version

Summary of OsREG548 (All List)

OrganismOryza sativa  
IDOsREG548  
SequenceCCGTTGGA  
Annotation  
PPDB MotifCCAACGG  function unknown  
PLACE Motif 
Total Entry Count1991  

Entry Sequences (1991 entries)

LocusGene modelSequenceDescription
Os01g0101600AK099952CCGTTGGATRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
AK122118CCGTTGGATNONE 
J013123J12CCGTTGGATNONE 
J033026O19CCGTTGGATNONE 
J033128C08CCGTTGGATNONE 
J065116M14CCGTTGGATNONE 
J090058F15CCGTTGGATNONE 
J090079F20CCGTTGGATNONE 
Os01g0150000006-053-H07GTGGGTCCAACGGCCCAGCNONE 
006-081-C11GTGGGTCCAACGGCCCAGCNONE 
009-050-D04GTGGGTCCAACGGCCCAGCNONE 
AK060948GTGGGTCCAACGGCCCAGC3-oxo-5-alpha-steroid 4-dehydrogenase, C-terminal domain containing protein. 
J023058M18GTGGGTCCAACGGCCCAGCNONE 
J023112H22GTGGGTCCAACGGCCCAGCNONE 
J065048P05GTGGGTCCAACGGCCCAGCNONE 
J100068N20GTGGGTCCAACGGCCCAGCNONE 
J100073A02GTGGGTCCAACGGCCCAGCNONE 
Os01g0176500AK102552ATCCAACGGCConserved hypothetical protein. 
Os01g0184000015-008-B06ATCCAACGGNONE 
AK071130ATCCAACGGNUC156 family protein. 
AK100604ATCCAACGGNONE 
Os01g0229900AK065381TCCAACGGNONE 
AK065429TCCAACGGSimilar to Shaggy-related protein kinase dzeta (EC 2.7.1.-) (ASK-dzeta). 
Os01g0262700AK100901ATCCAACGGConserved hypothetical protein. 
AK119928ATCCAACGGNONE 
J033057O20ATCCAACGGNONE 
J065093J01ATCCAACGGNONE 
J075164F23ATCCAACGGNONE 
J100025E08ATCCAACGGNONE 
J100029L03ATCCAACGGNONE 
J100079F02ATCCAACGGNONE 
Os01g0276700011-014-A12CCGTTGGANONE 
012-092-G12CCGTTGGANONE 
AK103164CCGTTGGANONE 
AK103465CCGTTGGASimilar to Pyruvate kinase, cytosolic isozyme (EC 2.7.1.40) (PK). 
J023019H09CCGTTGGANONE 
J023084I02CCGTTGGANONE 
J033027F20CCGTTGGANONE 
J033029M06CCGTTGGANONE 
J033039K13CCGTTGGANONE 
J033057C24CCGTTGGANONE 
J033058G20CCGTTGGANONE 
J033060A14CCGTTGGANONE 
J033061M21CCGTTGGANONE 
J033068M10CCGTTGGANONE 
J033074K16CCGTTGGANONE 
J033076C11CCGTTGGANONE 
J033093O13CCGTTGGANONE 
J033119H20CCGTTGGANONE 
J033121D22CCGTTGGANONE 
J033129N11CCGTTGGANONE 
J033131E12CCGTTGGANONE 
J033150L07CCGTTGGANONE 
J053024N17CCGTTGGANONE 
J053034G19CCGTTGGANONE 
J053035E18CCGTTGGANONE 
J053046M01CCGTTGGANONE 
J053047P04CCGTTGGANONE 
J053048B06CCGTTGGANONE 
J053050M22CCGTTGGANONE 
J053053E09CCGTTGGANONE 
J053053I07CCGTTGGANONE 
J053059K03CCGTTGGANONE 
J053059P12CCGTTGGANONE 
J053060C12CCGTTGGANONE 
J053060H24CCGTTGGANONE 
J053064D19CCGTTGGANONE 
J053066L15CCGTTGGANONE 
J053073I02CCGTTGGANONE 
J053083E15CCGTTGGANONE 
J053094D05CCGTTGGANONE 
J053094P18CCGTTGGANONE 
J053095C15CCGTTGGANONE 
J053095C21CCGTTGGANONE 
J053099N16CCGTTGGANONE 
J090025O19CCGTTGGANONE 
J090049N22CCGTTGGANONE 
J090050F17CCGTTGGANONE 
Os01g0281200AK107209GACCGTTGGASimilar to Type B-like cyclin (Fragment). 
AY647458GACCGTTGGANONE 
Os01g0309900AK100627CCGTTGGATLipase, class 3 family protein. 
Os01g0321800AK064712ATCCAACGGCCGAGAGas vesicle protein GvpC repeat containing protein. 
