version

Summary of OsREG547 (All List)

OrganismOryza sativa  
IDOsREG547  
SequenceCCGTGGGC  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count1411  

Entry Sequences (1411 entries)

LocusGene modelSequenceDescription
Os01g0150000006-053-H07CCCGTGGGCCCCACACNONE 
006-081-C11CCCGTGGGCCCCACACNONE 
009-050-D04CCCGTGGGCCCCACACNONE 
AK060948CCCGTGGGCCCCACAC3-oxo-5-alpha-steroid 4-dehydrogenase, C-terminal domain containing protein. 
J023058M18CCCGTGGGCCCCACACNONE 
J023112H22CCCGTGGGCCCCACACNONE 
J065048P05CCCGTGGGCCCCACACNONE 
J100068N20CCCGTGGGCCCCACACNONE 
J100073A02CCCGTGGGCCCCACACNONE 
Os01g0156300AK107993CCGTGGGCCACACGTCTCSimilar to Cappuccino protein. 
Os01g0174300012-006-G02CCGTGGGCCCACACNONE 
AK071324CCGTGGGCCCACACNADH:cytochrome b5 reductase (CBR) family protein. 
AK104306CCGTGGGCCCACACNONE 
J023089J04CCGTGGGCCCACACNONE 
J023107J15CCGTGGGCCCACACNONE 
J033084J16CCGTGGGCCCACACNONE 
J065097O20CCGTGGGCCCACACNONE 
J065099J15CCGTGGGCCCACACNONE 
J090006K02CCGTGGGCCCACACNONE 
J090023L17CCGTGGGCCCACACNONE 
J090088G14CCGTGGGCCCACACNONE 
Os01g0175100AK071289GCCCACGGGKv1.4 voltage-gated K+ channel family protein. 
J023088B10GCCCACGGGNONE 
J065122H15GCCCACGGGNONE 
J065140B19GCCCACGGGNONE 
J100031E12GCCCACGGGNONE 
J100068J03GCCCACGGGNONE 
J100083E12GCCCACGGGNONE 
Os01g0185200009-146-B06CCCGTGGGCCCACCCNONE 
009-163-F01CCCGTGGGCCCACCCNONE 
AK062984CCCGTGGGCCCACCCNONE 
AK065125CCCGTGGGCCCACCCGlutamyl-tRNA synthetase, class Ic family protein. 
AK105222CCCGTGGGCCCACCCNONE 
AK111284CCCGTGGGCCCACCCNONE 
Os01g0192000AK073660GCCCACGGNONE 
J033052J05GCCCACGGNONE 
Os01g0192550J065164G16GACGGCCCACGGConserved hypothetical protein. 
Os01g0244400J075054J20GCCCACGGGProtein of unknown function DUF1618 domain containing protein. 
J075101O11GCCCACGGGNONE 
J075123K08GCCCACGGGNONE 
Os01g0256400AK107950GCCCACGCCCACGGSimilar to Dynein light chain 1 protein DLC-1 (Fragment). 
J100044J04GCCCACGCCCACGGNONE 
Os01g0258600J075028F17GACGGCCCAGGCCCACGGCCCACANONE 
J075061L04GACGGCCCAGGCCCACGGCCCACAConserved hypothetical protein. 
J075071B09GACGGCCCAGGCCCACGGCCCACANONE 
J075093E04GACGGCCCAGGCCCACGGCCCACANONE 
J100033B11GACGGCCCAGGCCCACGGCCCACANONE 
Os01g0286600AB057749GCCCACGGGSimilar to Plastidal protoporphyrinogen oxidase. 
Os01g0327400AK068063CCGTGGGCSimilar to Peroxidase (Fragment). 
AK099241CCGTGGGCNONE 
J013129I12CCGTGGGCNONE 
J033114B18CCGTGGGCNONE 
J065025P08CCGTGGGCNONE 
J100042P06CCGTGGGCNONE 
J100067A20CCGTGGGCNONE 
Os01g0588200006-052-E10CCAGGCCCAACCAAGCCCACGGNONE 
AJ251563CCAGGCCCAACCAAGCCCACGGNONE 
AK070745CCAGGCCCAACCAAGCCCACGGVoltage-dependent anion channel. 
AK104055CCAGGCCCAACCAAGCCCACGGNONE 
AK104419CCAGGCCCAACCAAGCCCACGGNONE 
J023057A07CCAGGCCCAACCAAGCCCACGGNONE 
J023068C08CCAGGCCCAACCAAGCCCACGGNONE 
J023148E24CCAGGCCCAACCAAGCCCACGGNONE 
J090045O22CCAGGCCCAACCAAGCCCACGGNONE 
J090045P03CCAGGCCCAACCAAGCCCACGGNONE 
J090050C18CCAGGCCCAACCAAGCCCACGGNONE 
J100023F01CCAGGCCCAACCAAGCCCACGGNONE 
J100051I18CCAGGCCCAACCAAGCCCACGGNONE 
J100060P17CCAGGCCCAACCAAGCCCACGGNONE 
Os01g0606900AK065697ACCGGCCCACGGHeat shock protein DnaJ, N-terminal domain containing protein. 
Os01g0623500AK066142CCGTGGGCTAAA ATPase domain containing protein. 
J013055O07CCGTGGGCTNONE 
J053069D06CCGTGGGCTNONE 
J053095J11CCGTGGGCTNONE 
J065106D24CCGTGGGCTNONE 
J065134H18CCGTGGGCTNONE 
J075066D09CCGTGGGCTNONE 
J090004M17CCGTGGGCTNONE 
J100039L05CCGTGGGCTNONE 
J100042E15CCGTGGGCTNONE 
J100043B18CCGTGGGCTNONE 
J100057L11CCGTGGGCTNONE 
J100067C24CCGTGGGCTNONE 
J100073H01CCGTGGGCTNONE 
J100081J21CCGTGGGCTNONE 
Os01g0673500AK065017GCCCACGGSimilar to Katanin p60 ATPase-containing subunit A1 (EC 3.6.4.3) (Katanin p60 subunit A1) (p60 katanin). Splice isoform 2. 
AK069899GCCCACGGNONE 
Os01g0679000AK058515CCGTGGGCCGTGRNA polymerase III subunit RPC82, C -terminal domain containing protein. 
J013149O08CCGTGGGCCGTGNONE 
J033064N24CCGTGGGCCGTGNONE 
J043022M20CCGTGGGCCGTGNONE 
J065075K20CCGTGGGCCGTGNONE 
J065081K04CCGTGGGCCGTGNONE 
J065128K13CCGTGGGCCGTGNONE 
J065131K12CCGTGGGCCGTGNONE 
J065137H20CCGTGGGCCGTGNONE 
J065205A09CCGTGGGCCGTGNONE 
J090030C13CCGTGGGCCGTGNONE 
J090053I08CCGTGGGCCGTGNONE 
J090054O22CCGTGGGCCGTGNONE 
J090082C15CCGTGGGCCGTGNONE 
J090097P12CCGTGGGCCGTGNONE 
Os01g0684800AK073525GCCCACGGGProtein prenyltransferase domain containing protein. 
Os01g0705300AK102719AGATGGGCCGTGGGCCGTGConserved hypothetical protein. 
AK103903AGATGGGCCGTGGGCCGTGNONE 
J013146O16AGATGGGCCGTGGGCCGTGNONE 
J023024O09AGATGGGCCGTGGGCCGTGNONE 
J033105F22AGATGGGCCGTGGGCCGTGNONE 
J033150L19AGATGGGCCGTGGGCCGTGNONE 
J075008G14AGATGGGCCGTGGGCCGTGNONE 
J090089L03AGATGGGCCGTGGGCCGTGNONE 
J100040H18AGATGGGCCGTGGGCCGTGNONE 
Os01g0705500AK063120CACGGCCCACGGCCCATCTConserved hypothetical protein. 
J065063M12CACGGCCCACGGCCCATCTNONE 
J065165C11CACGGCCCACGGCCCATCTNONE 
Os01g0727400AK065692AGGGCCCACGGGConserved hypothetical protein. 
Os01g0730300AK101207CAGGTGGGCCCACGGHAD-superfamily hydrolase subfamily IIB protein. 
AK109542CAGGTGGGCCCACGGNONE 
Os01g0736100011-091-H04CCGTGGGCNONE 
015-004-D10CCGTGGGCNONE 
AK064298CCGTGGGCUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
AK099365CCGTGGGCNONE 
AK103355CCGTGGGCNONE 
J033044B20CCGTGGGCNONE 
J033094G06CCGTGGGCNONE 
J033111N02CCGTGGGCNONE 
J033111P10CCGTGGGCNONE 
J033126K03CCGTGGGCNONE 
J043034D12CCGTGGGCNONE 
Os01g0767600AK070672GGGGCCCACGGGConserved hypothetical protein. 
AK070672GGTGGGGCCCACGGConserved hypothetical protein. 
J013131M12GGGGCCCACGGGNONE 
J013131M12GGTGGGGCCCACGGNONE 
J023027B15GGGGCCCACGGGNONE 
J023027B15GGTGGGGCCCACGGNONE 
J023059I06GGGGCCCACGGGNONE 
J023059I06GGTGGGGCCCACGGNONE 
J023095L05GGGGCCCACGGGNONE 
J023095L05GGTGGGGCCCACGGNONE 
J033033E20GGGGCCCACGGGNONE 
J033033E20GGTGGGGCCCACGGNONE 
J033105F24GGGGCCCACGGGNONE 
J033105F24GGTGGGGCCCACGGNONE 
J033148N05GGGGCCCACGGGNONE 
J033148N05GGTGGGGCCCACGGNONE 
J065060H14GGGGCCCACGGGNONE 
J065060H14GGTGGGGCCCACGGNONE 
J090093E17GGGGCCCACGGGNONE 
J090093E17GGTGGGGCCCACGGNONE 
Os01g0816700AK100654GCCCACGGSimilar to L-ascorbate oxidase homolog precursor (EC 1.10.3.3) (Ascorbase). 
Os01g0821800015-005-A04CCCGTGGGCTNONE 
AK073951CCCGTGGGCTNONE 
AK103171CCCGTGGGCTNONE 
AK119168CCCGTGGGCTEndothelial monocyte-activating polypeptide II precursor pro-EMAP II family protein. 
J023031A22CCCGTGGGCTNONE 
J033098N09CCCGTGGGCTNONE 
J033121G11CCCGTGGGCTNONE 
J090030L03CCCGTGGGCTNONE 
Os01g0870100AK067564GTGGCCCACGGGProtein of unknown function DUF1012 family protein. 
AK072312GTGGCCCACGGGNONE 
AK103428GTGGCCCACGGGNONE 
Os01g0900900009-066-B01CCACGGCCCACGGCCCACGGNONE 
009-137-A03CCACGGCCCACGGCCCACGGNONE 
AK120577CCACGGCCCACGGCCCACGGOvarian tumour, otubain domain containing protein. 
