version

Summary of OsREG544 (All List)

OrganismOryza sativa  
IDOsREG544  
SequenceCCGGGCCG  
Annotation  
PPDB Motif 
PLACE Motif 
Total Entry Count1631  

Entry Sequences (1631 entries)

LocusGene modelSequenceDescription
Os01g0144600006-037-H02ACCGGGCCGTGGTGATGGGCCCGNONE 
AK061501ACCGGGCCGTGGTGATGGGCCCGConserved hypothetical protein. 
AK102823ACCGGGCCGTGGTGATGGGCCCGNONE 
J033108P10ACCGGGCCGTGGTGATGGGCCCGNONE 
J043026K08ACCGGGCCGTGGTGATGGGCCCGNONE 
J090009H21ACCGGGCCGTGGTGATGGGCCCGNONE 
Os01g0166800AK073783ATCTCGGCCCGGCConserved hypothetical protein. 
AK099378ATCTCGGCCCGGCNONE 
J033026H10ATCTCGGCCCGGCNONE 
J033067O18ATCTCGGCCCGGCNONE 
J033108A17ATCTCGGCCCGGCNONE 
J065015J11ATCTCGGCCCGGCNONE 
J065204P09ATCTCGGCCCGGCNONE 
Os01g0188200015-013-B12GGTTGGGCTGGCCGGGCCGNONE 
Os01g0206200AK102840CCAGGCCCGGCCCGGCCCATAAConserved hypothetical protein. 
J065099M13CCAGGCCCGGCCCGGCCCATAANONE 
Os01g0231700012-002-F11ATATGGGCCGGGCCGAGNONE 
013-082-F05ATATGGGCCGGGCCGAGNONE 
AK107453ATATGGGCCGGGCCGAGSimilar to 60S acidic ribosomal protein P2-B (CaRP2B). 
J065005L22ATATGGGCCGGGCCGAGNONE 
J065023E21ATATGGGCCGGGCCGAGNONE 
J065036H21ATATGGGCCGGGCCGAGNONE 
J065037M24ATATGGGCCGGGCCGAGNONE 
J065049L04ATATGGGCCGGGCCGAGNONE 
J065072F17ATATGGGCCGGGCCGAGNONE 
J065085H10ATATGGGCCGGGCCGAGNONE 
J065109N19ATATGGGCCGGGCCGAGNONE 
J065117M19ATATGGGCCGGGCCGAGNONE 
J065144C15ATATGGGCCGGGCCGAGNONE 
J065159G24ATATGGGCCGGGCCGAGNONE 
J065164N14ATATGGGCCGGGCCGAGNONE 
J075025K16ATATGGGCCGGGCCGAGNONE 
J075057L05ATATGGGCCGGGCCGAGNONE 
J075070I16ATATGGGCCGGGCCGAGNONE 
J075089D10ATATGGGCCGGGCCGAGNONE 
J075138F10ATATGGGCCGGGCCGAGNONE 
J090018C11ATATGGGCCGGGCCGAGNONE 
J100018L19ATATGGGCCGGGCCGAGNONE 
J100024B14ATATGGGCCGGGCCGAGNONE 
J100048L02ATATGGGCCGGGCCGAGNONE 
J100055A22ATATGGGCCGGGCCGAGNONE 
J100069K01ATATGGGCCGGGCCGAGNONE 
Os01g0238500006-086-E04GCCCGGCCGGGCCGGCNONE 
AK067076GCCCGGCCGGGCCGGCSimilar to Branched-chain-amino-acid aminotransferase-like protein 3, chloroplast precursor. 
AK104302GCCCGGCCGGGCCGGCNONE 
J013093D15GCCCGGCCGGGCCGGCNONE 
J065038O05GCCCGGCCGGGCCGGCNONE 
J075089I20GCCCGGCCGGGCCGGCNONE 
J075122B01GCCCGGCCGGGCCGGCNONE 
J090086G20GCCCGGCCGGGCCGGCNONE 
Os01g0246500AK058984TCCGGGCCGGGCCCAAAASimilar to Minus dominance protein. 
Os01g0557100Os01g0557100CGGCCCGGCAlpha/beta hydrolase family protein. 
Os01g0558600006-120-G12ATCTCGGCCCGGCCCGGCCCAACTNONE 
J013100N20ATCTCGGCCCGGCCCGGCCCAACTNONE 
J033043P09ATCTCGGCCCGGCCCGGCCCAACTNONE 
J033125M18ATCTCGGCCCGGCCCGGCCCAACTNONE 
J053043N11ATCTCGGCCCGGCCCGGCCCAACTNONE 
J065008E07ATCTCGGCCCGGCCCGGCCCAACTNONE 
J065080O16ATCTCGGCCCGGCCCGGCCCAACTNONE 
J075002G24ATCTCGGCCCGGCCCGGCCCAACTNONE 
J075123C09ATCTCGGCCCGGCCCGGCCCAACTNONE 
S66160ATCTCGGCCCGGCCCGGCCCAACTRas-related protein RIC1. 
Os01g0587000AK067605CCCGGCCCGGCCSimilar to Vacuolar ATP synthase subunit d (EC 3.6.3.14) (V-ATPase d subunit) (Vacuolar proton pump d subunit) (V-ATPase 41 KDa accessory protein) (DVA41). 
Os01g0588700AK066951CTCGGCCCGGTProtein of unknown function DUF572 family protein. 
AK071911CTCGGCCCGGTNONE 
J013059D18CTCGGCCCGGTNONE 
J013090C12CTCGGCCCGGTNONE 
J090043F17CTCGGCCCGGTNONE 
Os01g0606900AK065697CCCGGGCCGCAHeat shock protein DnaJ, N-terminal domain containing protein. 
Os01g0612600004-008-D07TGCGGGCCGGGCCGNONE 
009-057-C09TGCGGGCCGGGCCGNONE 
009-130-C01TGCGGGCCGGGCCGNONE 
AK062906TGCGGGCCGGGCCGNONE 
AK066561TGCGGGCCGGGCCGProtein of unknown function DUF1644 family protein. 
J013065E14TGCGGGCCGGGCCGNONE 
J013073D14TGCGGGCCGGGCCGNONE 
J023014A21TGCGGGCCGGGCCGNONE 
J023073M13TGCGGGCCGGGCCGNONE 
J023079F02TGCGGGCCGGGCCGNONE 
J023083B16TGCGGGCCGGGCCGNONE 
J023090G19TGCGGGCCGGGCCGNONE 
J023095F15TGCGGGCCGGGCCGNONE 
J023119H11TGCGGGCCGGGCCGNONE 
J033040B01TGCGGGCCGGGCCGNONE 
J033044F13TGCGGGCCGGGCCGNONE 
J033081E23TGCGGGCCGGGCCGNONE 
J033121K07TGCGGGCCGGGCCGNONE 
J033124D11TGCGGGCCGGGCCGNONE 
J033131N22TGCGGGCCGGGCCGNONE 
J065179E10TGCGGGCCGGGCCGNONE 
J090020A13TGCGGGCCGGGCCGNONE 
J090045K17TGCGGGCCGGGCCGNONE 
J090047M24TGCGGGCCGGGCCGNONE 
J090064G23TGCGGGCCGGGCCGNONE 
J090084G08TGCGGGCCGGGCCGNONE 
J090086F18TGCGGGCCGGGCCGNONE 
J100032D09TGCGGGCCGGGCCGNONE 
J100037O18TGCGGGCCGGGCCGNONE 
J100042B03TGCGGGCCGGGCCGNONE 
J100061D06TGCGGGCCGGGCCGNONE 
J100061I03TGCGGGCCGGGCCGNONE 
J100063B17TGCGGGCCGGGCCGNONE 
Os01g0624700AK111416CGGCCCGGCCSimilar to WRKY transcription factor 12. 
AY676924CGGCCCGGCCNONE 
AY870601CGGCCCGGCCNONE 
Os01g0639900004-009-H08GCCCAGCCGGGCCGCANONE 
006-050-F07GCCCAGCCGGGCCGCANONE 
006-120-D04GCCCAGCCGGGCCGCANONE 
AF182806GCCCAGCCGGGCCGCANONE 
AK060890GCCCAGCCGGGCCGCASimilar to Carbonic anhydrase, chloroplast precursor (EC 4.2.1.1) (Carbonate dehydratase). 
AK099825GCCCAGCCGGGCCGCANONE 
J075022I06GCCCAGCCGGGCCGCANONE 
U08404GCCCAGCCGGGCCGCANONE 
Os01g0642900009-109-F01ACCGGGCCGGANONE 
AK063836ACCGGGCCGGASingle-strand binding protein/Primosomal replication protein n family protein. 
AK073560ACCGGGCCGGANONE 
J033043K18ACCGGGCCGGANONE 
J100023C05ACCGGGCCGGANONE 
J100038C15ACCGGGCCGGANONE 
J100039C23ACCGGGCCGGANONE 
Os01g0743400AK059177GGGCCGGGCCGGCSimilar to Tryptophanyl-tRNA synthetase (Fragment). 
AK059177TCCGGGCCGCASimilar to Tryptophanyl-tRNA synthetase (Fragment). 
AK069114GGGCCGGGCCGGCNONE 
AK069114TCCGGGCCGCANONE 
J065070E07GGGCCGGGCCGGCNONE 
J065070E07TCCGGGCCGCANONE 
J065152G11GGGCCGGGCCGGCNONE 
J065152G11TCCGGGCCGCANONE 
Os01g0750900AK111087TCCGGGCCGGGConserved hypothetical protein. 
J100042H18TCCGGGCCGGGNONE 
J100044L13TCCGGGCCGGGNONE 
Os01g0753800AK121555TCGGCCCGGCConserved hypothetical protein. 
J013075H19TCGGCCCGGCNONE 
J013130F24TCGGCCCGGCNONE 
J033033I01TCGGCCCGGCNONE 
Os01g0756300014-074-B05ACCGGCCCGGTNONE 
AK069648ACCGGCCCGGTConserved hypothetical protein. 
Os01g0800300006-097-C12TCCGGCCCGGCCNONE 
014-070-C12TCCGGCCCGGCCNONE 
AK072549TCCGGCCCGGCCNONE 
AK100942TCCGGCCCGGCCNONE 
AK100951TCCGGCCCGGCCConserved hypothetical protein. 
AK106023TCCGGCCCGGCCNONE 
J023138D05TCCGGCCCGGCCNONE 
J075097P16TCCGGCCCGGCCNONE 
J075099F23TCCGGCCCGGCCNONE 
Os01g0801000AK064082ACATGGGCCGGGCCGGANONE 
AK064082CACGGCCCGGCCNONE 
AK101426ACATGGGCCGGGCCGGASimilar to Apurinic endonuclease-redox protein (DNA-(apurinic or apyrimidinic site) lyase) (EC 4.2.99.18). 
AK101426CACGGCCCGGCCSimilar to Apurinic endonuclease-redox protein (DNA-(apurinic or apyrimidinic site) lyase) (EC 4.2.99.18). 
Os01g0846300AK065949CCACGTGTTGCGGGCCGGGCCGGGSimilar to Protein phosphatase 2C. 
Os01g0856900AK107570CGGACGGCCCGGTGlycoside hydrolase, starch-binding domain containing protein. 
J065081B03CGGACGGCCCGGTNONE 
J075028J03CGGACGGCCCGGTNONE 
J075052C05CGGACGGCCCGGTNONE 
J075199J04CGGACGGCCCGGTNONE 
J090052L20CGGACGGCCCGGTNONE 
J090075L24CGGACGGCCCGGTNONE 
Os01g0863166J065007F23CACGGCCCGGCCNONE 
J065007F23GCCGGGCCGGGCCGNONE 
J065124H21CACGGCCCGGCCConserved hypothetical protein. 
J065124H21GCCGGGCCGGGCCGConserved hypothetical protein. 
Os01g0891400J065077E24CTCGCGCGGCCCGGGConserved hypothetical protein. 
J065206I07CTCGCGCGGCCCGGGNONE 
Os01g0913800011-060-B02ATTGGGCCGGGCCGANONE 
016-088-H02ATTGGGCCGGGCCGAProtein prenyltransferase domain containing protein. 
Os01g0973100J065216G12CCCGGCCCGGCCCProtein of unknown function DUF239, plant domain containing protein. 
Os01g0973400AK060011AGATGGGCCGGGCCGGGCCGAGCCGNONE 
AK068879AGATGGGCCGGGCCGGGCCGAGCCGConserved hypothetical protein 48 family protein. 