J075175N03ATCCAACGGCCGAGANONE 
Os01g0328400006-092-H09ATCCAACGGCNONE 
009-085-A02ATCCAACGGCNONE 
012-078-B03ATCCAACGGCNONE 
AK061988ATCCAACGGCUbiquitin. 
J013073B13ATCCAACGGCNONE 
J023135L09ATCCAACGGCNONE 
J023135O07ATCCAACGGCNONE 
J033027B12ATCCAACGGCNONE 
J033084P17ATCCAACGGCNONE 
J065010M05ATCCAACGGCNONE 
J065021N11ATCCAACGGCNONE 
J065021N12ATCCAACGGCNONE 
J065031K11ATCCAACGGCNONE 
J065072P04ATCCAACGGCNONE 
J065098D05ATCCAACGGCNONE 
J065122N23ATCCAACGGCNONE 
J065129L13ATCCAACGGCNONE 
J065135N13ATCCAACGGCNONE 
J065215N10ATCCAACGGCNONE 
J075120N22ATCCAACGGCNONE 
J090011G23ATCCAACGGCNONE 
J090014F06ATCCAACGGCNONE 
J090040G23ATCCAACGGCNONE 
J090075I20ATCCAACGGCNONE 
J090075N01ATCCAACGGCNONE 
J090089B04ATCCAACGGCNONE 
J090090F08ATCCAACGGCNONE 
J090091M17ATCCAACGGCNONE 
J090094L03ATCCAACGGCNONE 
J090099L06ATCCAACGGCNONE 
J100018A18ATCCAACGGCNONE 
J100027H13ATCCAACGGCNONE 
J100069C05ATCCAACGGCNONE 
J100086L10ATCCAACGGCNONE 
Os01g0349400AK064941ATCCAACGGCCNONE 
AK100195ATCCAACGGCCNONE 
AK105047ATCCAACGGCCNONE 
AK122182ATCCAACGGCCSimilar to Serine/threonine protein phosphatase PP1 (EC 3.1.3.16) (Fragment). 
Os01g0506100AK102377ATCCAACGGGlobin-like family protein. 
AK109825ATCCAACGGNONE 
Os01g0578000AK060971ATCCAACGGTCRecA bacterial DNA recombination family protein. 
AK068701ATCCAACGGTCNONE 
J090025J16ATCCAACGGTCNONE 
Os01g0658500AK058491GCCGTTGGAProtein of unknown function DUF852, eukaryotic family protein. 
AK069050GCCGTTGGANONE 
J043036P22GCCGTTGGANONE 
Os01g0710800013-097-E05AGCCGTTGGATNONE 
AK069973AGCCGTTGGATNONE 
AK071099AGCCGTTGGATConserved hypothetical protein. 
J023081K01AGCCGTTGGATNONE 
J023123E16AGCCGTTGGATNONE 
J033066B11AGCCGTTGGATNONE 
J065144G11AGCCGTTGGATNONE 
Os01g0716200AK062106AGCCGTTGGAIQ calmodulin-binding region domain containing protein. 
AK098920AGCCGTTGGANONE 
J013002N06AGCCGTTGGANONE 
J013050O19AGCCGTTGGANONE 
J013074N19AGCCGTTGGANONE 
J013127F17AGCCGTTGGANONE 
J013155C17AGCCGTTGGANONE 
J013158K07AGCCGTTGGANONE 
J053086D01AGCCGTTGGANONE 
Os01g0734800003-125-B01CCGTTGGANONE 
006-091-B09CCGTTGGANONE 
AK061830CCGTTGGANONE 
AK102415CCGTTGGAUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
J013023J06CCGTTGGANONE 
J033028I18CCGTTGGANONE 
J033060I01CCGTTGGANONE 
J033093B13CCGTTGGANONE 
J033148I15CCGTTGGANONE 
J043009M12CCGTTGGANONE 
J100033P04CCGTTGGANONE 
J100037L12CCGTTGGANONE 
J100047A08CCGTTGGANONE 
J100079D19CCGTTGGANONE 
Os01g0766600AK061986ATCCAACGGNONE 
AK103570ATCCAACGGBSD domain containing protein. 
Os01g0801700AK073813ATCCAACGGConserved hypothetical protein. 
J033067K14ATCCAACGGNONE 
Os01g0806300AK111352CCGTTGGATConserved hypothetical protein. 
Os01g0836800006-021-C09ATCCAACGGNONE 
006-091-F04ATCCAACGGNONE 
014-013-D08ATCCAACGGNONE 
015-018-F10ATCCAACGGNONE 
015-058-H03ATCCAACGGNONE 
AK061720ATCCAACGGNONE 
AK066629ATCCAACGGLung seven transmembrane receptor family protein. 
