version

Summary of OsREG543 (All List)

OrganismOryza sativa  
IDOsREG543  
SequenceCCGGGCCC  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count1853  

Entry Sequences (1853 entries)

LocusGene modelSequenceDescription
Os01g0100700006-066-G10CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
009-108-B10CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
AK059844CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
AK121523CCTGGGCCGGGCCCGGCCCAGCCCAACASimilar to 40S ribosomal protein S5-1. 
J023037D16CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J033028P14CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J033064M07CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J033123M01CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J065026O07CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J065082A05CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J075003I02CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J075170J15CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J100040D18CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
Os01g0131600006-030-A03CGCGTGGGCCCGGANONE 
006-049-C10CGCGTGGGCCCGGANONE 
006-054-E02CGCGTGGGCCCGGANONE 
011-035-H02CGCGTGGGCCCGGANONE 
011-036-E04CGCGTGGGCCCGGANONE 
012-047-C08CGCGTGGGCCCGGANONE 
012-079-F08CGCGTGGGCCCGGANONE 
012-097-C02CGCGTGGGCCCGGANONE 
012-100-A07CGCGTGGGCCCGGANONE 
013-015-H05CGCGTGGGCCCGGANONE 
013-047-A03CGCGTGGGCCCGGANONE 
013-051-B05CGCGTGGGCCCGGANONE 
013-061-G02CGCGTGGGCCCGGANONE 
013-077-H02CGCGTGGGCCCGGANONE 
015-005-D04CGCGTGGGCCCGGANONE 
015-064-B06CGCGTGGGCCCGGANONE 
015-072-D02CGCGTGGGCCCGGANONE 
016-073-E09CGCGTGGGCCCGGANONE 
016-088-H03CGCGTGGGCCCGGANONE 
AK062063CGCGTGGGCCCGGANONE 
AK101133CGCGTGGGCCCGGASimilar to AP2 domain containing protein RAP2.6 (Fragment). 
AK102277CGCGTGGGCCCGGANONE 
AK119645CGCGTGGGCCCGGANONE 
AY341828CGCGTGGGCCCGGANONE 
J013036O08CGCGTGGGCCCGGANONE 
J013037M17CGCGTGGGCCCGGANONE 
J013039B11CGCGTGGGCCCGGANONE 
J013039L20CGCGTGGGCCCGGANONE 
J013047B20CGCGTGGGCCCGGANONE 
J013048E23CGCGTGGGCCCGGANONE 
J013051E12CGCGTGGGCCCGGANONE 
J013051F12CGCGTGGGCCCGGANONE 
J013056B05CGCGTGGGCCCGGANONE 
J013057N24CGCGTGGGCCCGGANONE 
J013064D21CGCGTGGGCCCGGANONE 
J013065G24CGCGTGGGCCCGGANONE 
J013075L13CGCGTGGGCCCGGANONE 
J013075L24CGCGTGGGCCCGGANONE 
J013092F04CGCGTGGGCCCGGANONE 
J013092F10CGCGTGGGCCCGGANONE 
J013092M16CGCGTGGGCCCGGANONE 
J013096K06CGCGTGGGCCCGGANONE 
J013111F10CGCGTGGGCCCGGANONE 
J013120B17CGCGTGGGCCCGGANONE 
J013120P07CGCGTGGGCCCGGANONE 
J013122F18CGCGTGGGCCCGGANONE 
J013122H23CGCGTGGGCCCGGANONE 
J013126I15CGCGTGGGCCCGGANONE 
J013126L17CGCGTGGGCCCGGANONE 
J013129C15CGCGTGGGCCCGGANONE 
J013146A04CGCGTGGGCCCGGANONE 
J013146A06CGCGTGGGCCCGGANONE 
J013153F01CGCGTGGGCCCGGANONE 
J013156O06CGCGTGGGCCCGGANONE 
J013162D05CGCGTGGGCCCGGANONE 
J023008N04CGCGTGGGCCCGGANONE 
J023010D06CGCGTGGGCCCGGANONE 
J023011I23CGCGTGGGCCCGGANONE 
J023023I15CGCGTGGGCCCGGANONE 
J023025C08CGCGTGGGCCCGGANONE 
J023029H02CGCGTGGGCCCGGANONE 
J023033C18CGCGTGGGCCCGGANONE 
J023037D21CGCGTGGGCCCGGANONE 
J023049F17CGCGTGGGCCCGGANONE 
J023052B15CGCGTGGGCCCGGANONE 
J023061D03CGCGTGGGCCCGGANONE 
J023062M01CGCGTGGGCCCGGANONE 
J023089D24CGCGTGGGCCCGGANONE 
J023109J20CGCGTGGGCCCGGANONE 
J023109M21CGCGTGGGCCCGGANONE 
J023120N04CGCGTGGGCCCGGANONE 
J023122A04CGCGTGGGCCCGGANONE 
J023134F23CGCGTGGGCCCGGANONE 
J023149E20CGCGTGGGCCCGGANONE 
J033022A12CGCGTGGGCCCGGANONE 
J033022C04CGCGTGGGCCCGGANONE 
J033024K06CGCGTGGGCCCGGANONE 
J033026F23CGCGTGGGCCCGGANONE 
J033029J19CGCGTGGGCCCGGANONE 
J033040H20CGCGTGGGCCCGGANONE 
J033042P21CGCGTGGGCCCGGANONE 
J033043F14CGCGTGGGCCCGGANONE 
J033044G11CGCGTGGGCCCGGANONE 
J033052L10CGCGTGGGCCCGGANONE 
J033052O03CGCGTGGGCCCGGANONE 
J033052P03CGCGTGGGCCCGGANONE 
J033079B20CGCGTGGGCCCGGANONE 
J033089D21CGCGTGGGCCCGGANONE 
J033094P04CGCGTGGGCCCGGANONE 
J033103N02CGCGTGGGCCCGGANONE 
J033110J19CGCGTGGGCCCGGANONE 
J033114E17CGCGTGGGCCCGGANONE 
J033115K04CGCGTGGGCCCGGANONE 
J033119I06CGCGTGGGCCCGGANONE 
J033121L10CGCGTGGGCCCGGANONE 
J033123H14CGCGTGGGCCCGGANONE 
J033136H10CGCGTGGGCCCGGANONE 
J033139L07CGCGTGGGCCCGGANONE 
J033143G23CGCGTGGGCCCGGANONE 
J043021F16CGCGTGGGCCCGGANONE 
J080304G01CGCGTGGGCCCGGANONE 
J080305H24CGCGTGGGCCCGGANONE 
J080309B11CGCGTGGGCCCGGANONE 
J080315N09CGCGTGGGCCCGGANONE 
J080319J20CGCGTGGGCCCGGANONE 
J090014D01CGCGTGGGCCCGGANONE 
J090067F08CGCGTGGGCCCGGANONE 
J090079P18CGCGTGGGCCCGGANONE 
J090082K13CGCGTGGGCCCGGANONE 
J090093K17CGCGTGGGCCCGGANONE 
J090099G18CGCGTGGGCCCGGANONE 
J100022K14CGCGTGGGCCCGGANONE 
J100052G17CGCGTGGGCCCGGANONE 
Os01g0144600006-037-H02ACCGGGCCCACANONE 
AK061501ACCGGGCCCACAConserved hypothetical protein. 
AK102823ACCGGGCCCACANONE 
J033108P10ACCGGGCCCACANONE 
J043026K08ACCGGGCCCACANONE 
J090009H21ACCGGGCCCACANONE 
Os01g0147200016-005-F02GGGCCCGGCCCATCANONE 
AK106463GGGCCCGGCCCATCANONE 
AK121921GGGCCCGGCCCATCAIWS1, C-terminal family protein. 
J033098O16GGGCCCGGCCCATCANONE 
J033106E16GGGCCCGGCCCATCANONE 
J043026D12GGGCCCGGCCCATCANONE 
J065070B04GGGCCCGGCCCATCANONE 
J065162L03GGGCCCGGCCCATCANONE 
J065166F01GGGCCCGGCCCATCANONE 
J075030A13GGGCCCGGCCCATCANONE 
J075093O12GGGCCCGGCCCATCANONE 
J075106K15GGGCCCGGCCCATCANONE 
J075107F20GGGCCCGGCCCATCANONE 
J090031F21GGGCCCGGCCCATCANONE 
J090079E17GGGCCCGGCCCATCANONE 
Os01g0184800AK073377CACTGACAGCCCGGGCCCACCPhosducin family protein. 
AK102544CACTGACAGCCCGGGCCCACCNONE 
J023047L21CACTGACAGCCCGGGCCCACCNONE 
J023135I09CACTGACAGCCCGGGCCCACCNONE 
J033028G17CACTGACAGCCCGGGCCCACCNONE 
J065164L07CACTGACAGCCCGGGCCCACCNONE 
J065193F22CACTGACAGCCCGGGCCCACCNONE 
J075035I10CACTGACAGCCCGGGCCCACCNONE 
J075168H15CACTGACAGCCCGGGCCCACCNONE 
Os01g0192550J065164G16CACGGCCCATGGGCCCGGCConserved hypothetical protein. 
Os01g0218700AK064992CGCGTGGGCCCGGCABC transporter, transmembrane region, type 1 domain containing protein. 
Os01g0239700AK067723ACCGGGCCCACAASimilar to Leucine-rich receptor-like protein kinase. 
AK122130ACCGGGCCCACAANONE 
Os01g0246500AK058984TCCGGGCCGGGCCCAAAASimilar to Minus dominance protein. 
Os01g0254900AK068204CGTGTGGGGCCCGGASimilar to Syntaxin 22 (AtSYP22) (AtVAM3). 
AY789530CGTGTGGGGCCCGGANONE 
Os01g0283400AK119993ACCGGGCCCConserved hypothetical protein. 
Os01g0286000AK109824AGATGGGCCGGGCCCSnf7 family protein. 
Os01g0506200AK073118CCCGGGCCCCGCCCCACATetratricopeptide-like helical domain containing protein. 
J065002A07CCCGGGCCCCGCCCCACANONE 
J065079J08CCCGGGCCCCGCCCCACANONE 
J065167M18CCCGGGCCCCGCCCCACANONE 
Os01g0527700006-102-G07AACGGGCCCGGCCCATGNONE 
012-094-B11AACGGGCCCGGCCCATGNONE 
015-096-C04AACGGGCCCGGCCCATGNONE 
AK061861AACGGGCCCGGCCCATGProtoheme IX farnesyltransferase family protein. 
AK099005AACGGGCCCGGCCCATGNONE 
J013109B04AACGGGCCCGGCCCATGNONE 
J033057L14AACGGGCCCGGCCCATGNONE 
J090072H04AACGGGCCCGGCCCATGNONE 
J100030A14AACGGGCCCGGCCCATGNONE 
Os01g0666500AK102689GGCCGGGCCCACTConserved hypothetical protein. 
Os01g0720700J033124M22TCCGGGCCCACGCNONE 
J065006G21TCCGGGCCCACGCNONE 
J065025M24TCCGGGCCCACGCNONE 
J065041J02TCCGGGCCCACGCNONE 
J065044B14TCCGGGCCCACGCNONE 
J065061J06TCCGGGCCCACGCNONE 
J065116L21TCCGGGCCCACGCNONE 
J075030F18TCCGGGCCCACGCNONE 
J075034K17TCCGGGCCCACGCNONE 
J075063I02TCCGGGCCCACGCNONE 
J075110D21TCCGGGCCCACGCSimilar to Serine acetyltransferase. 
J075188L15TCCGGGCCCACGCNONE 
J075197B17TCCGGGCCCACGCNONE 
Os01g0764800AK102809GGGGCCCGGGSimilar to Nt-gh3 deduced protein. 
Os01g0767600AK070672CCCGGGCCCCConserved hypothetical protein. 
J013131M12CCCGGGCCCCNONE 
J023027B15CCCGGGCCCCNONE 
J023059I06CCCGGGCCCCNONE 
J023095L05CCCGGGCCCCNONE 
J033033E20CCCGGGCCCCNONE 
J033105F24CCCGGGCCCCNONE 
J033148N05CCCGGGCCCCNONE 
J065060H14CCCGGGCCCCNONE 
J090093E17CCCGGGCCCCNONE 
Os01g0770500AK071653ACCGGGCCCCNONE 
AK099603ACCGGGCCCCSimilar to ABC transporter ATP-binding protein. 
Os01g0816100012-082-H02GGGCCGGGCCCACCTGCAGCCCACGTNONE 
AB028183GGGCCGGGCCCACCTGCAGCCCACGTNONE 
AK073848GGGCCGGGCCCACCTGCAGCCCACGTNONE 
AY986504GGGCCGGGCCCACCTGCAGCCCACGTSimilar to NAC domain protein. 
J100061B19GGGCCGGGCCCACCTGCAGCCCACGTNONE 
Os01g0818600AK066550TGTGGGCCCGGTLeucine rich repeat, N-terminal domain containing protein. 
Os01g0837600AK108007CGGGTGGGCCCGGCConserved hypothetical protein 1589, plant family protein. 
J065005C19CGGGTGGGCCCGGCNONE 
J065025H20CGGGTGGGCCCGGCNONE 
J065061E22CGGGTGGGCCCGGCNONE 
J065065F14CGGGTGGGCCCGGCNONE 
J065083O21CGGGTGGGCCCGGCNONE 
J065201G05CGGGTGGGCCCGGCNONE 
Os01g0855600003-004-C02GGGCCCGGCCCACCCGNONE 
016-023-G11GGGCCCGGCCCACCCGNONE 
AK099776GGGCCCGGCCCACCCGSimilar to Hs1pro-1 protein. 
AY224522GGGCCCGGCCCACCCGNONE 
J013095E24GGGCCCGGCCCACCCGNONE 
J023041J04GGGCCCGGCCCACCCGNONE 
J065130B09GGGCCCGGCCCACCCGNONE 
J075031B02GGGCCCGGCCCACCCGNONE 
J075069H11GGGCCCGGCCCACCCGNONE 
J100026O10GGGCCCGGCCCACCCGNONE 
J100050J01GGGCCCGGCCCACCCGNONE 
J100052G04GGGCCCGGCCCACCCGNONE 
J100053D07GGGCCCGGCCCACCCGNONE 
J100054K16GGGCCCGGCCCACCCGNONE 
J100067A06GGGCCCGGCCCACCCGNONE 
J100067G01GGGCCCGGCCCACCCGNONE 
J100088C18GGGCCCGGCCCACCCGNONE 
Os01g0865100016-066-A05TCCGGGCCCCACCNONE 
AK065779TCCGGGCCCCACCNONE 
AK071410TCCGGGCCCCACCSimilar to Uricase (Fragment). 