AK099210AGATGGGCCGGGCCGGGCCGAGCCGNONE 
AK104863AGATGGGCCGGGCCGGGCCGAGCCGNONE 
J013170C09AGATGGGCCGGGCCGGGCCGAGCCGNONE 
J033106K13AGATGGGCCGGGCCGGGCCGAGCCGNONE 
J075018P18AGATGGGCCGGGCCGGGCCGAGCCGNONE 
J075039C18AGATGGGCCGGGCCGGGCCGAGCCGNONE 
J075104L18AGATGGGCCGGGCCGGGCCGAGCCGNONE 
Os02g0123200016-017-F04AAACGGCCCGGTNONE 
J033057C03AAACGGCCCGGTNONE 
J033087C11AAACGGCCCGGTNONE 
J033108J20AAACGGCCCGGTNONE 
J043015P08AAACGGCCCGGTNONE 
Os02g0169000AK101628TCGGCCCGGCCCATGTConserved hypothetical protein. 
Os02g0190900AK111037GCCCAATTTGGGCCGGGCCGTGPhytoene dehydrogenase-like protein. 
Os02g0190950J075001E02CACGGCCCGGCCCAAATTGGGCConserved hypothetical protein. 
J075117E23CACGGCCCGGCCCAAATTGGGCNONE 
J075117F23CACGGCCCGGCCCAAATTGGGCNONE 
J075144M12CACGGCCCGGCCCAAATTGGGCNONE 
J075145H10CACGGCCCGGCCCAAATTGGGCNONE 
J075186B15CACGGCCCGGCCCAAATTGGGCNONE 
Os02g0193500009-092-G09CTCGGCCCGGCCCNONE 
AK101237CTCGGCCCGGCCCHypothetical protein. 
J033031K13CTCGGCCCGGCCCNONE 
J033034P12CTCGGCCCGGCCCNONE 
J080304L19CTCGGCCCGGCCCNONE 
J100059N21CTCGGCCCGGCCCNONE 
Os02g0266200AK099647TTCGTGGGCCGGGCCGGTCACTGACANONE 
AK103371TTCGTGGGCCGGGCCGGTCACTGACAProtein prenyltransferase domain containing protein. 
Os02g0301400AK121646CGGCCCGGAThioredoxin-like fold domain containing protein. 
J033028E10CGGCCCGGANONE 
J033058J23CGGCCCGGANONE 
Os02g0445700011-046-C10CCCGGGCCGNONE 
011-046-C10GCCGGGCCGTGNONE 
Os02g0462800AK110587GGCCGGGCCGGCWRKY transcription factor 42 (Transcription factor WRKY02). 
AY676923GGCCGGGCCGGCNONE 
Os02g0533800009-149-F12GGCCGGGCCGGGNONE 
013-058-H02GGCCGGGCCGGGNONE 
014-017-G07GGCCGGGCCGGGNONE 
014-028-F04GGCCGGGCCGGGNONE 
014-050-G04GGCCGGGCCGGGNONE 
014-095-F04GGCCGGGCCGGGNONE 
014-099-C08GGCCGGGCCGGGNONE 
016-046-F05GGCCGGGCCGGGNONE 
AK121139GGCCGGGCCGGGConserved hypothetical protein. 
J013104A14GGCCGGGCCGGGNONE 
J023077F13GGCCGGGCCGGGNONE 
J023145I11GGCCGGGCCGGGNONE 
J065033D14GGCCGGGCCGGGNONE 
J065079I15GGCCGGGCCGGGNONE 
J065104E21GGCCGGGCCGGGNONE 
J065128E06GGCCGGGCCGGGNONE 
J065174F07GGCCGGGCCGGGNONE 
J065195B12GGCCGGGCCGGGNONE 
J065207B12GGCCGGGCCGGGNONE 
J080304M24GGCCGGGCCGGGNONE 
J090040A13GGCCGGGCCGGGNONE 
J090054B18GGCCGGGCCGGGNONE 
J100037A06GGCCGGGCCGGGNONE 
J100042F24GGCCGGGCCGGGNONE 
J100043N23GGCCGGGCCGGGNONE 
J100044H14GGCCGGGCCGGGNONE 
J100056K24GGCCGGGCCGGGNONE 
J100063O22GGCCGGGCCGGGNONE 
J100071G05GGCCGGGCCGGGNONE 
J100078G15GGCCGGGCCGGGNONE 
Os02g0533900AB062681CCCGGCCCGGCCNONE 
AK061722CCCGGCCCGGCCNONE 
AK106147CCCGGCCCGGCCNONE 
AK121892CCCGGCCCGGCCSimilar to Carbon-nitrogen hydrolase family protein. 
Os02g0595700006-057-E01CCCGGGCCGNONE 
006-082-F10CCCGGGCCGNONE 
006-087-C10CCCGGGCCGNONE 
006-091-H03CCCGGGCCGNONE 
006-094-A11CCCGGGCCGNONE 
AF145053CCCGGGCCGNONE 
AK064937CCCGGGCCGNONE 
AK066858CCCGGGCCGNONE 
AK104785CCCGGGCCGNONE 
AK119587CCCGGGCCGChloroplast translational elongation factor Tu. 
J013000P03CCCGGGCCGNONE 
Os02g0601800AB060276GACGGCCCGGATCCGACCCGCNONE 
AB060276TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
AK099539GACGGCCCGGATCCGACCCGCNONE 
AK099539TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
AK101873GACGGCCCGGATCCGACCCGCBromodomain containing protein. 
AK101873TCGGCCCGGGTGGGGCCCACGCCCAGATBromodomain containing protein. 
AK106801GACGGCCCGGATCCGACCCGCNONE 
AK106801TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
AK121758GACGGCCCGGATCCGACCCGCNONE 
AK121758TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
AK121891GACGGCCCGGATCCGACCCGCNONE 
AK121891TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J013059H01GACGGCCCGGATCCGACCCGCNONE 
J013059H01TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J013092F08GACGGCCCGGATCCGACCCGCNONE 
J013092F08TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J013146J04GACGGCCCGGATCCGACCCGCNONE 
J013146J04TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J023001K12GACGGCCCGGATCCGACCCGCNONE 
J023001K12TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J023002H16GACGGCCCGGATCCGACCCGCNONE 
J023002H16TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J023013B10GACGGCCCGGATCCGACCCGCNONE 
J023013B10TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J023081I22GACGGCCCGGATCCGACCCGCNONE 
J023081I22TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J023084K19GACGGCCCGGATCCGACCCGCNONE 
J023084K19TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J023150E24GACGGCCCGGATCCGACCCGCNONE 
J023150E24TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J033023B18GACGGCCCGGATCCGACCCGCNONE 
J033023B18TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J033025F18GACGGCCCGGATCCGACCCGCNONE 
J033025F18TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J033048P08GACGGCCCGGATCCGACCCGCNONE 
J033048P08TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J033060M24GACGGCCCGGATCCGACCCGCNONE 
J033060M24TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J033070G06GACGGCCCGGATCCGACCCGCNONE 
J033070G06TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J033088P12GACGGCCCGGATCCGACCCGCNONE 
J033088P12TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J033105C13GACGGCCCGGATCCGACCCGCNONE 
J033105C13TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J043009N18GACGGCCCGGATCCGACCCGCNONE 
J043009N18TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J065103G21GACGGCCCGGATCCGACCCGCNONE 
J065103G21TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J075039H15GACGGCCCGGATCCGACCCGCNONE 
J075039H15TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090014K10GACGGCCCGGATCCGACCCGCNONE 
J090014K10TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090022N02GACGGCCCGGATCCGACCCGCNONE 
J090022N02TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090033F18GACGGCCCGGATCCGACCCGCNONE 
J090033F18TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090033I04GACGGCCCGGATCCGACCCGCNONE 
J090033I04TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090041F11GACGGCCCGGATCCGACCCGCNONE 
J090041F11TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090045P20GACGGCCCGGATCCGACCCGCNONE 
J090045P20TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090054B01GACGGCCCGGATCCGACCCGCNONE 
J090054B01TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090055M12GACGGCCCGGATCCGACCCGCNONE 
J090055M12TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090071K09GACGGCCCGGATCCGACCCGCNONE 
J090071K09TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090098O16GACGGCCCGGATCCGACCCGCNONE 
J090098O16TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090099P15GACGGCCCGGATCCGACCCGCNONE 
J090099P15TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J100050I16GACGGCCCGGATCCGACCCGCNONE 
J100050I16TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
Os02g0602300AK065609GCCGGCCCGGCNONE 
AK066929GCCGGCCCGGCSimilar to Myelin transcription factor 1 (MYT1) (MYTI) (Proteolipid protein binding protein) (PLPB1). 
J013092L08GCCGGCCCGGCNONE 
J090040I23GCCGGCCCGGCNONE 
Os02g0630300AK108598GTCGCGCGCGCCGGCCCGGGCCNONE 
Os02g0636300AK100670TAATGGGCTGGGCCGGGCCGGCDEAD/DEAH box helicase, N-terminal domain containing protein. 
J013149P11TAATGGGCTGGGCCGGGCCGGCNONE 
J023022F15TAATGGGCTGGGCCGGGCCGGCNONE 
J023112J15TAATGGGCTGGGCCGGGCCGGCNONE 
J023145M22TAATGGGCTGGGCCGGGCCGGCNONE 
J043017P16TAATGGGCTGGGCCGGGCCGGCNONE 
Os02g0652800AK063448CCCGGGCCGGCMajor facilitator superfamily MFS_1 protein. 
Os02g0672600AK070286GGCCGGGCCGTGSimilar to N6-adenosine-methyltransferase 70 kDa subunit (EC 2.1.1.62) (MT-A70) (Methyltransferase-like protein 3). Splice isoform 2. 
AK101174GGCCGGGCCGTGNONE 
Os02g0679700AK108178GACGGCCCGGGProtein of unknown function DUF623, plant domain containing protein. 
J075112F23GACGGCCCGGGNONE 
Os02g0698100009-089-H10CAACGGCCCGGCCCATTTNONE 
AK060614CAACGGCCCGGCCCATTTGalactose oxidase, central domain containing protein. 
J090039P20CAACGGCCCGGCCCATTTNONE 
Os02g0750500AK101960TACGGCCCGGCCCAATASAM (and some other nucleotide) binding motif domain containing protein. 
J033075P05TACGGCCCGGCCCAATANONE 
J065054F02TACGGCCCGGCCCAATANONE 
J065124N03TACGGCCCGGCCCAATANONE 
J090001H12TACGGCCCGGCCCAATANONE 
J100057J01TACGGCCCGGCCCAATANONE 
J100062F12TACGGCCCGGCCCAATANONE 
Os02g0780500AK072784GGCCGGGCCGGCNONE 
AK121143GGCCGGGCCGGCConserved hypothetical protein. 
J023075M13GGCCGGGCCGGCNONE 
J023077P14GGCCGGGCCGGCNONE 
J023123C16GGCCGGGCCGGCNONE 
J023142P06GGCCGGGCCGGCNONE 
Os02g0792900AK068367ACCGGCCCGGTTMS membrane protein/tumour differentially expressed protein family protein. 
AK068367TCGGCCCGGGTMS membrane protein/tumour differentially expressed protein family protein. 
AK104731ACCGGCCCGGTNONE 
AK104731TCGGCCCGGGNONE 
AK106174ACCGGCCCGGTNONE 
AK106174TCGGCCCGGGNONE 
AK119191ACCGGCCCGGTNONE 
AK119191TCGGCCCGGGNONE 
Os02g0801900006-113-E02CACGGCCCGGCCNONE 
006-113-E02GCCGGGCCGGGCCGNONE 
AK109488CACGGCCCGGCCNONE 
AK109488GCCGGGCCGGGCCGNONE 
AK109498CACGGCCCGGCCConserved hypothetical protein. 
AK109498GCCGGGCCGGGCCGConserved hypothetical protein. 
J065007D19CACGGCCCGGCCNONE 
J065007D19GCCGGGCCGGGCCGNONE 
J065035G11CACGGCCCGGCCNONE 
J065035G11GCCGGGCCGGGCCGNONE 
J065044E05CACGGCCCGGCCNONE 
J065044E05GCCGGGCCGGGCCGNONE 
J065112N01CACGGCCCGGCCNONE 
J065112N01GCCGGGCCGGGCCGNONE 
J065143B03CACGGCCCGGCCNONE 
J065143B03GCCGGGCCGGGCCGNONE 
J065159A16CACGGCCCGGCCNONE 
J065159A16GCCGGGCCGGGCCGNONE 
J090007K23CACGGCCCGGCCNONE 
J090007K23GCCGGGCCGGGCCGNONE 
J090045N09CACGGCCCGGCCNONE 
J090045N09GCCGGGCCGGGCCGNONE 
J090049L20CACGGCCCGGCCNONE 
J090049L20GCCGGGCCGGGCCGNONE 
Os03g0101800006-069-F11ACCGGGCCGGCNONE 
006-089-G08ACCGGGCCGGCNONE 
006-120-D03ACCGGGCCGGCNONE 
AK061092ACCGGGCCGGCNONE 
AK061186ACCGGGCCGGCProtein of unknown function Cys-rich family protein. 