AK098958ATCCAACGGNONE 
AK106145ATCCAACGGNONE 
AK119783ATCCAACGGNONE 
J013063N02ATCCAACGGNONE 
J013071A10ATCCAACGGNONE 
J013124C08ATCCAACGGNONE 
J023055J07ATCCAACGGNONE 
J023081H15ATCCAACGGNONE 
J023082D01ATCCAACGGNONE 
J023091F07ATCCAACGGNONE 
J023091L13ATCCAACGGNONE 
J023104G05ATCCAACGGNONE 
J023110M16ATCCAACGGNONE 
J023120F18ATCCAACGGNONE 
J023128O11ATCCAACGGNONE 
J023140B11ATCCAACGGNONE 
J033023B15ATCCAACGGNONE 
J033025E14ATCCAACGGNONE 
J033027J21ATCCAACGGNONE 
J033041F19ATCCAACGGNONE 
J033044L10ATCCAACGGNONE 
J033052M08ATCCAACGGNONE 
J033084P07ATCCAACGGNONE 
J033086P11ATCCAACGGNONE 
J033090I20ATCCAACGGNONE 
J033093D17ATCCAACGGNONE 
J033099C04ATCCAACGGNONE 
J033108M19ATCCAACGGNONE 
J033124O20ATCCAACGGNONE 
J033145D24ATCCAACGGNONE 
J033145O09ATCCAACGGNONE 
J043016F03ATCCAACGGNONE 
J043037C06ATCCAACGGNONE 
J053095L22ATCCAACGGNONE 
J053100E09ATCCAACGGNONE 
J065023G19ATCCAACGGNONE 
J065197D03ATCCAACGGNONE 
J090003E23ATCCAACGGNONE 
J090012P18ATCCAACGGNONE 
J090019E14ATCCAACGGNONE 
J090021B01ATCCAACGGNONE 
J090022J10ATCCAACGGNONE 
J090045L06ATCCAACGGNONE 
J090050J02ATCCAACGGNONE 
J090065F15ATCCAACGGNONE 
J100018A06ATCCAACGGNONE 
J100022K07ATCCAACGGNONE 
J100036H01ATCCAACGGNONE 
J100044I09ATCCAACGGNONE 
J100057M17ATCCAACGGNONE 
J100058O04ATCCAACGGNONE 
J100079C21ATCCAACGGNONE 
J100079G13ATCCAACGGNONE 
Os01g0864100AK064616GACCGTTGGAConserved hypothetical protein. 
Os01g0866200009-039-E12ATCCAACGGTCNONE 
J065059P16ATCCAACGGTCNONE 
J065063E21ATCCAACGGTCNONE 
J065078B21ATCCAACGGTCNONE 
J065079A11ATCCAACGGTCNONE 
J065087H15ATCCAACGGTCNONE 
J065137M10ATCCAACGGTCNONE 
J065138K24ATCCAACGGTCNONE 
J065142E08ATCCAACGGTCNONE 
J065171G11ATCCAACGGTCNONE 
J065183K15ATCCAACGGTCNONE 
J065192J05ATCCAACGGTCNONE 
J075151P09ATCCAACGGTCNONE 
J090020B17ATCCAACGGTCNONE 
J090067F15ATCCAACGGTCNONE 
J090070K06ATCCAACGGTCNONE 
J090094G13ATCCAACGGTCNONE 
J100081M20ATCCAACGGTCHistone H3. 
J100089D06ATCCAACGGTCNONE 
Os01g0866300006-087-C06ATCCAACGGTCNONE 
006-114-E01ATCCAACGGTCNONE 
J065202L13ATCCAACGGTCNONE 
Os01g0866400AB007193CCGTTGGASimilar to Fructose-1,6-bisphosphatase (EC 3.1.3.11) (Fragment). 
AF378183CCGTTGGANONE 
AK070516CCGTTGGANONE 
AK119536CCGTTGGANONE 
J023057C24CCGTTGGANONE 
J023078G07CCGTTGGANONE 
J065015D23CCGTTGGANONE 
J065050J17CCGTTGGANONE 
J065058B03CCGTTGGANONE 
J065119C16CCGTTGGANONE 
J065134N01CCGTTGGANONE 
J065174B10CCGTTGGANONE 
J075046D04CCGTTGGANONE 
J075172N05CCGTTGGANONE 
Os01g0872000AK102239ATCCAACGGTGF-beta receptor, type I/II extracellular region family protein. 
Os01g0897800AF140489CATCCCCCATCCAACGGCNONE 
AK072409CATCCCCCATCCAACGGCNONE 
AK072812CATCCCCCATCCAACGGCRad21/Rec8 like protein, N-terminal domain containing protein. 
