
Summary of OsREG545 (All List)

OrganismOryza sativa  
PPDB Motif 
PLACE Motif 
Total Entry Count3167  

Entry Sequences (3167 entries)

LocusGene modelSequenceDescription
AK121523GCCGTCCGATSimilar to 40S ribosomal protein S5-1. 
Os01g0140400AK063999CCGTCCGATCCGLeucine rich repeat, N-terminal domain containing protein. 
AK066922GATCGGACGGCTProtein of unknown function DUF647 family protein. 
AK066922GATCGGACGGCTProtein of unknown function DUF647 family protein. 
Os01g0157600AK106766TCCGTCCGAAnkyrin repeat containing protein. 
Os01g0168500AK072657CCGTCCGAWD40-like domain containing protein. 
AK071658ATCGGACGGACConserved hypothetical protein. 
AK119511GTGGTGGGCCCCACGCCCCACCGTCCGASimilar to Cysteine protease inhibitor. 
AK101508GATCGGACGGCCSimilar to Cationic peroxidase isozyme 40K precursor. 
Os01g0281200AK107209CCGTCCGATCSimilar to Type B-like cyclin (Fragment). 
Os01g0347100AK100716CGGATCGGACGGCTProtein of unknown function DUF1399 family protein. 
Os01g0364900AK121145TCGGACGGCTConserved hypothetical protein. 
Os01g0506100AK102377ATCGGACGGCTGlobin-like family protein. 
AK100776AGCCGTCCGATSimilar to Brix domain containing protein 1 homolog. 
Os01g0558500AK099982ATCGGACGGCCPWWP domain containing protein. 
AK059810ATCGGACGGACSimilar to Clone ZZZ51 mRNA sequence. 
Os01g0637600AK106980GCCGTCCGATSimilar to Peptide deformylase, chloroplast precursor (EC (PDF) (Polypeptide deformylase). 
AK072283GATCGGACGGCSimilar to Aspartic proteinase oryzasin 1 precursor (EC 3.4.23.-). 
AK061329TCGGACGGCDrought induced 19 family protein. 
AK099894AGCCGTCCGATCPeptidyl-tRNA hydrolase family protein. 
AK064946GATCGGACGGSimilar to Transcription factor ICE1 (Inducer of CBF expression 1) (Basic helix- loop-helix protein 116) (bHLH116) (AtbHLH116). 
Os01g0731800AK121474TCGGACGGCTRINGv domain containing protein. 
AK067563GATCGGACGGCTGTP-binding protein, HSR1-related domain containing protein. 
Os01g0761100AK122112GCCGTCCGATCTesmin/TSO1-like, CXC domain containing protein. 
Os01g0766200AK069471ATCGGACGGCZinc finger, RING-type domain containing protein. 
AK069471CCGTCCGAZinc finger, RING-type domain containing protein. 
Os01g0796700AK120491ATCGGACGGZinc finger, RING-type domain containing protein. 
AK101426ATCGGACGGCCSimilar to Apurinic endonuclease-redox protein (DNA-(apurinic or apyrimidinic site) lyase) (EC 
AK065370ATCGGACGGACSimilar to ADP-ribosylation factor 1. 
AK065059CCGTCCGATSimilar to 2,3-bisphosphoglycerate-independent phosphoglycerate mutase (EC (Phosphoglyceromutase) (BPG-independent PGAM) (PGAM-I). 
Os01g0817800AK073827CCGTCGGACGGACWD40-like domain containing protein. 
Os01g0830100AK069755CGGATCGGACGGAPyridine nucleotide-disulphide oxidoreductase, NAD-binding region domain containing protein. 
Os01g0837600AK108007ATCGGACGGCCConserved hypothetical protein 1589, plant family protein. 
Os01g0849600AK108159CCGTCCGASimilar to ENOD18 protein (Fragment). 
AK104693AGCCGTCCGATCEukaryotic ribosomal protein L5 family protein. 