J023133N05CCACGGCCCACGGCCCACGGNONE 
Os01g0911700012-079-H01TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE 
012-088-G05TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE 
012-099-A01TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE 
015-009-H07TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE 
015-035-H12TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE 
016-054-G03TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE 
AK073805TGTGGGGCCCACGGGTCAGTGGGACGTGGCSimilar to Regulatory protein viviparous-1. 
AK105441TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE 
J033069I02TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE 
J033086K01TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE 
Os01g0934500AK073211CCGTGGGCCGTAConserved hypothetical protein. 
Os01g0939200AK110814CCGTGGGCConserved hypothetical protein. 
Os01g0960400AK111512CCCGTGGGCCGTGGProtein kinase-like domain containing protein. 
Os01g0963300AK067544CTGGCCCACGGCCCACTSimilar to Syntaxin 61 (AtSYP61) (Osmotic stess-sensitive mutant 1). 
Os02g0158400006-048-F06ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
AK061569ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCAssDNA-binding transcriptional regulator family protein. 
AK099479ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
AK104768ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J013025B22ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J023009C03ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J033115N14ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J065036F05ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J065191K17ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J065202K16ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075053E14ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075101E04ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075111C06ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075137O04ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075139E07ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075143K07ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075144K15ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075164L14ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075199D06ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J090010G24ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J090017C18ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J090066F01ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J090088G01ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
Os02g0169300006-023-D12CCGTGGGCCCACCACNONE 
006-062-B01CCGTGGGCCCACCACNONE 
015-049-F11CCGTGGGCCCACCACNONE 
015-057-G02CCGTGGGCCCACCACNONE 
015-092-F04CCGTGGGCCCACCACNONE 
015-095-H02CCGTGGGCCCACCACNONE 
015-097-B07CCGTGGGCCCACCACNONE 
AK070041CCGTGGGCCCACCACSimilar to Phosphoglycerate kinase, cytosolic (EC 2.7.2.3). 
J013042K07CCGTGGGCCCACCACNONE 
J013134H23CCGTGGGCCCACCACNONE 
J013134J23CCGTGGGCCCACCACNONE 
J023036N24CCGTGGGCCCACCACNONE 
J023049C06CCGTGGGCCCACCACNONE 
J023077E10CCGTGGGCCCACCACNONE 
J023077F10CCGTGGGCCCACCACNONE 
J023105N12CCGTGGGCCCACCACNONE 
J033036O12CCGTGGGCCCACCACNONE 
J033064P11CCGTGGGCCCACCACNONE 
J033079F01CCGTGGGCCCACCACNONE 
J033123M22CCGTGGGCCCACCACNONE 
J033143E10CCGTGGGCCCACCACNONE 
J075013D12CCGTGGGCCCACCACNONE 
Os02g0192700004-020-H12CCCGTGGGCCGGCNONE 
006-024-H06CCCGTGGGCCGGCNONE 
006-042-F06CCCGTGGGCCGGCNONE 
006-050-D04CCCGTGGGCCGGCNONE 
006-059-E10CCCGTGGGCCGGCNONE 
006-070-B02CCCGTGGGCCGGCNONE 
006-084-A09CCCGTGGGCCGGCNONE 
006-114-E11CCCGTGGGCCGGCNONE 
006-117-E05CCCGTGGGCCGGCNONE 
009-126-D11CCCGTGGGCCGGCNONE 
AK061629CCCGTGGGCCGGCSimilar to Thioredoxin peroxidase. 
AK065909CCCGTGGGCCGGCNONE 
J013043E11CCCGTGGGCCGGCNONE 
J065038I09CCCGTGGGCCGGCNONE 
J065078C12CCCGTGGGCCGGCNONE 
J065122O14CCCGTGGGCCGGCNONE 
J065198H04CCCGTGGGCCGGCNONE 
Os02g0200900J090088F16CCGTGGGCTTCNONE 
Os02g0219900004-018-E11CCGTGGGCCCCACCCCCCACACNONE 
AK060915CCGTGGGCCCCACCCCCCACACNONE 
AK099194CCGTGGGCCCCACCCCCCACACNONE 
AK104206CCGTGGGCCCCACCCCCCACACNONE 
AK104393CCGTGGGCCCCACCCCCCACACSimilar to Epstein-Barr nuclear antigen-1 (EBNA-1). 
J023109D07CCGTGGGCCCCACCCCCCACACNONE 
Os02g0251900AK109286CCGTGGGCCCCACASimilar to Tobacco rattle virus-induced protein variant 2. 
Os02g0439700AK067803CCGTGGGCGGGCCTGGPlant specific eukaryotic initiation factor 4B family protein. 
Os02g0478700AK099723AAGGCCCAGCCCACGGGRibosomal protein S27. 
J013089A06AAGGCCCAGCCCACGGGNONE 
J065068E01AAGGCCCAGCCCACGGGNONE 
J065217F15AAGGCCCAGCCCACGGGNONE 
Os02g0499300AK106994CTGGCCCACCAACCGTGGGCCACConserved hypothetical protein. 
Os02g0537500AK068689GGCCCGGCCCACGGGSimilar to E2F homolog. 
Os02g0555000015-020-G02CCGTGGGCCTCNONE 
015-020-G02TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
AK065270CCGTGGGCCTCNONE 
AK065270TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
AK121253CCGTGGGCCTCProtein of unknown function, ATP binding family protein. 
AK121253TGTGGGCTCTGGGCCGTGGGCCGTCProtein of unknown function, ATP binding family protein. 
J013002L01CCGTGGGCCTCNONE 
J013002L01TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
J023060A02CCGTGGGCCTCNONE 
J023060A02TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
J023101O11CCGTGGGCCTCNONE 
J023101O11TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
J023140A15CCGTGGGCCTCNONE 
J023140A15TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
J033042H19CCGTGGGCCTCNONE 
J033042H19TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
J033046C02CCGTGGGCCTCNONE 
J033046C02TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
J033080N19CCGTGGGCCTCNONE 
J033080N19TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
J065026I02CCGTGGGCCTCNONE 
J065026I02TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
J065040C18CCGTGGGCCTCNONE 
J065040C18TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
J090004I16CCGTGGGCCTCNONE 
J090004I16TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
Os02g0564100006-072-A11CCGTGGGCCACNONE 
AK073526CCGTGGGCCACSimilar to EL3 protein. 
AK105951CCGTGGGCCACNONE 
J100045C15CCGTGGGCCACNONE 
Os02g0578800009-044-A06CCGTGGGCCCCACANONE 
AK070066CCGTGGGCCCCACAProtein of unknown function DUF962 family protein. 
Os02g0593400016-051-C08CCCGGCCCACGGNONE 
AK064226CCCGGCCCACGGNONE 
AK072362CCCGGCCCACGGConserved hypothetical protein. 
AK109015CCCGGCCCACGGNONE 
J023063B12CCCGGCCCACGGNONE 
J065192M02CCCGGCCCACGGNONE 
J075182N05CCCGGCCCACGGNONE 
Os02g0602300AK065609CCGTGGGCCGTGNONE 
AK066929CCGTGGGCCGTGSimilar to Myelin transcription factor 1 (MYT1) (MYTI) (Proteolipid protein binding protein) (PLPB1). 
J013092L08CCGTGGGCCGTGNONE 
J090040I23CCGTGGGCCGTGNONE 
Os02g0603800AK105762GCCCACGGNONE 
AK120769GCCCACGGSimilar to Isoprenoid biosynthesis-like protein (Fragment). 
Os02g0610700014-008-A03GCCCACGGCCACACGNONE 
AK059205GCCCACGGCCACACGConserved hypothetical protein. 
AK100281GCCCACGGCCACACGNONE 
J023074H03GCCCACGGCCACACGNONE 
J065002J16GCCCACGGCCACACGNONE 
J065032I20GCCCACGGCCACACGNONE 
J065076A07GCCCACGGCCACACGNONE 
J065142O21GCCCACGGCCACACGNONE 
J065203A03GCCCACGGCCACACGNONE 
J075017F24GCCCACGGCCACACGNONE 
J075017G24GCCCACGGCCACACGNONE 
Os02g0616100006-043-E12GAAGCCCACGGNONE 
006-043-G11GAAGCCCACGGNONE 
006-053-C05GAAGCCCACGGNONE 
006-059-C04GAAGCCCACGGNONE 
006-068-F02GAAGCCCACGGNONE 
006-071-B10GAAGCCCACGGNONE 
006-084-A03GAAGCCCACGGNONE 
006-086-F07GAAGCCCACGGNONE 
006-105-B05GAAGCCCACGGNONE 
006-109-A06GAAGCCCACGGNONE 
009-105-B10GAAGCCCACGGNONE 
009-153-H09GAAGCCCACGGNONE 
AK060972GAAGCCCACGGConserved hypothetical protein. 
AK104643GAAGCCCACGGNONE 
J075074K09GAAGCCCACGGNONE 
Os02g0636300AK100670CCGTGGGCCGTGGDEAD/DEAH box helicase, N-terminal domain containing protein. 
J013149P11CCGTGGGCCGTGGNONE 
J023022F15CCGTGGGCCGTGGNONE 
J023112J15CCGTGGGCCGTGGNONE 
J023145M22CCGTGGGCCGTGGNONE 
J043017P16CCGTGGGCCGTGGNONE 
Os02g0694100J090034G11GCCCACGCCCACGGCyclin-like F-box domain containing protein. 
Os02g0731500J065098J18GCCACACGGCCCACGGAWPM-19-like family protein. 
J065123G07GCCACACGGCCCACGGNONE 
Os02g0744000AK064898AGCCCACGGGConserved hypothetical protein. 
AK104827AGCCCACGGGNONE 
J013000L12AGCCCACGGGNONE 
J013156N02AGCCCACGGGNONE 
J065001H14AGCCCACGGGNONE 
J065038D18AGCCCACGGGNONE 
J065039I18AGCCCACGGGNONE 
J065047C13AGCCCACGGGNONE 
J065053J09AGCCCACGGGNONE 
J065064G03AGCCCACGGGNONE 
J065066M05AGCCCACGGGNONE 
J065068O10AGCCCACGGGNONE 
J065090H22AGCCCACGGGNONE 
J065113L19AGCCCACGGGNONE 
J065121M02AGCCCACGGGNONE 
J065122K23AGCCCACGGGNONE 
J065138C12AGCCCACGGGNONE 
J065153E14AGCCCACGGGNONE 
J065156N12AGCCCACGGGNONE 
J065158L20AGCCCACGGGNONE 
J065166I06AGCCCACGGGNONE 
J065174L15AGCCCACGGGNONE 
J065175N03AGCCCACGGGNONE 
J090092C23AGCCCACGGGNONE 
Os02g0754500AK069965AGCCCATGACAAGCCCACGGNONE 
AK105696AGCCCATGACAAGCCCACGGAmidase family protein. 