J013039E23TCCGGGCCCCACCNONE 
J023024I07TCCGGGCCCCACCNONE 
J065160J15TCCGGGCCCCACCNONE 
J090052J17TCCGGGCCCCACCNONE 
Os01g0866300006-029-F08GGCCGGGCCCACTNONE 
006-074-E10GGCCGGGCCCACTNONE 
006-079-E11GGCCGGGCCCACTNONE 
009-048-A05GGCCGGGCCCACTNONE 
AK059875GGCCGGGCCCACTNONE 
J043005O17GGCCGGGCCCACTNONE 
Os01g0877500AK101067GGTGGGCCCGGAProtein of unknown function UPF0054 family protein. 
Os01g0887700AF045571CGTGGACCGGGCCCATGNONE 
AF047428CGTGGACCGGGCCCATGNONE 
AK071139CGTGGACCGGGCCCATGZinc finger, FYVE/PHD-type domain containing protein. 
J023082D05CGTGGACCGGGCCCATGNONE 
J065062L19CGTGGACCGGGCCCATGNONE 
J065116H15CGTGGACCGGGCCCATGNONE 
J065194N09CGTGGACCGGGCCCATGNONE 
J100074C19CGTGGACCGGGCCCATGNONE 
Os01g0913900AK110828GCCGGGCCCConserved hypothetical protein. 
Os01g0915800AK103859TTTTGGGCCGGGCCCAAACSimilar to FK506-binding protein 2-2 precursor (EC 5.2.1.8) (Peptidyl-prolyl cis- trans isomerase) (PPIase) (Rotamase) (15 kDa FKBP) (FKBP-15-2). 
J090051E20TTTTGGGCCGGGCCCAAACNONE 
J090056H03TTTTGGGCCGGGCCCAAACNONE 
J090058L14TTTTGGGCCGGGCCCAAACNONE 
J090058P16TTTTGGGCCGGGCCCAAACNONE 
J090076C19TTTTGGGCCGGGCCCAAACNONE 
J100086P14TTTTGGGCCGGGCCCAAACNONE 
Os01g0921600AK071344CCCGGGCCCACGTGTCSimilar to Mitochondrial import receptor subunit TOM20 (Translocase of outer membrane 20 kDa subunit). 
J013039J22CCCGGGCCCACGTGTCNONE 
J013109E03CCCGGGCCCACGTGTCNONE 
J023081J12CCCGGGCCCACGTGTCNONE 
J023091E24CCCGGGCCCACGTGTCNONE 
J033022A01CCCGGGCCCACGTGTCNONE 
J033074C13CCCGGGCCCACGTGTCNONE 
J065199E03CCCGGGCCCACGTGTCNONE 
J075172O04CCCGGGCCCACGTGTCNONE 
J090007G18CCCGGGCCCACGTGTCNONE 
J090052B17CCCGGGCCCACGTGTCNONE 
J090074H01CCCGGGCCCACGTGTCNONE 
J100043J09CCCGGGCCCACGTGTCNONE 
J100059J05CCCGGGCCCACGTGTCNONE 
Os01g0952600AK067525ACCGGGCCCACCCNONE 
AK070047ACCGGGCCCACCCSimilar to LacZ (Fragment). 
Os02g0115700AK065094CCCGGGCCCACCACatalase isozyme A (EC 1.11.1.6) (CAT-A). 
AK099231CCCGGGCCCACCANONE 
AK099923CCCGGGCCCACCANONE 
X61626CCCGGGCCCACCANONE 
Os02g0119400AK060055GTTTGGGCCCGGCCCACCTNONE 
AK102774GTTTGGGCCCGGCCCACCTSimilar to Syntaxin 52 (AtSYP52). 
J033107H09GTTTGGGCCCGGCCCACCTNONE 
J075175F09GTTTGGGCCCGGCCCACCTNONE 
J090011H05GTTTGGGCCCGGCCCACCTNONE 
J090091O05GTTTGGGCCCGGCCCACCTNONE 
Os02g0137800AK060530ACCGGGCCCCACCCCCCAConserved hypothetical protein. 
AK101629ACCGGGCCCCACCCCCCANONE 
J065195A10ACCGGGCCCCACCCCCCANONE 
Os02g0190900AK111037TTTTGGGCCGGGCCCATTAPhytoene dehydrogenase-like protein. 
Os02g0197600003-113-H08CCCGGGCCCACCCNONE 
003-129-H06CCCGGGCCCACCCNONE 
006-021-H09CCCGGGCCCACCCNONE 
006-022-B05CCCGGGCCCACCCNONE 
006-022-G12CCCGGGCCCACCCNONE 
006-023-A02CCCGGGCCCACCCNONE 
006-023-C02CCCGGGCCCACCCNONE 
006-023-G09CCCGGGCCCACCCNONE 
006-024-D12CCCGGGCCCACCCNONE 
006-025-C09CCCGGGCCCACCCNONE 
006-025-E01CCCGGGCCCACCCNONE 
006-026-A11CCCGGGCCCACCCNONE 
006-026-A12CCCGGGCCCACCCNONE 
006-028-E11CCCGGGCCCACCCNONE 
006-028-G03CCCGGGCCCACCCNONE 
006-029-A09CCCGGGCCCACCCNONE 
006-029-A12CCCGGGCCCACCCNONE 
006-029-D01CCCGGGCCCACCCNONE 
006-029-F12CCCGGGCCCACCCNONE 
006-029-G12CCCGGGCCCACCCNONE 
006-030-A08CCCGGGCCCACCCNONE 
006-030-C09CCCGGGCCCACCCNONE 
006-030-G06CCCGGGCCCACCCNONE 
006-031-D06CCCGGGCCCACCCNONE 
006-032-C01CCCGGGCCCACCCNONE 
006-034-B07CCCGGGCCCACCCNONE 
006-035-G01CCCGGGCCCACCCNONE 
006-036-H12CCCGGGCCCACCCNONE 
006-040-C01CCCGGGCCCACCCNONE 
006-041-G12CCCGGGCCCACCCNONE 
006-041-H02CCCGGGCCCACCCNONE 
006-041-H11CCCGGGCCCACCCNONE 
006-042-B01CCCGGGCCCACCCNONE 
006-042-F10CCCGGGCCCACCCNONE 
006-043-C04CCCGGGCCCACCCNONE 
006-044-D10CCCGGGCCCACCCNONE 
006-048-D11CCCGGGCCCACCCNONE 
006-049-D07CCCGGGCCCACCCNONE 
006-050-H05CCCGGGCCCACCCNONE 
006-051-D10CCCGGGCCCACCCNONE 
006-051-E05CCCGGGCCCACCCNONE 
006-053-C07CCCGGGCCCACCCNONE 
006-054-B10CCCGGGCCCACCCNONE 
006-054-C12CCCGGGCCCACCCNONE 
006-054-G08CCCGGGCCCACCCNONE 
006-055-D12CCCGGGCCCACCCNONE 
006-056-C04CCCGGGCCCACCCNONE 
006-056-H06CCCGGGCCCACCCNONE 
006-057-E07CCCGGGCCCACCCNONE 
006-058-C12CCCGGGCCCACCCNONE 
006-059-B06CCCGGGCCCACCCNONE 
006-059-B09CCCGGGCCCACCCNONE 
006-059-D05CCCGGGCCCACCCNONE 
006-060-D07CCCGGGCCCACCCNONE 
006-061-D01CCCGGGCCCACCCNONE 
006-061-G09CCCGGGCCCACCCNONE 
006-062-A12CCCGGGCCCACCCNONE 
006-062-D04CCCGGGCCCACCCNONE 
006-062-G01CCCGGGCCCACCCNONE 
006-063-C10CCCGGGCCCACCCNONE 
006-064-A10CCCGGGCCCACCCNONE 
006-067-E04CCCGGGCCCACCCNONE 
006-067-H11CCCGGGCCCACCCNONE 
006-069-G08CCCGGGCCCACCCNONE 
006-071-G06CCCGGGCCCACCCNONE 
006-073-E06CCCGGGCCCACCCNONE 
006-074-B12CCCGGGCCCACCCNONE 
006-074-F06CCCGGGCCCACCCNONE 
006-074-H01CCCGGGCCCACCCNONE 
006-076-D12CCCGGGCCCACCCNONE 
006-077-C08CCCGGGCCCACCCNONE 
006-083-H01CCCGGGCCCACCCNONE 
006-083-H09CCCGGGCCCACCCNONE 
006-084-C02CCCGGGCCCACCCNONE 
006-086-D05CCCGGGCCCACCCNONE 
006-086-E09CCCGGGCCCACCCNONE 
006-087-D04CCCGGGCCCACCCNONE 
006-087-E12CCCGGGCCCACCCNONE 
006-088-A01CCCGGGCCCACCCNONE 
006-088-H09CCCGGGCCCACCCNONE 
006-089-G01CCCGGGCCCACCCNONE 
006-090-G01CCCGGGCCCACCCNONE 
006-092-H10CCCGGGCCCACCCNONE 
006-096-G12CCCGGGCCCACCCNONE 
006-097-C04CCCGGGCCCACCCNONE 
006-098-B06CCCGGGCCCACCCNONE 
006-099-A02CCCGGGCCCACCCNONE 
006-099-B05CCCGGGCCCACCCNONE 
006-100-F02CCCGGGCCCACCCNONE 
006-100-F07CCCGGGCCCACCCNONE 
006-104-A01CCCGGGCCCACCCNONE 
006-107-F06CCCGGGCCCACCCNONE 
006-109-A05CCCGGGCCCACCCNONE 
006-110-G03CCCGGGCCCACCCNONE 
006-111-A06CCCGGGCCCACCCNONE 
006-111-C12CCCGGGCCCACCCNONE 
006-112-B03CCCGGGCCCACCCNONE 
006-113-A02CCCGGGCCCACCCNONE 
006-113-H06CCCGGGCCCACCCNONE 
006-115-D11CCCGGGCCCACCCNONE 
006-116-F11CCCGGGCCCACCCNONE 
006-117-A10CCCGGGCCCACCCNONE 
006-117-C01CCCGGGCCCACCCNONE 
006-117-D08CCCGGGCCCACCCNONE 
006-118-B12CCCGGGCCCACCCNONE 
006-118-D08CCCGGGCCCACCCNONE 
006-118-E11CCCGGGCCCACCCNONE 
006-118-H08CCCGGGCCCACCCNONE 
006-119-C10CCCGGGCCCACCCNONE 
006-120-H11CCCGGGCCCACCCNONE 
009-025-G09CCCGGGCCCACCCNONE 
009-061-H06CCCGGGCCCACCCNONE 
009-070-E02CCCGGGCCCACCCNONE 
009-077-A07CCCGGGCCCACCCNONE 
009-114-A07CCCGGGCCCACCCNONE 
009-115-G02CCCGGGCCCACCCNONE 
009-123-C06CCCGGGCCCACCCNONE 
009-125-H03CCCGGGCCCACCCNONE 
009-127-H11CCCGGGCCCACCCNONE 
009-136-G03CCCGGGCCCACCCNONE 
009-154-B05CCCGGGCCCACCCNONE 
009-162-B02CCCGGGCCCACCCNONE 
009-176-D09CCCGGGCCCACCCNONE 
009-178-F10CCCGGGCCCACCCNONE 
009-190-F05CCCGGGCCCACCCNONE 
009-200-C08CCCGGGCCCACCCNONE 
011-064-H10CCCGGGCCCACCCNONE 
AK060143CCCGGGCCCACCCNONE 
AK060970CCCGGGCCCACCCNONE 
AK068102CCCGGGCCCACCCSimilar to PSI type III chlorophyll a/b-binding protein. 
AK104096CCCGGGCCCACCCNONE 
AK104215CCCGGGCCCACCCNONE 
AK104348CCCGGGCCCACCCNONE 
AK104385CCCGGGCCCACCCNONE 
AK104392CCCGGGCCCACCCNONE 
AK104446CCCGGGCCCACCCNONE 
AK104458CCCGGGCCCACCCNONE 
AK104469CCCGGGCCCACCCNONE 
AK104522CCCGGGCCCACCCNONE 
AK104535CCCGGGCCCACCCNONE 
AK104557CCCGGGCCCACCCNONE 
AK104636CCCGGGCCCACCCNONE 
AK104646CCCGGGCCCACCCNONE 
AK104734CCCGGGCCCACCCNONE 
AK106085CCCGGGCCCACCCNONE 
AK109398CCCGGGCCCACCCNONE 
AK119554CCCGGGCCCACCCNONE 
J013044I21CCCGGGCCCACCCNONE 
J013090N21CCCGGGCCCACCCNONE 
J013130I24CCCGGGCCCACCCNONE 
J023038D09CCCGGGCCCACCCNONE 
J023064C23CCCGGGCCCACCCNONE 
J023088A09CCCGGGCCCACCCNONE 
J023105K12CCCGGGCCCACCCNONE 
J065022M15CCCGGGCCCACCCNONE 
J075062L23CCCGGGCCCACCCNONE 
J075069B05CCCGGGCCCACCCNONE 
J075072D15CCCGGGCCCACCCNONE 
J075090E24CCCGGGCCCACCCNONE 
J075126D14CCCGGGCCCACCCNONE 
J075154L21CCCGGGCCCACCCNONE 
J075165F23CCCGGGCCCACCCNONE 
J075166D04CCCGGGCCCACCCNONE 
J080003O05CCCGGGCCCACCCNONE 
J080005L07CCCGGGCCCACCCNONE 
J080008K15CCCGGGCCCACCCNONE 
J080009A07CCCGGGCCCACCCNONE 
J080009F05CCCGGGCCCACCCNONE 
J080010M06CCCGGGCCCACCCNONE 
J080011E06CCCGGGCCCACCCNONE 
J080011H20CCCGGGCCCACCCNONE 
J080018I05CCCGGGCCCACCCNONE 
J080021N17CCCGGGCCCACCCNONE 
J080036E20CCCGGGCCCACCCNONE 
J080040E22CCCGGGCCCACCCNONE 
J080044D19CCCGGGCCCACCCNONE 
J080045C21CCCGGGCCCACCCNONE 
J080047B08CCCGGGCCCACCCNONE 
J080048E24CCCGGGCCCACCCNONE 
J080053D19CCCGGGCCCACCCNONE 
J080053N09CCCGGGCCCACCCNONE 
J080054A19CCCGGGCCCACCCNONE 
J080061O16CCCGGGCCCACCCNONE 
J080064P15CCCGGGCCCACCCNONE 
J080065M06CCCGGGCCCACCCNONE 
J080067G11CCCGGGCCCACCCNONE 
J080072M09CCCGGGCCCACCCNONE 
J080079I15CCCGGGCCCACCCNONE 
J080082I12CCCGGGCCCACCCNONE 
J080083K21CCCGGGCCCACCCNONE 
J080096H12CCCGGGCCCACCCNONE 
J080096J10CCCGGGCCCACCCNONE 
J080097O13CCCGGGCCCACCCNONE 
J080305P05CCCGGGCCCACCCNONE 
J080311C21CCCGGGCCCACCCNONE 
J080317C16CCCGGGCCCACCCNONE 
Os02g0301100006-029-F04GGGTGGGCCCGGCNONE 
012-005-F07GGGTGGGCCCGGCNONE 
013-093-H10GGGTGGGCCCGGCNONE 
015-042-B01GGGTGGGCCCGGCNONE 
016-017-F09GGGTGGGCCCGGCNONE 
016-079-B07GGGTGGGCCCGGCNONE 
016-079-G03GGGTGGGCCCGGCNONE 
016-087-F11GGGTGGGCCCGGCNONE 
AK071676GGGTGGGCCCGGCNONE 
AK100174GGGTGGGCCCGGCMtN3 and saliva related transmembrane protein family protein. 