AK099099CATCCCCCATCCAACGGCNONE 
AY288943CATCCCCCATCCAACGGCNONE 
AY318757CATCCCCCATCCAACGGCNONE 
J013021C23CATCCCCCATCCAACGGCNONE 
J013027H03CATCCCCCATCCAACGGCNONE 
J013032C02CATCCCCCATCCAACGGCNONE 
J013068G13CATCCCCCATCCAACGGCNONE 
J013070K16CATCCCCCATCCAACGGCNONE 
J013070L02CATCCCCCATCCAACGGCNONE 
J013091E15CATCCCCCATCCAACGGCNONE 
J013109D04CATCCCCCATCCAACGGCNONE 
J013118B04CATCCCCCATCCAACGGCNONE 
J013129E08CATCCCCCATCCAACGGCNONE 
J013134I15CATCCCCCATCCAACGGCNONE 
J013146N16CATCCCCCATCCAACGGCNONE 
J023083F05CATCCCCCATCCAACGGCNONE 
J023107E17CATCCCCCATCCAACGGCNONE 
J023113D21CATCCCCCATCCAACGGCNONE 
J023123A22CATCCCCCATCCAACGGCNONE 
J023133I24CATCCCCCATCCAACGGCNONE 
J023134L21CATCCCCCATCCAACGGCNONE 
J023142N24CATCCCCCATCCAACGGCNONE 
J033051B12CATCCCCCATCCAACGGCNONE 
J033058B04CATCCCCCATCCAACGGCNONE 
J033068E24CATCCCCCATCCAACGGCNONE 
J033076D01CATCCCCCATCCAACGGCNONE 
J033088O06CATCCCCCATCCAACGGCNONE 
J033093K15CATCCCCCATCCAACGGCNONE 
J033101G18CATCCCCCATCCAACGGCNONE 
J033130A01CATCCCCCATCCAACGGCNONE 
J043027I17CATCCCCCATCCAACGGCNONE 
J043027L17CATCCCCCATCCAACGGCNONE 
J090001N13CATCCCCCATCCAACGGCNONE 
J090004L10CATCCCCCATCCAACGGCNONE 
J090027D08CATCCCCCATCCAACGGCNONE 
J090027H18CATCCCCCATCCAACGGCNONE 
J090031F16CATCCCCCATCCAACGGCNONE 
J090048L18CATCCCCCATCCAACGGCNONE 
J090050N08CATCCCCCATCCAACGGCNONE 
J090051G05CATCCCCCATCCAACGGCNONE 
J090063G03CATCCCCCATCCAACGGCNONE 
J090068P21CATCCCCCATCCAACGGCNONE 
J090072P21CATCCCCCATCCAACGGCNONE 
J090079A14CATCCCCCATCCAACGGCNONE 
J090086I20CATCCCCCATCCAACGGCNONE 
J090087D19CATCCCCCATCCAACGGCNONE 
J090099B06CATCCCCCATCCAACGGCNONE 
J100047J19CATCCCCCATCCAACGGCNONE 
J100058I06CATCCCCCATCCAACGGCNONE 
Os01g0917100AK107234ATCCAACGGCTConserved hypothetical protein. 
Os01g0952700AK103457CCGTTGGATMetallo-dependent hydrolase, composite domain containing protein. 
Os01g0972300009-034-G05GTCGGATCCAACGGNONE 
AK062432GTCGGATCCAACGGDVL family protein. 
Os01g0973500AK069546ATCCAACGGSimilar to Protein kinase APK1A, chloroplast precursor (EC 2.7.1.-). 
Os02g0100200AK121311ATCCAACGGCTSteroid nuclear receptor, ligand-binding domain containing protein. 
Os02g0135000AK069693AGCCGTTGGAConserved hypothetical protein. 
J023028F11AGCCGTTGGANONE 
Os02g0148600AK059287GGCCGTTGGATConserved hypothetical protein. 
Os02g0163500AK070929AGCCGTTGGAConserved hypothetical protein. 
J065065O20AGCCGTTGGANONE 
J065073E14AGCCGTTGGANONE 
J065134J06AGCCGTTGGANONE 
J075017I19AGCCGTTGGANONE 
J075074A02AGCCGTTGGANONE 
J075088N14AGCCGTTGGANONE 
J075108F01AGCCGTTGGANONE 
J075114M06AGCCGTTGGANONE 
J075153E15AGCCGTTGGANONE 
J075158D01AGCCGTTGGANONE 
J075177K13AGCCGTTGGANONE 
J075195G15AGCCGTTGGANONE 
J075198A19AGCCGTTGGANONE 
Os02g0188500AK102004CATCCCCCTCCAACGGCTNONE 
AK106917CATCCCCCTCCAACGGCTUbiquitin domain containing protein. 
J090039N13CATCCCCCTCCAACGGCTNONE 
Os02g0205000AK060003TCCAACGGCNONE 
AK073514TCCAACGGCRibosomal protein L19 family protein. 
J065106I07TCCAACGGCNONE 
Os02g0205400AK101434ATCCAACGGCCWD40-like domain containing protein. 
J043024M20ATCCAACGGCCNONE 
Os02g0220600AK061944ATCCAACGGElongation factor 1-gamma (EF-1-gamma) (eEF-1B gamma). 