Os02g0805900AK073740AGCCCACGGCCCACCTDcp2, box A domain containing protein. 
J013068E03AGCCCACGGCCCACCTNONE 
J033066K03AGCCCACGGCCCACCTNONE 
J033092C14AGCCCACGGCCCACCTNONE 
J065020G11AGCCCACGGCCCACCTNONE 
J065098E16AGCCCACGGCCCACCTNONE 
J065124L06AGCCCACGGCCCACCTNONE 
J065134M23AGCCCACGGCCCACCTNONE 
J065187M23AGCCCACGGCCCACCTNONE 
J065208G07AGCCCACGGCCCACCTNONE 
J075002G10AGCCCACGGCCCACCTNONE 
J075004L01AGCCCACGGCCCACCTNONE 
J075051K23AGCCCACGGCCCACCTNONE 
J090063C03AGCCCACGGCCCACCTNONE 
J090071J21AGCCCACGGCCCACCTNONE 
J100078K12AGCCCACGGCCCACCTNONE 
Os02g0806000AK072745AGGTGGGCCGTGGGCTGCN5-related N-acetyltransferase domain containing protein. 
J013130C06AGGTGGGCCGTGGGCTNONE 
J013154L12AGGTGGGCCGTGGGCTNONE 
J023135J07AGGTGGGCCGTGGGCTNONE 
J065038E23AGGTGGGCCGTGGGCTNONE 
J065042C10AGGTGGGCCGTGGGCTNONE 
J090075B11AGGTGGGCCGTGGGCTNONE 
J100033J17AGGTGGGCCGTGGGCTNONE 
Os03g0119100AK069519CCATGGGCCCACGGCCCATTSimilar to Phospholipase D beta 2. 
J023024E17CCATGGGCCCACGGCCCATTNONE 
J023122B02CCATGGGCCCACGGCCCATTNONE 
J090094E15CCATGGGCCCACGGCCCATTNONE 
Os03g0131300015-095-G06CCGTGGGCCCCCACNONE 
AK100656CCGTGGGCCCCCACUbiquitin domain containing protein. 
J033140O12CCGTGGGCCCCCACNONE 
J065112C14CCGTGGGCCCCCACNONE 
J090070D10CCGTGGGCCCCCACNONE 
Os03g0132800AK104997GCCCACGGCCNONE 
AK122069GCCCACGGCCSimilar to protein kinase-like protein [Oryza sativa (japonica cultivar-group)]. 
Os03g0167000AK107307CCCGTGGGCCGTGGConserved hypothetical protein. 
J100070K07CCCGTGGGCCGTGGNONE 
Os03g0169600004-013-C11CCGTGGGCCCCACCACNONE 
011-035-C04CCGTGGGCCCCACCACNONE 
AK060900CCGTGGGCCCCACCACNONE 
AK099490CCGTGGGCCCCACCACZinc finger, Dof-type family protein. 
AK104523CCGTGGGCCCCACCACNONE 
AY224429CCGTGGGCCCCACCACNONE 
J013026L11CCGTGGGCCCCACCACNONE 
J013026N04CCGTGGGCCCCACCACNONE 
J013030D16CCGTGGGCCCCACCACNONE 
J013049P17CCGTGGGCCCCACCACNONE 
J013099D17CCGTGGGCCCCACCACNONE 
J013114M09CCGTGGGCCCCACCACNONE 
J013124F12CCGTGGGCCCCACCACNONE 
J013131J05CCGTGGGCCCCACCACNONE 
J023025M09CCGTGGGCCCCACCACNONE 
J090042J08CCGTGGGCCCCACCACNONE 
J090094F11CCGTGGGCCCCACCACNONE 
J100051I17CCGTGGGCCCCACCACNONE 
Os03g0182800003-126-E06GCGGCCCACGGNONE 
AJ304840GCGGCCCACGGNONE 
AK073133GCGGCCCACGGNONE 
AY323478GCGGCCCACGGSimilar to Ethylene responsive element binding factor3 (OsERF3). 
J033023E13GCGGCCCACGGNONE 
J033028C22GCGGCCCACGGNONE 
J033042J03GCGGCCCACGGNONE 
J065022E13GCGGCCCACGGNONE 
J065208N24GCGGCCCACGGNONE 
J100034B17GCGGCCCACGGNONE 
J100035J21GCGGCCCACGGNONE 
J100039L16GCGGCCCACGGNONE 
J100040A02GCGGCCCACGGNONE 
J100051L11GCGGCCCACGGNONE 
J100064F07GCGGCCCACGGNONE 
J100070J12GCGGCCCACGGNONE 
Os03g0187700009-155-F05CCGTGGGCCGTCCGATCNONE 
J033140E21CCGTGGGCCGTCCGATCNONE 
J033142E21CCGTGGGCCGTCCGATCNONE 
J065014P17CCGTGGGCCGTCCGATCNONE 
J065083L20CCGTGGGCCGTCCGATCNONE 
J065092E08CCGTGGGCCGTCCGATCNONE 
J065154C08CCGTGGGCCGTCCGATCTarget SNARE coiled-coil region domain containing protein. 
J075142H08CCGTGGGCCGTCCGATCNONE 
J075175K21CCGTGGGCCGTCCGATCNONE 
J090070B20CCGTGGGCCGTCCGATCNONE 
J100071M06CCGTGGGCCGTCCGATCNONE 
Os03g0218400AK069202TCCGGCCCGTGGGCCGCSimilar to Hexose transporter. 
AK099306TCCGGCCCGTGGGCCGCNONE 
AY342321TCCGGCCCGTGGGCCGCNONE 
J023066K08TCCGGCCCGTGGGCCGCNONE 
J100032N19TCCGGCCCGTGGGCCGCNONE 
Os03g0219200011-045-E01CCCGTGGGCNONE 
AK073785CCCGTGGGCSimilar to Superoxide dismutase (EC 1.15.1.1). 
J033068D19CCCGTGGGCNONE 
J043009H23CCCGTGGGCNONE 
Os03g0260100AK066143GTGGCCCACGGCCCACCAConserved hypothetical protein. 
Os03g0277000AK100522GTGGCCCACGGSimilar to GDP dissociation inhibitor protein OsGDI1. 
Os03g0291800AK064880CCGTGGGCNONE 
Os03g0294200AK069285CCCGTGGGCCCCACASimilar to Fructose-6-phosphate-2-kinase/fructose-2, 6-bisphosphatase. 
Os03g0299900AK069075TCAGCCCACGGSimilar to Plastid aminotransferase (Fragment). 
AY338235TCAGCCCACGGNONE 
J053077F07TCAGCCCACGGNONE 
Os03g0309000AK070071GGCCGTGGGCCGTGVirulence factor, pectin lyase fold family protein. 
Os03g0321800006-065-G02GGCCGTGGGCCGAGANONE 
AK061075GGCCGTGGGCCGAGANONE 
AK111447GGCCGTGGGCCGAGASimilar to WRKY transcription factor 55. 
J065122E07GGCCGTGGGCCGAGANONE 
J065187N05GGCCGTGGGCCGAGANONE 
J065214K09GGCCGTGGGCCGAGANONE 
J090050M01GGCCGTGGGCCGAGANONE 
Os03g0326600AK107632TCTGGGCCGTGGGCCCTTGGTGGGCCAARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os03g0336200AK059473CCCGTGGGCNONE 
AK070466CCCGTGGGCTranscription factor RF2b. 
AY466471CCCGTGGGCNONE 
Os03g0340500012-007-F10TGTGGGGCCCACGGGTCAGTGGNONE 
AK099406TGTGGGGCCCACGGGTCAGTGGNONE 
AK102158TGTGGGGCCCACGGGTCAGTGGSimilar to Sucrose synthase (EC 2.4.1.13). 
J013030N13TGTGGGGCCCACGGGTCAGTGGNONE 
J013063E02TGTGGGGCCCACGGGTCAGTGGNONE 
J013063I02TGTGGGGCCCACGGGTCAGTGGNONE 
J013157O07TGTGGGGCCCACGGGTCAGTGGNONE 
J023131N05TGTGGGGCCCACGGGTCAGTGGNONE 
J033033P05TGTGGGGCCCACGGGTCAGTGGNONE 
J033040N16TGTGGGGCCCACGGGTCAGTGGNONE 
J033044M19TGTGGGGCCCACGGGTCAGTGGNONE 
J033086F24TGTGGGGCCCACGGGTCAGTGGNONE 
J033097H01TGTGGGGCCCACGGGTCAGTGGNONE 
J033106C22TGTGGGGCCCACGGGTCAGTGGNONE 
J033128M13TGTGGGGCCCACGGGTCAGTGGNONE 
J033133I15TGTGGGGCCCACGGGTCAGTGGNONE 
J043027A21TGTGGGGCCCACGGGTCAGTGGNONE 
J090028A09TGTGGGGCCCACGGGTCAGTGGNONE 
J090053D06TGTGGGGCCCACGGGTCAGTGGNONE 
J090083O17TGTGGGGCCCACGGGTCAGTGGNONE 
J090099H10TGTGGGGCCCACGGGTCAGTGGNONE 
J100036M05TGTGGGGCCCACGGGTCAGTGGNONE 
Os03g0342900006-032-D01CCCGTGGGCCCCACNONE 
006-033-E10CCCGTGGGCCCCACNONE 
006-051-G06CCCGTGGGCCCCACNONE 
006-053-E05CCCGTGGGCCCCACNONE 
006-056-B05CCCGTGGGCCCCACNONE 
006-058-F04CCCGTGGGCCCCACNONE 
006-059-E05CCCGTGGGCCCCACNONE 
006-060-F10CCCGTGGGCCCCACNONE 
006-104-D12CCCGTGGGCCCCACNONE 
009-129-C12CCCGTGGGCCCCACNONE 
AK060136CCCGTGGGCCCCACNONE 
AK060980CCCGTGGGCCCCACNONE 
AK064815CCCGTGGGCCCCACDormancyauxin associated family protein. 
AK104244CCCGTGGGCCCCACNONE 
AK104391CCCGTGGGCCCCACNONE 
AK104590CCCGTGGGCCCCACNONE 
AK104744CCCGTGGGCCCCACNONE 
AK106100CCCGTGGGCCCCACNONE 
J013000E10CCCGTGGGCCCCACNONE 
J075027O22CCCGTGGGCCCCACNONE 
J075052J03CCCGTGGGCCCCACNONE 
J075066E15CCCGTGGGCCCCACNONE 
J075095C17CCCGTGGGCCCCACNONE 
J075118N05CCCGTGGGCCCCACNONE 
J075187K22CCCGTGGGCCCCACNONE 
J090026L04CCCGTGGGCCCCACNONE 
J090059G16CCCGTGGGCCCCACNONE 
J100055P20CCCGTGGGCCCCACNONE 
J100062A10CCCGTGGGCCCCACNONE 
J100068G20CCCGTGGGCCCCACNONE 
Os03g0372900AK100417GAAGCCCACGGGCyclin-like F-box domain containing protein. 