AK104411GGGTGGGCCCGGCNONE 
AK104467GGGTGGGCCCGGCNONE 
J023069G02GGGTGGGCCCGGCNONE 
J023108F17GGGTGGGCCCGGCNONE 
J033042B04GGGTGGGCCCGGCNONE 
J033128D06GGGTGGGCCCGGCNONE 
J033138I12GGGTGGGCCCGGCNONE 
J053064K16GGGTGGGCCCGGCNONE 
J065088A12GGGTGGGCCCGGCNONE 
J065102L08GGGTGGGCCCGGCNONE 
J065104L14GGGTGGGCCCGGCNONE 
J065117M20GGGTGGGCCCGGCNONE 
J065117N14GGGTGGGCCCGGCNONE 
J065120H23GGGTGGGCCCGGCNONE 
J065135F06GGGTGGGCCCGGCNONE 
J065138J17GGGTGGGCCCGGCNONE 
J065138P06GGGTGGGCCCGGCNONE 
J065156G16GGGTGGGCCCGGCNONE 
J065163M20GGGTGGGCCCGGCNONE 
J065176A14GGGTGGGCCCGGCNONE 
J065182C02GGGTGGGCCCGGCNONE 
J065200C05GGGTGGGCCCGGCNONE 
J065213J22GGGTGGGCCCGGCNONE 
J065217D24GGGTGGGCCCGGCNONE 
J075009H03GGGTGGGCCCGGCNONE 
J075020D10GGGTGGGCCCGGCNONE 
J075026L24GGGTGGGCCCGGCNONE 
J075028L01GGGTGGGCCCGGCNONE 
J075057O09GGGTGGGCCCGGCNONE 
J075089A20GGGTGGGCCCGGCNONE 
J075094J15GGGTGGGCCCGGCNONE 
J075103B11GGGTGGGCCCGGCNONE 
J075143L13GGGTGGGCCCGGCNONE 
J075153K15GGGTGGGCCCGGCNONE 
J075161P22GGGTGGGCCCGGCNONE 
J075166J06GGGTGGGCCCGGCNONE 
J075177G06GGGTGGGCCCGGCNONE 
J075198N06GGGTGGGCCCGGCNONE 
Os02g0326700AK064977GGCCGGGCCCCACGRhomboid-like protein family protein. 
Os02g0527300AK101934TCCGGGCCCCGCCGAGATSimilar to Heat shock transcription factor 31 (Fragment). 
J013047O11TCCGGGCCCCGCCGAGATNONE 
J033073P11TCCGGGCCCCGCCGAGATNONE 
Os02g0562300AK073250ACCGGGCCCCACGTCalmodulin binding protein-like family protein. 
Os02g0600200009-154-A06CCCACCCGGGCCCACACNONE 
AK058978CCCACCCGGGCCCACACNONE 
AK066974CCCACCCGGGCCCACACIQ calmodulin-binding region domain containing protein. 
Os02g0606800AK073760CCCGGGCCCACAIsochorismatase hydrolase family protein. 
J100033B19CCCGGGCCCACANONE 
J100047E15CCCGGGCCCACANONE 
J100058A18CCCGGGCCCACANONE 
J100068L14CCCGGGCCCACANONE 
J100089I02CCCGGGCCCACANONE 
Os02g0614400016-088-D04ACCGGGCCCAATNONE 
AK071805ACCGGGCCCAATConserved hypothetical protein. 
J023108N22ACCGGGCCCAATNONE 
Os02g0625500011-025-C06CCCGGGCCCGCANONE 
AB050624CCCGGGCCCGCANONE 
AK059188CCCGGGCCCGCANONE 
AK059771CCCGGGCCCGCANONE 
AK101791CCCGGGCCCGCASimilar to Adenosine kinase-like protein (Fragment). 
AY224510CCCGGGCCCGCANONE 
J013152H02CCCGGGCCCGCANONE 
J023012P09CCCGGGCCCGCANONE 
J023127D16CCCGGGCCCGCANONE 
J033024G01CCCGGGCCCGCANONE 
J033025L19CCCGGGCCCGCANONE 
J033080M04CCCGGGCCCGCANONE 
J033101A08CCCGGGCCCGCANONE 
J033121L12CCCGGGCCCGCANONE 
J043017N15CCCGGGCCCGCANONE 
J065207J01CCCGGGCCCGCANONE 
J090049G12CCCGGGCCCGCANONE 
J100036A07CCCGGGCCCGCANONE 
J100076C04CCCGGGCCCGCANONE 
J100080N22CCCGGGCCCGCANONE 
Os02g0629000009-047-E10CCCGGGCCCCACCCGNONE 
AK062480CCCGGGCCCCACCCGProtein of unknown function DUF584 family protein. 
Os02g0631000AK068667ACCGGGCCCCConserved hypothetical protein. 
J013159L03ACCGGGCCCCNONE 
J023119O20ACCGGGCCCCNONE 
J090098N20ACCGGGCCCCNONE 
Os02g0658500AK120166ACCGGGCCCGCATGTCAGTGNONE 
Os02g0741300AK105716CCCGGGCCCNONE 
AK120667CCCGGGCCCGlycoside hydrolase, family 47 protein. 
Os03g0122000AK101458TGCGGGCCCGGCCCATATProtein kinase-like domain containing protein. 
J013035K10TGCGGGCCCGGCCCATATNONE 
J013050E10TGCGGGCCCGGCCCATATNONE 
J033040C13TGCGGGCCCGGCCCATATNONE 
Os03g0138600Os03g0138600GCCGGGCCCCACCACProtein of unknown function DUF810 family protein. 
Os03g0148000AK110468GCCGGGCCCACAProtein of unknown function DUF677 family protein. 
Os03g0171700J065192H12CCCGGGCCCACTBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
Os03g0184600AK065264ATTTGGGCCCGGCCCACAANAD-dependent epimerase/dehydratase family protein. 
Os03g0191200AK070228TGGTGGGCCCGGTWW/Rsp5/WWP domain containing protein. 
Os03g0192400009-081-A03AGTGGGCCCGGCCCNONE 
009-159-B02AGTGGGCCCGGCCCNONE 
AK070573AGTGGGCCCGGCCCGRIM-19 family protein. 
J023056B01AGTGGGCCCGGCCCNONE 
J023075G06AGTGGGCCCGGCCCNONE 
J033048K16AGTGGGCCCGGCCCNONE 
J033048L16AGTGGGCCCGGCCCNONE 
J053031H23AGTGGGCCCGGCCCNONE 
J065002H14AGTGGGCCCGGCCCNONE 
J065006G22AGTGGGCCCGGCCCNONE 
J065032G13AGTGGGCCCGGCCCNONE 
J065056A09AGTGGGCCCGGCCCNONE 
J065078I01AGTGGGCCCGGCCCNONE 
J065095G01AGTGGGCCCGGCCCNONE 
J065095I18AGTGGGCCCGGCCCNONE 
J065134M18AGTGGGCCCGGCCCNONE 
J065158P07AGTGGGCCCGGCCCNONE 
J065165K17AGTGGGCCCGGCCCNONE 
J065181J12AGTGGGCCCGGCCCNONE 
J065189N09AGTGGGCCCGGCCCNONE 
J065200D13AGTGGGCCCGGCCCNONE 
J065202H20AGTGGGCCCGGCCCNONE 
J065215K20AGTGGGCCCGGCCCNONE 
J075049N19AGTGGGCCCGGCCCNONE 
J075147J16AGTGGGCCCGGCCCNONE 
J090081E19AGTGGGCCCGGCCCNONE 
J100017C16AGTGGGCCCGGCCCNONE 
J100039M16AGTGGGCCCGGCCCNONE 
J100043E23AGTGGGCCCGGCCCNONE 
J100063L12AGTGGGCCCGGCCCNONE 
J100079F22AGTGGGCCCGGCCCNONE 
Os03g0199500J065099N05CCCGGGCCCCNONE 
J065152P14CCCGGGCCCCConserved hypothetical protein. 
J080009C14CCCGGGCCCCNONE 
J080011K01CCCGGGCCCCNONE 
J080015H12CCCGGGCCCCNONE 
J080022K05CCCGGGCCCCNONE 
J080034G01CCCGGGCCCCNONE 
J080038I04CCCGGGCCCCNONE 
J080039F20CCCGGGCCCCNONE 
J080042J22CCCGGGCCCCNONE 
J080042N23CCCGGGCCCCNONE 
J080043E07CCCGGGCCCCNONE 
J080050A12CCCGGGCCCCNONE 
J080050C11CCCGGGCCCCNONE 
J080052B01CCCGGGCCCCNONE 
J080052H22CCCGGGCCCCNONE 
J080060E02CCCGGGCCCCNONE 
J080063K24CCCGGGCCCCNONE 
J080067I07CCCGGGCCCCNONE 
J080081H22CCCGGGCCCCNONE 
J080085J10CCCGGGCCCCNONE 
J080089E20CCCGGGCCCCNONE 
J080092N04CCCGGGCCCCNONE 
J080093B01CCCGGGCCCCNONE 
J080093N04CCCGGGCCCCNONE 
J080097B03CCCGGGCCCCNONE 
Os03g0205500Os03g0205500CCCGGGCCCGGCCCACTGGCCCAGTCytochrome b5 domain containing protein. 
Os03g0206400AK066494CCCGGGCCCGCAConserved hypothetical protein. 
AK107011CCCGGGCCCGCANONE 
J065162G04CCCGGGCCCGCANONE 
Os03g0222100AK070688CCCGGGCCCACTSimilar to Topoisomerase-like protein. 
J023057E15CCCGGGCCCACTNONE 
J023099M24CCCGGGCCCACTNONE 
J023147F14CCCGGGCCCACTNONE 
Os03g0240700009-086-G10TAATGGGCCCGGCCCAAACNONE 
AK071799TAATGGGCCCGGCCCAAACConserved hypothetical protein. 
J023112A13TAATGGGCCCGGCCCAAACNONE 
J043022A01TAATGGGCCCGGCCCAAACNONE 
J065106A01TAATGGGCCCGGCCCAAACNONE 
J075023P22TAATGGGCCCGGCCCAAACNONE 
J075138I21TAATGGGCCCGGCCCAAACNONE 
J075173L02TAATGGGCCCGGCCCAAACNONE 
Os03g0240800006-092-D05GTTTGGGCCGGGCCCATTANONE 
AK059292GTTTGGGCCGGGCCCATTANONE 
AK061178GTTTGGGCCGGGCCCATTASimilar to AGL157Cp. 
AK121552GTTTGGGCCGGGCCCATTANONE 
J023131D06GTTTGGGCCGGGCCCATTANONE 
J033033E14GTTTGGGCCGGGCCCATTANONE 
J033105B01GTTTGGGCCGGGCCCATTANONE 
J033114L18GTTTGGGCCGGGCCCATTANONE 
J033132N24GTTTGGGCCGGGCCCATTANONE 
J065032H03GTTTGGGCCGGGCCCATTANONE 
J065115J20GTTTGGGCCGGGCCCATTANONE 
J065150C05GTTTGGGCCGGGCCCATTANONE 
J080302A11GTTTGGGCCGGGCCCATTANONE 
J080302H16GTTTGGGCCGGGCCCATTANONE 
J080305M12GTTTGGGCCGGGCCCATTANONE 
J080306F13GTTTGGGCCGGGCCCATTANONE 
J080312A06GTTTGGGCCGGGCCCATTANONE 
J090088P09GTTTGGGCCGGGCCCATTANONE 
Os03g0278400015-014-G10GCTGGGCCCGGGNONE 
AK070052GCTGGGCCCGGGSimilar to ADP ribosylation GTPase-like protein (Fragment). 
AY224461GCTGGGCCCGGGNONE 
J065218E15GCTGGGCCCGGGNONE 
J075115A06GCTGGGCCCGGGNONE 
J075134I05GCTGGGCCCGGGNONE 
J100032D08GCTGGGCCCGGGNONE 
J100044O13GCTGGGCCCGGGNONE 
J100051G15GCTGGGCCCGGGNONE 
J100052O21GCTGGGCCCGGGNONE 
J100071A12GCTGGGCCCGGGNONE 
Os03g0294200AK069285CCCGGGCCCACASimilar to Fructose-6-phosphate-2-kinase/fructose-2, 6-bisphosphatase. 