AK104946ATCCAACGGNONE 
D89802ATCCAACGGNONE 
J013042L22ATCCAACGGNONE 
J013056A14ATCCAACGGNONE 
J013120G13ATCCAACGGNONE 
J013155K19ATCCAACGGNONE 
J023002B10ATCCAACGGNONE 
J023080J19ATCCAACGGNONE 
J023081C08ATCCAACGGNONE 
J023090H05ATCCAACGGNONE 
J023091M07ATCCAACGGNONE 
J023115F09ATCCAACGGNONE 
J033025I23ATCCAACGGNONE 
J033026G12ATCCAACGGNONE 
J033035E15ATCCAACGGNONE 
J033040N13ATCCAACGGNONE 
J033046C17ATCCAACGGNONE 
J033069F02ATCCAACGGNONE 
J033071B16ATCCAACGGNONE 
J033071N22ATCCAACGGNONE 
J033088J02ATCCAACGGNONE 
J033092N24ATCCAACGGNONE 
J033093I09ATCCAACGGNONE 
J033126G06ATCCAACGGNONE 
J043003G15ATCCAACGGNONE 
J043010M11ATCCAACGGNONE 
J043024O20ATCCAACGGNONE 
J065092N03ATCCAACGGNONE 
J080004D17ATCCAACGGNONE 
J080010L09ATCCAACGGNONE 
J080021I11ATCCAACGGNONE 
J080022L01ATCCAACGGNONE 
J080029B01ATCCAACGGNONE 
J080032D11ATCCAACGGNONE 
J080039B11ATCCAACGGNONE 
J080040K17ATCCAACGGNONE 
J080041B21ATCCAACGGNONE 
J080052L24ATCCAACGGNONE 
J080054M12ATCCAACGGNONE 
J080057B15ATCCAACGGNONE 
J080078G15ATCCAACGGNONE 
J080078H06ATCCAACGGNONE 
J080079M03ATCCAACGGNONE 
J080088H16ATCCAACGGNONE 
J080093C11ATCCAACGGNONE 
J080095K09ATCCAACGGNONE 
J080095O20ATCCAACGGNONE 
J090009J19ATCCAACGGNONE 
J090040D04ATCCAACGGNONE 
J090052E14ATCCAACGGNONE 
J090063B14ATCCAACGGNONE 
J090071K04ATCCAACGGNONE 
J090075E12ATCCAACGGNONE 
J090087A06ATCCAACGGNONE 
J090094P03ATCCAACGGNONE 
J090098M14ATCCAACGGNONE 
Os02g0467400AK072333AGCCGTTGGATConserved hypothetical protein. 
AK073879AGCCGTTGGATNONE 
AK121931AGCCGTTGGATNONE 
J065085B12AGCCGTTGGATNONE 
Os02g0556700AK073875ATCCAACGGCCT-complex 11 family protein. 
Os02g0586400006-066-D08CGCACCGCACCGTTGGATNONE 
006-073-A01CGCACCGCACCGTTGGATNONE 
J065088B17CGCACCGCACCGTTGGATNONE 
J075065L07CGCACCGCACCGTTGGATNONE 
J100017B20CGCACCGCACCGTTGGATNONE 
J100025B03CGCACCGCACCGTTGGATNONE 
Os02g0602500015-078-E08CCGTTGGATNONE 
AK064340CCGTTGGATNONE 
AK073602CCGTTGGATIsy1-like splicing family protein. 
J033052I23CCGTTGGATNONE 
J065060C10CCGTTGGATNONE 
J065192K14CCGTTGGATNONE 
J100076I15CCGTTGGATNONE 
Os02g0611400AK101310AGCCGTTGGATProtein prenyltransferase domain containing protein. 
J033024H21AGCCGTTGGATNONE 
J033033O21AGCCGTTGGATNONE 
J065134H24AGCCGTTGGATNONE 
J090087E02AGCCGTTGGATNONE 
Os02g0615500AK068010TCCAACGGCNONE 
AK100073TCCAACGGCProtein kinase-like domain containing protein. 
J013170D14TCCAACGGCNONE 
Os02g0659600J065119F20ATCCAACGGNONE 
J065181I02ATCCAACGGConserved hypothetical protein. 
J090092M04ATCCAACGGNONE 
Os02g0733300AK101108TCCAACGGCCGAAASimilar to Endo-beta-1,4-glucanase precursor (EC 3.2.1.4). 
AK101108TCCAACGGTCCCACCCGSimilar to Endo-beta-1,4-glucanase precursor (EC 3.2.1.4). 
AK105446TCCAACGGCCGAAANONE 
AK105446TCCAACGGTCCCACCCGNONE 
Os02g0744900AK061968ATCCAACGGCTSimilar to Geranylgeranyl reductase (Fragment). 