Os03g0386000AK072984TGCGGCCCCCACCACCCGTGGGCCCACCTSimilar to WD domain protein-like. 
J065009K18TGCGGCCCCCACCACCCGTGGGCCCACCTNONE 
J065165P09TGCGGCCCCCACCACCCGTGGGCCCACCTNONE 
Os03g0405100AK108624CCGTGGGCCCAACCRpsU-divergently transcribed family protein. 
Os03g0438000AK119977GCAGCCCACGGConserved hypothetical protein. 
Os03g0574300AK072541CCAAGCCCACGGCCHypothetical protein. 
J023134M10CCAAGCCCACGGCCNONE 
Os03g0643300AK099445GCCCACGCCCACGCCCACGCCCACGGCCCACGGSimilar to AER123Wp. 
AK108010GCCCACGCCCACGCCCACGCCCACGGCCCACGGNONE 
Os03g0663800011-023-B06GCCCACGGCCNONE 
011-033-C06GCCCACGGCCNONE 
012-011-E03GCCCACGGCCNONE 
012-014-F04GCCCACGGCCNONE 
012-027-C01GCCCACGGCCNONE 
012-027-H07GCCCACGGCCNONE 
012-031-A02GCCCACGGCCNONE 
012-044-E05GCCCACGGCCNONE 
012-045-G10GCCCACGGCCNONE 
012-049-H02GCCCACGGCCNONE 
012-053-G08GCCCACGGCCNONE 
012-058-D07GCCCACGGCCNONE 
012-061-H02GCCCACGGCCNONE 
012-066-A02GCCCACGGCCNONE 
012-074-F12GCCCACGGCCNONE 
012-079-D08GCCCACGGCCNONE 
012-081-E05GCCCACGGCCNONE 
012-083-F04GCCCACGGCCNONE 
012-084-F08GCCCACGGCCNONE 
012-086-E08GCCCACGGCCNONE 
012-086-F01GCCCACGGCCNONE 
012-087-F03GCCCACGGCCNONE 
012-087-H02GCCCACGGCCNONE 
012-088-E05GCCCACGGCCNONE 
012-089-B02GCCCACGGCCNONE 
014-016-A04GCCCACGGCCNONE 
AK105347GCCCACGGCCNONE 
J075032I06GCCCACGGCCNONE 
J075041O22GCCCACGGCCNONE 
J075093E24GCCCACGGCCNONE 
J075094E06GCCCACGGCCNONE 
U45322GCCCACGGCCCupin region domain containing protein. 
Os03g0685700AK066043CCGTGGGCTGTProtein prenyltransferase domain containing protein. 
J013048F08CCGTGGGCTGTNONE 
Os03g0701700011-034-E06CCCGTGGGCCACNONE 
AF013979CCCGTGGGCCACNONE 
AK065161CCCGTGGGCCACSimilar to Ethylene receptor. 
AK067813CCCGTGGGCCACNONE 
J013002C04CCCGTGGGCCACNONE 
J013035M07CCCGTGGGCCACNONE 
J013049B10CCCGTGGGCCACNONE 
J013065F11CCCGTGGGCCACNONE 
J013072K18CCCGTGGGCCACNONE 
J013073P08CCCGTGGGCCACNONE 
J013098F08CCCGTGGGCCACNONE 
J013154M13CCCGTGGGCCACNONE 
J023001H02CCCGTGGGCCACNONE 
J023003D16CCCGTGGGCCACNONE 
J023014P17CCCGTGGGCCACNONE 
J023036A22CCCGTGGGCCACNONE 
J023038N01CCCGTGGGCCACNONE 
J023042E11CCCGTGGGCCACNONE 
J023058O05CCCGTGGGCCACNONE 
J023084D05CCCGTGGGCCACNONE 
J023088O17CCCGTGGGCCACNONE 
J023138O11CCCGTGGGCCACNONE 
J023147A10CCCGTGGGCCACNONE 
J033029G18CCCGTGGGCCACNONE 
J033031N13CCCGTGGGCCACNONE 
J033090D09CCCGTGGGCCACNONE 
J033091I06CCCGTGGGCCACNONE 
J033096B20CCCGTGGGCCACNONE 
J033101A19CCCGTGGGCCACNONE 
J033135D03CCCGTGGGCCACNONE 
J043001L13CCCGTGGGCCACNONE 
J043020A13CCCGTGGGCCACNONE 
J053071K24CCCGTGGGCCACNONE 
J053092L14CCCGTGGGCCACNONE 
J053099F19CCCGTGGGCCACNONE 
J065009P22CCCGTGGGCCACNONE 
J065046A22CCCGTGGGCCACNONE 
J065099K22CCCGTGGGCCACNONE 
J065112O22CCCGTGGGCCACNONE 
J065119K11CCCGTGGGCCACNONE 
J065212B11CCCGTGGGCCACNONE 
J090022A11CCCGTGGGCCACNONE 
J090054F15CCCGTGGGCCACNONE 
J090076B20CCCGTGGGCCACNONE 
J090099M22CCCGTGGGCCACNONE 
J100032L01CCCGTGGGCCACNONE 
J100065H13CCCGTGGGCCACNONE 
Os03g0748700AK067853CCGTGGGCIron hydrogenase domain containing protein. 
Os03g0748900006-088-H04GGCCGTGGGCNONE 
AK061165GGCCGTGGGCRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J065097I23GGCCGTGGGCNONE 
J100025O17GGCCGTGGGCNONE 
Os03g0756800009-100-H11CCGTGGGCCGGTGGGCCCGNONE 
AK120423CCGTGGGCCGGTGGGCCCGProtein of unknown function UPF0139 family protein. 
J013095D02CCGTGGGCCGGTGGGCCCGNONE 
J023091G12CCGTGGGCCGGTGGGCCCGNONE 
J065207J17CCGTGGGCCGGTGGGCCCGNONE 
J100067G13CCGTGGGCCGGTGGGCCCGNONE 
J100089L11CCGTGGGCCGGTGGGCCCGNONE 
Os03g0758700AK106620TGCGGCCCACGGWD40-like domain containing protein. 
Os03g0774600AK066871CAGGCCCACGGHypothetical protein. 
J053033J17CAGGCCCACGGNONE 
Os03g0780600AK120180CCCGTGGGCCCCACGTNONE 
D13224CCCGTGGGCCCCACGTTubulin beta-1 chain (Beta-1 tubulin). 
J013033M18CCCGTGGGCCCCACGTNONE 
J033022G05CCCGTGGGCCCCACGTNONE 
J033028A16CCCGTGGGCCCCACGTNONE 
J033050M08CCCGTGGGCCCCACGTNONE 
J090053F04CCCGTGGGCCCCACGTNONE 
J090064E19CCCGTGGGCCCCACGTNONE 
J090083J24CCCGTGGGCCCCACGTNONE 
J100024I23CCCGTGGGCCCCACGTNONE 
Os03g0803500AK059759GCCCACGGSimilar to Prolyl 4-hydroxylase alpha-1 subunit-like protein. 
J065094L11GCCCACGGNONE 
J065123P07GCCCACGGNONE 
J065162G09GCCCACGGNONE 
J065163N13GCCCACGGNONE 
J065212F04GCCCACGGNONE 
J065214A05GCCCACGGNONE 
Os03g0832200AK070712CCCGTGGGCCAGSimilar to Calcium-binding protein precursor (Calreticulin). 
AK070712GGCCGTGGGCCATSimilar to Calcium-binding protein precursor (Calreticulin). 
Os03g0854800J090007D13GCCGGCCCACGGGNONE 
J090085N22GCCGGCCCACGGGNONE 
Os04g0122000AK065510CCGTGGGCCGCACGTGGGCTTTTLeucine rich repeat, N-terminal domain containing protein. 
AK072577CCGTGGGCCGCACGTGGGCTTTTNONE 
AK099773CCGTGGGCCGCACGTGGGCTTTTNONE 
J013030L03CCGTGGGCCGCACGTGGGCTTTTNONE 
J013042D23CCGTGGGCCGCACGTGGGCTTTTNONE 
J013050E17CCGTGGGCCGCACGTGGGCTTTTNONE 
J013051J21CCGTGGGCCGCACGTGGGCTTTTNONE 
J013055L09CCGTGGGCCGCACGTGGGCTTTTNONE 
J013064A03CCGTGGGCCGCACGTGGGCTTTTNONE 
J013095E06CCGTGGGCCGCACGTGGGCTTTTNONE 
J013111A06CCGTGGGCCGCACGTGGGCTTTTNONE 
J013118K01CCGTGGGCCGCACGTGGGCTTTTNONE 
J013119A03CCGTGGGCCGCACGTGGGCTTTTNONE 
J013134F07CCGTGGGCCGCACGTGGGCTTTTNONE 
J033132N23CCGTGGGCCGCACGTGGGCTTTTNONE 
Os04g0126800AK107895CCCGGGCCCACGGGHypothetical protein. 
Os04g0274700J043039I02GCCCACGGConserved hypothetical protein. 
Os04g0504600J065162K24CCGTGGGCCTTNONE 
Os04g0531100013-046-D02CACGGCCCACGGNONE 
AF090698CACGGCCCACGGNONE 
AK063584CACGGCCCACGGC2 calcium/lipid-binding region, CaLB domain containing protein. 
J065025M20CACGGCCCACGGNONE 
J065028L15CACGGCCCACGGNONE 
J065048O03CACGGCCCACGGNONE 
J065053K10CACGGCCCACGGNONE 
J065072H10CACGGCCCACGGNONE 
J065081H10CACGGCCCACGGNONE 
J065082N17CACGGCCCACGGNONE 
J065104K08CACGGCCCACGGNONE 
J065106M03CACGGCCCACGGNONE 
J065119I05CACGGCCCACGGNONE 
J065122F04CACGGCCCACGGNONE 
J065140N24CACGGCCCACGGNONE 
J065153G09CACGGCCCACGGNONE 
J065171H07CACGGCCCACGGNONE 
J065172M23CACGGCCCACGGNONE 
J065173K13CACGGCCCACGGNONE 
J065177D22CACGGCCCACGGNONE 
J065189H10CACGGCCCACGGNONE 
J065198H24CACGGCCCACGGNONE 
J065204D19CACGGCCCACGGNONE 
J075006C08CACGGCCCACGGNONE 
J075029I08CACGGCCCACGGNONE 
J075039A16CACGGCCCACGGNONE 
J075107I24CACGGCCCACGGNONE 
J075135M22CACGGCCCACGGNONE 
J075181P06CACGGCCCACGGNONE 
J075190O11CACGGCCCACGGNONE 
J075193F04CACGGCCCACGGNONE 
Os04g0562000006-096-A05GCAGCCCACGGGNONE 
006-105-B08GCAGCCCACGGGNONE 
AK060894GCAGCCCACGGGNONE 
AK072630GCAGCCCACGGGZinc finger, DHHC-type domain containing protein. 