Os01g0927000AK106700AGCCGTCCGATCSimilar to SET domain-containing protein SET118. 
AK106700ATCGGACGGCSimilar to SET domain-containing protein SET118. 
AK069516CCGTCCGATDrought induced 19 family protein. 
Os02g0100200AK121311CCGTCCGATSteroid nuclear receptor, ligand-binding domain containing protein. 
AK070711GGCCGTCCGATCConserved hypothetical protein. 
AK106553CCGTCCGATConserved hypothetical protein. 
AK119650GATCGGACGGCCMAP kinase MAPK2 (MAP kinase 3). 
Os02g0216200AK108648AGCCGTCCGATCHypothetical protein. 
Os02g0219000AK064689GATCGGACGGInterferon-related developmental regulator domain containing protein. 
AK104393ATCGGACGGCCCACGTSimilar to Epstein-Barr nuclear antigen-1 (EBNA-1). 
Os02g0220600AK061944ATCGGACGGCCGAGATElongation factor 1-gamma (EF-1-gamma) (eEF-1B gamma). 
AK061944GCCGTCCGATCElongation factor 1-gamma (EF-1-gamma) (eEF-1B gamma). 
AK059647AGCCGTCCGATCSimilar to 40S ribosomal protein S3a (CYC07 protein). 
Os02g0299600AK069297CCGTCCGATCProtein of unknown function DUF1242 family protein. 
Os02g0317500AK102355ATCGGACGGCyclin-like F-box domain containing protein. 
AK109380CCGTCCGATCConserved hypothetical protein. 
Os02g0462800AK110587GCCGTCCGATCWRKY transcription factor 42 (Transcription factor WRKY02). 
AK058851TCCGTCCGAConserved hypothetical protein. 
AK121892CGGATCGGACGGSimilar to Carbon-nitrogen hydrolase family protein. 
Os02g0556700AK073875GGCCGTCCGATCT-complex 11 family protein. 
AK121206AGTGGGCCCCACCCCGTCCGAProtein kinase-like domain containing protein. 
AK101873GTCCGTCCGATCBromodomain containing protein. 
Os02g0610500AK058536GCGCGGGTCGGACGGSimilar to CONSTANS-like protein CO9 (Fragment). 
AK061679AGCCGTCCGATCConserved hypothetical protein. 
J100090A12CCCCCGCGACGCGGATCGGACGGCTConserved hypothetical protein. 
AK121803ATCGGACGGSimilar to 65kD microtubule associated protein. 
Os02g0733300AK101108TCCGTCCGASimilar to Endo-beta-1,4-glucanase precursor (EC 
Os02g0750500AK101960GGCCGTCCGATSAM (and some other nucleotide) binding motif domain containing protein. 
AK099805AGCCGTCCGATRibosomal protein L29 family protein. 
AK072308GGCCGTCCGATReplication protein A 70kDa. 
Os02g0807750J075136J04GCCGTCCGATCHypothetical protein. 
Os03g0111600AK101020AGCCGTCCGATCCCCACGTProtein of unknown function DUF1618 domain containing protein. 
AK071287TCGGACGGCCCATGSimilar to Partner of Nob1; Pno1p; Yor145cp like KH domain containing protein, transcripts identified by EST. 
AK099355ATCGGACGGASimilar to Chitinase (EC (Fragment). 
AK121681AGCCGTCCGATC24-methylenesterol C-methyltransferase 2 (EC (24-sterol C- methyltransferase 2) (Sterol-C-methyltransferase 2). 
Os03g0151500AK109181GATCGGACGGConserved hypothetical protein. 
AK103466ATCGGACGGGCCGCALupus La protein family protein. 
AK103466GATCGGACGGLupus La protein family protein. 
J065132L03ATCGGACGGCTHypothetical protein. 
AK059911TCGGACGGAConserved hypothetical protein. 
Os03g0177100AK068092AGCCGTCCGATCConserved hypothetical protein. 
J065154C08CCGTGGGCCGTCCGATCTarget SNARE coiled-coil region domain containing protein. 