Os03g0295700AK067856ACCGGGCCCCConserved hypothetical protein. 
Os03g0356484009-038-H01ACCGGGCCCCACANONE 
AK105146ACCGGGCCCCACATetratricopeptide-like helical domain containing protein. 
J065204G11ACCGGGCCCCACANONE 
Os03g0374400016-027-B12GGCCGGGCCCCACCCGNONE 
AK069719GGCCGGGCCCCACCCGConserved hypothetical protein. 
J023020L05GGCCGGGCCCCACCCGNONE 
J023026H16GGCCGGGCCCCACCCGNONE 
J033025P22GGCCGGGCCCCACCCGNONE 
J075016I21GGCCGGGCCCCACCCGNONE 
J090015G21GGCCGGGCCCCACCCGNONE 
Os03g0374500Os03g0374500GGCCGGGCCCCACCCGHypothetical protein. 
Os03g0390400009-175-E06TCCGGGCCCATTTNONE 
013-040-G01TCCGGGCCCATTTNONE 
014-050-G05TCCGGGCCCATTTNONE 
AB025187TCCGGGCCCATTTSimilar to Cytochrome c oxidase subunit 6b. 
AK120174TCCGGGCCCATTTNONE 
J013033A17TCCGGGCCCATTTNONE 
J023028J08TCCGGGCCCATTTNONE 
J023061N05TCCGGGCCCATTTNONE 
J023077A03TCCGGGCCCATTTNONE 
J023086E01TCCGGGCCCATTTNONE 
J033022A08TCCGGGCCCATTTNONE 
J033040F24TCCGGGCCCATTTNONE 
J075073I24TCCGGGCCCATTTNONE 
J075081H01TCCGGGCCCATTTNONE 
J075175N19TCCGGGCCCATTTNONE 
J100025M03TCCGGGCCCATTTNONE 
J100036J06TCCGGGCCCATTTNONE 
J100045O18TCCGGGCCCATTTNONE 
J100062G15TCCGGGCCCATTTNONE 
J100090N19TCCGGGCCCATTTNONE 
Os03g0397400AB112772CGTGTGGGCCCGGGCCCGGANONE 
AK069928CGTGTGGGCCCGGGCCCGGASimilar to Low affinity calcium transporter CAX2 (Fragment). 
J023014O18CGTGTGGGCCCGGGCCCGGANONE 
J023036P06CGTGTGGGCCCGGGCCCGGANONE 
J023145E24CGTGTGGGCCCGGGCCCGGANONE 
J033142I11CGTGTGGGCCCGGGCCCGGANONE 
J043003A10CGTGTGGGCCCGGGCCCGGANONE 
J075023H21CGTGTGGGCCCGGGCCCGGANONE 
J075145O10CGTGTGGGCCCGGGCCCGGANONE 
J075149A03CGTGTGGGCCCGGGCCCGGANONE 
J090099B09CGTGTGGGCCCGGGCCCGGANONE 
J100017L14CGTGTGGGCCCGGGCCCGGANONE 
J100050K18CGTGTGGGCCCGGGCCCGGANONE 
J100063P16CGTGTGGGCCCGGGCCCGGANONE 
Os03g0628900009-062-G01ATTTGGGCCCGGGNONE 
AK103619ATTTGGGCCCGGGPrefoldin domain containing protein. 
J033133L23ATTTGGGCCCGGGNONE 
J100039C17ATTTGGGCCCGGGNONE 
J100048I07ATTTGGGCCCGGGNONE 
J100062E19ATTTGGGCCCGGGNONE 
J100063B11ATTTGGGCCCGGGNONE 
Os03g0633800AK073044CCCGGGCCCCACCTGTCSimilar to IAA6 (Fragment). 
J065038L22CCCGGGCCCCACCTGTCNONE 
J065185C13CCCGGGCCCCACCTGTCNONE 
Os03g0647400AK073665GGGCCCGGAGCK domain containing protein. 
J033051B07GGGCCCGGANONE 
Os03g0648400005-003-D07CCCGGGCCCAGCNONE 
006-048-C12CCCGGGCCCAGCNONE 
006-049-A03CCCGGGCCCAGCNONE 
011-008-F07CCCGGGCCCAGCNONE 
011-039-A07CCCGGGCCCAGCNONE 
011-044-D10CCCGGGCCCAGCNONE 
011-099-C01CCCGGGCCCAGCNONE 
012-051-B09CCCGGGCCCAGCNONE 
012-051-D08CCCGGGCCCAGCNONE 
012-056-G07CCCGGGCCCAGCNONE 
012-062-A01CCCGGGCCCAGCNONE 
012-079-C03CCCGGGCCCAGCNONE 
014-003-A06CCCGGGCCCAGCNONE 
015-010-D02CCCGGGCCCAGCNONE 
AK102263CCCGGGCCCAGCSimilar to DnaJ protein homolog (DNAJ-1). 
AK103763CCCGGGCCCAGCNONE 
AK105028CCCGGGCCCAGCNONE 
AY224432CCCGGGCCCAGCNONE 
J013043H01CCCGGGCCCAGCNONE 
J013134K10CCCGGGCCCAGCNONE 
J023037D18CCCGGGCCCAGCNONE 
J023077K20CCCGGGCCCAGCNONE 
J023105M19CCCGGGCCCAGCNONE 
J023131M09CCCGGGCCCAGCNONE 
J033022F05CCCGGGCCCAGCNONE 
J033051J22CCCGGGCCCAGCNONE 
J033061D03CCCGGGCCCAGCNONE 
J033084H04CCCGGGCCCAGCNONE 
J033088M01CCCGGGCCCAGCNONE 
J033119H12CCCGGGCCCAGCNONE 
J033131C18CCCGGGCCCAGCNONE 
J043030C06CCCGGGCCCAGCNONE 
J080032A08CCCGGGCCCAGCNONE 
J090008C11CCCGGGCCCAGCNONE 
J090014D24CCCGGGCCCAGCNONE 
J090024C20CCCGGGCCCAGCNONE 
J090024H08CCCGGGCCCAGCNONE 
J090029F10CCCGGGCCCAGCNONE 
J090032K16CCCGGGCCCAGCNONE 
J090034L14CCCGGGCCCAGCNONE 
J090035C20CCCGGGCCCAGCNONE 
J090044H05CCCGGGCCCAGCNONE 
J090048M09CCCGGGCCCAGCNONE 
J090056I15CCCGGGCCCAGCNONE 
J090062B01CCCGGGCCCAGCNONE 
J090076F06CCCGGGCCCAGCNONE 
J090077A02CCCGGGCCCAGCNONE 
J090084E21CCCGGGCCCAGCNONE 
J090084J09CCCGGGCCCAGCNONE 
J090086G11CCCGGGCCCAGCNONE 
J090092C20CCCGGGCCCAGCNONE 
J100018G14CCCGGGCCCAGCNONE 
J100018I22CCCGGGCCCAGCNONE 
J100024N14CCCGGGCCCAGCNONE 
J100032K09CCCGGGCCCAGCNONE 
J100036F09CCCGGGCCCAGCNONE 
J100041M04CCCGGGCCCAGCNONE 
J100042H05CCCGGGCCCAGCNONE 
J100043P19CCCGGGCCCAGCNONE 
J100044B04CCCGGGCCCAGCNONE 
J100049L24CCCGGGCCCAGCNONE 
J100050M21CCCGGGCCCAGCNONE 
J100057F24CCCGGGCCCAGCNONE 
J100063I11CCCGGGCCCAGCNONE 
J100064J24CCCGGGCCCAGCNONE 
J100070B13CCCGGGCCCAGCNONE 
J100076A13CCCGGGCCCAGCNONE 
J100081C20CCCGGGCCCAGCNONE 
J100081L09CCCGGGCCCAGCNONE 
J100084G23CCCGGGCCCAGCNONE 
J100088H02CCCGGGCCCAGCNONE 
Os03g0701000J075172J23CCCGGGCCCACCCGNONE 
Os03g0712200AK073205AACTGGGCCCGGTTGGGCCAGZinc finger, RanBP2-type domain containing protein. 
AK098968AACTGGGCCCGGTTGGGCCAGNONE 
Os03g0736600AK060375GGGGCCCGGTCCAGAConserved hypothetical protein. 
Os03g0752800AB041020GGGGCCCGGGCCGGCNONE 
AF058697GGGGCCCGGGCCGGCMADS14 protein. 
AF139664GGGGCCCGGGCCGGCNONE 
AK121171GGGGCCCGGGCCGGCNONE 
AY332478GGGGCCCGGGCCGGCNONE 
AY551916GGGGCCCGGGCCGGCNONE 
J023081C04GGGGCCCGGGCCGGCNONE 
Os03g0755000AK068540ACCGGGCCCATACSimilar to Serine/threonine kinase (Fragment). 
Os03g0767700AK073586TCGGCCCAATAAACGGGCCCGGTConserved hypothetical protein. 
J033050D05TCGGCCCAATAAACGGGCCCGGTNONE 
Os03g0780800AK059874GGCCCGGGCCCACCACNONE 
AK103085GGCCCGGGCCCACCACFatty acid hydroxylase domain containing protein. 
J065214L21GGCCCGGGCCCACCACNONE 
J075178I24GGCCCGGGCCCACCACNONE 
J075197K14GGCCCGGGCCCACCACNONE 
Os03g0789200015-015-H03CCCGGGCCCACCANONE 
AK071787CCCGGGCCCACCAProtein of unknown function DUF593 family protein. 
AY224542CCCGGGCCCACCANONE 
J023110P10CCCGGGCCCACCANONE 
J075039H19CCCGGGCCCACCANONE 
Os03g0796600003-113-D10CCCGGGCCCAGCGCACCGCCACGTCNONE 
011-076-B12CCCGGGCCCAGCGCACCGCCACGTCNONE 
AK105257CCCGGGCCCAGCGCACCGCCACGTCProtein of unknown function DUF506, plant family protein. 
J075105C03CCCGGGCCCAGCGCACCGCCACGTCNONE 
J080036O17CCCGGGCCCAGCGCACCGCCACGTCNONE 
J080064E16CCCGGGCCCAGCGCACCGCCACGTCNONE 
J080069E03CCCGGGCCCAGCGCACCGCCACGTCNONE 
J080079E23CCCGGGCCCAGCGCACCGCCACGTCNONE 
J090036H20CCCGGGCCCAGCGCACCGCCACGTCNONE 
J100029L10CCCGGGCCCAGCGCACCGCCACGTCNONE 
J100055G09CCCGGGCCCAGCGCACCGCCACGTCNONE 
Os03g0796800J065024O22GCCACGTGGGCCCGGGConserved hypothetical protein. 
Os03g0807900006-056-G10GACACGTGGGGCCCGGCNONE 
AK060962GACACGTGGGGCCCGGCChaperonin-like RbcX family protein. 
AK070287GACACGTGGGGCCCGGCNONE 
J023049O16GACACGTGGGGCCCGGCNONE 
J100025I21GACACGTGGGGCCCGGCNONE 
J100035K21GACACGTGGGGCCCGGCNONE 
Os03g0822700005-010-E01TCCGGGCCCACCANONE 
006-088-H12TCCGGGCCCACCANONE 
AK061682TCCGGGCCCACCANONE 
AK101448TCCGGGCCCACCAArmadillo-like helical domain containing protein. 
J023091N05TCCGGGCCCACCANONE 
Os03g0837900AK068346ACCGGGCCCACACStreptomyces cyclase/dehydrase family protein. 
Os03g0847500AK073859GCCGGGCCCSimilar to Plastid quinol oxidase (Plastid terminal oxidase). 
Os03g0851000006-098-C01TTGTGGGCCGGGCCCAAACNONE 
AK060496TTGTGGGCCGGGCCCAAACSimilar to Transcription factor homolog BTF3-like protein. 
AK102202TTGTGGGCCGGGCCCAAACNONE 
AK104157TTGTGGGCCGGGCCCAAACNONE 
J033087F19TTGTGGGCCGGGCCCAAACNONE 
J065087I16TTGTGGGCCGGGCCCAAACNONE 
J065113G04TTGTGGGCCGGGCCCAAACNONE 
J090026M02TTGTGGGCCGGGCCCAAACNONE 
J090027I04TTGTGGGCCGGGCCCAAACNONE 
J100073E19TTGTGGGCCGGGCCCAAACNONE 
Os03g0852600009-174-G04ATATGGGCCCGGANONE 
AK063101ATATGGGCCCGGAProtein of unknown function DUF565 family protein. 
J065131H12ATATGGGCCCGGANONE 
J090046K24ATATGGGCCCGGANONE 
Os03g0852900011-012-A12TCCGGGCCCAACTNONE 
AK100660TCCGGGCCCAACTSimilar to Cleavage and polyadenylation specificity factor, 73 kDa subunit (CPSF 73 kDa subunit). 
J013073D18TCCGGGCCCAACTNONE 
J013152K17TCCGGGCCCAACTNONE 
J023111N01TCCGGGCCCAACTNONE 
J065214G07TCCGGGCCCAACTNONE 
J090080E10TCCGGGCCCAACTNONE 
Os03g0855700AK070400GCTGGGCCCGGTNucleic acid-binding, OB-fold domain containing protein. 
Os04g0126800AK107895CCCGGGCCCACGGGHypothetical protein. 
Os04g0282400AK120187CCCGGGCCCCACACSimilar to FPF1 protein-like (RAA1). 
J013034O10CCCGGGCCCCACACNONE 
J013071G20CCCGGGCCCCACACNONE 
Os04g0390500AK066575TCCGGGCCCCNONE 
AK099908TCCGGGCCCCNONE 
AK100148TCCGGGCCCCNONE 
Os04g0418000006-025-C05TCCGGGCCCNONE 
006-025-D11TCCGGGCCCNONE 
006-045-F02TCCGGGCCCNONE 
006-060-B04TCCGGGCCCNONE 
006-063-E03TCCGGGCCCNONE 
006-070-G08TCCGGGCCCNONE 
006-072-H05TCCGGGCCCNONE 
AK061030TCCGGGCCCNONE 
AK099124TCCGGGCCCNONE 
AK106155TCCGGGCCCConserved hypothetical protein. 