AK104521GCAGCCCACGGGNONE 
J023038A11GCAGCCCACGGGNONE 
J023130P03GCAGCCCACGGGNONE 
J090006F10GCAGCCCACGGGNONE 
J090007M22GCAGCCCACGGGNONE 
Os04g0595000AK106907TTTTGGGCCGTGGGCTPeptidase A1, pepsin family protein. 
Os04g0601800AK062641GCCCACGGSimilar to Plastid protein. 
Os04g0652900AK071125GTGGGGCCCACGGPeptidyl-tRNA hydrolase, PTH2 domain containing protein. 
J023082K03GTGGGGCCCACGGNONE 
J075142E01GTGGGGCCCACGGNONE 
Os04g0658600AK064729CCACGGCCCACGGNONE 
AK119253CCACGGCCCACGGNucleolar, Nop52 family protein. 
J075132J07CCACGGCCCACGGNONE 
J075157N21CCACGGCCCACGGNONE 
Os04g0670800AK073170GAGGCCCACGGNONE 
Os04g0675400AK068186CCGTGGGCCGTGSimilar to Chaperone protein dnaJ. 
J013029J20CCGTGGGCCGTGNONE 
J013072I16CCGTGGGCCGTGNONE 
J013134H18CCGTGGGCCGTGNONE 
J013159H06CCGTGGGCCGTGNONE 
Os04g0679800AK060662CCGTGGGCCCCACGSimilar to RNA-binding protein-like protein. 
AK099987CCGTGGGCCCCACGNONE 
J013130B11CCGTGGGCCCCACGNONE 
J065049C17CCGTGGGCCCCACGNONE 
J075191N12CCGTGGGCCCCACGNONE 
J075191P12CCGTGGGCCCCACGNONE 
J100031C07CCGTGGGCCCCACGNONE 
Os04g0685100AK065262CCGTGGGCCGTCRibosomal biogenesis regulatory protein family protein. 
J013002J24CCGTGGGCCGTCNONE 
J013030M11CCGTGGGCCGTCNONE 
J033139J12CCGTGGGCCGTCNONE 
J065013D12CCGTGGGCCGTCNONE 
J065117J01CCGTGGGCCGTCNONE 
J065143K20CCGTGGGCCGTCNONE 
J065181E12CCGTGGGCCGTCNONE 
J065184A17CCGTGGGCCGTCNONE 
J065193B13CCGTGGGCCGTCNONE 
J065196H01CCGTGGGCCGTCNONE 
J075072G17CCGTGGGCCGTCNONE 
J075077B02CCGTGGGCCGTCNONE 
J075088A06CCGTGGGCCGTCNONE 
J075099H13CCGTGGGCCGTCNONE 
J075111O04CCGTGGGCCGTCNONE 
J075131F20CCGTGGGCCGTCNONE 
J075139K01CCGTGGGCCGTCNONE 
J075194I16CCGTGGGCCGTCNONE 
Os05g0121400AK099528GCCCACGGGNONE 
Os05g0145100AK107957CCGTGGGCCATCCCCCConserved hypothetical protein. 
Os05g0155100006-075-B02CCGTGGGCCGGANONE 
AK061929CCGTGGGCCGGANONE 
AK102810CCGTGGGCCGGANONE 
AK120877CCGTGGGCCGGASimilar to 60S ribosomal protein L18. 
J013023E03CCGTGGGCCGGANONE 
J013038C16CCGTGGGCCGGANONE 
J013120M14CCGTGGGCCGGANONE 
J013153B04CCGTGGGCCGGANONE 
J013159B07CCGTGGGCCGGANONE 
J023012A02CCGTGGGCCGGANONE 
J023027F08CCGTGGGCCGGANONE 
J023027I12CCGTGGGCCGGANONE 
J023120F05CCGTGGGCCGGANONE 
J023138O03CCGTGGGCCGGANONE 
J023142H13CCGTGGGCCGGANONE 
J023143P06CCGTGGGCCGGANONE 
J033023P09CCGTGGGCCGGANONE 
J033035O14CCGTGGGCCGGANONE 
J033042N19CCGTGGGCCGGANONE 
J033043B12CCGTGGGCCGGANONE 
J033065D10CCGTGGGCCGGANONE 
J033081A12CCGTGGGCCGGANONE 
J033084N05CCGTGGGCCGGANONE 
J033085M03CCGTGGGCCGGANONE 
J033112D15CCGTGGGCCGGANONE 
J033114O07CCGTGGGCCGGANONE 
J033119D15CCGTGGGCCGGANONE 
J033140E06CCGTGGGCCGGANONE 
J033141K23CCGTGGGCCGGANONE 
J043040I22CCGTGGGCCGGANONE 
J053050B21CCGTGGGCCGGANONE 
J053065I18CCGTGGGCCGGANONE 
J053074O16CCGTGGGCCGGANONE 
J065072K13CCGTGGGCCGGANONE 
J065211I09CCGTGGGCCGGANONE 
J090004K04CCGTGGGCCGGANONE 
J090016L06CCGTGGGCCGGANONE 
J090040F22CCGTGGGCCGGANONE 
J090063F22CCGTGGGCCGGANONE 
J090081J09CCGTGGGCCGGANONE 
J100032A10CCGTGGGCCGGANONE 
J100037G20CCGTGGGCCGGANONE 
J100056O10CCGTGGGCCGGANONE 
J100071D10CCGTGGGCCGGANONE 
J100075K13CCGTGGGCCGGANONE 
J100079F16CCGTGGGCCGGANONE 
J100080O16CCGTGGGCCGGANONE 
J100086N05CCGTGGGCCGGANONE 
Os05g0187100012-066-F01CCCGTGGGCNONE 
AK067988CCCGTGGGCSimilar to Hexokinase. 
Os05g0247800AK073843GCCCACGGGlycoside hydrolase, family 18 protein. 
J033068H05GCCCACGGNONE 
Os05g0344200006-022-E04CCGTGGGCCTCNONE 
006-080-D01CCGTGGGCCTCNONE 
009-021-D03CCGTGGGCCTCNONE 
009-026-A10CCGTGGGCCTCNONE 
009-054-B12CCGTGGGCCTCNONE 
009-059-H03CCGTGGGCCTCNONE 
009-077-C02CCGTGGGCCTCNONE 
009-095-H12CCGTGGGCCTCNONE 
009-106-B08CCGTGGGCCTCNONE 
009-138-D10CCGTGGGCCTCNONE 
009-140-G06CCGTGGGCCTCNONE 
009-146-E09CCGTGGGCCTCNONE 
009-161-F04CCGTGGGCCTCNONE 
009-176-F05CCGTGGGCCTCNONE 
013-047-C03CCGTGGGCCTCNONE 
013-052-E07CCGTGGGCCTCNONE 
013-054-G04CCGTGGGCCTCNONE 
013-095-D10CCGTGGGCCTCNONE 
014-003-D06CCGTGGGCCTCNONE 
014-020-C09CCGTGGGCCTCNONE 
014-043-E01CCGTGGGCCTCNONE 
014-080-G09CCGTGGGCCTCNONE 
014-081-H05CCGTGGGCCTCNONE 
AK060058CCGTGGGCCTCConserved hypothetical protein. 
AK098850CCGTGGGCCTCNONE 
AK104716CCGTGGGCCTCNONE 
AK119727CCGTGGGCCTCNONE 
J013000G04CCGTGGGCCTCNONE 
J013155L11CCGTGGGCCTCNONE 
J033138J22CCGTGGGCCTCNONE 
J065112E22CCGTGGGCCTCNONE 
J065124M06CCGTGGGCCTCNONE 
J065130M01CCGTGGGCCTCNONE 
J065137I03CCGTGGGCCTCNONE 
J065157O12CCGTGGGCCTCNONE 
J065171B12CCGTGGGCCTCNONE 
J075003O16CCGTGGGCCTCNONE 
J075026G12CCGTGGGCCTCNONE 
J075032K07CCGTGGGCCTCNONE 
J075070I11CCGTGGGCCTCNONE 
J075093K06CCGTGGGCCTCNONE 
J075148C12CCGTGGGCCTCNONE 
J075148L08CCGTGGGCCTCNONE 
J075152G13CCGTGGGCCTCNONE 
J075177G07CCGTGGGCCTCNONE 
J100026I09CCGTGGGCCTCNONE 
J100083L11CCGTGGGCCTCNONE 
J100086F04CCGTGGGCCTCNONE 
Os05g0358000006-083-G07CCCGTGGGCCCCACCNONE 
AK061141CCCGTGGGCCCCACCNONE 
AK070900CCCGTGGGCCCCACCNONE 
AK101263CCCGTGGGCCCCACCDrought induced 19 family protein. 
J023098C13CCCGTGGGCCCCACCNONE 
J033032J06CCCGTGGGCCCCACCNONE 
J065014A09CCCGTGGGCCCCACCNONE 
J065121L01CCCGTGGGCCCCACCNONE 
J065130K19CCCGTGGGCCCCACCNONE 
J065208B21CCCGTGGGCCCCACCNONE 
J075080G14CCCGTGGGCCCCACCNONE 
J075135L01CCCGTGGGCCCCACCNONE 
J075180J15CCCGTGGGCCCCACCNONE 
Os05g0397300009-051-E02GGGGCCCACGGCCNONE 
009-060-E03GGGGCCCACGGCCNONE 
009-075-B01GGGGCCCACGGCCNONE 
009-082-B11GGGGCCCACGGCCNONE 
009-136-D05GGGGCCCACGGCCNONE 
AK062621GGGGCCCACGGCCNONE 
AK066003GGGGCCCACGGCCNONE 
AK070832GGGGCCCACGGCCConserved hypothetical protein. 
J023066C05GGGGCCCACGGCCNONE 
Os05g0401300009-111-H03CCGTGGGCCGTGGGCCGTGNONE 
AK060678CCGTGGGCCGTGGGCCGTGTwin-arginine translocation pathway signal domain containing protein. 
Os05g0411300014-098-D05CCGTGGGCCCGNONE 
015-093-F04CCGTGGGCCCGNONE 
AK071931CCGTGGGCCCGConserved hypothetical protein. 