AK103196ACCGGGCCGGCNONE 
AK104399ACCGGGCCGGCNONE 
J033090H19ACCGGGCCGGCNONE 
J033121P22ACCGGGCCGGCNONE 
J065096C01ACCGGGCCGGCNONE 
J065097C05ACCGGGCCGGCNONE 
J065134I12ACCGGGCCGGCNONE 
J075061L02ACCGGGCCGGCNONE 
J075076K08ACCGGGCCGGCNONE 
J075091K01ACCGGGCCGGCNONE 
J080302F08ACCGGGCCGGCNONE 
J080304F11ACCGGGCCGGCNONE 
J080306I01ACCGGGCCGGCNONE 
J080307F02ACCGGGCCGGCNONE 
J080309G06ACCGGGCCGGCNONE 
J080313P12ACCGGGCCGGCNONE 
J080317C19ACCGGGCCGGCNONE 
J090036F13ACCGGGCCGGCNONE 
J090097P16ACCGGGCCGGCNONE 
J100025K18ACCGGGCCGGCNONE 
J100060J21ACCGGGCCGGCNONE 
Os03g0102200AK120183TCGGCCCGGCCCGGTSimilar to DNA-directed RNA polymerase II 14.5 kDa polypeptide (EC 2.7.7.6) (RPB9) (RPB14.5). 
J013034D10TCGGCCCGGCCCGGTNONE 
J065116C05TCGGCCCGGCCCGGTNONE 
J065120N21TCGGCCCGGCCCGGTNONE 
J090049D24TCGGCCCGGCCCGGTNONE 
Os03g0113700AK103835AGTTGGGCCGGGCCGTGGSimilar to Heat shock 70 kDa protein, mitochondrial precursor. 
Os03g0113800AK065925CCACGGCCCGGCCCAACTProtein prenyltransferase domain containing protein. 
J013047E20CCACGGCCCGGCCCAACTNONE 
J065026F21CCACGGCCCGGCCCAACTNONE 
J065047B03CCACGGCCCGGCCCAACTNONE 
J065054J12CCACGGCCCGGCCCAACTNONE 
J065079M24CCACGGCCCGGCCCAACTNONE 
J065093M07CCACGGCCCGGCCCAACTNONE 
J065153F02CCACGGCCCGGCCCAACTNONE 
J065155E21CCACGGCCCGGCCCAACTNONE 
J065179H15CCACGGCCCGGCCCAACTNONE 
J075019N02CCACGGCCCGGCCCAACTNONE 
J075089E01CCACGGCCCGGCCCAACTNONE 
J090066I18CCACGGCCCGGCCCAACTNONE 
J090087K20CCACGGCCCGGCCCAACTNONE 
J100079F05CCACGGCCCGGCCCAACTNONE 
Os03g0122200009-052-H10GCCGGGCCGCATGGGCCATNONE 
AB042934GCCGGGCCGCATGGGCCATNONE 
AK065033GCCGGGCCGCATGGGCCATSimilar to 50S ribosomal protein L11. 
J013001H03GCCGGGCCGCATGGGCCATNONE 
J023149C23GCCGGGCCGCATGGGCCATNONE 
J065025J15GCCGGGCCGCATGGGCCATNONE 
J065093D22GCCGGGCCGCATGGGCCATNONE 
Os03g0131500AK109755TCCGGGCCGGTVitamin K epoxide reductase domain containing protein. 
Os03g0133300AK064510TGTTGGGCCGGGCCGAConserved hypothetical protein. 
Os03g0137500006-040-G01GCCGGGCCGTANONE 
015-054-G04GCCGGGCCGTANONE 
AK060148GCCGGGCCGTANONE 
AK073584GCCGGGCCGTANONE 
AK100231GCCGGGCCGTASimilar to VDAC3.1. 
J013146L24GCCGGGCCGTANONE 
J023022O09GCCGGGCCGTANONE 
J023049J19GCCGGGCCGTANONE 
J023133L05GCCGGGCCGTANONE 
J023143P12GCCGGGCCGTANONE 
J033040B12GCCGGGCCGTANONE 
J033050O14GCCGGGCCGTANONE 
J033066G05GCCGGGCCGTANONE 
J065007J18GCCGGGCCGTANONE 
J100067H13GCCGGGCCGTANONE 
Os03g0146400AK111974GCCGGGCCGTGSimilar to Lethal leaf-spot 1 (Fragment). 
AK120554GCCGGGCCGTGNONE 
J075060J10GCCGGGCCGTGNONE 
Os03g0168200AK099530GGACGGCCCGGTConserved hypothetical protein. 
Os03g0184100AK067400CGGCCCGGCHypothetical protein. 
J013030J24CGGCCCGGCNONE 
J013037M23CGGCCCGGCNONE 
J013106B15CGGCCCGGCNONE 
J013130H10CGGCCCGGCNONE 
J013152B03CGGCCCGGCNONE 
J013157J24CGGCCCGGCNONE 
J013157K04CGGCCCGGCNONE 
J033093A19CGGCCCGGCNONE 
J033106E24CGGCCCGGCNONE 
J090043G12CGGCCCGGCNONE 
Os03g0192400009-081-A03TACGGCCCGGTNONE 
009-159-B02TACGGCCCGGTNONE 
AK070573TACGGCCCGGTGRIM-19 family protein. 
J023056B01TACGGCCCGGTNONE 
J023075G06TACGGCCCGGTNONE 
J033048K16TACGGCCCGGTNONE 
J033048L16TACGGCCCGGTNONE 
J053031H23TACGGCCCGGTNONE 
J065002H14TACGGCCCGGTNONE 
J065006G22TACGGCCCGGTNONE 
J065032G13TACGGCCCGGTNONE 
J065056A09TACGGCCCGGTNONE 
J065078I01TACGGCCCGGTNONE 
J065095G01TACGGCCCGGTNONE 
J065095I18TACGGCCCGGTNONE 
J065134M18TACGGCCCGGTNONE 
J065158P07TACGGCCCGGTNONE 
J065165K17TACGGCCCGGTNONE 
J065181J12TACGGCCCGGTNONE 
J065189N09TACGGCCCGGTNONE 
J065200D13TACGGCCCGGTNONE 
J065202H20TACGGCCCGGTNONE 
J065215K20TACGGCCCGGTNONE 
J075049N19TACGGCCCGGTNONE 
J075147J16TACGGCCCGGTNONE 
J090081E19TACGGCCCGGTNONE 
J100017C16TACGGCCCGGTNONE 
J100039M16TACGGCCCGGTNONE 
J100043E23TACGGCCCGGTNONE 
J100063L12TACGGCCCGGTNONE 
J100079F22TACGGCCCGGTNONE 
Os03g0214100AB111916CGGCCCGGCCCATCTNONE 
AF009179CGGCCCGGCCCATCTReplication protein A1. 
AK060582CGGCCCGGCCCATCTNONE 
Os03g0248600AK073611CCAACGGCCCGGCSimilar to Enolase 2 (EC 4.2.1.11) (2-phosphoglycerate dehydratase 2) (2-phospho- D-glycerate hydro-lyase 2). 
AK099342CCAACGGCCCGGCNONE 
AK104877CCAACGGCCCGGCNONE 
J013026L10CCAACGGCCCGGCNONE 
J013055P12CCAACGGCCCGGCNONE 
J023091A14CCAACGGCCCGGCNONE 
J033034G07CCAACGGCCCGGCNONE 
J033048H19CCAACGGCCCGGCNONE 
J033128D07CCAACGGCCCGGCNONE 
J065060L24CCAACGGCCCGGCNONE 
J065176A19CCAACGGCCCGGCNONE 
J090018K08CCAACGGCCCGGCNONE 
J090023C03CCAACGGCCCGGCNONE 
Os03g0261500AK061995GCCCGGCCCGGCNONE 
J013044K20GCCCGGCCCGGCNONE 
J033113A11GCCCGGCCCGGCNONE 
J100032O18GCCCGGCCCGGCNONE 
J100037K21GCCCGGCCCGGCNONE 
Os03g0284000Os03g0284000CACGGCCCGGCCConserved hypothetical protein. 
Os03g0312300AK111364GACGGCCCGGCProtein of unknown function DUF26 domain containing protein. 
Os03g0353400006-092-E01GCCGGCCCGGCNONE 
006-120-A08GCCGGCCCGGCNONE 
009-098-A01GCCGGCCCGGCNONE 
009-139-G01GCCGGCCCGGCNONE 
013-041-E01GCCGGCCCGGCNONE 
013-068-C06GCCGGCCCGGCNONE 
014-014-G01GCCGGCCCGGCNONE 
014-088-E11GCCGGCCCGGCNONE 
AB110172GCCGGCCCGGCNONE 
AK062176GCCGGCCCGGCSimilar to Poly(A)-binding protein C-terminal interacting protein 6. 
AK068753GCCGGCCCGGCNONE 
AY656247GCCGGCCCGGCNONE 
J013049N20GCCGGCCCGGCNONE 
J013072F18GCCGGCCCGGCNONE 
J013089L05GCCGGCCCGGCNONE 
J013099L20GCCGGCCCGGCNONE 
J013131G13GCCGGCCCGGCNONE 
J013157B15GCCGGCCCGGCNONE 
J013158E09GCCGGCCCGGCNONE 
J023013I18GCCGGCCCGGCNONE 
J023019G19GCCGGCCCGGCNONE 
J023027C18GCCGGCCCGGCNONE 
J023052J24GCCGGCCCGGCNONE 
J023080N08GCCGGCCCGGCNONE 
J033043F21GCCGGCCCGGCNONE 
J033044C08GCCGGCCCGGCNONE 
J033086N04GCCGGCCCGGCNONE 
J065041E07GCCGGCCCGGCNONE 
J065067N17GCCGGCCCGGCNONE 
J065082H19GCCGGCCCGGCNONE 
J065104D20GCCGGCCCGGCNONE 
J065105P09GCCGGCCCGGCNONE 
J065114D01GCCGGCCCGGCNONE 
J065119D15GCCGGCCCGGCNONE 
J065134G02GCCGGCCCGGCNONE 
J065143D06GCCGGCCCGGCNONE 
J065170G14GCCGGCCCGGCNONE 
J065178K06GCCGGCCCGGCNONE 
J065208P11GCCGGCCCGGCNONE 
J075004A10GCCGGCCCGGCNONE 
J075034E12GCCGGCCCGGCNONE 
J075035P22GCCGGCCCGGCNONE 
J075065O16GCCGGCCCGGCNONE 
J075070M03GCCGGCCCGGCNONE 
J075115B03GCCGGCCCGGCNONE 
J075190B04GCCGGCCCGGCNONE 
J080002C13GCCGGCCCGGCNONE 
J080010I08GCCGGCCCGGCNONE 
J080017L24GCCGGCCCGGCNONE 
J080023D11GCCGGCCCGGCNONE 
J080025A02GCCGGCCCGGCNONE 
J080025N09GCCGGCCCGGCNONE 
J080035D22GCCGGCCCGGCNONE 
J080038L13GCCGGCCCGGCNONE 
J080042F06GCCGGCCCGGCNONE 
J080043H05GCCGGCCCGGCNONE 
J080048K17GCCGGCCCGGCNONE 
J080053M20GCCGGCCCGGCNONE 
J080056I23GCCGGCCCGGCNONE 
J080057J06GCCGGCCCGGCNONE 
J080058C18GCCGGCCCGGCNONE 
J080062I15GCCGGCCCGGCNONE 
J080080E19GCCGGCCCGGCNONE 
J080096K12GCCGGCCCGGCNONE 
J090004M12GCCGGCCCGGCNONE 
J090055H05GCCGGCCCGGCNONE 
J090062J17GCCGGCCCGGCNONE 
J100044K10GCCGGCCCGGCNONE 
J100047I15GCCGGCCCGGCNONE 
J100047K03GCCGGCCCGGCNONE 
J100058I20GCCGGCCCGGCNONE 
J100067P14GCCGGCCCGGCNONE 
J100074F02GCCGGCCCGGCNONE 
Os03g0383100AK107106CCCGGGCCGAAAConserved hypothetical protein. 
Os03g0703300016-074-H01CTCGGCCCGGANONE 
AK073831CTCGGCCCGGACalponin-like actin-binding domain containing protein. 
Os03g0711600X88799TCCGGCCCGGTSimilar to DNA binding protein (Fragment). 
Os03g0712200AK073205ACCGGGCCGGGZinc finger, RanBP2-type domain containing protein. 
AK098968ACCGGGCCGGGNONE 
Os03g0736300AK104929GGCCGGGCCGGGCNONE 
Os03g0737600014-094-E01TACTGGGCCGGGCCGANONE 
AB038234TACTGGGCCGGGCCGANONE 
AK101854TACTGGGCCGGGCCGACyclin H-1. 