AK119714TCCGGGCCCNONE 
J023039I07TCCGGGCCCNONE 
J065025N03TCCGGGCCCNONE 
Os04g0435700AK100857CCCACCCGGGCCCACCCGSimilar to UVB-resistance protein UVR8. 
Os04g0444900AK063657ACCGGGCCCCACACSimilar to Alfin-1. 
AK098960ACCGGGCCCCACACNONE 
J065037L14ACCGGGCCCCACACNONE 
J065037P22ACCGGGCCCCACACNONE 
J065173O15ACCGGGCCCCACACNONE 
Os04g0476000Os04g0476000ACCGGGCCCAATATetratricopeptide-like helical domain containing protein. 
Os04g0490500AK065576GCCGGGCCCCSimilar to Pto kinase interactor 1. 
J080004D10GCCGGGCCCCNONE 
J080083C02GCCGGGCCCCNONE 
J080083G13GCCGGGCCCCNONE 
J080097F03GCCGGGCCCCNONE 
Os04g0561200AK107862CCCGGGCCCCCACCellular retinaldehyde-binding/triple function, C-terminal domain containing protein. 
J065028J03CCCGGGCCCCCACNONE 
J065042H13CCCGGGCCCCCACNONE 
J065079N01CCCGGGCCCCCACNONE 
J065190N16CCCGGGCCCCCACNONE 
J065191H22CCCGGGCCCCCACNONE 
Os04g0563300AK100487CAGGTGGGCCCGGCCCATACyclin-like F-box domain containing protein. 
J023097O18CAGGTGGGCCCGGCCCATANONE 
J065100E16CAGGTGGGCCCGGCCCATANONE 
J075022C23CAGGTGGGCCCGGCCCATANONE 
J075023L18CAGGTGGGCCCGGCCCATANONE 
J075040N10CAGGTGGGCCCGGCCCATANONE 
J075061L14CAGGTGGGCCCGGCCCATANONE 
J075069B15CAGGTGGGCCCGGCCCATANONE 
J075106C16CAGGTGGGCCCGGCCCATANONE 
J075138P13CAGGTGGGCCCGGCCCATANONE 
J075139H18CAGGTGGGCCCGGCCCATANONE 
J075139L06CAGGTGGGCCCGGCCCATANONE 
J075149B07CAGGTGGGCCCGGCCCATANONE 
J075177N21CAGGTGGGCCCGGCCCATANONE 
Os04g0660600009-113-A11CCCGGGCCCAATTNONE 
AK120899CCCGGGCCCAATTATPase, V0 complex, subunit H family protein. 
J023030J05CCCGGGCCCAATTNONE 
J065068M07CCCGGGCCCAATTNONE 
J065120G22CCCGGGCCCAATTNONE 
J065168J18CCCGGGCCCAATTNONE 
J065211M10CCCGGGCCCAATTNONE 
J075175E21CCCGGGCCCAATTNONE 
J090021C06CCCGGGCCCAATTNONE 
J090032P15CCCGGGCCCAATTNONE 
J090082E05CCCGGGCCCAATTNONE 
J100090O11CCCGGGCCCAATTNONE 
Os05g0126200AK059554GTCGAGTCATTGGGCCGGGCCCATATConserved hypothetical protein. 
AK121734GTCGAGTCATTGGGCCGGGCCCATATNONE 
J033084B09GTCGAGTCATTGGGCCGGGCCCATATNONE 
J090010I10GTCGAGTCATTGGGCCGGGCCCATATNONE 
Os05g0176100AF030052CCCGGGCCCACCCNONE 
AK067850CCCGGGCCCACCCNONE 
AK067967CCCGGGCCCACCCNONE 
AK098978CCCGGGCCCACCCNONE 
AK099228CCCGGGCCCACCCNONE 
AK099281CCCGGGCCCACCCNONE 
AK100188CCCGGGCCCACCCSimilar to RSW1-like cellulose synthase catalytic subunit (Fragment). 
AK102140CCCGGGCCCACCCNONE 
Os05g0320700AK100598TCCGGGCCCACGTSimilar to Cytochrome P450. 
AK104994TCCGGGCCCACGTNONE 
Os05g0350600AK066244ACCGGGCCCCACCCCACCACSimilar to Atranbp1b protein. 
J075100E12ACCGGGCCCCACCCCACCACNONE 
J090024D03ACCGGGCCCCACCCCACCACNONE 
J100027C02ACCGGGCCCCACCCCACCACNONE 
J100053P05ACCGGGCCCCACCCCACCACNONE 
J100055P22ACCGGGCCCCACCCCACCACNONE 
Os05g0430200J090095K16ACCGGGCCCACCTGTCNONE 
Os05g0430300AK121670GGGCCCGGCCCProtein of unknown function DUF668 family protein. 
Os05g0533600AK067577TCCGGGCCCCACTCCSimilar to Starch synthase IVa (Glycogen (Starch) synthase-like). 
AY224560TCCGGGCCCCACTCCNONE 
AY373258TCCGGGCCCCACTCCNONE 
Os05g0543800AK072185CCCGGGCCCATATConserved hypothetical protein. 
Os05g0563500AK121924GGCCGGGCCCConserved hypothetical protein. 
J033106F17GGCCGGGCCCNONE 
Os05g0577900016-028-C02TTGTGGGCCTACATGGGCCGGGCCCATGGNONE 
AK064201TTGTGGGCCTACATGGGCCGGGCCCATGGConserved hypothetical protein. 
Os05g0578000AK065040CCATGGGCCCGGCCCATGTAGGCCCACAASimilar to PEX14 protein. 
J013001H17CCATGGGCCCGGCCCATGTAGGCCCACAANONE 
J013036A06CCATGGGCCCGGCCCATGTAGGCCCACAANONE 
J033122K08CCATGGGCCCGGCCCATGTAGGCCCACAANONE 
Os06g0114700AK061552GACAGGTGGGCCCGGGProtein of unknown function DUF1218 family protein. 
AK098848GACAGGTGGGCCCGGGNONE 
AK122142GACAGGTGGGCCCGGGNONE 
J013000D16GACAGGTGGGCCCGGGNONE 
Os06g0212900AK071518GGCCGGGCCCCACTCCHeat shock protein Hsp70 family protein. 
AK104048GGCCGGGCCCCACTCCNONE 
J023019O18GGCCGGGCCCCACTCCNONE 
J023090N13GGCCGGGCCCCACTCCNONE 
J023101M15GGCCGGGCCCCACTCCNONE 
J023122F06GGCCGGGCCCCACTCCNONE 
J075023H16GGCCGGGCCCCACTCCNONE 
J090006J22GGCCGGGCCCCACTCCNONE 
J090075F24GGCCGGGCCCCACTCCNONE 
J090095A17GGCCGGGCCCCACTCCNONE 
Os06g0226500009-030-E06TGTGGGCCCGGCCCNONE 
AK071601TGTGGGCCCGGCCCBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
J023102C01TGTGGGCCCGGCCCNONE 
Os06g0316100011-089-C01ACATGGGCCGGGCCCAGGNONE 
015-030-D11ACATGGGCCGGGCCCAGGNONE 
015-044-H10ACATGGGCCGGGCCCAGGNONE 
AK105260ACATGGGCCGGGCCCAGGConserved hypothetical protein. 
AK119646ACATGGGCCGGGCCCAGGNONE 
Os06g0476200AK065566CCCGGGCCCAGANONE 
AK068502CCCGGGCCCAGASimilar to Phosphoglucomutase precursor (EC 5.4.2.2). 
Os06g0567000009-166-G12CCCACCTGTTGGGCCGGGCCCACTNONE 
AK121337CCCACCTGTTGGGCCGGGCCCACTProtein of unknown function UPF0197 family protein. 
J013122F01CCCACCTGTTGGGCCGGGCCCACTNONE 
J023080N12CCCACCTGTTGGGCCGGGCCCACTNONE 
J023120F03CCCACCTGTTGGGCCGGGCCCACTNONE 
J065013B18CCCACCTGTTGGGCCGGGCCCACTNONE 
J065039P21CCCACCTGTTGGGCCGGGCCCACTNONE 
J065089E06CCCACCTGTTGGGCCGGGCCCACTNONE 
J065095N19CCCACCTGTTGGGCCGGGCCCACTNONE 
J065119H03CCCACCTGTTGGGCCGGGCCCACTNONE 
J065121D18CCCACCTGTTGGGCCGGGCCCACTNONE 
J065149G04CCCACCTGTTGGGCCGGGCCCACTNONE 
J075012J04CCCACCTGTTGGGCCGGGCCCACTNONE 
J075021G13CCCACCTGTTGGGCCGGGCCCACTNONE 
J075106I23CCCACCTGTTGGGCCGGGCCCACTNONE 
J075107F19CCCACCTGTTGGGCCGGGCCCACTNONE 
J075152J22CCCACCTGTTGGGCCGGGCCCACTNONE 
J075186J20CCCACCTGTTGGGCCGGGCCCACTNONE 
J075188F16CCCACCTGTTGGGCCGGGCCCACTNONE 
J080001G06CCCACCTGTTGGGCCGGGCCCACTNONE 
J080002O09CCCACCTGTTGGGCCGGGCCCACTNONE 
J080006E10CCCACCTGTTGGGCCGGGCCCACTNONE 
J080006F24CCCACCTGTTGGGCCGGGCCCACTNONE 
J080012L07CCCACCTGTTGGGCCGGGCCCACTNONE 
J080016A10CCCACCTGTTGGGCCGGGCCCACTNONE 
J080017D11CCCACCTGTTGGGCCGGGCCCACTNONE 
J080017I04CCCACCTGTTGGGCCGGGCCCACTNONE 
J080017I10CCCACCTGTTGGGCCGGGCCCACTNONE 
J080020P06CCCACCTGTTGGGCCGGGCCCACTNONE 
J080024A20CCCACCTGTTGGGCCGGGCCCACTNONE 
J080027B10CCCACCTGTTGGGCCGGGCCCACTNONE 
J080027E03CCCACCTGTTGGGCCGGGCCCACTNONE 
J080027I01CCCACCTGTTGGGCCGGGCCCACTNONE 
J080027K20CCCACCTGTTGGGCCGGGCCCACTNONE 
J080041L12CCCACCTGTTGGGCCGGGCCCACTNONE 
J080043D21CCCACCTGTTGGGCCGGGCCCACTNONE 
J080044K11CCCACCTGTTGGGCCGGGCCCACTNONE 
J080048I08CCCACCTGTTGGGCCGGGCCCACTNONE 
J080049M12CCCACCTGTTGGGCCGGGCCCACTNONE 
J080050C14CCCACCTGTTGGGCCGGGCCCACTNONE 
J080050N21CCCACCTGTTGGGCCGGGCCCACTNONE 
J080053F04CCCACCTGTTGGGCCGGGCCCACTNONE 
J080054O16CCCACCTGTTGGGCCGGGCCCACTNONE 
J080058O21CCCACCTGTTGGGCCGGGCCCACTNONE 
J080059M11CCCACCTGTTGGGCCGGGCCCACTNONE 
J080061A11CCCACCTGTTGGGCCGGGCCCACTNONE 
J080063B15CCCACCTGTTGGGCCGGGCCCACTNONE 
J080063F22CCCACCTGTTGGGCCGGGCCCACTNONE 
J080066M18CCCACCTGTTGGGCCGGGCCCACTNONE 
J080068D12CCCACCTGTTGGGCCGGGCCCACTNONE 
J080070D22CCCACCTGTTGGGCCGGGCCCACTNONE 
J080071B06CCCACCTGTTGGGCCGGGCCCACTNONE 
J080072B17CCCACCTGTTGGGCCGGGCCCACTNONE 
J080081O04CCCACCTGTTGGGCCGGGCCCACTNONE 
J080089H05CCCACCTGTTGGGCCGGGCCCACTNONE 
J080093K13CCCACCTGTTGGGCCGGGCCCACTNONE 
J080095I05CCCACCTGTTGGGCCGGGCCCACTNONE 
J080097F19CCCACCTGTTGGGCCGGGCCCACTNONE 
J080304C03CCCACCTGTTGGGCCGGGCCCACTNONE 
J080304H11CCCACCTGTTGGGCCGGGCCCACTNONE 
J080308M21CCCACCTGTTGGGCCGGGCCCACTNONE 
J080313O15CCCACCTGTTGGGCCGGGCCCACTNONE 
J090020N23CCCACCTGTTGGGCCGGGCCCACTNONE 
J100023C12CCCACCTGTTGGGCCGGGCCCACTNONE 
Os06g0589500AK073322CCCGGGCCCGCAConserved hypothetical protein. 
J033030G15CCCGGGCCCGCANONE 
J033148N18CCCGGGCCCGCANONE 
Os06g0603000AK068856TCCGGGCCCACCTGTCNONE 
AK104955TCCGGGCCCACCTGTCSimilar to Heme oxygenase 1 (Fragment). 
Os06g0624900006-066-E01GGGGCCCGGGNONE 
AK061790GGGGCCCGGGNONE 
AK065620GGGGCCCGGGConserved hypothetical protein. 
AK067251GGGGCCCGGGNONE 
J013099A07GGGGCCCGGGNONE 
J065029M10GGGGCCCGGGNONE 
J065068B08GGGGCCCGGGNONE 
J065072A12GGGGCCCGGGNONE 
J065075F16GGGGCCCGGGNONE 
J065080C16GGGGCCCGGGNONE 
J075007G04GGGGCCCGGGNONE 
J075027O03GGGGCCCGGGNONE 
J075055A13GGGGCCCGGGNONE 
J075055E01GGGGCCCGGGNONE 
J075110N02GGGGCCCGGGNONE 
J075147P10GGGGCCCGGGNONE 
J075175L20GGGGCCCGGGNONE 
Os06g0704300AK107008ATCTGGGCCGGGCCCZinc finger, CCCH-type domain containing protein. 
J065038I12ATCTGGGCCGGGCCCNONE 
J065079E03ATCTGGGCCGGGCCCNONE 
J075035B15ATCTGGGCCGGGCCCNONE 
J090072D21ATCTGGGCCGGGCCCNONE 
Os06g0715000AK107114AACGGGCCCGGTConserved hypothetical protein. 