AK073142CCGTGGGCCCGNONE 
Os05g0445500009-021-C05TCCGGCCCATGGGCCGTGGGCCTCNONE 
009-129-D11TCCGGCCCATGGGCCGTGGGCCTCNONE 
009-147-E04TCCGGCCCATGGGCCGTGGGCCTCNONE 
009-169-C11TCCGGCCCATGGGCCGTGGGCCTCNONE 
AK121459TCCGGCCCATGGGCCGTGGGCCTCSimilar to 60S acidic ribosomal protein P2B. 
D21114TCCGGCCCATGGGCCGTGGGCCTCNONE 
J023001K23TCCGGCCCATGGGCCGTGGGCCTCNONE 
J023107J19TCCGGCCCATGGGCCGTGGGCCTCNONE 
J023143J09TCCGGCCCATGGGCCGTGGGCCTCNONE 
J065049D04TCCGGCCCATGGGCCGTGGGCCTCNONE 
J065092I06TCCGGCCCATGGGCCGTGGGCCTCNONE 
J065188H04TCCGGCCCATGGGCCGTGGGCCTCNONE 
Os05g0463400AK100354CCGTGGGCCCCACAPWWP domain containing protein. 
J013022B18CCGTGGGCCCCACANONE 
J023083G23CCGTGGGCCCCACANONE 
Os05g0468700AB051864CCCGTGGGCCATAmmonium transporter. 
AK065288CCCGTGGGCCATNONE 
J013002M22CCCGTGGGCCATNONE 
Os05g0490800J065037L19CCAGCCCACGGCCCGGCCCACCTNONE 
Os05g0500500AK110627GCGGCCCACGGHSP20-like chaperone domain containing protein. 
Os05g0535200AK070696TCTCGGCCCACGGCGTGGACyclin-like F-box domain containing protein. 
J023057L12TCTCGGCCCACGGCGTGGANONE 
Os05g0537200AK121713GGCCGTGGGCCGTGGSimilar to Myosin XI (Fragment). 
Os05g0541900009-130-F05AACTGGGCTGGGCCTCCGTGGGCCGCNONE 
009-200-E07AACTGGGCTGGGCCTCCGTGGGCCGCNONE 
013-057-G09AACTGGGCTGGGCCTCCGTGGGCCGCNONE 
Os05g0542900AK102925GTGGCCCACGGCCCACGGCCCACGTGTVirulence factor, pectin lyase fold family protein. 
Os05g0555300009-032-C03CGCGTGCGCTGGCCCACGGNONE 
009-125-E08CGCGTGCGCTGGCCCACGGNONE 
009-149-C12CGCGTGCGCTGGCCCACGGNONE 
009-172-C01CGCGTGCGCTGGCCCACGGNONE 
AK062890CGCGTGCGCTGGCCCACGGFerredoxin domain containing protein. 
AK062997CGCGTGCGCTGGCCCACGGNONE 
Os05g0565000AK102673GAAGCCCACGGCCCATTASimilar to 60S ribosomal protein L18a-1. 
J033102C12GAAGCCCACGGCCCATTANONE 
J033124C13GAAGCCCACGGCCCATTANONE 
J043003L04GAAGCCCACGGCCCATTANONE 
J043006N08GAAGCCCACGGCCCATTANONE 
Os05g0576600AK107732CCGTGGGCConserved hypothetical protein. 
Os06g0122200AK109712CCCGTGGGCCGAACGGCCCATGTConserved hypothetical protein. 
Os06g0210500AK066979GGACGGCTGGGCCGTGGGCCCCCGTGGGCTGCCGTGGGCCTTSimilar to Mitochondrial phosphate transporter. 
Os06g0219600AK060429CAACGGCCCACAGCCCACGGSimilar to Poly(A)-binding protein II-like. 
AK099019CAACGGCCCACAGCCCACGGNONE 
J013118A14CAACGGCCCACAGCCCACGGNONE 
Os06g0298500AK108252TAGGCCCACGGConserved hypothetical protein. 
J065144C04TAGGCCCACGGNONE 
J075054P09TAGGCCCACGGNONE 
J075165A13TAGGCCCACGGNONE 
J075172E10TAGGCCCACGGNONE 
Os06g0337100006-100-G05CTGGCCCACGGGTCAGTGGNONE 
AK061222CTGGCCCACGGGTCAGTGGConserved hypothetical protein. 
Os06g0559400014-010-E06GCCCACGGNONE 
014-100-E08GCCCACGGNONE 
AK068350GCCCACGGConserved hypothetical protein. 
AK068719GCCCACGGNONE 
J090056B03GCCCACGGNONE 
Os06g0567000009-166-G12ATCCAACGGCCCACGGGNONE 
AK121337ATCCAACGGCCCACGGGProtein of unknown function UPF0197 family protein. 
J013122F01ATCCAACGGCCCACGGGNONE 
J023080N12ATCCAACGGCCCACGGGNONE 
J023120F03ATCCAACGGCCCACGGGNONE 
J065013B18ATCCAACGGCCCACGGGNONE 
J065039P21ATCCAACGGCCCACGGGNONE 
J065089E06ATCCAACGGCCCACGGGNONE 
J065095N19ATCCAACGGCCCACGGGNONE 
J065119H03ATCCAACGGCCCACGGGNONE 
J065121D18ATCCAACGGCCCACGGGNONE 
J065149G04ATCCAACGGCCCACGGGNONE 
J075012J04ATCCAACGGCCCACGGGNONE 
J075021G13ATCCAACGGCCCACGGGNONE 
J075106I23ATCCAACGGCCCACGGGNONE 
J075107F19ATCCAACGGCCCACGGGNONE 
J075152J22ATCCAACGGCCCACGGGNONE 
J075186J20ATCCAACGGCCCACGGGNONE 
J075188F16ATCCAACGGCCCACGGGNONE 
J080001G06ATCCAACGGCCCACGGGNONE 
J080002O09ATCCAACGGCCCACGGGNONE 
J080006E10ATCCAACGGCCCACGGGNONE 
J080006F24ATCCAACGGCCCACGGGNONE 
J080012L07ATCCAACGGCCCACGGGNONE 
J080016A10ATCCAACGGCCCACGGGNONE 
J080017D11ATCCAACGGCCCACGGGNONE 
J080017I04ATCCAACGGCCCACGGGNONE 
J080017I10ATCCAACGGCCCACGGGNONE 
J080020P06ATCCAACGGCCCACGGGNONE 
J080024A20ATCCAACGGCCCACGGGNONE 
J080027B10ATCCAACGGCCCACGGGNONE 
J080027E03ATCCAACGGCCCACGGGNONE 
J080027I01ATCCAACGGCCCACGGGNONE 
J080027K20ATCCAACGGCCCACGGGNONE 
J080041L12ATCCAACGGCCCACGGGNONE 
J080043D21ATCCAACGGCCCACGGGNONE 
J080044K11ATCCAACGGCCCACGGGNONE 
J080048I08ATCCAACGGCCCACGGGNONE 
J080049M12ATCCAACGGCCCACGGGNONE 
J080050C14ATCCAACGGCCCACGGGNONE 
J080050N21ATCCAACGGCCCACGGGNONE 
J080053F04ATCCAACGGCCCACGGGNONE 
J080054O16ATCCAACGGCCCACGGGNONE 
J080058O21ATCCAACGGCCCACGGGNONE 
J080059M11ATCCAACGGCCCACGGGNONE 
J080061A11ATCCAACGGCCCACGGGNONE 
J080063B15ATCCAACGGCCCACGGGNONE 
J080063F22ATCCAACGGCCCACGGGNONE 
J080066M18ATCCAACGGCCCACGGGNONE 
J080068D12ATCCAACGGCCCACGGGNONE 
J080070D22ATCCAACGGCCCACGGGNONE 
J080071B06ATCCAACGGCCCACGGGNONE 
J080072B17ATCCAACGGCCCACGGGNONE 
J080081O04ATCCAACGGCCCACGGGNONE 
J080089H05ATCCAACGGCCCACGGGNONE 
J080093K13ATCCAACGGCCCACGGGNONE 
J080095I05ATCCAACGGCCCACGGGNONE 
J080097F19ATCCAACGGCCCACGGGNONE 
J080304C03ATCCAACGGCCCACGGGNONE 
J080304H11ATCCAACGGCCCACGGGNONE 
J080308M21ATCCAACGGCCCACGGGNONE 
J080313O15ATCCAACGGCCCACGGGNONE 
J090020N23ATCCAACGGCCCACGGGNONE 
J100023C12ATCCAACGGCCCACGGGNONE 
Os06g0585200016-065-C02AACGGCCCGTGGGCCGCANONE 
AK068592AACGGCCCGTGGGCCGCANONE 
AK073844AACGGCCCGTGGGCCGCANONE 
AK106549AACGGCCCGTGGGCCGCAConserved hypothetical protein. 
J013154A14AACGGCCCGTGGGCCGCANONE 
J100049K24AACGGCCCGTGGGCCGCANONE 
J100059C18AACGGCCCGTGGGCCGCANONE 
J100082N13AACGGCCCGTGGGCCGCANONE 
Os06g0589500AK073322CACTGACACGTGGGCCCACGGConserved hypothetical protein. 
AK073322CCCGTGGGCCCCConserved hypothetical protein. 
J033030G15CACTGACACGTGGGCCCACGGNONE 
J033030G15CCCGTGGGCCCCNONE 
J033148N18CACTGACACGTGGGCCCACGGNONE 
J033148N18CCCGTGGGCCCCNONE 
Os06g0627500AK101725CCGTGGGCLeucine-rich repeat, plant specific containing protein. 
Os06g0648500AK106895CGGGTGGGGCCCACGGConserved hypothetical protein. 
Os06g0682300009-098-E01GTGGCCCACGGNONE 
009-134-F09GTGGCCCACGGNONE 
009-137-E02GTGGCCCACGGNONE 
009-198-E05GTGGCCCACGGNONE 
AK062934GTGGCCCACGGHypothetical protein. 
J075053E04GTGGCCCACGGNONE 
Os07g0100200006-022-D06AAAGCCCACGGNONE 
011-025-B06AAAGCCCACGGNONE 
012-069-A07AAAGCCCACGGNONE 
AK060986AAAGCCCACGGNONE 
AK073305AAAGCCCACGGSimilar to PDX1-like protein 4. 
J023055C05AAAGCCCACGGNONE 
J033024J11AAAGCCCACGGNONE 
J065045F14AAAGCCCACGGNONE 
J075097C22AAAGCCCACGGNONE 
Os07g0105300AK107419GCCGGCCCACGGGConserved hypothetical protein. 
AK109521GCCGGCCCACGGGNONE 
Os07g0166800006-038-C11CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
012-080-F02CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
AK070524CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCRad6 (Ubiquitin carrier protein). 