AK098873ATCCAACGGCTNONE 
J013001C18ATCCAACGGCTNONE 
J080003D07ATCCAACGGCTNONE 
J080003H24ATCCAACGGCTNONE 
J080010C23ATCCAACGGCTNONE 
J080011I04ATCCAACGGCTNONE 
J080011O03ATCCAACGGCTNONE 
J080012F13ATCCAACGGCTNONE 
J080020E06ATCCAACGGCTNONE 
J080025H22ATCCAACGGCTNONE 
J080026D15ATCCAACGGCTNONE 
J080028D20ATCCAACGGCTNONE 
J080029P20ATCCAACGGCTNONE 
J080031K22ATCCAACGGCTNONE 
J080034I05ATCCAACGGCTNONE 
J080036E11ATCCAACGGCTNONE 
J080036H13ATCCAACGGCTNONE 
J080037E17ATCCAACGGCTNONE 
J080043N05ATCCAACGGCTNONE 
J080044L23ATCCAACGGCTNONE 
J080047N11ATCCAACGGCTNONE 
J080048O04ATCCAACGGCTNONE 
J080049M01ATCCAACGGCTNONE 
J080050F21ATCCAACGGCTNONE 
J080054F09ATCCAACGGCTNONE 
J080055N20ATCCAACGGCTNONE 
J080058C02ATCCAACGGCTNONE 
J080058K15ATCCAACGGCTNONE 
J080062G02ATCCAACGGCTNONE 
J080066H16ATCCAACGGCTNONE 
J080066O05ATCCAACGGCTNONE 
J080067O16ATCCAACGGCTNONE 
J080068E13ATCCAACGGCTNONE 
J080069P16ATCCAACGGCTNONE 
J080072M11ATCCAACGGCTNONE 
J080076H09ATCCAACGGCTNONE 
J080081G24ATCCAACGGCTNONE 
J080082J05ATCCAACGGCTNONE 
J080084I10ATCCAACGGCTNONE 
J080087L24ATCCAACGGCTNONE 
J080089H07ATCCAACGGCTNONE 
J080089M05ATCCAACGGCTNONE 
J080092G18ATCCAACGGCTNONE 
J080095N08ATCCAACGGCTNONE 
Os02g0760300009-137-D04ATCCAACGGCCCAGGNONE 
AK063850ATCCAACGGCCCAGGSimilar to Immunophilin. 
AK121481ATCCAACGGCCCAGGNONE 
J023149K16ATCCAACGGCCCAGGNONE 
J033098A18ATCCAACGGCCCAGGNONE 
J065017E05ATCCAACGGCCCAGGNONE 
J065088E24ATCCAACGGCCCAGGNONE 
J080305N16ATCCAACGGCCCAGGNONE 
J080306F22ATCCAACGGCCCAGGNONE 
J080306P07ATCCAACGGCCCAGGNONE 
J080318H06ATCCAACGGCCCAGGNONE 
J090013M21ATCCAACGGCCCAGGNONE 
J100029G11ATCCAACGGCCCAGGNONE 
Os02g0763000J065017L09TCCAACGGCTNONE 
J065036A05TCCAACGGCTNONE 
J065087C01TCCAACGGCTNONE 
J065105A14TCCAACGGCTNONE 
J065164J03TCCAACGGCTNONE 
J065175J19TCCAACGGCTNONE 
J065201H07TCCAACGGCTProtein of unknown function Cys-rich family protein. 
J075032O12TCCAACGGCTNONE 
J075085D24TCCAACGGCTNONE 
J075197C17TCCAACGGCTNONE 
J100032C19TCCAACGGCTNONE 
Os02g0766600006-039-E02CCGTTGGATNONE 
009-087-E05CCGTTGGATNONE 
013-049-E02CCGTTGGATNONE 
AK059779CCGTTGGATProtein of unknown function DUF1685 family protein. 
AK099386CCGTTGGATNONE 
J033072H02CCGTTGGATNONE 
J065045F21CCGTTGGATNONE 
J065079P05CCGTTGGATNONE 
J065121M12CCGTTGGATNONE 
J065134C23CCGTTGGATNONE 
J065140G23CCGTTGGATNONE 
J065180P12CCGTTGGATNONE 
J065212O07CCGTTGGATNONE 
J100028B03CCGTTGGATNONE 
J100030E05CCGTTGGATNONE 
J100037O12CCGTTGGATNONE 
J100050P11CCGTTGGATNONE 
J100058I07CCGTTGGATNONE 
J100059G05CCGTTGGATNONE 
J100062H11CCGTTGGATNONE 
J100064L18CCGTTGGATNONE 
J100068G08CCGTTGGATNONE 
Os02g0771200011-006-B07ATCCAACGGTCNONE 
AK066823ATCCAACGGTCConserved hypothetical protein. 
AK071059ATCCAACGGTCNONE 
J013075K03ATCCAACGGTCNONE 
Os02g0776800AB042415ATCCAACGGCTNONE 
AK072308ATCCAACGGCTReplication protein A 70kDa. 