Os07g0142000AK059877ACCGGGCCCACAReticulon family protein. 
AK099414ACCGGGCCCACANONE 
Os07g0159800009-100-A07CCCGGGCCCACACGNONE 
009-140-B04CCCGGGCCCACACGNONE 
AK059284CCCGGGCCCACACGNONE 
AK060475CCCGGGCCCACACGE1 protein and Def2/Der2 allergen family protein. 
J023054H06CCCGGGCCCACACGNONE 
J023083L17CCCGGGCCCACACGNONE 
J043005N13CCCGGGCCCACACGNONE 
J065164K01CCCGGGCCCACACGNONE 
J065192C18CCCGGGCCCACACGNONE 
J090058G23CCCGGGCCCACACGNONE 
J100017G10CCCGGGCCCACACGNONE 
J100081F12CCCGGGCCCACACGNONE 
Os07g0162600015-024-F04CTTGGGCCCGGANONE 
015-024-F04TCGTGGGCCCGGANONE 
AK105789CTTGGGCCCGGANONE 
AK105789TCGTGGGCCCGGANONE 
AK106274CTTGGGCCCGGAEsterase/lipase/thioesterase domain containing protein. 
AK106274TCGTGGGCCCGGAEsterase/lipase/thioesterase domain containing protein. 
J100026E18CTTGGGCCCGGANONE 
J100026E18TCGTGGGCCCGGANONE 
J100037B07CTTGGGCCCGGANONE 
J100037B07TCGTGGGCCCGGANONE 
J100090H11CTTGGGCCCGGANONE 
J100090H11TCGTGGGCCCGGANONE 
Os07g0171100AF272978TCCGGGCCCACCACNONE 
AK062132TCCGGGCCCACCACNONE 
AK066475TCCGGGCCCACCACTetratricopeptide-like helical domain containing protein. 
J013068C23TCCGGGCCCACCACNONE 
Os07g0173200AK061624ACCGGGCCCACGTFrigida-like family protein. 
AK065275ACCGGGCCCACGTNONE 
AK098856ACCGGGCCCACGTNONE 
AK098899ACCGGGCCCACGTNONE 
Os07g0181500AK072431GCCGGGCCCACCTGTCProtein of unknown function DUF506, plant family protein. 
Os07g0246200012-046-B07GCCGGGCCCACCCGNONE 
AB021259GCCGGGCCCACCCGNONE 
AK065341GCCGGGCCCACCCGSimilar to Calreticulin (Fragment). 
AK099348GCCGGGCCCACCCGNONE 
AK104328GCCGGGCCCACCCGNONE 
AK104826GCCGGGCCCACCCGNONE 
J013000E04GCCGGGCCCACCCGNONE 
J013093M19GCCGGGCCCACCCGNONE 
J013108J08GCCGGGCCCACCCGNONE 
J013118G03GCCGGGCCCACCCGNONE 
J013121I07GCCGGGCCCACCCGNONE 
J013153K07GCCGGGCCCACCCGNONE 
J023028N07GCCGGGCCCACCCGNONE 
J023034F12GCCGGGCCCACCCGNONE 
J023043J11GCCGGGCCCACCCGNONE 
J023087A03GCCGGGCCCACCCGNONE 
J023099N05GCCGGGCCCACCCGNONE 
J023105B02GCCGGGCCCACCCGNONE 
J023110H02GCCGGGCCCACCCGNONE 
J023112E15GCCGGGCCCACCCGNONE 
J023132C20GCCGGGCCCACCCGNONE 
J023134G12GCCGGGCCCACCCGNONE 
J023138O12GCCGGGCCCACCCGNONE 
J033031E05GCCGGGCCCACCCGNONE 
J033032C03GCCGGGCCCACCCGNONE 
J033039K10GCCGGGCCCACCCGNONE 
J033050P09GCCGGGCCCACCCGNONE 
J033074D03GCCGGGCCCACCCGNONE 
J033075G14GCCGGGCCCACCCGNONE 
J033075I23GCCGGGCCCACCCGNONE 
J033081H23GCCGGGCCCACCCGNONE 
J033087N08GCCGGGCCCACCCGNONE 
J033110B03GCCGGGCCCACCCGNONE 
J033148H22GCCGGGCCCACCCGNONE 
J043027F13GCCGGGCCCACCCGNONE 
J043031H01GCCGGGCCCACCCGNONE 
J080003O10GCCGGGCCCACCCGNONE 
J080022D10GCCGGGCCCACCCGNONE 
J080029I12GCCGGGCCCACCCGNONE 
J080034A09GCCGGGCCCACCCGNONE 
J080035H20GCCGGGCCCACCCGNONE 
J080049C10GCCGGGCCCACCCGNONE 
J080053G14GCCGGGCCCACCCGNONE 
J080055J22GCCGGGCCCACCCGNONE 
J080058J04GCCGGGCCCACCCGNONE 
J080069E14GCCGGGCCCACCCGNONE 
J080069M23GCCGGGCCCACCCGNONE 
J080072E19GCCGGGCCCACCCGNONE 
J080072I03GCCGGGCCCACCCGNONE 
J080075B13GCCGGGCCCACCCGNONE 
J080078I11GCCGGGCCCACCCGNONE 
J080081F16GCCGGGCCCACCCGNONE 
J080088O10GCCGGGCCCACCCGNONE 
J080089G18GCCGGGCCCACCCGNONE 
J090009C10GCCGGGCCCACCCGNONE 
J090022D23GCCGGGCCCACCCGNONE 
J090023A15GCCGGGCCCACCCGNONE 
J090024M10GCCGGGCCCACCCGNONE 
J090038F24GCCGGGCCCACCCGNONE 
J090039O13GCCGGGCCCACCCGNONE 
J090040N12GCCGGGCCCACCCGNONE 
J090054I18GCCGGGCCCACCCGNONE 
J090061C16GCCGGGCCCACCCGNONE 
J090063H23GCCGGGCCCACCCGNONE 
J090067F21GCCGGGCCCACCCGNONE 
J090075A01GCCGGGCCCACCCGNONE 
J090076K11GCCGGGCCCACCCGNONE 
J090078L11GCCGGGCCCACCCGNONE 
J090079P03GCCGGGCCCACCCGNONE 
J090087D23GCCGGGCCCACCCGNONE 
J090087G22GCCGGGCCCACCCGNONE 
J090089F03GCCGGGCCCACCCGNONE 
J090092A04GCCGGGCCCACCCGNONE 
J100024L17GCCGGGCCCACCCGNONE 
J100031P13GCCGGGCCCACCCGNONE 
J100032H05GCCGGGCCCACCCGNONE 
J100036P03GCCGGGCCCACCCGNONE 
J100038L07GCCGGGCCCACCCGNONE 
J100043I20GCCGGGCCCACCCGNONE 
J100069A21GCCGGGCCCACCCGNONE 
J100078G06GCCGGGCCCACCCGNONE 
J100081J24GCCGGGCCCACCCGNONE 
J100081N04GCCGGGCCCACCCGNONE 
J100084K16GCCGGGCCCACCCGNONE 
J100085O06GCCGGGCCCACCCGNONE 
J100088L13GCCGGGCCCACCCGNONE 
J100090O21GCCGGGCCCACCCGNONE 
Os07g0438800AK060412ACCGGGCCCCACGNONE 
AK060412GCCGGCCCGGGCCCACCCNONE 
AK100065ACCGGGCCCCACGSimilar to Phosphate starvation regulator protein (Regulatory protein of P- starvation acclimation response Psr1). 
AK100065GCCGGCCCGGGCCCACCCSimilar to Phosphate starvation regulator protein (Regulatory protein of P- starvation acclimation response Psr1). 
AK103195ACCGGGCCCCACGNONE 
AK103195GCCGGCCCGGGCCCACCCNONE 
AY224478ACCGGGCCCCACGNONE 
AY224478GCCGGCCCGGGCCCACCCNONE 
J013160O05ACCGGGCCCCACGNONE 
J013160O05GCCGGCCCGGGCCCACCCNONE 
J023030C05ACCGGGCCCCACGNONE 
J023030C05GCCGGCCCGGGCCCACCCNONE 
J033025O04ACCGGGCCCCACGNONE 
J033025O04GCCGGCCCGGGCCCACCCNONE 
J033121P15ACCGGGCCCCACGNONE 
J033121P15GCCGGCCCGGGCCCACCCNONE 
J043034I23ACCGGGCCCCACGNONE 
J043034I23GCCGGCCCGGGCCCACCCNONE 
J065022N01ACCGGGCCCCACGNONE 
J065022N01GCCGGCCCGGGCCCACCCNONE 
J065022N02ACCGGGCCCCACGNONE 
J065022N02GCCGGCCCGGGCCCACCCNONE 
J065023M01ACCGGGCCCCACGNONE 
J065023M01GCCGGCCCGGGCCCACCCNONE 
J065101G13ACCGGGCCCCACGNONE 
J065101G13GCCGGCCCGGGCCCACCCNONE 
J075058P13ACCGGGCCCCACGNONE 
J075058P13GCCGGCCCGGGCCCACCCNONE 
J075186K10ACCGGGCCCCACGNONE 
J075186K10GCCGGCCCGGGCCCACCCNONE 
J075199F17ACCGGGCCCCACGNONE 
J075199F17GCCGGCCCGGGCCCACCCNONE 
Os07g0474300AK108961CGCCACGTGTCCGGGCCCCConserved hypothetical protein. 
Os07g0512100Os07g0512100TTGTGGGCCCGGCCCGGCCCGGCCCAGTTAnkyrin repeat containing protein. 
Os07g0516900009-108-C10GCCGGGCCCNONE 
AK062798GCCGGGCCCNONE 
Os07g0545400009-136-E03TCCGGGCCCACGANONE 
013-015-G08TCCGGGCCCACGANONE 
AK059228TCCGGGCCCACGANONE 
J065040D09TCCGGGCCCACGANONE 
J065051C19TCCGGGCCCACGANONE 
J065139B05TCCGGGCCCACGANONE 
J065160E20TCCGGGCCCACGANONE 
J065207I17TCCGGGCCCACGANONE 
J080319M24TCCGGGCCCACGANONE 
Os07g0546100AK058282TCCGGGCCCGGGNONE 
Os07g0561300AK072982ACCGGGCCCCACACGCyclin-like F-box domain containing protein. 
J023149I22ACCGGGCCCCACACGNONE 
J065149C18ACCGGGCCCCACACGNONE 
J065166N15ACCGGGCCCCACACGNONE 
J075011J01ACCGGGCCCCACACGNONE 
J075013I05ACCGGGCCCCACACGNONE 
J075039H11ACCGGGCCCCACACGNONE 
J075067J09ACCGGGCCCCACACGNONE 
J075084E08ACCGGGCCCCACACGNONE 
J075085E12ACCGGGCCCCACACGNONE 
J075090D11ACCGGGCCCCACACGNONE 
J075092D12ACCGGGCCCCACACGNONE 
J075126N17ACCGGGCCCCACACGNONE 
J075179F01ACCGGGCCCCACACGNONE 
J075184P21ACCGGGCCCCACACGNONE 
Os07g0568000AK069485CCCGGGCCCCNONE 
AK072783CCCGGGCCCCApolipophorin III-like domain containing protein. 
Os07g0568300AK067784CCCGGGCCCNONE 
AK067895CCCGGGCCCSimilar to ZF protein (Fragment). 
J013119M01CCCGGGCCCNONE 
J013120B09CCCGGGCCCNONE 
J013123G12CCCGGGCCCNONE 
J023012C12CCCGGGCCCNONE 
J023020G17CCCGGGCCCNONE 
J023037E23CCCGGGCCCNONE 
J033076I01CCCGGGCCCNONE 
J033108A07CCCGGGCCCNONE 
J033138J02CCCGGGCCCNONE 
J075033L09CCCGGGCCCNONE 
J075049E02CCCGGGCCCNONE 
J075060N23CCCGGGCCCNONE 
J075094H13CCCGGGCCCNONE 
J075179L18CCCGGGCCCNONE 
J080005P09CCCGGGCCCNONE 
J080044J03CCCGGGCCCNONE 
J080062G20CCCGGGCCCNONE 
J080063L23CCCGGGCCCNONE 
J080065B16CCCGGGCCCNONE 
J080071K09CCCGGGCCCNONE 
J080089C23CCCGGGCCCNONE 
J090008P21CCCGGGCCCNONE 
J090046B22CCCGGGCCCNONE 
J090094C19CCCGGGCCCNONE 
J090096B19CCCGGGCCCNONE 
J100060G03CCCGGGCCCNONE 
J100082D16CCCGGGCCCNONE 
Os07g0569100013-067-E02CCCGGGCCCACCTNONE 
013-081-C06CCCGGGCCCACCTNONE 
014-030-G06CCCGGGCCCACCTNONE 
014-034-H09CCCGGGCCCACCTNONE 
AK120160CCCGGGCCCACCTRemorin, C-terminal region domain containing protein. 
J090034F20CCCGGGCCCACCTNONE 
Os07g0619400009-095-D09TCCGGGCCCATATNONE 
AK062716TCCGGGCCCATATCalcium-binding EF-hand domain containing protein. 
Os07g0639900J080305F09CAGGTGGGCCGGGCCCATAANONE 
J080305J22CAGGTGGGCCGGGCCCATAAThymidylate kinase domain containing protein. 
J080311G07CAGGTGGGCCGGGCCCATAANONE 
J080315B14CAGGTGGGCCGGGCCCATAANONE 
J080317C02CAGGTGGGCCGGGCCCATAANONE 
Os07g0661600006-050-D12ACGCGTGGGCCCGGGNONE 
009-124-B10ACGCGTGGGCCCGGGNONE 
AK061123ACGCGTGGGCCCGGGNONE 
AK066432ACGCGTGGGCCCGGGSimilar to RNA-binding protein-like protein. 
AK104664ACGCGTGGGCCCGGGNONE 
J013064M13ACGCGTGGGCCCGGGNONE 
J013122O12ACGCGTGGGCCCGGGNONE 
J033044A16ACGCGTGGGCCCGGGNONE 
J033144D14ACGCGTGGGCCCGGGNONE 
J090078P13ACGCGTGGGCCCGGGNONE 
Os07g0681500AK103662TCCGGGCCCACCTGACAGGNONE 
AK121650TCCGGGCCCACCTGACAGGAnkyrin repeat containing protein. 