AK121382CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J023022D19CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J023055G02CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J023073E02CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J023125B08CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J023127H21CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J033052G01CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J033067F13CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J065046L14CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J065178D11CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J065205N17CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J075006K17CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J075051D20CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J075109L04CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J090024K15CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J090025N04CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J090049N09CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J090070N12CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J090078O21CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J090083L07CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J100063K16CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J100083D14CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
Os07g0181500AK072431GCCCACGGProtein of unknown function DUF506, plant family protein. 
Os07g0184800AK059544CCCGTGGGCSimilar to Variant of histone H1. 
AK099050CCCGTGGGCNONE 
AK102642CCCGTGGGCNONE 
AK106132CCCGTGGGCNONE 
J023037O08CCCGTGGGCNONE 
J023050M02CCCGTGGGCNONE 
J023087A10CCCGTGGGCNONE 
J033027D14CCCGTGGGCNONE 
J033028N17CCCGTGGGCNONE 
J033043P10CCCGTGGGCNONE 
J033051D07CCCGTGGGCNONE 
J033073M07CCCGTGGGCNONE 
J033075H01CCCGTGGGCNONE 
J033084E04CCCGTGGGCNONE 
J033096D10CCCGTGGGCNONE 
J033100F04CCCGTGGGCNONE 
J033114B06CCCGTGGGCNONE 
J033117C10CCCGTGGGCNONE 
J033140B21CCCGTGGGCNONE 
J043034J07CCCGTGGGCNONE 
J065006F04CCCGTGGGCNONE 
J065130H16CCCGTGGGCNONE 
J075020G13CCCGTGGGCNONE 
J075108M17CCCGTGGGCNONE 
J080018A06CCCGTGGGCNONE 
J080037J11CCCGTGGGCNONE 
J080048F15CCCGTGGGCNONE 
J080057D16CCCGTGGGCNONE 
J080069A10CCCGTGGGCNONE 
J080086L09CCCGTGGGCNONE 
J080088A17CCCGTGGGCNONE 
J100046F24CCCGTGGGCNONE 
Os07g0184900AK102066TCGGCCCGTGGGCCGTGTTGGGCCGAGGCCCACGTGGGAGTGGGAAGGCCCACGCACCGCSimilar to Ku70-like protein. 
Os07g0185700012-040-A11AGGGCCCACGGGCCCATCGNONE 
AK070572AGGGCCCACGGGCCCATCGConserved hypothetical protein. 
J065116D10AGGGCCCACGGGCCCATCGNONE 
J065122F20AGGGCCCACGGGCCCATCGNONE 
Os07g0187300AK103069CCCGTGGGCCGGARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J013042I12CCCGTGGGCCGGANONE 
J033117P16CCCGTGGGCCGGANONE 
Os07g0194500AK121816CCGTGGGCTProlyl 4-hydroxylase, alpha subunit domain containing protein. 
J033098K22CCGTGGGCTNONE 
Os07g0209700AK070654GCCCACGGProtein of unknown function DUF1677, Oryza sativa family protein. 
Os07g0213400003-104-B01CCGTGGGCCAGNONE 
AK062273CCGTGGGCCAGConserved hypothetical protein. 
J065122P17CCGTGGGCCAGNONE 
J065160A01CCGTGGGCCAGNONE 
J090065M11CCGTGGGCCAGNONE 
Os07g0223100006-044-G07GAGGCCCACGGNONE 
006-071-E10GAGGCCCACGGNONE 
006-077-A04GAGGCCCACGGNONE 
009-162-H05GAGGCCCACGGNONE 
J023050M10GAGGCCCACGGNONE 
J023055F05GAGGCCCACGGNONE 
J023060I11GAGGCCCACGGNONE 
J023101M01GAGGCCCACGGNONE 
J065059J21GAGGCCCACGGNONE 
J065087I18GAGGCCCACGGNONE 
J065113L17GAGGCCCACGGNONE 
J065123E19GAGGCCCACGGNONE 
J065137O04GAGGCCCACGGNONE 
J065217M03GAGGCCCACGGNONE 
J090012O14GAGGCCCACGGNONE 
J090014C13GAGGCCCACGGNONE 
J090060C24GAGGCCCACGGNONE 
J100037H14GAGGCCCACGGNONE 
J100060E10GAGGCCCACGGNONE 
J100067L04GAGGCCCACGGNONE 
J100075G09GAGGCCCACGGNONE 
J100077C15GAGGCCCACGGNONE 
Os07g0274700J065002G18CCCGTGGGCCCCCACCCGCGCNONE 
J065092L19CCCGTGGGCCCCCACCCGCGCNONE 
J065099K11CCCGTGGGCCCCCACCCGCGCNONE 
J065103L08CCCGTGGGCCCCCACCCGCGCNONE 
J065185I19CCCGTGGGCCCCCACCCGCGCNONE 
J075004L22CCCGTGGGCCCCCACCCGCGCNONE 
J075007G03CCCGTGGGCCCCCACCCGCGCNONE 
J075020E09CCCGTGGGCCCCCACCCGCGCNONE 
J075046B02CCCGTGGGCCCCCACCCGCGCNONE 
J075070D08CCCGTGGGCCCCCACCCGCGCNONE 
J075118L24CCCGTGGGCCCCCACCCGCGCNONE 
J075140C15CCCGTGGGCCCCCACCCGCGCNONE 
J075157A21CCCGTGGGCCCCCACCCGCGCNONE 
J075165J01CCCGTGGGCCCCCACCCGCGCNONE 
J075172J18CCCGTGGGCCCCCACCCGCGCNONE 
J075177P10CCCGTGGGCCCCCACCCGCGCNONE 
J100042D15CCCGTGGGCCCCCACCCGCGCNONE 
J100053M21CCCGTGGGCCCCCACCCGCGCNONE 
J100067M12CCCGTGGGCCCCCACCCGCGCNONE 
Os07g0422100013-054-G11GCCCACGGGNONE 
AK063592GCCCACGGGNONE 
J065165K10GCCCACGGGNONE 
J075021B01GCCCACGGGNONE 
J075087H22GCCCACGGGNONE 
J075118C10GCCCACGGGNONE 
J075134N03GCCCACGGGNONE 
J075151F23GCCCACGGGNONE 
U57639GCCCACGGGAWPM-19-like family protein. 
Os07g0456700AK100891GCCCACGGGSimilar to (1,4)-beta-xylan endohydrolase (EC 3.2.1.8). 
Os07g0472300AK070792CCGTGGGCTGAConserved hypothetical protein. 
J023007O06CCGTGGGCTGANONE 
J023041I11CCGTGGGCTGANONE 
J023065F23CCGTGGGCTGANONE 
Os07g0574800006-097-G09CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
013-077-E02CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
014-010-B04CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
AK067721CCAGCCCAGCCCAGCCCACGGGCCGTGGTubulin alpha-1 chain. 
AK069140CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
AK104900CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J013037J23CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J013045O05CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J013056A21CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J013119N24CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J023036H19CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J023036K16CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J023067J23CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J023075H08CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J023084K13CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J023097O10CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J033093K22CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J033105L08CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J065219H05CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J075010N07CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J075130I08CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090014E16CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090025K17CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090030L19CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090035J05CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090036B17CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090037A15CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090064C17CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090069L18CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090073N11CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090077F23CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J090099F02CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J100029N06CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J100056I04CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J100061A13CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J100062B10CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J100062J17CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J100072F22CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J100072J22CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
J100076C03CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
X91808CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
Z11931CCAGCCCAGCCCAGCCCACGGGCCGTGGNONE 
Os07g0596600AK067238CCCGTGGGCCCCACCSimilar to Cdc2MsC protein. 
Os07g0605200AF091458CCCGTGGGCCCCACCGGGCCNONE 
AF139665CCCGTGGGCCCCACCGGGCCNONE 
AJ011675CCCGTGGGCCCCACCGGGCCNONE 
AK064704CCCGTGGGCCCCACCGGGCCMADS box transcription factor 18 (OsMADS18) (MADS box protein 2) (MADS box protein 28) (FDRMADS7). 
J075159J15CCCGTGGGCCCCACCGGGCCNONE 
J090034M06CCCGTGGGCCCCACCGGGCCNONE 
J090079L24CCCGTGGGCCCCACCGGGCCNONE 
Os07g0607200AK065746CCAAGCCCACGGCCCAACCProtein of unknown function DUF751 family protein. 
J065037B15CCAAGCCCACGGCCCAACCNONE 
J065042E20CCAAGCCCACGGCCCAACCNONE 
J065161I08CCAAGCCCACGGCCCAACCNONE 
Os07g0628500AK059560CCCGTGGGCNONE 
AK070963CCCGTGGGCBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
AY222337CCCGTGGGCNONE 
J023068N18CCCGTGGGCNONE 
J023088M08CCCGTGGGCNONE 
J033072H21CCCGTGGGCNONE 
Os07g0669000AK099431AGCCCACGGSimilar to Catalytic subunit of polymerase zeta. 
J065073M09AGCCCACGGNONE 
Os07g0674100AB183706AACGGCCCACGGUDP-glucuronic acid decarboxylase. 
AK099614AACGGCCCACGGNONE 
J013050E02AACGGCCCACGGNONE 
J065162F06AACGGCCCACGGNONE 
J065180F10AACGGCCCACGGNONE 
J090049F09AACGGCCCACGGNONE 
J100064L11AACGGCCCACGGNONE 
Os07g0686500AK119424CCCGTGGGCCGTGGProtein of unknown function DUF630 domain containing protein. 
J065064P13CCCGTGGGCCGTGGNONE 
J065070L21CCCGTGGGCCGTGGNONE 
J065196A06CCCGTGGGCCGTGGNONE 
J065216M14CCCGTGGGCCGTGGNONE 
Os07g0690300012-048-A07GCCGGGCCCACGGGNONE 
AK099674GCCGGGCCCACGGGChromatin SPT2 family protein. 
J013028F12GCCGGGCCCACGGGNONE 
J013069F21GCCGGGCCCACGGGNONE 
J013104E17GCCGGGCCCACGGGNONE 
J013153M16GCCGGGCCCACGGGNONE 
J023012L09GCCGGGCCCACGGGNONE 
J023069A08GCCGGGCCCACGGGNONE 
J023132L23GCCGGGCCCACGGGNONE 
J033120P19GCCGGGCCCACGGGNONE 
J065173J03GCCGGGCCCACGGGNONE 
J075008H06GCCGGGCCCACGGGNONE 
J075043J15GCCGGGCCCACGGGNONE 
J075147I12GCCGGGCCCACGGGNONE 
J090041G07GCCGGGCCCACGGGNONE 
Os07g0693100AB111050CCGTGGGCCGTANONE 
AK100433CCGTGGGCCGTASimilar to Pyruvate decarboxylase isozyme 3 (EC 4.1.1.1) (PDC). 