Os03g0217900AK119980AGCCGTCCGATConserved hypothetical protein. 
Os03g0231600AK105963CCGTCCGASimilar to Branched-chain-amino-acid aminotransferase 3, chloroplast precursor (EC (Atbcat-3). 
AK069529ATCGGACGGCTDihydrodipicolinate reductase family protein. 
AK111884AGCCGTCCGATCAcid phosphatase/vanadium-dependent haloperoxidase family protein. 
Os03g0296300AK100042CGGATCGGACGGMitochondrial import inner membrane translocase, subunit Tim17/22 family protein. 
Os03g0296400AK073460CCGTCCGATCCGSimilar to Eukaryotic translation initiation factor 2 subunit 1 (Eukaryotic translation initiation factor 2 alpha subunit) (eIF-2-alpha) (EIF- 2alpha) (EIF-2A) (Fragment). 
Os03g0300200AK102070ATCGGACGGCTSimilar to Ubiquitin-specific protease 16. 
Os03g0300300AK099693AGCCGTCCGAWD40-like domain containing protein. 
Os03g0314800AK103334GCCGTCCGATCPlant neutral invertase family protein. 
AK058567ATCGGACGGCCCACGTGProteasome subunit alpha type 2 (EC (20S proteasome alpha subunit B) (20S proteasome subunit alpha-2). 
AK058567ATCGGACGGCGCGCGACProteasome subunit alpha type 2 (EC (20S proteasome alpha subunit B) (20S proteasome subunit alpha-2). 
AY062181TCCGTCCGACGTGGCGSimilar to Potential histone-like transcription factor. 
Os03g0425100AK070206GCCGTCCGATCHypothetical protein. 
Os03g0574300AK072541ATCGGACGGCCHypothetical protein. 
Os03g0646300AK069229CGGATCGGACGGSimilar to Cyclic nucleotide-gated channel A (Fragment). 
Os03g0648300AK067192GTGGGTCCGTCCGAIQ calmodulin-binding region domain containing protein. 
Os03g0659900AK067560TCTGGACCGTCCGATCSimilar to S3 self-incompatibility locus-linked pollen 3.15 protein. 
AK059164GCCGTCCGATCSimilar to Glycine-rich RNA-binding, abscisic acid-inducible protein. 
Os03g0684400AK100086CCGTCCGATCCGMg2+ transporter protein, CorA-like family protein. 
AK100086GATCGGACGGCCCAGATMg2+ transporter protein, CorA-like family protein. 
AK109359GATCGGACGGConserved hypothetical protein. 
Os03g0690000AK062756GATCGGACGGCCCACGCConserved hypothetical protein. 
Os03g0699300AK120407CCGAGCCGTCCGATCSimilar to Adenylosuccinate synthetase, chloroplast precursor (EC (IMP-- aspartate ligase) (AdSS) (AMPSase). 
AK060065ATCGGACGGACProtein of unknown function DUF292, eukaryotic domain containing protein. 
Os03g0728100AK068717TCCGTCCGATCHeat shock protein DnaJ, N-terminal domain containing protein. 
Os03g0728800AK068068ATCGGACGGCSimilar to RNA helicase (Fragment). 
Os03g0746000AK073682AGCCGTCCGATCConserved hypothetical protein. 
Os03g0751100AK102404CCGTCCGATCSimilar to Isp4 protein-like. 
D13224CCGTCCGATTubulin beta-1 chain (Beta-1 tubulin). 
Os03g0784400AK103474CCGTCCGATCProtein of unknown function DUF1692 domain containing protein. 
Os03g0811100AK072463ATCGGACGGCTSimilar to Magnesium-chelatase subunit chlD, chloroplast precursor (EC (Mg-protoporphyrin IX chelatase) (Mg-chelatase subunit D). 
AK119756AGCCGTCCGATCGGACSimilar to DNA-directed RNA polymerase. 