Os07g0690300012-048-A07GCCGGGCCCACGGGNONE 
AK099674GCCGGGCCCACGGGChromatin SPT2 family protein. 
J013028F12GCCGGGCCCACGGGNONE 
J013069F21GCCGGGCCCACGGGNONE 
J013104E17GCCGGGCCCACGGGNONE 
J013153M16GCCGGGCCCACGGGNONE 
J023012L09GCCGGGCCCACGGGNONE 
J023069A08GCCGGGCCCACGGGNONE 
J023132L23GCCGGGCCCACGGGNONE 
J033120P19GCCGGGCCCACGGGNONE 
J065173J03GCCGGGCCCACGGGNONE 
J075008H06GCCGGGCCCACGGGNONE 
J075043J15GCCGGGCCCACGGGNONE 
J075147I12GCCGGGCCCACGGGNONE 
J090041G07GCCGGGCCCACGGGNONE 
Os08g0120000006-042-E02CCCGGGCCCACANONE 
006-051-F06CCCGGGCCCACANONE 
006-052-G03CCCGGGCCCACANONE 
006-095-B11CCCGGGCCCACANONE 
AB017427CCCGGGCCCACANONE 
AB017428CCCGGGCCCACANONE 
AK059789CCCGGGCCCACANONE 
AK059815CCCGGGCCCACASuccinate dehydrogenase iron-protein subunit (SDHB). 
AK099077CCCGGGCCCACANONE 
AK102607CCCGGGCCCACANONE 
AK104303CCCGGGCCCACANONE 
AK104304CCCGGGCCCACANONE 
AK104421CCCGGGCCCACANONE 
D10414CCCGGGCCCACANONE 
J013170D08CCCGGGCCCACANONE 
J023086D16CCCGGGCCCACANONE 
J033099B04CCCGGGCCCACANONE 
J065042P05CCCGGGCCCACANONE 
J065144E22CCCGGGCCCACANONE 
J065162J20CCCGGGCCCACANONE 
J065196N13CCCGGGCCCACANONE 
J090013B11CCCGGGCCCACANONE 
Os08g0127500AK071322GCCGGGCCCACAAcid phosphatase/vanadium-dependent haloperoxidase related family protein. 
J023087N16GCCGGGCCCACANONE 
J065146A20GCCGGGCCCACANONE 
J075043F12GCCGGGCCCACANONE 
J090015B21GCCGGGCCCACANONE 
Os08g0128200AK120428CGTGTGGGCCCGGGConserved hypothetical protein. 
Os08g0135900AK072535CCGATCCGGTGGGCCCGGTSimilar to Tryptophan synthase beta chain 1 (EC 4.2.1.20) (Orange pericarp 1) (Fragment). 
Os08g0160600AK106763CCCGGGCCCCACCTGTConserved hypothetical protein. 
Os08g0440100AK068551TCCGGGCCCSimilar to Temperature stress-induced lipocalin. 
J013155M04TCCGGGCCCNONE 
J033041C20TCCGGGCCCNONE 
J043031L02TCCGGGCCCNONE 
J043038J23TCCGGGCCCNONE 
J065006F20TCCGGGCCCNONE 
J065030H05TCCGGGCCCNONE 
J065069H05TCCGGGCCCNONE 
J065078M19TCCGGGCCCNONE 
J065146E24TCCGGGCCCNONE 
J065154J17TCCGGGCCCNONE 
J065158L04TCCGGGCCCNONE 
J065182J20TCCGGGCCCNONE 
J065211P16TCCGGGCCCNONE 
J075020M18TCCGGGCCCNONE 
J075035J01TCCGGGCCCNONE 
J075037K13TCCGGGCCCNONE 
J075052E12TCCGGGCCCNONE 
J075056I12TCCGGGCCCNONE 
J075064H18TCCGGGCCCNONE 
J075121E06TCCGGGCCCNONE 
J075123H03TCCGGGCCCNONE 
J075146P20TCCGGGCCCNONE 
J075156O06TCCGGGCCCNONE 
J075158A14TCCGGGCCCNONE 
J075169L03TCCGGGCCCNONE 
J090013K02TCCGGGCCCNONE 
Os08g0473900012-010-C04ACCGGGCCCCNONE 
012-025-A10ACCGGGCCCCNONE 
012-025-C03ACCGGGCCCCNONE 
012-030-H02ACCGGGCCCCNONE 
012-033-A03ACCGGGCCCCNONE 
012-044-F02ACCGGGCCCCNONE 
012-046-F01ACCGGGCCCCNONE 
012-050-C04ACCGGGCCCCNONE 
012-051-G08ACCGGGCCCCNONE 
012-051-H03ACCGGGCCCCNONE 
012-056-F12ACCGGGCCCCNONE 
012-062-E07ACCGGGCCCCNONE 
012-067-C12ACCGGGCCCCNONE 
012-073-B07ACCGGGCCCCNONE 
012-078-H09ACCGGGCCCCNONE 
012-083-G12ACCGGGCCCCNONE 
012-086-C12ACCGGGCCCCNONE 
012-089-H12ACCGGGCCCCNONE 
012-091-B09ACCGGGCCCCNONE 
012-092-G08ACCGGGCCCCNONE 
014-045-D08ACCGGGCCCCNONE 
015-004-H02ACCGGGCCCCNONE 
015-005-G05ACCGGGCCCCNONE 
015-007-D06ACCGGGCCCCNONE 
015-014-G04ACCGGGCCCCNONE 
015-019-G11ACCGGGCCCCNONE 
015-037-G04ACCGGGCCCCNONE 
015-044-D02ACCGGGCCCCNONE 
015-046-A05ACCGGGCCCCNONE 
015-049-D09ACCGGGCCCCNONE 
015-052-F12ACCGGGCCCCNONE 
015-054-E03ACCGGGCCCCNONE 
015-066-D02ACCGGGCCCCNONE 
015-070-H03ACCGGGCCCCNONE 
015-074-H10ACCGGGCCCCNONE 
015-077-C04ACCGGGCCCCNONE 
015-090-A10ACCGGGCCCCNONE 
015-091-F11ACCGGGCCCCNONE 
016-002-G04ACCGGGCCCCNONE 
016-004-E03ACCGGGCCCCNONE 
016-008-H10ACCGGGCCCCNONE 
016-015-G12ACCGGGCCCCNONE 
016-018-G01ACCGGGCCCCNONE 
016-023-C07ACCGGGCCCCNONE 
016-023-G06ACCGGGCCCCNONE 
016-027-G04ACCGGGCCCCNONE 
016-039-G04ACCGGGCCCCNONE 
016-044-A06ACCGGGCCCCNONE 
016-053-H06ACCGGGCCCCNONE 
016-063-H03ACCGGGCCCCNONE 
016-066-A01ACCGGGCCCCNONE 
016-066-E08ACCGGGCCCCNONE 
016-072-G03ACCGGGCCCCNONE 
016-088-C06ACCGGGCCCCNONE 
016-090-D01ACCGGGCCCCNONE 
AK073487ACCGGGCCCCAlpha-amylase isozyme 3D precursor (EC 3.2.1.1) (1,4-alpha-D-glucan glucanohydrolase). 
AK119561ACCGGGCCCCNONE 
AK119761ACCGGGCCCCNONE 
J033024B15ACCGGGCCCCNONE 
J033040A17ACCGGGCCCCNONE 
J033041J03ACCGGGCCCCNONE 
J033093F11ACCGGGCCCCNONE 
J033117E15ACCGGGCCCCNONE 
J033128F11ACCGGGCCCCNONE 
J065006O09ACCGGGCCCCNONE 
J065010E21ACCGGGCCCCNONE 
J065011P15ACCGGGCCCCNONE 
J065013M15ACCGGGCCCCNONE 
J065019E20ACCGGGCCCCNONE 
J065021I21ACCGGGCCCCNONE 
J065022D23ACCGGGCCCCNONE 
J065024L10ACCGGGCCCCNONE 
J065026P16ACCGGGCCCCNONE 
J065027C20ACCGGGCCCCNONE 
J065027G06ACCGGGCCCCNONE 
J065027G23ACCGGGCCCCNONE 
J065028B11ACCGGGCCCCNONE 
J065030J05ACCGGGCCCCNONE 
J065031G17ACCGGGCCCCNONE 
J065034J07ACCGGGCCCCNONE 
J065037N01ACCGGGCCCCNONE 
J065040H20ACCGGGCCCCNONE 
J065041C22ACCGGGCCCCNONE 
J065044A21ACCGGGCCCCNONE 
J065044L06ACCGGGCCCCNONE 
J065045J02ACCGGGCCCCNONE 
J065048D10ACCGGGCCCCNONE 
J065049H23ACCGGGCCCCNONE 
J065049I21ACCGGGCCCCNONE 
J065052D03ACCGGGCCCCNONE 
J065055D22ACCGGGCCCCNONE 
J065057L13ACCGGGCCCCNONE 
J065058B13ACCGGGCCCCNONE 
J065059B04ACCGGGCCCCNONE 
J065059C05ACCGGGCCCCNONE 
J065059H01ACCGGGCCCCNONE 
J065059K01ACCGGGCCCCNONE 
J065063G19ACCGGGCCCCNONE 
J065073E20ACCGGGCCCCNONE 
J065075I10ACCGGGCCCCNONE 
J065081I24ACCGGGCCCCNONE 
J065084E05ACCGGGCCCCNONE 
J065084E12ACCGGGCCCCNONE 
J065084J12ACCGGGCCCCNONE 
J065086H18ACCGGGCCCCNONE 
J065087F07ACCGGGCCCCNONE 
J065095J02ACCGGGCCCCNONE 
J065097E24ACCGGGCCCCNONE 
J065102I06ACCGGGCCCCNONE 
J065104N21ACCGGGCCCCNONE 
J065105A16ACCGGGCCCCNONE 
J065107C13ACCGGGCCCCNONE 
J065108N11ACCGGGCCCCNONE 
J065112I04ACCGGGCCCCNONE 
J065112J05ACCGGGCCCCNONE 
J065112K17ACCGGGCCCCNONE 
J065115I05ACCGGGCCCCNONE 
J065120J21ACCGGGCCCCNONE 
J065120K18ACCGGGCCCCNONE 
J065121L19ACCGGGCCCCNONE 
J065123K20ACCGGGCCCCNONE 
J065123M10ACCGGGCCCCNONE 
J065124L18ACCGGGCCCCNONE 
J065127E19ACCGGGCCCCNONE 
J065128B05ACCGGGCCCCNONE 
J065130F11ACCGGGCCCCNONE 
J065130P06ACCGGGCCCCNONE 
J065132K13ACCGGGCCCCNONE 
J065134I17ACCGGGCCCCNONE 
J065139I11ACCGGGCCCCNONE 
J065141G14ACCGGGCCCCNONE 
J065141O04ACCGGGCCCCNONE 
J065146P07ACCGGGCCCCNONE 
J065148L24ACCGGGCCCCNONE 
J065154H20ACCGGGCCCCNONE 
J065155I05ACCGGGCCCCNONE 
J065165F05ACCGGGCCCCNONE 
J065166I20ACCGGGCCCCNONE 
J065168D14ACCGGGCCCCNONE 
J065168F12ACCGGGCCCCNONE 
J065169F17ACCGGGCCCCNONE 
J065169J11ACCGGGCCCCNONE 
J065169O14ACCGGGCCCCNONE 
J065171E05ACCGGGCCCCNONE 
J065171L21ACCGGGCCCCNONE 
J065175G24ACCGGGCCCCNONE 
J065178M19ACCGGGCCCCNONE 
J065179C17ACCGGGCCCCNONE 
J065179E04ACCGGGCCCCNONE 
J065180C03ACCGGGCCCCNONE 
J065182D08ACCGGGCCCCNONE 
J065183P17ACCGGGCCCCNONE 
J065188N09ACCGGGCCCCNONE 
J065190G15ACCGGGCCCCNONE 
J065190N03ACCGGGCCCCNONE 
J065191H11ACCGGGCCCCNONE 
J065193C13ACCGGGCCCCNONE 
J065193G19ACCGGGCCCCNONE 
J065199F19ACCGGGCCCCNONE 
J065202L20ACCGGGCCCCNONE 
J065204K12ACCGGGCCCCNONE 
J065206H08ACCGGGCCCCNONE 
J065208E02ACCGGGCCCCNONE 
J065210O09ACCGGGCCCCNONE 
J065211L19ACCGGGCCCCNONE 
J065211N19ACCGGGCCCCNONE 
J065212I06ACCGGGCCCCNONE 
J065213P21ACCGGGCCCCNONE 
J065215C14ACCGGGCCCCNONE 
J100032J03ACCGGGCCCCNONE 
M24287ACCGGGCCCCNONE 
Os08g0544800009-168-G01GGGGCCCGGTNONE 
011-046-D09GGGGCCCGGTNONE 
012-003-C08GGGGCCCGGTNONE 
012-042-B06GGGGCCCGGTNONE 
013-035-H12GGGGCCCGGTNONE 
013-072-A10GGGGCCCGGTNONE 
014-010-B11GGGGCCCGGTNONE 
014-097-E06GGGGCCCGGTNONE 
015-003-E12GGGGCCCGGTNONE 
015-040-B04GGGGCCCGGTNONE 
AK060536GGGGCCCGGTNONE 
AK102666GGGGCCCGGTNONE 
AK119660GGGGCCCGGTPCF2. 
D87261GGGGCCCGGTNONE 
J090049N23GGGGCCCGGTNONE 
J090084G06GGGGCCCGGTNONE 
Os09g0330200AK111018GCCGGGCCCAGGCCACGTCConserved hypothetical protein. 
Os09g0347900AK071224GGCCGGGCCCACCTGConserved hypothetical protein. 
J023087B12GGCCGGGCCCACCTGNONE 
Os09g0412900014-003-F10GGGCCGGGCCCGTTAGGCCCAACANONE 
AK102254GGGCCGGGCCCGTTAGGCCCAACAProtein prenyltransferase domain containing protein. 