AK101212ATCCAACGGCTNONE 
J033031B02ATCCAACGGCTNONE 
J090004E18ATCCAACGGCTNONE 
J090084C24ATCCAACGGCTNONE 
Os03g0119000006-027-A04ATCCAACGGNONE 
006-096-F10ATCCAACGGNONE 
AK071417ATCCAACGGProlyl 4-hydroxylase, alpha subunit domain containing protein. 
AK104225ATCCAACGGNONE 
AK104441ATCCAACGGNONE 
J013129D22ATCCAACGGNONE 
J023091L16ATCCAACGGNONE 
J090094H21ATCCAACGGNONE 
Os03g0123600006-064-G05ATCCAACGGCCGAAANONE 
AK101248ATCCAACGGCCGAAANONE 
AK105012ATCCAACGGCCGAAAProtein of unknown function Cys-rich family protein. 
AK109354ATCCAACGGCCGAAANONE 
J033032D06ATCCAACGGCCGAAANONE 
J080308A01ATCCAACGGCCGAAANONE 
J090071H02ATCCAACGGCCGAAANONE 
J100048C10ATCCAACGGCCGAAANONE 
Os03g0127900009-144-F12GCCGTTGGANONE 
AK062977GCCGTTGGASodium/hydrogen exchanger family protein. 
Os03g0146300011-078-E08ATCCAACGGCCNONE 
014-009-B07ATCCAACGGCCNONE 
AK121395ATCCAACGGCCSimilar to Cyclin-dependent kinases regulatory subunit. 
AY583319ATCCAACGGCCNONE 
J013104I06ATCCAACGGCCNONE 
J023130M16ATCCAACGGCCNONE 
J053037E13ATCCAACGGCCNONE 
J075104M08ATCCAACGGCCNONE 
J075144I22ATCCAACGGCCNONE 
J100057B09ATCCAACGGCCNONE 
Os03g0148000AK110468ATCCAACGGProtein of unknown function DUF677 family protein. 
Os03g0152900Os03g0152900GCCGTTGGATKinesin, motor region domain containing protein. 
Os03g0160200AK064836GCCCAGATCCAACGGCTConserved hypothetical protein. 
AK071081GCCCAGATCCAACGGCTNONE 
AK100712GCCCAGATCCAACGGCTNONE 
AK104859GCCCAGATCCAACGGCTNONE 
J013000F21GCCCAGATCCAACGGCTNONE 
J013024G05GCCCAGATCCAACGGCTNONE 
J013035E12GCCCAGATCCAACGGCTNONE 
J013041A17GCCCAGATCCAACGGCTNONE 
J013045D10GCCCAGATCCAACGGCTNONE 
J013045F04GCCCAGATCCAACGGCTNONE 
J013046F04GCCCAGATCCAACGGCTNONE 
J013047F10GCCCAGATCCAACGGCTNONE 
J013051E10GCCCAGATCCAACGGCTNONE 
J013059J07GCCCAGATCCAACGGCTNONE 
J013059O17GCCCAGATCCAACGGCTNONE 
J013060A20GCCCAGATCCAACGGCTNONE 
J013063J23GCCCAGATCCAACGGCTNONE 
J013066D19GCCCAGATCCAACGGCTNONE 
J013069O08GCCCAGATCCAACGGCTNONE 
J013088K24GCCCAGATCCAACGGCTNONE 
J013098G04GCCCAGATCCAACGGCTNONE 
J013100I15GCCCAGATCCAACGGCTNONE 
J013102E18GCCCAGATCCAACGGCTNONE 
J013102O09GCCCAGATCCAACGGCTNONE 
J013119M18GCCCAGATCCAACGGCTNONE 
J013123I19GCCCAGATCCAACGGCTNONE 
J013146H15GCCCAGATCCAACGGCTNONE 
J013149A14GCCCAGATCCAACGGCTNONE 
J023003A05GCCCAGATCCAACGGCTNONE 
J023013O19GCCCAGATCCAACGGCTNONE 
J023044M05GCCCAGATCCAACGGCTNONE 
J023048O03GCCCAGATCCAACGGCTNONE 
J023049L17GCCCAGATCCAACGGCTNONE 
J023060D22GCCCAGATCCAACGGCTNONE 
J023060F20GCCCAGATCCAACGGCTNONE 
J023069G09GCCCAGATCCAACGGCTNONE 
J023086E11GCCCAGATCCAACGGCTNONE 
J023091I09GCCCAGATCCAACGGCTNONE 
J023091M19GCCCAGATCCAACGGCTNONE 
J023101D06GCCCAGATCCAACGGCTNONE 
J023109B03GCCCAGATCCAACGGCTNONE 
J023113B14GCCCAGATCCAACGGCTNONE 
J023114B19GCCCAGATCCAACGGCTNONE 