AK099592GGCCGTCCGATCSimilar to Chaperone protein dnaJ 1. 
AK065702ATCGGACGGCTConserved hypothetical protein. 
AK065702CCGTCCGATCConserved hypothetical protein. 
Os03g0847600AK066947GCCGTCCGASimilar to GAMYB-binding protein. 
AK068202GCCGTCCGATSimilar to AHM2 (Fragment). 
AK061854ATCGGACGGCCProtein of unknown function UPF0172 family protein. 
AK062974GCCGTCCGATHypothetical protein. 
Os04g0401800AB197127AGCCGTCCGATCCGDNA repair metallo-beta-lactamase domain containing protein. 
AB197127GATCGGACGGCTDNA repair metallo-beta-lactamase domain containing protein. 
J033141G07CGTGGACCGTCCGATHypothetical protein. 
Os04g0423600AK065331ATCGGACGGNuclear protein SET domain containing protein. 
Os04g0428500AK109932CGCGTGGGCTGTCGGACGGConserved hypothetical protein. 
AK064143ATCGGACGGBTB domain containing protein. 
Os04g0485400AK109290CCGTCCGATCSimilar to Nucleotide-binding protein. 
AK111787ATCGGACGGACRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os04g0496600AK065058ATCGGACGGCConserved hypothetical protein. 
Os04g0506300AK063591ATCGGACGGTCCAGATMS membrane protein/tumour differentially expressed protein family protein. 
Os04g0510000AK109180ATCGGACGGConserved hypothetical protein. 
AK065957GATCGGACGGCTConserved hypothetical protein. 
Os04g0529600Os04g0529600ATCGGACGGLanthionine synthetase C-like family protein. 
Os04g0532800AK107135TCCGTCCGATMyb, DNA-binding domain containing protein. 
Os04g0562100AK060598TCCGTCCGAAmino acid/polyamine transporter II family protein. 
Os04g0566900AK072344AGCCGTCCGATCConserved hypothetical protein. 
AK121673ATCGGACGGCConserved hypothetical protein. 
Os04g0602800AK100925GGCCGTCCGATCSimilar to Yarrowia lipolytica chromosome D of strain CLIB99 of Yarrowia lipolytica. 
AK072824GATCGGACGGConserved hypothetical protein. 
Os04g0627900AK108443CCGTCGGACGGCCGAGATCACGCCACGTCTranslation initiation factor SUI1 domain containing protein. 
Os04g0644100AK106954GCCGTCCGATSterile alpha motif homology domain containing protein. 
Os04g0652900AK071125ATCCCCCATCGGACGGPeptidyl-tRNA hydrolase, PTH2 domain containing protein. 
Os04g0661300AK070723CGGATCGGACGGConserved hypothetical protein. 
AK119682GATCGGACGGTCCACGUbiquitin-conjugating enzyme (EC (Ubiquitin carrier protein). 
Os05g0100500AK071466GATCGGACGGCCCAGGSimilar to Debaryomyces hansenii chromosome F of strain CBS767 of Debaryomyces hansenii. 
Os05g0112101J065141G20AGCCGTCCGATCEpsin, N-terminal domain containing protein. 
AK072977CCGTCCGATCATP-dependent DNA helicase RecQ family protein. 
Os05g0214100AK100400GTCCGTCCGATCSimilar to Kluyveromyces lactis strain NRRL Y-1140 chromosome F of strain NRRL Y- 1140 of Kluyveromyces lactis. 
Os05g0297900AK071238AGCCGTCCGATCSimilar to Signal peptidase 18 subunit (Fragment). 
Os05g0328000AK107977GATCGGACGGCCConserved hypothetical protein. 
AK107977GGCCGTCCGATCConserved hypothetical protein. 
AK064169TCCGTCCGATetratricopeptide-like helical domain containing protein. 
AK061434ATCGGACGGCCCATGTAGCCCAACTConserved hypothetical protein. 
AK102897ATCGGACGGAProliferation-associated protein 1 family protein. 