AK105468TACTGGGCCGGGCCGANONE 
J033069N12TACTGGGCCGGGCCGANONE 
J043017A22TACTGGGCCGGGCCGANONE 
J065154A20TACTGGGCCGGGCCGANONE 
Os03g0748500AK110695TCCGGGCCGAANONE 
Os03g0752800AB041020GGGGCCCGGGCCGGCNONE 
AF058697GGGGCCCGGGCCGGCMADS14 protein. 
AF139664GGGGCCCGGGCCGGCNONE 
AK121171GGGGCCCGGGCCGGCNONE 
AY332478GGGGCCCGGGCCGGCNONE 
AY551916GGGGCCCGGGCCGGCNONE 
J023081C04GGGGCCCGGGCCGGCNONE 
Os03g0776400015-009-D03GCCGGGCCGGCNONE 
AK106237GCCGGGCCGGCConserved hypothetical protein. 
J100024C12GCCGGGCCGGCNONE 
J100083J23GCCGGGCCGGCNONE 
Os03g0798600AK121716GGCCGGGCCGGAACACGTGGGCCTASimilar to 40S ribosomal protein S15 (Fragment). 
J013120B18GGCCGGGCCGGAACACGTGGGCCTANONE 
J033079G18GGCCGGGCCGGAACACGTGGGCCTANONE 
J043038B19GGCCGGGCCGGAACACGTGGGCCTANONE 
J065091E15GGCCGGGCCGGAACACGTGGGCCTANONE 
J065092P10GGCCGGGCCGGAACACGTGGGCCTANONE 
J065189F18GGCCGGGCCGGAACACGTGGGCCTANONE 
J065189L12GGCCGGGCCGGAACACGTGGGCCTANONE 
J075021B11GGCCGGGCCGGAACACGTGGGCCTANONE 
J075022L15GGCCGGGCCGGAACACGTGGGCCTANONE 
J075046G12GGCCGGGCCGGAACACGTGGGCCTANONE 
J075080H15GGCCGGGCCGGAACACGTGGGCCTANONE 
J090045H01GGCCGGGCCGGAACACGTGGGCCTANONE 
J090077H16GGCCGGGCCGGAACACGTGGGCCTANONE 
J090083D22GGCCGGGCCGGAACACGTGGGCCTANONE 
J100021D24GGCCGGGCCGGAACACGTGGGCCTANONE 
J100023G04GGCCGGGCCGGAACACGTGGGCCTANONE 
J100049J23GGCCGGGCCGGAACACGTGGGCCTANONE 
J100075K23GGCCGGGCCGGAACACGTGGGCCTANONE 
J100077G22GGCCGGGCCGGAACACGTGGGCCTANONE 
Os03g0807200011-031-F07GGGCCGGGCCGGCNONE 
011-031-F07GTTTGGGCCGGGCCGTCNONE 
AK063932GGGCCGGGCCGGCNONE 
AK063932GTTTGGGCCGGGCCGTCNONE 
AK103496GGGCCGGGCCGGCProtein of unknown function DUF1639 family protein. 
AK103496GTTTGGGCCGGGCCGTCProtein of unknown function DUF1639 family protein. 
J033131A04GGGCCGGGCCGGCNONE 
J033131A04GTTTGGGCCGGGCCGTCNONE 
J065109O03GGGCCGGGCCGGCNONE 
J065109O03GTTTGGGCCGGGCCGTCNONE 
J080001M11GGGCCGGGCCGGCNONE 
J080001M11GTTTGGGCCGGGCCGTCNONE 
J080002H18GGGCCGGGCCGGCNONE 
J080002H18GTTTGGGCCGGGCCGTCNONE 
J080005I08GGGCCGGGCCGGCNONE 
J080005I08GTTTGGGCCGGGCCGTCNONE 
J080006B05GGGCCGGGCCGGCNONE 
J080006B05GTTTGGGCCGGGCCGTCNONE 
J080006D17GGGCCGGGCCGGCNONE 
J080006D17GTTTGGGCCGGGCCGTCNONE 
J080007M19GGGCCGGGCCGGCNONE 
J080007M19GTTTGGGCCGGGCCGTCNONE 
J080011E07GGGCCGGGCCGGCNONE 
J080011E07GTTTGGGCCGGGCCGTCNONE 
J080012H06GGGCCGGGCCGGCNONE 
J080012H06GTTTGGGCCGGGCCGTCNONE 
J080014D08GGGCCGGGCCGGCNONE 
J080014D08GTTTGGGCCGGGCCGTCNONE 
J080017D06GGGCCGGGCCGGCNONE 
J080017D06GTTTGGGCCGGGCCGTCNONE 
J080017K17GGGCCGGGCCGGCNONE 
J080017K17GTTTGGGCCGGGCCGTCNONE 
J080020B17GGGCCGGGCCGGCNONE 
J080020B17GTTTGGGCCGGGCCGTCNONE 
J080021O05GGGCCGGGCCGGCNONE 
J080021O05GTTTGGGCCGGGCCGTCNONE 
J080021O15GGGCCGGGCCGGCNONE 
J080021O15GTTTGGGCCGGGCCGTCNONE 
J080023I18GGGCCGGGCCGGCNONE 
J080023I18GTTTGGGCCGGGCCGTCNONE 
J080025A21GGGCCGGGCCGGCNONE 
J080025A21GTTTGGGCCGGGCCGTCNONE 
J080027P22GGGCCGGGCCGGCNONE 
J080027P22GTTTGGGCCGGGCCGTCNONE 
J080028M22GGGCCGGGCCGGCNONE 
J080028M22GTTTGGGCCGGGCCGTCNONE 
J080029B09GGGCCGGGCCGGCNONE 
J080029B09GTTTGGGCCGGGCCGTCNONE 
J080029M07GGGCCGGGCCGGCNONE 
J080029M07GTTTGGGCCGGGCCGTCNONE 
J080029M17GGGCCGGGCCGGCNONE 
J080029M17GTTTGGGCCGGGCCGTCNONE 
J080030H23GGGCCGGGCCGGCNONE 
J080030H23GTTTGGGCCGGGCCGTCNONE 
J080030K16GGGCCGGGCCGGCNONE 
J080030K16GTTTGGGCCGGGCCGTCNONE 
J080030L19GGGCCGGGCCGGCNONE 
J080030L19GTTTGGGCCGGGCCGTCNONE 
J080031A12GGGCCGGGCCGGCNONE 
J080031A12GTTTGGGCCGGGCCGTCNONE 
J080031N21GGGCCGGGCCGGCNONE 
J080031N21GTTTGGGCCGGGCCGTCNONE 
J080032G05GGGCCGGGCCGGCNONE 
J080032G05GTTTGGGCCGGGCCGTCNONE 
J080032P20GGGCCGGGCCGGCNONE 
J080032P20GTTTGGGCCGGGCCGTCNONE 
J080033H20GGGCCGGGCCGGCNONE 
J080033H20GTTTGGGCCGGGCCGTCNONE 
J080034H22GGGCCGGGCCGGCNONE 
J080034H22GTTTGGGCCGGGCCGTCNONE 
J080034J03GGGCCGGGCCGGCNONE 
J080034J03GTTTGGGCCGGGCCGTCNONE 
J080034J16GGGCCGGGCCGGCNONE 
J080034J16GTTTGGGCCGGGCCGTCNONE 
J080034N01GGGCCGGGCCGGCNONE 
J080034N01GTTTGGGCCGGGCCGTCNONE 
J080035K20GGGCCGGGCCGGCNONE 
J080035K20GTTTGGGCCGGGCCGTCNONE 
J080036I04GGGCCGGGCCGGCNONE 
J080036I04GTTTGGGCCGGGCCGTCNONE 
J080036I19GGGCCGGGCCGGCNONE 
J080036I19GTTTGGGCCGGGCCGTCNONE 
J080036O21GGGCCGGGCCGGCNONE 
J080036O21GTTTGGGCCGGGCCGTCNONE 
J080038D06GGGCCGGGCCGGCNONE 
J080038D06GTTTGGGCCGGGCCGTCNONE 
J080039J15GGGCCGGGCCGGCNONE 
J080039J15GTTTGGGCCGGGCCGTCNONE 
J080039P18GGGCCGGGCCGGCNONE 
J080039P18GTTTGGGCCGGGCCGTCNONE 
J080041H20GGGCCGGGCCGGCNONE 
J080041H20GTTTGGGCCGGGCCGTCNONE 
J080041M11GGGCCGGGCCGGCNONE 
J080041M11GTTTGGGCCGGGCCGTCNONE 
J080042F14GGGCCGGGCCGGCNONE 
J080042F14GTTTGGGCCGGGCCGTCNONE 
J080043G10GGGCCGGGCCGGCNONE 
J080043G10GTTTGGGCCGGGCCGTCNONE 
J080043J02GGGCCGGGCCGGCNONE 
J080043J02GTTTGGGCCGGGCCGTCNONE 
J080044C19GGGCCGGGCCGGCNONE 
J080044C19GTTTGGGCCGGGCCGTCNONE 
J080044G11GGGCCGGGCCGGCNONE 
J080044G11GTTTGGGCCGGGCCGTCNONE 
J080045M03GGGCCGGGCCGGCNONE 
J080045M03GTTTGGGCCGGGCCGTCNONE 
J080045N07GGGCCGGGCCGGCNONE 
J080045N07GTTTGGGCCGGGCCGTCNONE 
J080047K14GGGCCGGGCCGGCNONE 
J080047K14GTTTGGGCCGGGCCGTCNONE 
J080049I21GGGCCGGGCCGGCNONE 
J080049I21GTTTGGGCCGGGCCGTCNONE 
J080050A06GGGCCGGGCCGGCNONE 
J080050A06GTTTGGGCCGGGCCGTCNONE 
J080050I16GGGCCGGGCCGGCNONE 
J080050I16GTTTGGGCCGGGCCGTCNONE 
J080050N16GGGCCGGGCCGGCNONE 
J080050N16GTTTGGGCCGGGCCGTCNONE 
J080052C23GGGCCGGGCCGGCNONE 
J080052C23GTTTGGGCCGGGCCGTCNONE 
J080052D18GGGCCGGGCCGGCNONE 
J080052D18GTTTGGGCCGGGCCGTCNONE 
J080052F20GGGCCGGGCCGGCNONE 
J080052F20GTTTGGGCCGGGCCGTCNONE 
J080052F23GGGCCGGGCCGGCNONE 
J080052F23GTTTGGGCCGGGCCGTCNONE 
J080053M03GGGCCGGGCCGGCNONE 
J080053M03GTTTGGGCCGGGCCGTCNONE 
J080054G13GGGCCGGGCCGGCNONE 
J080054G13GTTTGGGCCGGGCCGTCNONE 
J080054H12GGGCCGGGCCGGCNONE 
J080054H12GTTTGGGCCGGGCCGTCNONE 
J080055N03GGGCCGGGCCGGCNONE 
J080055N03GTTTGGGCCGGGCCGTCNONE 
J080056E07GGGCCGGGCCGGCNONE 
J080056E07GTTTGGGCCGGGCCGTCNONE 
J080057L04GGGCCGGGCCGGCNONE 
J080057L04GTTTGGGCCGGGCCGTCNONE 
J080063O19GGGCCGGGCCGGCNONE 
J080063O19GTTTGGGCCGGGCCGTCNONE 
J080064E21GGGCCGGGCCGGCNONE 
J080064E21GTTTGGGCCGGGCCGTCNONE 
J080065D18GGGCCGGGCCGGCNONE 
J080065D18GTTTGGGCCGGGCCGTCNONE 
J080065F18GGGCCGGGCCGGCNONE 
J080065F18GTTTGGGCCGGGCCGTCNONE 
J080065H14GGGCCGGGCCGGCNONE 
J080065H14GTTTGGGCCGGGCCGTCNONE 
J080065K15GGGCCGGGCCGGCNONE 
J080065K15GTTTGGGCCGGGCCGTCNONE 
J080065M24GGGCCGGGCCGGCNONE 
J080065M24GTTTGGGCCGGGCCGTCNONE 
J080066B18GGGCCGGGCCGGCNONE 
J080066B18GTTTGGGCCGGGCCGTCNONE 
J080066B19GGGCCGGGCCGGCNONE 
J080066B19GTTTGGGCCGGGCCGTCNONE 
J080071H19GGGCCGGGCCGGCNONE 
J080071H19GTTTGGGCCGGGCCGTCNONE 
J080072E18GGGCCGGGCCGGCNONE 
J080072E18GTTTGGGCCGGGCCGTCNONE 
J080074K21GGGCCGGGCCGGCNONE 
J080074K21GTTTGGGCCGGGCCGTCNONE 
J080075B06GGGCCGGGCCGGCNONE 
J080075B06GTTTGGGCCGGGCCGTCNONE 
J080076H07GGGCCGGGCCGGCNONE 
J080076H07GTTTGGGCCGGGCCGTCNONE 
J080079D16GGGCCGGGCCGGCNONE 
J080079D16GTTTGGGCCGGGCCGTCNONE 
J080082B20GGGCCGGGCCGGCNONE 
J080082B20GTTTGGGCCGGGCCGTCNONE 
J080084N16GGGCCGGGCCGGCNONE 
J080084N16GTTTGGGCCGGGCCGTCNONE 
J080085L07GGGCCGGGCCGGCNONE 
J080085L07GTTTGGGCCGGGCCGTCNONE 
J080086L04GGGCCGGGCCGGCNONE 
J080086L04GTTTGGGCCGGGCCGTCNONE 
J080086M07GGGCCGGGCCGGCNONE 
J080086M07GTTTGGGCCGGGCCGTCNONE 
J080087D02GGGCCGGGCCGGCNONE 
J080087D02GTTTGGGCCGGGCCGTCNONE 
J080087D15GGGCCGGGCCGGCNONE 
J080087D15GTTTGGGCCGGGCCGTCNONE 
J080087J19GGGCCGGGCCGGCNONE 
J080087J19GTTTGGGCCGGGCCGTCNONE 
J080088G20GGGCCGGGCCGGCNONE 
J080088G20GTTTGGGCCGGGCCGTCNONE 
J080092M15GGGCCGGGCCGGCNONE 
J080092M15GTTTGGGCCGGGCCGTCNONE 
J080093O10GGGCCGGGCCGGCNONE 
J080093O10GTTTGGGCCGGGCCGTCNONE 
J080095L09GGGCCGGGCCGGCNONE 
J080095L09GTTTGGGCCGGGCCGTCNONE 
J080096A18GGGCCGGGCCGGCNONE 
J080096A18GTTTGGGCCGGGCCGTCNONE 
J080097C03GGGCCGGGCCGGCNONE 
J080097C03GTTTGGGCCGGGCCGTCNONE 
J090019J07GGGCCGGGCCGGCNONE 
J090019J07GTTTGGGCCGGGCCGTCNONE 
J090024N12GGGCCGGGCCGGCNONE 
J090024N12GTTTGGGCCGGGCCGTCNONE 
J090049I09GGGCCGGGCCGGCNONE 
J090049I09GTTTGGGCCGGGCCGTCNONE 
Os03g0822700005-010-E01GACGGCCCGGCCCNONE 
006-088-H12GACGGCCCGGCCCNONE 
AK061682GACGGCCCGGCCCNONE 
AK101448GACGGCCCGGCCCArmadillo-like helical domain containing protein. 