AK102867GGGCCGGGCCCGTTAGGCCCAACANONE 
J033088H22GGGCCGGGCCCGTTAGGCCCAACANONE 
Os09g0416400J075067A16TCGGACGGCGGAGAGGTGGGCCCGGAConserved hypothetical protein. 
J075104N21TCGGACGGCGGAGAGGTGGGCCCGGANONE 
J075106F04TCGGACGGCGGAGAGGTGGGCCCGGANONE 
J075131F08TCGGACGGCGGAGAGGTGGGCCCGGANONE 
Os09g0433700AK072369TCCGGGCCCSimilar to Pectin methylesterase (Fragment). 
Os09g0439600AK100577GCCGGGCCCACGAExo70 exocyst complex subunit family protein. 
J090071K03GCCGGGCCCACGANONE 
Os09g0465600AB107218CCCGGGCCCACCTNONE 
AK068061CCCGGGCCCACCTSimilar to Glucose-6-phosphate isomerase-like protein (Fragment). 
AY224509CCCGGGCCCACCTNONE 
Os09g0480400AK100641TCCGGGCCCCCCCGCGSimilar to Glycosyltransferase QUASIMODO1 (EC 2.4.1.-). 
J023110G15TCCGGGCCCCCCCGCGNONE 
J090053K21TCCGGGCCCCCCCGCGNONE 
Os09g0491772011-007-H10CCCGGGCCCACCNONE 
012-015-C11CCCGGGCCCACCNONE 
012-060-G11CCCGGGCCCACCNONE 
015-020-F09CCCGGGCCCACCNONE 
015-035-F07CCCGGGCCCACCNONE 
016-035-G11CCCGGGCCCACCNONE 
AK069787CCCGGGCCCACCSimilar to Heat shock protein 70 (Hsc70-5). 
J023030H18CCCGGGCCCACCNONE 
J023060K21CCCGGGCCCACCNONE 
J023079I08CCCGGGCCCACCNONE 
J023111B17CCCGGGCCCACCNONE 
J023123E03CCCGGGCCCACCNONE 
J023125B22CCCGGGCCCACCNONE 
J023126H24CCCGGGCCCACCNONE 
J023131N16CCCGGGCCCACCNONE 
J023149M09CCCGGGCCCACCNONE 
J033022H04CCCGGGCCCACCNONE 
J033022L09CCCGGGCCCACCNONE 
J033038H14CCCGGGCCCACCNONE 
J033044M15CCCGGGCCCACCNONE 
J033044O04CCCGGGCCCACCNONE 
J033050E01CCCGGGCCCACCNONE 
J033066L09CCCGGGCCCACCNONE 
J033075I19CCCGGGCCCACCNONE 
J033079F17CCCGGGCCCACCNONE 
J033093L14CCCGGGCCCACCNONE 
J033094C14CCCGGGCCCACCNONE 
J033094G07CCCGGGCCCACCNONE 
J033101G06CCCGGGCCCACCNONE 
J033103D07CCCGGGCCCACCNONE 
J033105K18CCCGGGCCCACCNONE 
J033112M23CCCGGGCCCACCNONE 
J033119D21CCCGGGCCCACCNONE 
J033121G18CCCGGGCCCACCNONE 
J033124B01CCCGGGCCCACCNONE 
J033126C07CCCGGGCCCACCNONE 
J033140K24CCCGGGCCCACCNONE 
J033141P13CCCGGGCCCACCNONE 
J033142K24CCCGGGCCCACCNONE 
J043024P12CCCGGGCCCACCNONE 
J043031P09CCCGGGCCCACCNONE 
J043039O09CCCGGGCCCACCNONE 
J065101K22CCCGGGCCCACCNONE 
J065136K09CCCGGGCCCACCNONE 
J090004J08CCCGGGCCCACCNONE 
J090010F03CCCGGGCCCACCNONE 
J090014L23CCCGGGCCCACCNONE 
J090020E05CCCGGGCCCACCNONE 
J090032D02CCCGGGCCCACCNONE 
J090048A04CCCGGGCCCACCNONE 
J090061G05CCCGGGCCCACCNONE 
Os09g0516600AK070780CCCGGGCCCACCAGCCCAGNONE 
AK103563CCCGGGCCCACCAGCCCAGNONE 
AY054407CCCGGGCCCACCAGCCCAGGlyoxalase II. 
J013058P06CCCGGGCCCACCAGCCCAGNONE 
J013093G04CCCGGGCCCACCAGCCCAGNONE 
J023007G05CCCGGGCCCACCAGCCCAGNONE 
J023091A08CCCGGGCCCACCAGCCCAGNONE 
J023136K23CCCGGGCCCACCAGCCCAGNONE 
J023138D20CCCGGGCCCACCAGCCCAGNONE 
J033022N20CCCGGGCCCACCAGCCCAGNONE 
J033065N15CCCGGGCCCACCAGCCCAGNONE 
J033109L23CCCGGGCCCACCAGCCCAGNONE 
J053073C08CCCGGGCCCACCAGCCCAGNONE 
J075094J24CCCGGGCCCACCAGCCCAGNONE 
J075106P21CCCGGGCCCACCAGCCCAGNONE 
Os09g0539100AK071977ACCGGGCCCATTTSimilar to 3-dehydroquinate synthase-like protein. 
AK098959ACCGGGCCCATTTNONE 
Os09g0547200016-021-H03CCCGGGCCCACACACCNONE 
AK073078CCCGGGCCCACACACCProtein of unknown function DUF292, eukaryotic domain containing protein. 
AK104984CCCGGGCCCACACACCNONE 
J065005L05CCCGGGCCCACACACCNONE 
J065039C06CCCGGGCCCACACACCNONE 
J065116H17CCCGGGCCCACACACCNONE 
J100046A17CCCGGGCCCACACACCNONE 
Os11g0156600Os11g0156600ACCGGGCCCCACCTB2/DP1 and HVA22 related protein family protein. 
Os11g0216100AK059179ACGTGGGCCCGGGSimilar to Chaperone protein dnaJ. 
Os11g0429000AK067370CCCGGGCCCACGCConserved hypothetical protein. 
Os11g0445300AK073557GCCGGGCCCCProtein kinase-like domain containing protein. 
J033046C19GCCGGGCCCCNONE 
J065025H02GCCGGGCCCCNONE 
J065026K20GCCGGGCCCCNONE 
J065161F22GCCGGGCCCCNONE 
J065196D22GCCGGGCCCCNONE 
J075130B15GCCGGGCCCCNONE 
J090004H14GCCGGGCCCCNONE 
J090083D24GCCGGGCCCCNONE 
J100077F15GCCGGGCCCCNONE 
Os11g0544700AF464904CCCGGGCCCCNONE 
AK072844CCCGGGCCCCRepressor protein. 
J023143I16CCCGGGCCCCNONE 
Os11g0549615AK069660TCCGGGCCCACCTGAcid phosphatase, type 5 family protein. 
J023031L04TCCGGGCCCACCTGNONE 
Os11g0549690J065085G07AGTGGGCCGGGCCCAACTConserved hypothetical protein. 
J065218B08AGTGGGCCGGGCCCAACTNONE 
J090036H16AGTGGGCCGGGCCCAACTNONE 
Os11g0604600006-022-C01ACCGGGCCCCACGCGTNONE 
AK061397ACCGGGCCCCACGCGTNONE 
AK102376ACCGGGCCCCACGCGTRINGv domain containing protein. 
J033091P05ACCGGGCCCCACGCGTNONE 
J065062C12ACCGGGCCCCACGCGTNONE 
J065062H09ACCGGGCCCCACGCGTNONE 
J065064A02ACCGGGCCCCACGCGTNONE 
J065101I16ACCGGGCCCCACGCGTNONE 
J065123F23ACCGGGCCCCACGCGTNONE 
J065155N12ACCGGGCCCCACGCGTNONE 
J065164F22ACCGGGCCCCACGCGTNONE 
J065181G08ACCGGGCCCCACGCGTNONE 
J075055H05ACCGGGCCCCACGCGTNONE 
J075058A22ACCGGGCCCCACGCGTNONE 
J075082H23ACCGGGCCCCACGCGTNONE 
J075111A14ACCGGGCCCCACGCGTNONE 
J075176I06ACCGGGCCCCACGCGTNONE 
Os12g0158700J065021C04TGTGGGCCCGGGNONE 
J090082H20TGTGGGCCCGGGConserved hypothetical protein. 
Os12g0188900012-030-C08GCCGGGCCCGCNONE 
J013027N23GCCGGGCCCGCConserved hypothetical protein. 
J013156K23GCCGGGCCCGCNONE 
J023134K02GCCGGGCCCGCNONE 
J033051M18GCCGGGCCCGCNONE 
J033143K05GCCGGGCCCGCNONE 
J080003C24GCCGGGCCCGCNONE 
J080004K05GCCGGGCCCGCNONE 
J080009D14GCCGGGCCCGCNONE 
J080014L12GCCGGGCCCGCNONE 
J080020E23GCCGGGCCCGCNONE 
J080021K20GCCGGGCCCGCNONE 
J080024B19GCCGGGCCCGCNONE 
J080024C12GCCGGGCCCGCNONE 
J080031K10GCCGGGCCCGCNONE 
J080034G09GCCGGGCCCGCNONE 
J080036C10GCCGGGCCCGCNONE 
J080037K18GCCGGGCCCGCNONE 
J080039J17GCCGGGCCCGCNONE 
J080040A20GCCGGGCCCGCNONE 
J080042B06GCCGGGCCCGCNONE 
J080046P07GCCGGGCCCGCNONE 
J080047G02GCCGGGCCCGCNONE 
J080049E12GCCGGGCCCGCNONE 
J080056N14GCCGGGCCCGCNONE 
J080059K10GCCGGGCCCGCNONE 
J080064F05GCCGGGCCCGCNONE 
J080064I04GCCGGGCCCGCNONE 
J080064K17GCCGGGCCCGCNONE 
J080069A15GCCGGGCCCGCNONE 
J080071E22GCCGGGCCCGCNONE 
J080071M24GCCGGGCCCGCNONE 
J080074C17GCCGGGCCCGCNONE 
J080075J07GCCGGGCCCGCNONE 
J080079F11GCCGGGCCCGCNONE 
J080083F15GCCGGGCCCGCNONE 
J080084N21GCCGGGCCCGCNONE 
J080086O03GCCGGGCCCGCNONE 
J080089K02GCCGGGCCCGCNONE 
J080092K22GCCGGGCCCGCNONE 
J080093P09GCCGGGCCCGCNONE 
J090001N04GCCGGGCCCGCNONE 
J090041M02GCCGGGCCCGCNONE 
Os12g0210200AF309381TGTGGGCCCGGGNONE 
AK069105TGTGGGCCCGGGSimilar to Glutathione S-transferase GST 18 (EC 2.5.1.18). 
J023004I03TGTGGGCCCGGGNONE 
J033069C11TGTGGGCCCGGGNONE 
J065087E20TGTGGGCCCGGGNONE 
J065097G21TGTGGGCCCGGGNONE 
Os12g0223300006-037-D03GGGCCCGGCCCATTNONE 
AJ429043GGGCCCGGCCCATTNONE 
AK060133GGGCCCGGCCCATTSimilar to Outer membrane cytochrome b(5) (Fragment). 
AK073017GGGCCCGGCCCATTNONE 
J065085K05GGGCCCGGCCCATTNONE 
J075053C01GGGCCCGGCCCATTNONE 
J075055O06GGGCCCGGCCCATTNONE 
J075073B01GGGCCCGGCCCATTNONE 
J075089M07GGGCCCGGCCCATTNONE 
J075095E16GGGCCCGGCCCATTNONE 
J075112O19GGGCCCGGCCCATTNONE 
J075143A11GGGCCCGGCCCATTNONE 
J075173D24GGGCCCGGCCCATTNONE 
J075199G18GGGCCCGGCCCATTNONE 
J090030N06GGGCCCGGCCCATTNONE 
J100052H12GGGCCCGGCCCATTNONE 
J100079F09GGGCCCGGCCCATTNONE 
Os12g0443700AK069541GCCGGGCCCATCCSimilar to Glu-prolyl-tRNA aminoacyl synthetase (Fragment). 
AK104881GCCGGGCCCATCCNONE 
Os12g0477600009-115-E02ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
009-125-D04ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
009-152-E11ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
013-003-H06ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
AK099534ACCGGGCCCACTGGGCCGGAGGCCCAAAAConserved hypothetical protein. 
J065109J18ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J065115L23ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075002K19ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075034D13ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075038B07ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075051A21ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075052J11ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075072A08ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075080E10ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075101E13ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075112F22ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075139O17ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075141K08ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075146N01ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075171J24ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
Os12g0527500AK109836CCAGGCCCATCCGGGCCCACGGCCCyclin-like F-box domain containing protein. 
Os12g0541400AK101210CCCGGGCCCCPrefoldin domain containing protein. 
J033031A17CCCGGGCCCCNONE 
J090051F01CCCGGGCCCCNONE 
Os12g0560300AK060332CCCGGGCCCACGTGTCSimilar to NTGB2 (Fragment). 
AK099125CCCGGGCCCACGTGTCNONE 
AK099149CCCGGGCCCACGTGTCNONE 
J023044P12CCCGGGCCCACGTGTCNONE 
J023063C05CCCGGGCCCACGTGTCNONE 
J043006H11CCCGGGCCCACGTGTCNONE 
J065055C21CCCGGGCCCACGTGTCNONE 
J065104A14CCCGGGCCCACGTGTCNONE 
J075156I06CCCGGGCCCACGTGTCNONE 
J090083J19CCCGGGCCCACGTGTCNONE 
J100069A17CCCGGGCCCACGTGTCNONE 
Os12g0613500009-028-C05CCACTGACAACCGGGCCCCACCACACACCCGGCCCCACANONE 
011-081-E10CCACTGACAACCGGGCCCCACCACACACCCGGCCCCACANONE 
AB118018CCACTGACAACCGGGCCCCACCACACACCCGGCCCCACANONE 
AK058205CCACTGACAACCGGGCCCCACCACACACCCGGCCCCACANONE 
AK101273CCACTGACAACCGGGCCCCACCACACACCCGGCCCCACALissencephaly type-1-like homology motif domain containing protein. 
J033033A11CCACTGACAACCGGGCCCCACCACACACCCGGCCCCACANONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.