Os05g0395300AK066212CCGTCCGATCProtein of unknown function DUF21 domain containing protein. 
Os05g0408200AK100057CCGTCCGASBP domain containing protein. 
Os05g0428600AK106696CCGTCCGATCSimilar to HSP70 precursor. 
Os05g0506900AK106697CGTGGACCGTCCGATCBrix domain containing protein. 
Os05g0510700AK070308GATCGGACGGCTCGGBSD domain containing protein. 
AK122158CGGATCGGACGGCCDNA-binding TFAR19-related protein family protein. 
Os05g0548100AK060333AGCCGTCCGATCCGConserved hypothetical protein. 
AK102111GATCGGACGGArmadillo-like helical domain containing protein. 
D32144GATCGGACGGAspartic proteinase oryzasin 1 precursor (EC 3.4.23.-). 
Os05g0586600AB096011CCGTCCGATCCGPlastid sigma factor SIG5. 
AB096011GGCCGTCCGATPlastid sigma factor SIG5. 
AK072845ATCGGACGGCCSimilar to Nucleolar histone deacetylase HD2-p39. 
AK062921GATCGGACGGSimilar to RAV-like protein. 
Os06g0146300AK101052ATCGGACGGCConserved hypothetical protein. 
AK066113CCGTCCGATLipolytic enzyme, G-D-S-L family protein. 
AK063418CCGTCCGASimilar to Arm repeat containing protein. 
AK058497ATCGGACGGProtein kinase-like domain containing protein. 
Os06g0245800AK066714ATCGGACGGCSimilar to Alanyl-tRNA synthetase. 
Os06g0264700J100028B14CCGTCCGATCAcylphosphatase domain containing protein. 
Os06g0505400AK068107ATCGGACGGCTAbortive infection protein family protein. 
Os06g0506100AK107403GATCGGACGGCTProtein prenyltransferase domain containing protein. 
AK099075CCGTCCGATAT-rich interaction region domain containing protein. 
Os06g0666400AK108002GATCGGACGGCTVQ domain containing protein. 
Os06g0667400AK065424CCGTCCGATCConserved hypothetical protein. 
AK100915GATCGGACGGConserved hypothetical protein. 
AK100915GATCGGACGGConserved hypothetical protein. 
AK071515CGGATCGGACGGASimilar to Chaperone protein dnaJ. 
Os06g0716700AB037681ATCGGACGGCSimilar to Endoplasmin homolog precursor (GRP94 homolog). 
AB037681CCGAGCCGTCCGATCSimilar to Endoplasmin homolog precursor (GRP94 homolog). 
J075130K10ATCGGACGGCTConserved hypothetical protein. 
Os07g0209000AK059111GATCGGACGGCCCAGATSimilar to Dolichyl-di-phosphooligosaccharide-protein glycotransferase (Oligosaccharyltransferase)-like. 
AK062273GCCGTCCGATConserved hypothetical protein. 
J075134C14ATCGGACGGCTRibosomal protein L24E family protein. 
AK101492GCCGTCCGATCSimilar to Glutamate dehydrogenase (EC (GDH). 
AK072937ATCGGACGGACConserved hypothetical protein. 
Os07g0557500AK101830GATCGGACGGZinc finger, RING-type domain containing protein. 
AK119534CCGTCCGATCSimilar to Chlorophyll a/b-binding protein CP29 precursor. 
Os07g0586000AK069212ATCGGACGGCCCConserved hypothetical protein. 
AK103292TCCGTCCGAConserved hypothetical protein. 
AK121650GATCGGACGGCCCAGATAnkyrin repeat containing protein. 
Os08g0150800AK101530GATCGGACGGCSimilar to Tyrosyl-tRNA synthetase (Tyrosyl-tRNA ligase; TyrRS). class-I aaRS. 
AK067305ATCGGACGGRNA polymerase II transcription factor SIII subunit A family protein. 
AK067305ATCGGACGGRNA polymerase II transcription factor SIII subunit A family protein. 