J023091N05GACGGCCCGGCCCNONE 
Os03g0831100AK103115AACGGCCCGGCCArmadillo-like helical domain containing protein. 
J033119F15AACGGCCCGGCCNONE 
J065011M19AACGGCCCGGCCNONE 
J075019I08AACGGCCCGGCCNONE 
J075047A01AACGGCCCGGCCNONE 
J075096P21AACGGCCCGGCCNONE 
J075121I05AACGGCCCGGCCNONE 
J075121I07AACGGCCCGGCCNONE 
J090063F13AACGGCCCGGCCNONE 
J090068F16AACGGCCCGGCCNONE 
J090094E14AACGGCCCGGCCNONE 
Os03g0846400AK067706GCAGCCCATGGGCCGGATCGGCCCGGCNONE 
AK067706GCTGGGCCGTGTCTGGGCCGGGCCGTGNONE 
AK070549GCAGCCCATGGGCCGGATCGGCCCGGCPeptidase, trypsin-like serine and cysteine domain containing protein. 
AK070549GCTGGGCCGTGTCTGGGCCGGGCCGTGPeptidase, trypsin-like serine and cysteine domain containing protein. 
Os04g0206200015-013-E04CCCGGGCCGANONE 
AK109506CCCGGGCCGANONE 
AK110950CCCGGGCCGANONE 
Os04g0208400AK069629GCCGGCCCGGCACGGCCCAGCCyclin-like F-box domain containing protein. 
AK069629GCTGGGCCGGGCCGCyclin-like F-box domain containing protein. 
Os04g0283800AK109869CGGCCCGGCOcticosapeptide/Phox/Bem1p domain containing protein. 
Os04g0378200AK103076GGGCCGGGCCGGGSterile alpha motif SAM domain containing protein. 
J033118E02GGGCCGGGCCGGGNONE 
J065065F15GGGCCGGGCCGGGNONE 
J090080I24GGGCCGGGCCGGGNONE 
Os04g0445100014-052-B04TCCGGCCCGGCNONE 
AK063700TCCGGCCCGGCSimilar to 22.7 kDa class IV heat shock protein precursor. 
Os04g0461100009-136-H10ATCTGGGCCGGGCCGTTTNONE 
009-147-H12ATCTGGGCCGGGCCGTTTNONE 
AK068022ATCTGGGCCGGGCCGTTTPlastid and cyanobacterial ribosomal protein PSRP-3/Ycf65 family protein. 
J013130N24ATCTGGGCCGGGCCGTTTNONE 
J065019D10ATCTGGGCCGGGCCGTTTNONE 
J065168O21ATCTGGGCCGGGCCGTTTNONE 
J075051G06ATCTGGGCCGGGCCGTTTNONE 
J075148G11ATCTGGGCCGGGCCGTTTNONE 
Os04g0486400AJ535489GGGCCGGGCCGGGCCGAANONE 
AK103296GGGCCGGGCCGGGCCGAARML1 protein. 
J013045L03GGGCCGGGCCGGGCCGAANONE 
J013045M03GGGCCGGGCCGGGCCGAANONE 
J033034L24GGGCCGGGCCGGGCCGAANONE 
J033125B02GGGCCGGGCCGGGCCGAANONE 
J075001G08GGGCCGGGCCGGGCCGAANONE 
J075011I16GGGCCGGGCCGGGCCGAANONE 
J075033M08GGGCCGGGCCGGGCCGAANONE 
J075044G01GGGCCGGGCCGGGCCGAANONE 
J075047D04GGGCCGGGCCGGGCCGAANONE 
J075061J09GGGCCGGGCCGGGCCGAANONE 
J075085L07GGGCCGGGCCGGGCCGAANONE 
J075087D20GGGCCGGGCCGGGCCGAANONE 
J075117A04GGGCCGGGCCGGGCCGAANONE 
J075134H06GGGCCGGGCCGGGCCGAANONE 
J075184J12GGGCCGGGCCGGGCCGAANONE 
Os04g0491500AK068089TCCGGGCCGGCNONE 
AK068089TTTCGGCCCGGCCCAACCNONE 
AK101116TCCGGGCCGGCTGF-beta receptor, type I/II extracellular region family protein. 
AK101116TTTCGGCCCGGCCCAACCTGF-beta receptor, type I/II extracellular region family protein. 
Os04g0513100AK067841ACCGGGCCGSimilar to Beta-glucosidase. 
J075105F14ACCGGGCCGNONE 
Os04g0526800006-051-F03GCCGGCCCGGTNONE 
AK061581GCCGGCCCGGTGRAM domain containing protein. 
J065188M01GCCGGCCCGGTNONE 
J100043J05GCCGGCCCGGTNONE 
Os04g0527700AK072980AACGGGCCGGGCCGGCCCAGTACHCH domain containing protein. 
J023117E20AACGGGCCGGGCCGGCCCAGTANONE 
J023150D11AACGGGCCGGGCCGGCCCAGTANONE 
Os04g0541700AK109177ACCGGGCCGGGNONE 
AY554030ACCGGGCCGGGNONE 
J065055P13ACCGGGCCGGGNONE 
J065057N20ACCGGGCCGGGNONE 
J065136D07ACCGGGCCGGGNONE 
Os04g0542900AK068610TTCGGCCCGGTConserved hypothetical protein. 
Os04g0555700AK069329CGGCCCGGCSimilar to Actin-depolymerizing factor (ADF). 
Os04g0627000AK101563TCCGGGCCGAGANONE 
Os04g0636900009-009-D04CGGCCCGGTNONE 
009-010-G07CGGCCCGGTNONE 
009-048-H10CGGCCCGGTNONE 
013-066-B10CGGCCCGGTNONE 
014-093-G08CGGCCCGGTNONE 
015-025-C07CGGCCCGGTNONE 
J013058C15CGGCCCGGTNONE 
J013058E15CGGCCCGGTNONE 
J013072N16CGGCCCGGTNONE 
J013102O16CGGCCCGGTNONE 
J090069E22CGGCCCGGTNONE 
J100030G19CGGCCCGGTNONE 
J100050F15CGGCCCGGTNONE 
J100050L20CGGCCCGGTNONE 
J100054F18CGGCCCGGTNONE 
J100083P05CGGCCCGGTNONE 
Os04g0659400AK070174CTCGGCCCGGAENT domain containing protein. 
Os04g0670400012-048-A10TACGGCCCGGCCCATTTGGCCCACGAANONE 
AK103099TACGGCCCGGCCCATTTGGCCCACGAAOvarian tumour, otubain domain containing protein. 
J033118N06TACGGCCCGGCCCATTTGGCCCACGAANONE 
J100019K03TACGGCCCGGCCCATTTGGCCCACGAANONE 
Os04g0670500AK107506TTCGTGGGCCAAATGGGCCGGGCCGTACysteine protease 1 precursor (EC 3.4.22.-) (OsCP1). 
Os04g0673400Os04g0673400ACCGGGCCGGGCSimilar to Uracil-DNA glycosylase (EC 3.2.2.-) (UDG). 
Os04g0683800011-050-B05CTCGGCCCGGCCCNONE 
AK073897CTCGGCCCGGCCCSimilar to Phosphoribosyltransferase (Fragment). 
AK102910CTCGGCCCGGCCCNONE 
J033075A06CTCGGCCCGGCCCNONE 
J033079F23CTCGGCCCGGCCCNONE 
J033093D20CTCGGCCCGGCCCNONE 
J033099B18CTCGGCCCGGCCCNONE 
J033129G13CTCGGCCCGGCCCNONE 
J065075F21CTCGGCCCGGCCCNONE 
J065093M19CTCGGCCCGGCCCNONE 
J075023K10CTCGGCCCGGCCCNONE 
J075046J08CTCGGCCCGGCCCNONE 
J090003I20CTCGGCCCGGCCCNONE 
J090017L12CTCGGCCCGGCCCNONE 
J090024B04CTCGGCCCGGCCCNONE 
J090033A20CTCGGCCCGGCCCNONE 
J090083F02CTCGGCCCGGCCCNONE 
Os04g0690600011-007-D04GCCGGCCCGGTNONE 
AK109449GCCGGCCCGGTConserved hypothetical protein. 
J065019H13GCCGGCCCGGTNONE 
J065021N08GCCGGCCCGGTNONE 
J065085C08GCCGGCCCGGTNONE 
J065214O07GCCGGCCCGGTNONE 
Os05g0156200AK071622TCCGGGCCGTTConserved hypothetical protein. 
J023099E19TCCGGGCCGTTNONE 
J090025C09TCCGGGCCGTTNONE 
J090071K23TCCGGGCCGTTNONE 
Os05g0198000J080004C03CGGCCCGGProtein of unknown function DUF247, plant family protein. 
J080004M24CGGCCCGGNONE 
J080004O15CGGCCCGGNONE 
J080006E14CGGCCCGGNONE 
J080006I07CGGCCCGGNONE 
J080007N13CGGCCCGGNONE 
J080009C21CGGCCCGGNONE 
J080009L03CGGCCCGGNONE 
J080010F10CGGCCCGGNONE 
J080015H04CGGCCCGGNONE 
J080015L04CGGCCCGGNONE 
J080018C21CGGCCCGGNONE 
J080022M22CGGCCCGGNONE 
J080027O19CGGCCCGGNONE 
J080030I07CGGCCCGGNONE 
J080037P07CGGCCCGGNONE 
J080044C18CGGCCCGGNONE 
J080049F14CGGCCCGGNONE 
J080050F04CGGCCCGGNONE 
J080052B18CGGCCCGGNONE 
J080081B11CGGCCCGGNONE 
J080083G12CGGCCCGGNONE 
J080086A11CGGCCCGGNONE 
J080087C06CGGCCCGGNONE 
J080088E06CGGCCCGGNONE 
J080091O21CGGCCCGGNONE 
J080094N23CGGCCCGGNONE 
Os05g0223300AK069616CCCGGCCCGGCCCGGCCCGCASimilar to RNA-binding protein. 
J080093O15CCCGGCCCGGCCCGGCCCGCANONE 
J090061N02CCCGGCCCGGCCCGGCCCGCANONE 
Os05g0328000AK107977TTTCGGCCCGGAConserved hypothetical protein. 
