTGGGCCGGGCCCACTNONE 
J100023C12CCCACCTGTTGGGCCGGGCCCACTNONE 
Os06g0585200016-065-C02CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCNONE 
AK068592CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCNONE 
AK073844CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCNONE 
AK106549CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCConserved hypothetical protein. 
J013154A14CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCNONE 
J100049K24CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCNONE 
J100059C18CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCNONE 
J100082N13CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCNONE 
Os06g0592500AK119729CTGGGCTTGGTGGGCCGGTSimilar to Ethylene-responsive transcriptional coactivator. 
AK122052CTGGGCTTGGTGGGCCGGTNONE 
Os06g0642900AK073896GCCCACCCGGCCCACGCUbiquitin system component Cue domain containing protein. 
J033042P11GCCCACCCGGCCCACGCNONE 
J033072G12GCCCACCCGGCCCACGCNONE 
J090050C02GCCCACCCGGCCCACGCNONE 
Os06g0643000AK067701GCCGGCCCACCACCAACPhox-like domain containing protein. 
J013032G04GCCGGCCCACCACCAACNONE 
J013044B17GCCGGCCCACCACCAACNONE 
J013114M13GCCGGCCCACCACCAACNONE 
J023133A02GCCGGCCCACCACCAACNONE 
J043022A07GCCGGCCCACCACCAACNONE 
J075046O21GCCGGCCCACCACCAACNONE 
J075142L01GCCGGCCCACCACCAACNONE 
J090076I16GCCGGCCCACCACCAACNONE 
J100056O17GCCGGCCCACCACCAACNONE 
Os06g0647900AK073750ACCGGCCCAGATConserved hypothetical protein. 
J033029K17ACCGGCCCAGATNONE 
J033070L21ACCGGCCCAGATNONE 
Os06g0650100009-016-C02ACCGGCCCACCTNONE 
AK062354ACCGGCCCACCTSimilar to Polyubiquitin gene (Fragment). 
Os06g0677600009-200-F02GGTTGGGCCGGANONE 
AK063252GGTTGGGCCGGALike-Sm ribonucleoprotein, core family protein. 
J075028G10GGTTGGGCCGGANONE 
J075189D08GGTTGGGCCGGANONE 
J090045C02GGTTGGGCCGGANONE 
Os06g0682800011-092-E01GCCGGGCCACATGGGCCGGANONE 
AK064816GCCGGGCCACATGGGCCGGAZinc finger, CCCH-type domain containing protein. 
J013000E13GCCGGGCCACATGGGCCGGANONE 
J013035J22GCCGGGCCACATGGGCCGGANONE 
J013045M06GCCGGGCCACATGGGCCGGANONE 
J013120A07GCCGGGCCACATGGGCCGGANONE 
J033144H15GCCGGGCCACATGGGCCGGANONE 
J033145H15GCCGGGCCACATGGGCCGGANONE 
J033145N16GCCGGGCCACATGGGCCGGANONE 
J090019J02GCCGGGCCACATGGGCCGGANONE 
Os06g0693000AK064280TCTGGGCCGGGCCGTGProtein kinase-like domain containing protein. 
Os06g0694500AK067484GCCGGCCCATCTCGGCCCATGASimilar to Nitrogen fixation like protein. 
AK103983GCCGGCCCATCTCGGCCCATGANONE 
Os06g0704300AK107008ATCTGGGCCGGGCCCZinc finger, CCCH-type domain containing protein. 
J065038I12ATCTGGGCCGGGCCCNONE 
J065079E03ATCTGGGCCGGGCCCNONE 
J075035B15ATCTGGGCCGGGCCCNONE 
J090072D21ATCTGGGCCGGGCCCNONE 
Os06g0712900AK106648ACATGGGCCGGADihydrouridine synthase, DuS family protein. 
J075055M19ACATGGGCCGGANONE 
J075122I03ACATGGGCCGGANONE 
Os06g0715000AK107114GGGCTGGGCCGGCConserved hypothetical protein. 
AK107114TAATGGGCCGGAConserved hypothetical protein. 
Os06g0717400AK072887GCCGGCCCGGCCCATTTPseudouridine synthase, Rlu family protein. 
Os06g0725400J065086O07AATGGGCCGGGCCGGTSimilar to BLE1 protein. 
J065114J19AATGGGCCGGGCCGGTNONE 
Os07g0101500AK059667GCCGGCCCACGANONE 
AK071749GCCGGCCCACGASimilar to Sterol 4-alpha-methyl-oxidase (Fragment). 
J023112L07GCCGGCCCACGANONE 
J065050F03GCCGGCCCACGANONE 
J090015C05GCCGGCCCACGANONE 
J090045C11GCCGGCCCACGANONE 
Os07g0105300AK107419GCCGGCCCACGGGConserved hypothetical protein. 
AK107419GCCGGGCCTGGGCCGGCConserved hypothetical protein. 
AK109521GCCGGCCCACGGGNONE 
AK109521GCCGGGCCTGGGCCGGCNONE 
Os07g0110100009-059-D11TATTGGGCCGGANONE 
AK071499TATTGGGCCGGAConserved hypothetical protein. 
J065064P17TATTGGGCCGGANONE 
J065111B09TATTGGGCCGGANONE 
J075099A14TATTGGGCCGGANONE 
J075139C23TATTGGGCCGGANONE 
Os07g0110800009-107-B11GGCCCGGCCCATCANONE 
AK062792GGCCCGGCCCATCAConserved hypothetical protein. 
J053026P09GGCCCGGCCCATCANONE 
J053074L17GGCCCGGCCCATCANONE 
J065057E24GGCCCGGCCCATCANONE 
J065149B18GGCCCGGCCCATCANONE 
J075002O20GGCCCGGCCCATCANONE 
J090002C13GGCCCGGCCCATCANONE 
Os07g0110900AK058987TGATGGGCCGGGCCConserved hypothetical protein. 
J065032L02TGATGGGCCGGGCCNONE 
J065074H06TGATGGGCCGGGCCNONE 
J065168M23TGATGGGCCGGGCCNONE 
Os07g0112800AK058206CCCGGCCCATTTSimilar to Eukaryotic translation initiation factor 5A-4 (eIF-5A-4). 
J023052P13CCCGGCCCATTTNONE 
J033064G11CCCGGCCCATTTNONE 
J065044F12CCCGGCCCATTTNONE 
J065047I05CCCGGCCCATTTNONE 
J065059P17CCCGGCCCATTTNONE 
J065180P17CCCGGCCCATTTNONE 
J075131M22CCCGGCCCATTTNONE 
Os07g0113200AK108787GGCCCGGCCCATCAConserved hypothetical protein. 
J065090J04GGCCCGGCCCATCANONE 
J065116K24GGCCCGGCCCATCANONE 
J065161F14GGC