Os08g0187700AK099689GATCGGACGGCCGAGAGCCCATCARegulation of nuclear pre-mRNA protein domain containing protein. 
AK120613ATCTGGGCCGTCCGATCBromodomain containing protein. 
Os08g0300700AK101762ATCGGACGGAProtein prenyltransferase domain containing protein. 
AK106170TCCGTCCGAATP-dependent Clp protease adaptor protein ClpS family protein. 
AK060222CCGTCCGACGTGGCSimilar to LHC I type IV chlorophyll binding protein (Fragment). 
AK060222GGCCGTCCGATCSimilar to LHC I type IV chlorophyll binding protein (Fragment). 
Os08g0481500J065054C23TCCGTCCGATConserved hypothetical protein. 
AK069097ATCGGACGGCMethyl-CpG binding domain containing protein. 
Os08g0502700AK064774GCCACGTCGGACGGGTGTGGGCCCCACGAAAminotransferase, class V family protein. 
Os08g0503800AK101954AGCCGTCCGATCTGGTGGGCCCACACSimilar to Beta-(1,2)-xylosyltransferase (EC 
AK064826CCGTCCGATSimilar to Glutamate-1-semialdehyde 2,1-aminomutase, chloroplast precursor (EC (GSA) (Glutamate-1-semialdehyde aminotransferase) (GSA- AT). 
Os09g0281900AK121112CGGATCGGACGGCTThyroid hormone receptor-associated protein complex component TRAP170- like protein. 
AK068435CCGAGCCGTCCGATConserved hypothetical protein. 
AK062891GATCGGACGGCTCGGConserved hypothetical protein. 
Os09g0384900AK064530TCCGTCCGAProtein of unknown function DUF295 family protein. 
AK064072ATCGGACGGCBromo adjacent region domain containing protein. 
Os09g0416400J075067A16TCGGACGGCGGAGAGGTGGGCCCGGAConserved hypothetical protein. 
AK067260ATCGGACGGCTSimilar to RNA Binding Protein 47. 
Os09g0467700AK061600GGGCCGTCCGATCConserved hypothetical protein. 
AK068941TCAGCCCAGTCGGACGGACTranscription initiation factor IIB (General transcription factor TFIIB). 
AK061415GATCGGACGGCInosine/uridine-preferring nucleoside hydrolase domain containing protein. 
Os09g0570400AK065287GATCGGACGGCTMajor facilitator superfamily protein. 
AK073392TCCGTCCGA60S ribosomal protein L3. 
Os11g0176000AK105568GATCGGACGGWD40-like domain containing protein. 
Os11g0267400AK069552AGCCGTCCGATCSimilar to ClpC. 
Os11g0536900J100027G18CCGTCCGATCConserved hypothetical protein. 
AK101587TCGGACGGConserved hypothetical protein. 
AK071098GCCGTCCGATCSimilar to RING domain protein. 
AK120270ATCGGACGGCCCACGTConserved hypothetical protein. 
AK105453GATCGGACGGCSimilar to Translationally controlled tumor protein (Fragment). 
AK105453GATCGGACGGCCSimilar to Translationally controlled tumor protein (Fragment). 
Os11g0689000AK067598GATCGGACGGHypothetical protein. 
AK065431CCGTCCGATHeat shock protein 70. 
Os12g0502100Os12g0502100AGCCGTCCGATCConserved hypothetical protein. 
Os12g0562100AK064831GATCGGACGGCCConserved hypothetical protein. 
Os12g0578200AK105512GATCGGACGGTGGGGGATSimilar to Chorismate mutase, chloroplast precursor (EC (CM-1). 
Os12g0583300Os12g0583300ATCGGACGGAPeptidase A1, pepsin family protein. 
Os12g0605300AK108664GCCGTCCGATCTesmin/TSO1-like, CXC domain containing protein. 
Os12g0615300AK119448TCGGACGGEGF-like calcium-binding domain containing protein. 

Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.