J065005I02TTTCGGCCCGGANONE 
J065049M05TTTCGGCCCGGANONE 
J080005F01TTTCGGCCCGGANONE 
J080005H15TTTCGGCCCGGANONE 
J080005K23TTTCGGCCCGGANONE 
J080007O03TTTCGGCCCGGANONE 
J080013H09TTTCGGCCCGGANONE 
J080024C02TTTCGGCCCGGANONE 
J080026M22TTTCGGCCCGGANONE 
J080029K21TTTCGGCCCGGANONE 
J080032K04TTTCGGCCCGGANONE 
J080034M16TTTCGGCCCGGANONE 
J080037G11TTTCGGCCCGGANONE 
J080040L01TTTCGGCCCGGANONE 
J080041D13TTTCGGCCCGGANONE 
J080043G20TTTCGGCCCGGANONE 
J080046H17TTTCGGCCCGGANONE 
J080048A05TTTCGGCCCGGANONE 
J080064C21TTTCGGCCCGGANONE 
J080067E15TTTCGGCCCGGANONE 
J080071P05TTTCGGCCCGGANONE 
J080074H16TTTCGGCCCGGANONE 
J080076A18TTTCGGCCCGGANONE 
J080076D20TTTCGGCCCGGANONE 
J080077J15TTTCGGCCCGGANONE 
J080085J11TTTCGGCCCGGANONE 
J080086E08TTTCGGCCCGGANONE 
J080088I23TTTCGGCCCGGANONE 
J080088I24TTTCGGCCCGGANONE 
J080089D05TTTCGGCCCGGANONE 
J080093B04TTTCGGCCCGGANONE 
J080093D07TTTCGGCCCGGANONE 
J080094A09TTTCGGCCCGGANONE 
J080096I12TTTCGGCCCGGANONE 
J080097L23TTTCGGCCCGGANONE 
Os05g0350500013-071-D05CCCGGGCCGNONE 
AF020787CCCGGGCCGNONE 
AK061712CCCGGGCCGNONE 
AK102897CCCGGGCCGProliferation-associated protein 1 family protein. 
J033060G23CCCGGGCCGNONE 
J033112P14CCCGGGCCGNONE 
J033127J04CCCGGGCCGNONE 
J090015L18CCCGGGCCGNONE 
J090047K03CCCGGGCCGNONE 
J090097J17CCCGGGCCGNONE 
Os05g0350600AK066244CCCGGGCCGGCSimilar to Atranbp1b protein. 
J075100E12CCCGGGCCGGCNONE 
J090024D03CCCGGGCCGGCNONE 
J100027C02CCCGGGCCGGCNONE 
J100053P05CCCGGGCCGGCNONE 
J100055P22CCCGGGCCGGCNONE 
Os05g0361900006-033-D04CTCGGCCCGGTNONE 
AK060107CTCGGCCCGGTMitochondrial substrate carrier family protein. 
AK104602CTCGGCCCGGTNONE 
AK104747CTCGGCCCGGTNONE 
J033133L03CTCGGCCCGGTNONE 
J080001O06CTCGGCCCGGTNONE 
J080004F05CTCGGCCCGGTNONE 
J080005D12CTCGGCCCGGTNONE 
J080008G19CTCGGCCCGGTNONE 
J080015D10CTCGGCCCGGTNONE 
J080015H22CTCGGCCCGGTNONE 
J080016K15CTCGGCCCGGTNONE 
J080018D12CTCGGCCCGGTNONE 
J080020A01CTCGGCCCGGTNONE 
J080027A09CTCGGCCCGGTNONE 
J080032F05CTCGGCCCGGTNONE 
J080039D09CTCGGCCCGGTNONE 
J080043J19CTCGGCCCGGTNONE 
J080052G22CTCGGCCCGGTNONE 
J080052M15CTCGGCCCGGTNONE 
J080053D22CTCGGCCCGGTNONE 
J080061I18CTCGGCCCGGTNONE 
J080064O14CTCGGCCCGGTNONE 
J080075K01CTCGGCCCGGTNONE 
J080082I02CTCGGCCCGGTNONE 
J080095C14CTCGGCCCGGTNONE 
J100028N14CTCGGCCCGGTNONE 
Os05g0397700AK067298GGCCGGGCCGGGCCGGTSecY protein family protein. 
Os05g0405400J090016P17CACGGCCCGGTNONE 
Os05g0414200015-033-G02TCCGACGGCGGCCCGGCCNONE 
AK106297TCCGACGGCGGCCCGGCCDisease resistance protein family protein. 
Os05g0463400AK100354GTATGGGCCCGTGGCCCATGGGCCCAACCGGCCCGGCCPWWP domain containing protein. 
J013022B18GTATGGGCCCGTGGCCCATGGGCCCAACCGGCCCGGCCNONE 
J023083G23GTATGGGCCCGTGGCCCATGGGCCCAACCGGCCCGGCCNONE 
Os05g0490800J065037L19CCAGCCCACGGCCCGGCCCACCTNONE 
Os05g0494600AK108158TCCGGGCCGAConserved hypothetical protein. 
Os05g0536900009-033-D11AGATGGGCCGGGCCGGTNONE 
AK105140AGATGGGCCGGGCCGGTSimilar to RAB7A. 
Os05g0548100AK060333CACGGCCCGGTConserved hypothetical protein. 
AK100682CACGGCCCGGTNONE 
J013151E01CACGGCCCGGTNONE 
J023113L22CACGGCCCGGTNONE 
J043027A19CACGGCCCGGTNONE 
J075093E06CACGGCCCGGTNONE 
J090060D15CACGGCCCGGTNONE 
J090082J03CACGGCCCGGTNONE 
J100050E01CACGGCCCGGTNONE 
Os05g0553700006-100-D08ACCGGGCCGGTNONE 
AK099747ACCGGGCCGGTNONE 
AK101606ACCGGGCCGGTNONE 
AK103396ACCGGGCCGGTSimilar to Syntaxin 71 (AtSYP71). 
J033022M23ACCGGGCCGGTNONE 
J090086G01ACCGGGCCGGTNONE 
Os05g0571400009-019-B04GACGGCCCGGCCCAGTTNONE 
009-043-H02GACGGCCCGGCCCAGTTNONE 
AK062369GACGGCCCGGCCCAGTTConserved hypothetical protein. 
Os05g0594100006-034-F04TCCGGGCCGTTGNONE 
006-061-A02TCCGGGCCGTTGNONE 
009-081-E02TCCGGGCCGTTGNONE 
AK060122TCCGGGCCGTTGNONE 
AK106130TCCGGGCCGTTGSimilar to GDA2 protein. 
J023010C07TCCGGGCCGTTGNONE 
J023098J20TCCGGGCCGTTGNONE 
J023117G22TCCGGGCCGTTGNONE 
J023127J08TCCGGGCCGTTGNONE 
J033117G03TCCGGGCCGTTGNONE 
J033124I03TCCGGGCCGTTGNONE 
J043015K15TCCGGGCCGTTGNONE 
Os05g0594800AK058332CCCGGGCCGGCAdhesion regulating molecule family protein. 
AK068013CCCGGGCCGGCNONE 
J013129L24CCCGGGCCGGCNONE 
Os06g0102300AK071958CCCGGGCCGNONE 
Os06g0104000AK068490GCCACGTGCCACGGCCCGGCCCGGCCCATGAConserved hypothetical protein. 
Os06g0107800009-133-F03TCCGGGCCGTTGGATNONE 
AK062921TCCGGGCCGTTGGATSimilar to RAV-like protein. 
Os06g0140100011-063-A02TGTTGGGCCGGGCCGTGNONE 
AK063371TGTTGGGCCGGGCCGTGLeucine carboxyl methyltransferase family protein. 
Os06g0150600011-051-F03GGCCGGGCCGTANONE 
AK063346GGCCGGGCCGTATransferase family protein. 
Os06g0157800AK121504TCGGCCCGGCCCAGTTSimilar to CG7224 (Fragment). 
J033022L20TCGGCCCGGCCCAGTTNONE 
J075033D09TCGGCCCGGCCCAGTTNONE 
Os06g0246500AK105105CCCGGGCCGTGSimilar to Pyruvate dehydrogenase E1 alpha subunit (EC 1.2.4.1). 
Os06g0319700AK120884GGCCCGGCCCGGTSimilar to 60S ribosomal protein L31. 
J013089A14GGCCCGGCCCGGTNONE 
J023028N24GGCCCGGCCCGGTNONE 
J033098H21GGCCCGGCCCGGTNONE 
J033118G04GGCCCGGCCCGGTNONE 
J090056P15GGCCCGGCCCGGTNONE 
J090062B02GGCCCGGCCCGGTNONE 
J100024B09GGCCCGGCCCGGTNONE 
J100060I04GGCCCGGCCCGGTNONE 
J100078H11GGCCCGGCCCGGTNONE 
J100080A14GGCCCGGCCCGGTNONE 
J100086F18GGCCCGGCCCGGTNONE 
Os06g0338900016-067-B02ACCGGGCCGTGNONE 
AK100837ACCGGGCCGTGNucleotidyl transferase domain containing protein. 
J013058L01ACCGGGCCGTGNONE 
J013135N01ACCGGGCCGTGNONE 
J023123E15ACCGGGCCGTGNONE 
J033051J01ACCGGGCCGTGNONE 
J090002O21ACCGGGCCGTGNONE 
J090013F06ACCGGGCCGTGNONE 
J090056F16ACCGGGCCGTGNONE 
J090081G13ACCGGGCCGTGNONE 
J090090P21ACCGGGCCGTGNONE 
J100039F05ACCGGGCCGTGNONE 
J100059J03ACCGGGCCGTGNONE 
Os06g0551400009-003-D11CCCACCCGGCCCGGCCCACANONE 
011-025-C09CCCACCCGGCCCGGCCCACANONE 
AK066548CCCACCCGGCCCGGCCCACARas-related protein RIC2. 
D13758CCCACCCGGCCCGGCCCACANONE 
J013069H14CCCACCCGGCCCGGCCCACANONE 
J053037J07CCCACCCGGCCCGGCCCACANONE 
J065011J03CCCACCCGGCCCGGCCCACANONE 
J065078L15CCCACCCGGCCCGGCCCACANONE 
J065103H24CCCACCCGGCCCGGCCCACANONE 
J065157A07CCCACCCGGCCCGGCCCACANONE 
J065213P12CCCACCCGGCCCGGCCCACANONE 
J090007P04CCCACCCGGCCCGGCCCACANONE 
J090052N23CCCACCCGGCCCGGCCCACANONE 
Os06g0564700AK070508GCCGGCCCGGCCSimilar to Cysteine synthase (EC 4.2.99.8). 
J023050D23GCCGGCCCGGCCNONE 
Os06g0585200016-065-C02CACGGCCCGGCCNONE 
016-065-C02GCCGGGCCGGGCCGTGNONE 
AK068592CACGGCCCGGCCNONE 
AK068592GCCGGGCCGGGCCGTGNONE 
AK073844CACGGCCCGGCCNONE 
AK073844GCCGGGCCGGGCCGTGNONE 
AK106549CACGGCCCGGCCConserved hypothetical protein. 
AK106549GCCGGGCCGGGCCGTGConserved hypothetical protein. 
J013154A14CACGGCCCGGCCNONE 
J013154A14GCCGGGCCGGGCCGTGNONE 
J100049K24CACGGCCCGGCCNONE 
J100049K24GCCGGGCCGGGCCGTGNONE 
J100059C18CACGGCCCGGCCNONE 
J100059C18GCCGGGCCGGGCCGTGNONE 
J100082N13CACGGCCCGGCCNONE 
J100082N13GCCGGGCCGGGCCGTGNONE 
Os06g0590301J033139K16CACGGCCCGGTNONE 
J065011M13CACGGCCCGGTNONE 
J065027D20CACGGCCCGGTNONE 
J065039O05CACGGCCCGGTGlucose/ribitol dehydrogenase family protein. 
J065051O10CACGGCCCGGTNONE 
J065128I21CACGGCCCGGTNONE 
J065163P10CACGGCCCGGTNONE 
J065169H02CACGGCCCGGTNONE 
Os06g0656300006-034-G12CACGGCCCGGTNONE 
006-056-B10CACGGCCCGGTNONE 
006-089-A09CACGGCCCGGTNONE 
006-104-H10CACGGCCCGGTNONE 
006-108-G10CACGGCCCGGTNONE 
006-111-C10CACGGCCCGGTNONE 
006-113-G11CACGGCCCGGTNONE 
006-119-H10CACGGCCCGGTNONE 
009-033-E11CACGGCCCGGTNONE 
009-106-C06CACGGCCCGGTNONE 
009-160-F06CACGGCCCGGTNONE 
AK060123CACGGCCCGGTNONE 
AK060127CACGGCCCGGTProtein of unknown function DUF588 family protein. 
AK104184CACGGCCCGGTNONE 
J065042D07CACGGCCCGGTNONE 
J075029H23CACGGCCCGGTNONE 
J075151L06CACGGCCCGGTNONE 
J090027A16CACGGCCCGGTNONE 
Os06g0663600AK100787TCCGGGCCGCAEndonuclease V family protein. 
Os06g0670100AK102577TACGGCCCGGTHypothetical protein. 