J023054O07CCGTGGGCCGTANONE 
J023088C24CCGTGGGCCGTANONE 
J023088I11CCGTGGGCCGTANONE 
Os08g0178800009-155-D05CCGTGGGCNONE 
AK063025CCGTGGGCHypothetical protein. 
Os08g0230000014-096-F01CCGTGGGCCGGGCCGTCGGGCCGTANONE 
AK067127CCGTGGGCCGGGCCGTCGGGCCGTAConserved hypothetical protein. 
J013096C05CCGTGGGCCGGGCCGTCGGGCCGTANONE 
J100032D12CCGTGGGCCGGGCCGTCGGGCCGTANONE 
Os08g0300700AK101762AGCCCACGGProtein prenyltransferase domain containing protein. 
Os08g0440500AK058761TCCACGCCCACGGMIR domain containing protein. 
Os08g0441400011-033-F01AGCCCACGGNONE 
015-084-B04AGCCCACGGNONE 
AK063317AGCCCACGGNONE 
AK064141AGCCCACGGConserved hypothetical protein. 
J065060F06AGCCCACGGNONE 
J075110A22AGCCCACGGNONE 
J080307P11AGCCCACGGNONE 
J090041E06AGCCCACGGNONE 
Os08g0461300AK065651TTCGGCCCACGGGCyclin-like F-box domain containing protein. 
Os08g0474600J075102L06GAGGCCCACGGNONE 
J075103J21GAGGCCCACGGNONE 
Os08g0480400J065154C22TAAGCCCACGGNONE 
J065214F15TAAGCCCACGGProtein of unknown function DUF1637 family protein. 
Os08g0490100009-038-D02CCCGTGGGCCCCNONE 
J065152E11CCCGTGGGCCCCSimilar to PBF protein. 
J090050K03CCCGTGGGCCCCNONE 
J090053L01CCCGTGGGCCCCNONE 
Os08g0560900AK120366GCCCACGGGNONE 
Os09g0324300AK109691TTATGGGCCGCCGTGGGCTTTCyclin-like F-box domain containing protein. 
Os09g0407300AK069164GGGGCCCACGGNONE 
AK103905GGGGCCCACGGConserved hypothetical protein. 
Os09g0424600AK073882GCCCACGGGHAD superfamily (subfamily IG) hydrolase, 5'-Nucleotidase protein. 
Os09g0438000AK109935GCCCACGGGNONE 
AK120739GCCCACGGGSimilar to RbohAOsp (Fragment). 
Os09g0450200AK068872AGCCCACGGGConserved hypothetical protein. 
J065013B14AGCCCACGGGNONE 
J065034F17AGCCCACGGGNONE 
J065039K11AGCCCACGGGNONE 
J065093N22AGCCCACGGGNONE 
J075034N13AGCCCACGGGNONE 
J075110O14AGCCCACGGGNONE 
J075122H04AGCCCACGGGNONE 
J075147B13AGCCCACGGGNONE 
J075149A02AGCCCACGGGNONE 
J075195L14AGCCCACGGGNONE 
Os09g0471000AK103634GCCCACGGProtein of unknown function DUF1637 family protein. 
AK107828GCCCACGGNONE 
Os09g0499500J075050M22CCGTGGGCHypothetical protein. 
J075157M01CCGTGGGCNONE 
Os09g0511700AK101420TAGGCCCACGGCCCACCCSimilar to Prunasin hydrolase isoform PH C precursor (EC 3.2.1.118). 
J013022L19TAGGCCCACGGCCCACCCNONE 
J013036D23TAGGCCCACGGCCCACCCNONE 
J013037F22TAGGCCCACGGCCCACCCNONE 
J013111M23TAGGCCCACGGCCCACCCNONE 
J023109F14TAGGCCCACGGCCCACCCNONE 
J023119H17TAGGCCCACGGCCCACCCNONE 
J023133H23TAGGCCCACGGCCCACCCNONE 
J033032G17TAGGCCCACGGCCCACCCNONE 
J033038B10TAGGCCCACGGCCCACCCNONE 
J033071M16TAGGCCCACGGCCCACCCNONE 
J033096G04TAGGCCCACGGCCCACCCNONE 
J033109D06TAGGCCCACGGCCCACCCNONE 
J043016E22TAGGCCCACGGCCCACCCNONE 
J043022O09TAGGCCCACGGCCCACCCNONE 
J100023N11TAGGCCCACGGCCCACCCNONE 
J100046I21TAGGCCCACGGCCCACCCNONE 
Os09g0531200AK064107GCCCACGGGRNA recognition motif 2 domain containing protein. 
Os09g0532700AK069946GCCCCACCGGCCCACGGAlpha/beta hydrolase family protein. 
Os09g0533300AK073741GCCCACGGPhosphoesterase At2g46880 family protein. 
J043004F12GCCCACGGNONE 
J043013K12GCCCACGGNONE 
J075006D19GCCCACGGNONE 
J075064C01GCCCACGGNONE 
J090003A07GCCCACGGNONE 
J090085H04GCCCACGGNONE 
J100051J16GCCCACGGNONE 
Os09g0535000AK058712CCGTGGGCCGASimilar to Triosephosphate isomerase, chloroplast precursor (EC 5.3.1.1) (TIM) (Triose-phosphate isomerase). 
AK069488CCGTGGGCCGANONE 
AK069832CCGTGGGCCGANONE 
J100065D20CCGTGGGCCGANONE 
Os11g0156600Os11g0156600CCGTGGGCCCCACATB2/DP1 and HVA22 related protein family protein. 
Os11g0219400AK069850CCCGTGGGCTGGAnkyrin repeat containing protein. 
AK099123CCCGTGGGCTGGNONE 
J023143G18CCCGTGGGCTGGNONE 
Os11g0421800015-041-B05CCCGTGGGCCCCCACACNONE 
AK106317CCCGTGGGCCCCCACACConserved hypothetical protein. 
Os11g0461300006-094-F10CCCGTGGGCNONE 
AK061200CCCGTGGGCUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
Os11g0481600AK109900GAAGCCCACGGConserved hypothetical protein. 
Os11g0546300AK121962GCCCACGGPatatin family protein. 
J075030A04GCCCACGGNONE 
J075073J11GCCCACGGNONE 
J075161G14GCCCACGGNONE 
J075178C13GCCCACGGNONE 
Os11g0549615AK069660CCGTGGGCCCCACCAcid phosphatase, type 5 family protein. 
J023031L04CCGTGGGCCCCACCNONE 
Os12g0156400012-065-D02ACAGCCCACACGTGGCCGTGGGCCCCNONE 
012-065-D02CCGTGGGCCCACANONE 
AK072086ACAGCCCACACGTGGCCGTGGGCCCCNONE 
AK072086CCGTGGGCCCACANONE 
AK099278ACAGCCCACACGTGGCCGTGGGCCCCDcp1-like decapping family protein. 
AK099278CCGTGGGCCCACADcp1-like decapping family protein. 
J013063H09ACAGCCCACACGTGGCCGTGGGCCCCNONE 
J013063H09CCGTGGGCCCACANONE 
J023125D09ACAGCCCACACGTGGCCGTGGGCCCCNONE 
J023125D09CCGTGGGCCCACANONE 
J023149G21ACAGCCCACACGTGGCCGTGGGCCCCNONE 
J023149G21CCGTGGGCCCACANONE 
J033064E07ACAGCCCACACGTGGCCGTGGGCCCCNONE 
J033064E07CCGTGGGCCCACANONE 
J033093C07ACAGCCCACACGTGGCCGTGGGCCCCNONE 
J033093C07CCGTGGGCCCACANONE 
J033107E06ACAGCCCACACGTGGCCGTGGGCCCCNONE 
J033107E06CCGTGGGCCCACANONE 
J075172A11ACAGCCCACACGTGGCCGTGGGCCCCNONE 
J075172A11CCGTGGGCCCACANONE 
J090009E07ACAGCCCACACGTGGCCGTGGGCCCCNONE 
J090009E07CCGTGGGCCCACANONE 
J090023F13ACAGCCCACACGTGGCCGTGGGCCCCNONE 
J090023F13CCGTGGGCCCACANONE 
J090071N18ACAGCCCACACGTGGCCGTGGGCCCCNONE 
J090071N18CCGTGGGCCCACANONE 
Os12g0241000AK068925CCCGTGGGCCGGGIojap-related protein family protein. 
J023001D05CCCGTGGGCCGGGNONE 
J065042C19CCCGTGGGCCGGGNONE 
J065081G23CCCGTGGGCCGGGNONE 
J065105M09CCCGTGGGCCGGGNONE 
J065163P20CCCGTGGGCCGGGNONE 
J065182L22CCCGTGGGCCGGGNONE 
Os12g0244500AK102026CCCGTGGGCConserved hypothetical protein. 
J023014D06CCCGTGGGCNONE 
J023060C12CCCGTGGGCNONE 
J033080M18CCCGTGGGCNONE 
J090017I22CCCGTGGGCNONE 
J090023D21CCCGTGGGCNONE 
J090036J05CCCGTGGGCNONE 
J090053M19CCCGTGGGCNONE 
Os12g0488800015-085-F11GGCCCGGCCCGTGGGCCGTGGNONE 
AK064347GGCCCGGCCCGTGGGCCGTGGRNA polymerase II, RPB4 domain containing protein. 
J033065H11GGCCCGGCCCGTGGGCCGTGGNONE 
J033145P10GGCCCGGCCCGTGGGCCGTGGNONE 
J065137L04GGCCCGGCCCGTGGGCCGTGGNONE 
J065171P08GGCCCGGCCCGTGGGCCGTGGNONE 
Os12g0527500AK109836CCAGGCCCATCCGGGCCCACGGCCCyclin-like F-box domain containing protein. 
Os12g0557800AK121691CCAGCCCACGGGProtein prenyltransferase domain containing protein. 
J013095M03CCAGCCCACGGGNONE 
J033071H11CCAGCCCACGGGNONE 
J065101B02CCAGCCCACGGGNONE 
Os12g0573000AK067552AACGGCCCACGGCCCACGTHypothetical protein. 
AK069292AACGGCCCACGGCCCACGTNONE 
Os12g0592200Os12g0592200GCCCGGCCCACGGCCCACTConserved hypothetical protein. 
Os12g0601400009-057-A09GGGGCCCACGGGNONE 
AK073361GGGGCCCACGGGSimilar to Auxin-responsive protein (Aux/IAA) (Fragment). 
J065037G12GGGGCCCACGGGNONE 
J065099K06GGGGCCCACGGGNONE 
J065156F11GGGGCCCACGGGNONE 
J100025G04GGGGCCCACGGGNONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.