Os06g0693000AK064280TCTGGGCCGGGCCGTGProtein kinase-like domain containing protein. 
Os06g0711600016-047-G09TTCGGCCCGGTNONE 
AK064384TTCGGCCCGGTmRNA splicing factor SYF2 family protein. 
AK102831TTCGGCCCGGTNONE 
J013072P18TTCGGCCCGGTNONE 
J023049G01TTCGGCCCGGTNONE 
J023088I01TTCGGCCCGGTNONE 
J033023I22TTCGGCCCGGTNONE 
J033106I12TTCGGCCCGGTNONE 
J033109G07TTCGGCCCGGTNONE 
J065030F22TTCGGCCCGGTNONE 
J065132H19TTCGGCCCGGTNONE 
J080301D07TTCGGCCCGGTNONE 
J080305C09TTCGGCCCGGTNONE 
J080312C03TTCGGCCCGGTNONE 
J080313I15TTCGGCCCGGTNONE 
J080315B09TTCGGCCCGGTNONE 
J090056N21TTCGGCCCGGTNONE 
J100027B07TTCGGCCCGGTNONE 
Os06g0717400AK072887GCCGGCCCGGCCCATTTPseudouridine synthase, Rlu family protein. 
Os06g0725400J065086O07AATGGGCCGGGCCGGTSimilar to BLE1 protein. 
J065114J19AATGGGCCGGGCCGGTNONE 
Os07g0105300AK107419GGGCCGGCCCGGCConserved hypothetical protein. 
AK109521GGGCCGGCCCGGCNONE 
Os07g0124600AK073437GATCCGACGGCCCGGARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J033042K24GATCCGACGGCCCGGANONE 
J033136G07GATCCGACGGCCCGGANONE 
J065092I12GATCCGACGGCCCGGANONE 
J065132F04GATCCGACGGCCCGGANONE 
J065143I11GATCCGACGGCCCGGANONE 
Os07g0144200Os07g0144200GGCCCGGCCCGGCCCHypothetical protein. 
Os07g0158900AK064980CCCGGGCCGCyclin-like F-box domain containing protein. 
AK064980GCCGGGCCGTGCyclin-like F-box domain containing protein. 
Os07g0164500J013094M18CCCGGGCCGGCCCATTNONE 
J013153L05CCCGGGCCGGCCCATTNONE 
J023011J18CCCGGGCCGGCCCATTNONE 
J023106H21CCCGGGCCGGCCCATTNONE 
J033105F10CCCGGGCCGGCCCATTNONE 
J065210M20CCCGGGCCGGCCCATTSimilar to Dolichyl pyrophosphate Man9GlcNAc2 alpha-1,3-glucosyltransferase (EC 2.4.1.-) (Dolichyl-P-Glc:Man9GlcNAc2-PP-dolichyl glucosyltransferase). 
J090060F05CCCGGGCCGGCCCATTNONE 
J090061C13CCCGGGCCGGCCCATTNONE 
J090074K15CCCGGGCCGGCCCATTNONE 
Os07g0205700AK120553CCCGGGCCGGCCCSimilar to Xaa-Pro dipeptidase (EC 3.4.-.-). 
J065022J24CCCGGGCCGGCCCNONE 
Os07g0206900AK107761GGCCGGGCCGGCProtein of unknown function DUF642 family protein. 
Os07g0258400AK121534CTCGGCCCGGCCCACCTNONE 
L41217CTCGGCCCGGCCCACCTNONE 
S81897CTCGGCCCGGCCCACCTOsNramp1 (Integral membrane protein). 
Os07g0301200AB110202GCCGGCCCGGCACGGCCCAGCNONE 
AB110202GCTGGGCCGGGCCGNONE 
AK073463GCCGGCCCGGCACGGCCCAGCSimilar to RNA helicase (Fragment). 
AK073463GCTGGGCCGGGCCGSimilar to RNA helicase (Fragment). 
Os07g0408100AK108466GCCGGGCCGTGNONE 
AK111780GCCGGGCCGTGWD40-like domain containing protein. 
Os07g0422100013-054-G11ACCGGCCCGGGNONE 
AK063592ACCGGCCCGGGNONE 
J065165K10ACCGGCCCGGGNONE 
J075021B01ACCGGCCCGGGNONE 
J075087H22ACCGGCCCGGGNONE 
J075118C10ACCGGCCCGGGNONE 
J075134N03ACCGGCCCGGGNONE 
J075151F23ACCGGCCCGGGNONE 
U57639ACCGGCCCGGGAWPM-19-like family protein. 
Os07g0438800AK060412GCCGGCCCGGGCCCACCCNONE 
AK100065GCCGGCCCGGGCCCACCCSimilar to Phosphate starvation regulator protein (Regulatory protein of P- starvation acclimation response Psr1). 
AK103195GCCGGCCCGGGCCCACCCNONE 
AY224478GCCGGCCCGGGCCCACCCNONE 
J013160O05GCCGGCCCGGGCCCACCCNONE 
J023030C05GCCGGCCCGGGCCCACCCNONE 
J033025O04GCCGGCCCGGGCCCACCCNONE 
J033121P15GCCGGCCCGGGCCCACCCNONE 
J043034I23GCCGGCCCGGGCCCACCCNONE 
J065022N01GCCGGCCCGGGCCCACCCNONE 
J065022N02GCCGGCCCGGGCCCACCCNONE 
J065023M01GCCGGCCCGGGCCCACCCNONE 
J065101G13GCCGGCCCGGGCCCACCCNONE 
J075058P13GCCGGCCCGGGCCCACCCNONE 
J075186K10GCCGGCCCGGGCCCACCCNONE 
J075199F17GCCGGCCCGGGCCCACCCNONE 
Os07g0496200AK064866CACGGCCCGGCCNONE 
AK065801CACGGCCCGGCCSimilar to NAD-dependent malic enzyme 62 kDa isoform, mitochondrial precursor (EC 1.1.1.39) (NAD-ME). 
Os07g0512100Os07g0512100TTGTGGGCCCGGCCCGGCCCGGCCCAGTTAnkyrin repeat containing protein. 
Os07g0546000AF188065GGCCCGGCCCGGCCGGCCCACCNONE 
AK061800GGCCCGGCCCGGCCGGCCCACCNONE 
AK065871GGCCCGGCCCGGCCGGCCCACCSimilar to Isopentenyl pyrophosphate:dimethyllallyl pyrophosphate isomerase (EC 5.3.3.2) (Fragment). 
J013024C02GGCCCGGCCCGGCCGGCCCACCNONE 
J013035F03GGCCCGGCCCGGCCGGCCCACCNONE 
J013044J20GGCCCGGCCCGGCCGGCCCACCNONE 
Os07g0555400AK070977GCTGGGCCGGGCCGCCCATTTConserved hypothetical protein. 
AK070977GGGCCGGCCCGGCConserved hypothetical protein. 
Os07g0573400006-035-G11CCCGGGCCGAGNONE 
AK061739CCCGGGCCGAGNONE 
AK065116CCCGGGCCGAGNONE 
AK102732CCCGGGCCGAGProtein of unknown function DUF239, plant domain containing protein. 
AK119637CCCGGGCCGAGNONE 
AK121705CCCGGGCCGAGNONE 
Os07g0573600AK073925GTTTGGGCCGGGCCGAAAREX1 DNA Repair family protein. 
J033072E11GTTTGGGCCGGGCCGAAANONE 
Os07g0578600AK067155TTCGGCCCGGCCCACTCCSimilar to 5-formyltetrahydrofolate cycloligase (EC 6.3.3.2). 
AK106065TTCGGCCCGGCCCACTCCNONE 
Os07g0618800009-116-H12TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
AK074019TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCSimilar to Centrin (Caltractin). 
J033074L14TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J065187P13TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080002E06TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080010A10TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080012N16TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080014F21TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080016E05TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080018L10TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080021F24TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080022M11TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080023F12TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080023H02TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080024A13TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080025F03TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080025F04TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080028H05TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080030B18TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080031E07TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080033H12TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080038J06TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080039M20TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080042E01TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080042G10TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080044H14TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080046F19TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080047A01TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080049O03TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080050H10TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080052P06TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080052P09TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080056I06TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080061A12TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080061I04TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080063K06TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080069I24TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080072D24TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080076D19TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080076F15TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080076I22TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080076J11TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080077C19TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080080A22TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080081E12TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080081I23TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080084H01TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080085A04TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080085N21TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080086A14TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080086G22TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080096H06TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080097G06TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J090002O14TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J100072G23TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J100077M11TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
Os07g0639900J080305F09TCGTGGGCCGGGCCGGGCCGGGCCGAANONE 
J080305J22TCGTGGGCCGGGCCGGGCCGGGCCGAAThymidylate kinase domain containing protein. 
J080311G07TCGTGGGCCGGGCCGGGCCGGGCCGAANONE 
J080315B14TCGTGGGCCGGGCCGGGCCGGGCCGAANONE 
J080317C02TCGTGGGCCGGGCCGGGCCGGGCCGAANONE 
Os08g0139100006-027-E12GGCCCGGCCCGGCCCGGCCCACTNONE 
006-089-E06GGCCCGGCCCGGCCCGGCCCACTNONE 
006-113-G02GGCCCGGCCCGGCCCGGCCCACTNONE 
AK061429GGCCCGGCCCGGCCCGGCCCACTNONE 
AK099590GGCCCGGCCCGGCCCGGCCCACTSimilar to DAG protein, chloroplast precursor. 
AK104727GGCCCGGCCCGGCCCGGCCCACTNONE 
J013043H11GGCCCGGCCCGGCCCGGCCCACTNONE 
J013049N13GGCCCGGCCCGGCCCGGCCCACTNONE 
J065079F01GGCCCGGCCCGGCCCGGCCCACTNONE 
J065122N24GGCCCGGCCCGGCCCGGCCCACTNONE 
J065142J24GGCCCGGCCCGGCCCGGCCCACTNONE 
J065193N03GGCCCGGCCCGGCCCGGCCCACTNONE 
J075041I21GGCCCGGCCCGGCCCGGCCCACTNONE 
J075145E04GGCCCGGCCCGGCCCGGCCCACTNONE 
Os08g0167500006-063-D04TCATGGGCCGGGCCGGGNONE 
006-066-G09TCATGGGCCGGGCCGGGNONE 
AK061061TCATGGGCCGGGCCGGGConserved hypothetical protein. 
AK071197TCATGGGCCGGGCCGGGNONE 
J023082N10TCATGGGCCGGGCCGGGNONE 
Os08g0195400006-057-E04CACGGCCCGGTNONE 
006-057-E04GGGCCGGCCCGGCACGGCCCGNONE 
006-060-B10CACGGCCCGGTNONE 
006-060-B10GGGCCGGCCCGGCACGGCCCGNONE 
AK070464CACGGCCCGGTConserved hypothetical protein. 
AK070464GGGCCGGCCCGGCACGGCCCGConserved hypothetical protein. 
AK104389CACGGCCCGGTNONE 
AK104389GGGCCGGCCCGGCACGGCCCGNONE 
AK106140CACGGCCCGGTNONE 
AK106140GGGCCGGCCCGGCACGGCCCGNONE 
J023013G08CACGGCCCGGTNONE 
J023013G08GGGCCGGCCCGGCACGGCCCGNONE 
J023054K19CACGGCCCGGTNONE 
J023054K19GGGCCGGCCCGGCACGGCCCGNONE 
J023089D18CACGGCCCGGTNONE 
J023089D18GGGCCGGCCCGGCACGGCCCGNONE 
J023092K05CACGGCCCGGTNONE 
J023092K05GGGCCGGCCCGGCACGGCCCGNONE 
J033025A08CACGGCCCGGTNONE 
J033025A08GGGCCGGCCCGGCACGGCCCGNONE 
J033067P12CACGGCCCGGTNONE 
J033067P12GGGCCGGCCCGGCACGGCCCGNONE 
J033098A10CACGGCCCGGTNONE 
J033098A10GGGCCGGCCCGGCACGGCCCGNONE 
J065219L04CACGGCCCGGTNONE 
J065219L04GGGCCGGCCCGGCACGGCCCGNONE 
J090021P06CACGGCCCGGTNONE 
J090021P06GGGCCGGCCCGGCACGGCCCGNONE 
J090062M05CACGGCCCGGTNONE 
J090062M05GGGCCGGCCCGGCACGGCCCGNONE 
J090079F15CACGGCCCGGTNONE 
J090079F15GGGCCGGCCCGGCACGGCCCGNONE 
J100041H19CACGGCCCGGTNONE 
J100041H19GGGCCGGCCCGGCACGGCCCGNONE 
Os08g0206600AK064336TCGGCCCGGTAICARFT/IMPCHase bienzyme family protein. 
AK102764TCGGCCCGGTNONE 
Os08g0224200AK101331CGGACGGCCCGGTSimilar to Ythdf2-prov protein. 
Os08g0230000014-096-F01CCGTGGGCCGGGCCGTCGGGCCGTANONE 
014-096-F01GGCCGGGCCGGCNONE 
AK067127CCGTGGGCCGGGCCGTCGGGCCGTAConserved hypothetical protein. 
AK067127GGCCGGGCCGGCConserved hypothetical protein. 
J013096C05CCGTGGGCCGGGCCGTCGGGCCGTANONE 
J013096C05GGCCGGGCCGGCNONE 
J100032D12CCGTGGGCCGGGCCGTCGGGCCGTANONE 
J100032D12GGCCGGGCCGGCNONE 
Os08g0328300AK102227GCCGGGCCGTGNONE 
AK105392GCCGGGCCGTGENT domain containing protein. 
Os08g0363000015-090-A07TAATGGGCCTCCGGCCCGGTNONE 
AK103677TAATGGGCCTCCGGCCCGGTNONE 
AK106532TAATGGGCCTCCGGCCCGGTProtein of unknown function DUF295 family protein. 
J033136B21TAATGGGCCTCCGGCCCGGTNONE 
J033136E01TAATGGGCCTCCGGCCCGGTNONE 
J043029N11TAATGGGCCTCCGGCCCGGTNONE 
J065071G13TAATGGGCCTCCGGCCCGGTNONE 
J065105J22TAATGGGCCTCCGGCCCGGTNONE 
J075084B18TAATGGGCCTCCGGCCCGGTNONE 
Os08g0416000AF145729GGCCGGGCCGGCHomeodomain leucine zipper protein. 
AK100634GGCCGGGCCGGCNONE 
AK101569GGCCGGGCCGGCNONE 
AK110561GGCCGGGCCGGCNONE 
J013074A01GGCCGGGCCGGCNONE 
J013159K22GGCCGGGCCGGCNONE 
J023028M01GGCCGGGCCGGCNONE 
J023033C15GGCCGGGCCGGCNONE 
J023107N23GGCCGGGCCGGCNONE 
J023110A12GGCCGGGCCGGCNONE 
J023122D02GGCCGGGCCGGCNONE 
J033050G15GGCCGGGCCGGCNONE 
J033107D17GGCCGGGCCGGCNONE 
J065082J21GGCCGGGCCGGCNONE 
J065165L21GGCCGGGCCGGCNONE 
J065171J17GGCCGGGCCGGCNONE 
J100026K13GGCCGGGCCGGCNONE 
J100039E16GGCCGGGCCGGCNONE 
J100056J11GGCCGGGCCGGCNONE 
J100070I19GGCCGGGCCGGCNONE 
J100073B16GGCCGGGCCGGCNONE 
J100081M19GGCCGGGCCGGCNONE 
J100088E09GGCCGGGCCGGCNONE 
Os08g0425000AK105302GCCGGGCCGTCCConserved hypothetical protein. 
Os08g0433200013-023-E07TACGGCCCGGCCCAAANONE 
AK099471TACGGCCCGGCCCAAAConserved hypothetical protein. 
J013024A05TACGGCCCGGCCCAAANONE 
J013065N03TACGGCCCGGCCCAAANONE 
J023111A21TACGGCCCGGCCCAAANONE 
J065035F10TACGGCCCGGCCCAAANONE 
J065083H01TACGGCCCGGCCCAAANONE 
J065159E03TACGGCCCGGCCCAAANONE 
J065186A03TACGGCCCGGCCCAAANONE 
J075032B02TACGGCCCGGCCCAAANONE 
J075038L14TACGGCCCGGCCCAAANONE 
J075047N21TACGGCCCGGCCCAAANONE 
J075076H05TACGGCCCGGCCCAAANONE 
J075110C08TACGGCCCGGCCCAAANONE 
J090096K17TACGGCCCGGCCCAAANONE 
Os08g0442300006-067-F05GCTGGGCCAGGCCGGGCCGGANONE 
AK059843GCTGGGCCAGGCCGGGCCGGANONE 
AK071719GCTGGGCCAGGCCGGGCCGGASimilar to Calcineurin-like protein. 
AK102411GCTGGGCCAGGCCGGGCCGGANONE 
J023108H11GCTGGGCCAGGCCGGGCCGGANONE 
J033092P05GCTGGGCCAGGCCGGGCCGGANONE 
J075109C09GCTGGGCCAGGCCGGGCCGGANONE 
J090070B02GCTGGGCCAGGCCGGGCCGGANONE 
J090076M14GCTGGGCCAGGCCGGGCCGGANONE 
J100064B16GCTGGGCCAGGCCGGGCCGGANONE 
Os08g0525600AK103172TCCGGGCCGTTSimilar to Peptidylprolyl isomerase; FK506-binding protein. 
Os08g0535600AK121683CCCGGCCCGGCCCGTTZinc finger, Tim10/DDP-type family protein. 
J065077E05CCCGGCCCGGCCCGTTNONE 
J075088M24CCCGGCCCGGCCCGTTNONE 
J075140B03CCCGGCCCGGCCCGTTNONE 
J090014B14CCCGGCCCGGCCCGTTNONE 
Os08g0554000AK111661AGATGGGCCGGGCCGTAWD-40 repeat containing protein. 
AK112044AGATGGGCCGGGCCGTANONE 
J013039N12AGATGGGCCGGGCCGTANONE 
J013134D02AGATGGGCCGGGCCGTANONE 
J013153B06AGATGGGCCGGGCCGTANONE 
J033044L16AGATGGGCCGGGCCGTANONE 
J033073P14AGATGGGCCGGGCCGTANONE 
Os09g0241200AK120155TCGGCCCGGTConserved hypothetical protein. 
J013030A17TCGGCCCGGTNONE 
Os09g0243200AK107718TCCGGGCCGAAZinc finger, RING-type domain containing protein. 
Os09g0296400J090084M08CCCGGCCCGGCCCConserved hypothetical protein. 
Os09g0325700011-041-G03GGACGGCCCGGANONE 
AK063334GGACGGCCCGGASimilar to Protein phpsphatase 2C (PP2C) (EC 3.1.3.16). 
J080317M24GGACGGCCCGGANONE 
Os09g0360400009-192-H06AAGGCCCACCCGGCCCGGGNONE 
AK071395AAGGCCCACCCGGCCCGGGConserved hypothetical protein. 
J013045J21AAGGCCCACCCGGCCCGGGNONE 
J023095O09AAGGCCCACCCGGCCCGGGNONE 
J065207K01AAGGCCCACCCGGCCCGGGNONE 
Os09g0424600AK073882CGGCCCGGGHAD superfamily (subfamily IG) hydrolase, 5'-Nucleotidase protein. 
AK073882TCCGGGCCGTGHAD superfamily (subfamily IG) hydrolase, 5'-Nucleotidase protein. 
Os09g0461500006-107-E02GGCCCGGGCCGNONE 
011-089-D02GGCCCGGGCCGNONE 
AK063400GGCCCGGGCCGNONE 
AK102328GGCCCGGGCCGEsterase/lipase/thioesterase domain containing protein. 
J033090L22GGCCCGGGCCGNONE 
J065031O14GGCCCGGGCCGNONE 
J065083D22GGCCCGGGCCGNONE 
J065182N14GGCCCGGGCCGNONE 
J065190H22GGCCCGGGCCGNONE 
J065219H11GGCCCGGGCCGNONE 
J075007O22GGCCCGGGCCGNONE 
J075025E09GGCCCGGGCCGNONE 
J075041K24GGCCCGGGCCGNONE 
J075046F11GGCCCGGGCCGNONE 
J090032E12GGCCCGGGCCGNONE 
Os09g0522800015-033-B12CCCGGCCCGGANONE 
015-083-G12CCCGGCCCGGANONE 
AK070906CCCGGCCCGGAProtein of unknown function DUF1618 domain containing protein. 
J023065L17CCCGGCCCGGANONE 
J090090P20CCCGGCCCGGANONE 
Os09g0533600AK070024ACCGGGCCGASimilar to Avr9/Cf-9 induced kinase 1. 
Os11g0106700006-055-F11GGCCGGGCCGGGCNONE 
006-099-D08GGCCGGGCCGGGCNONE 
009-155-A12GGCCGGGCCGGGCNONE 
AF519570GGCCGGGCCGGGCNONE 
AK059354GGCCGGGCCGGGCSimilar to Ferritin 1, chloroplast precursor (EC 1.16.3.1) (ZmFer1). 
Os11g0219400AK069850CACGGCCCGGTAnkyrin repeat containing protein. 
AK069850GGGCCGGCCCGGCAnkyrin repeat containing protein. 
AK099123CACGGCCCGGTNONE 
AK099123GGGCCGGCCCGGCNONE 
J023143G18CACGGCCCGGTNONE 
J023143G18GGGCCGGCCCGGCNONE 
Os11g0482000006-056-D12CCCGGCCCGGCCCAACANONE 
006-102-C10CCCGGCCCGGCCCAACANONE 
009-005-E07CCCGGCCCGGCCCAACANONE 
014-088-D03CCCGGCCCGGCCCAACANONE 
AK059558CCCGGCCCGGCCCAACASimilar to 40S ribosomal protein S5-1. 
AK103918CCCGGCCCGGCCCAACANONE 
Os11g0484300AK121422AAATGGGCCGGGCCGAGGCCCAAASimilar to Mcm2-prov protein. 
Os11g0544600AK064128CTCGGCCCGGCCCGGCCCGGCCConserved hypothetical protein. 
J075118L07CTCGGCCCGGCCCGGCCCGGCCNONE 
Os11g0586300AK072257TCGGCCCGGCCCACGTConserved hypothetical protein. 
Os11g0606300J075039E08ATTGGGCCGGCCCGGTNONE 
J075044E18ATTGGGCCGGCCCGGTNONE 
J075053G16ATTGGGCCGGCCCGGTConserved hypothetical protein. 
Os11g0660000AK066709CCCGGGCCGSodium/calcium exchanger membrane region domain containing protein. 
AK066709GCCGGGCCGTGSodium/calcium exchanger membrane region domain containing protein. 
J013074O18CCCGGGCCGNONE 
J013074O18GCCGGGCCGTGNONE 
J023081H12CCCGGGCCGNONE 
J023081H12GCCGGGCCGTGNONE 
J065072E24CCCGGGCCGNONE 
J065072E24GCCGGGCCGTGNONE 
J065186K08CCCGGGCCGNONE 
J065186K08GCCGGGCCGTGNONE 
J075079E19CCCGGGCCGNONE 
J075079E19GCCGGGCCGTGNONE 
J075093J05CCCGGGCCGNONE 
J075093J05GCCGGGCCGTGNONE 
J075124I21CCCGGGCCGNONE 
J075124I21GCCGGGCCGTGNONE 
J075187F09CCCGGGCCGNONE 
J075187F09GCCGGGCCGTGNONE 
J090037O16CCCGGGCCGNONE 
J090037O16GCCGGGCCGTGNONE 
Os12g0106000AF370029GGCCGGGCCGGGCSimilar to Ferritin 1, chloroplast precursor (EC 1.16.3.1) (ZmFer1). 
AF519571GGCCGGGCCGGGCNONE 
AK102242GGCCGGGCCGGGCNONE 
AY324879GGCCGGGCCGGGCNONE 
J053063M21GGCCGGGCCGGGCNONE 
J090080A16GGCCGGGCCGGGCNONE 
Os12g0150100009-047-B11ACCGGGCCGAAANONE 
AK105075ACCGGGCCGAAASimilar to 60S ribosomal protein L26A. 
J013067G22ACCGGGCCGAAANONE 
J033103F08ACCGGGCCGAAANONE 
J065029P11ACCGGGCCGAAANONE 
J065043B18ACCGGGCCGAAANONE 
J065123E16ACCGGGCCGAAANONE 
J065141O20ACCGGGCCGAAANONE 
J065161O04ACCGGGCCGAAANONE 
J065201M07ACCGGGCCGAAANONE 
J075058I23ACCGGGCCGAAANONE 
J075172J08ACCGGGCCGAAANONE 
J100040L13ACCGGGCCGAAANONE 
Os12g0256300AK073908TTCGGCCCGGTSimilar to Schizosaccharomyces pombe (Fragment). 
AK099579TTCGGCCCGGTNONE 
Os12g0533500AK068646TCGGCCCGGCCCGGCCCAGAConserved hypothetical protein. 
J013158L10TCGGCCCGGCCCGGCCCAGANONE 
J065083J02TCGGCCCGGCCCGGCCCAGANONE 
J075079D02TCGGCCCGGCCCGGCCCAGANONE 
J100037H16TCGGCCCGGCCCGGCCCAGANONE 
J100075P13TCGGCCCGGCCCGGCCCAGANONE 
Os12g0599900AK101252TCTCGGCCCGGCCTetratricopeptide region domain containing protein. 
J033032F05TCTCGGCCCGGCCNONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.