J023115H16GCCCAGATCCAACGGCTNONE 
J023134F22GCCCAGATCCAACGGCTNONE 
J023139I06GCCCAGATCCAACGGCTNONE 
J023150C02GCCCAGATCCAACGGCTNONE 
J033033A14GCCCAGATCCAACGGCTNONE 
J033058O11GCCCAGATCCAACGGCTNONE 
J033060H13GCCCAGATCCAACGGCTNONE 
J033075P14GCCCAGATCCAACGGCTNONE 
J033084O05GCCCAGATCCAACGGCTNONE 
J033087G04GCCCAGATCCAACGGCTNONE 
J033092E18GCCCAGATCCAACGGCTNONE 
J033101G23GCCCAGATCCAACGGCTNONE 
J033112I05GCCCAGATCCAACGGCTNONE 
J033118E14GCCCAGATCCAACGGCTNONE 
J033118P04GCCCAGATCCAACGGCTNONE 
J033123C07GCCCAGATCCAACGGCTNONE 
J043003C01GCCCAGATCCAACGGCTNONE 
J043024B21GCCCAGATCCAACGGCTNONE 
J043030N04GCCCAGATCCAACGGCTNONE 
J043039J02GCCCAGATCCAACGGCTNONE 
J043039N08GCCCAGATCCAACGGCTNONE 
J075006N21GCCCAGATCCAACGGCTNONE 
J075008A16GCCCAGATCCAACGGCTNONE 
J075018J16GCCCAGATCCAACGGCTNONE 
J075023G04GCCCAGATCCAACGGCTNONE 
J075134F18GCCCAGATCCAACGGCTNONE 
J075181B05GCCCAGATCCAACGGCTNONE 
J090014O14GCCCAGATCCAACGGCTNONE 
J090020H22GCCCAGATCCAACGGCTNONE 
J090022G17GCCCAGATCCAACGGCTNONE 
J090023J24GCCCAGATCCAACGGCTNONE 
J090033H01GCCCAGATCCAACGGCTNONE 
J090038A03GCCCAGATCCAACGGCTNONE 
J090041O22GCCCAGATCCAACGGCTNONE 
J090049E10GCCCAGATCCAACGGCTNONE 
J090063E24GCCCAGATCCAACGGCTNONE 
J090080N12GCCCAGATCCAACGGCTNONE 
J100021G23GCCCAGATCCAACGGCTNONE 
J100028P06GCCCAGATCCAACGGCTNONE 
J100060L21GCCCAGATCCAACGGCTNONE 
J100077D16GCCCAGATCCAACGGCTNONE 
J100088I09GCCCAGATCCAACGGCTNONE 
Os03g0209400006-064-D01AGCCGTTGGATNONE 
AK059829AGCCGTTGGATGot1-like protein family protein. 
J075020J24AGCCGTTGGATNONE 
J075021D13AGCCGTTGGATNONE 
J075024F20AGCCGTTGGATNONE 
J075030B10AGCCGTTGGATNONE 
J075042D12AGCCGTTGGATNONE 
J075053D16AGCCGTTGGATNONE 
J075060J09AGCCGTTGGATNONE 
J075097J19AGCCGTTGGATNONE 
J075138D24AGCCGTTGGATNONE 
J100030P20AGCCGTTGGATNONE 
J100052N12AGCCGTTGGATNONE 
Os03g0214900AK100534TCCAACGGCCCAGATConserved hypothetical protein. 
Os03g0233500AK073139ATCCAACGGUBA-like domain containing protein. 
Os03g0278500AK070850CCCATCCAACGGPolyadenylate binding protein, human types 1, 2, 3, 4 family protein. 
J023031B16CCCATCCAACGGNONE 
Os03g0278900006-049-H12AGCCGTTGGATNONE 
006-082-A07AGCCGTTGGATNONE 
009-169-C04AGCCGTTGGATNONE 
AK066019AGCCGTTGGATATPase, F0 complex, subunit B/B', bacterial and chloroplast family protein. 
AK105925AGCCGTTGGATNONE 
AY224460AGCCGTTGGATNONE 
J065021K17AGCCGTTGGATNONE 
J065141H24AGCCGTTGGATNONE 
J065142J20AGCCGTTGGATNONE 
J065152J03AGCCGTTGGATNONE 
J065163A13AGCCGTTGGATNONE 
J065191I21AGCCGTTGGATNONE 
J065193K12AGCCGTTGGATNONE 
J075003D01AGCCGTTGGATNONE 
J075017D24AGCCGTTGGATNONE 
J075060F20AGCCGTTGGATNONE 
J075154C11AGCCGTTGGATNONE 
J075173F04AGCCGTTGGATNONE 
Os03g0344100009-166-F10TCCAACGGGCCNONE 
AK061903TCCAACGGGCCNONE 
AK065547TCCAACGGGCCSimilar to ASF/SF2-like pre-mRNA splicing factor SRP32''. 
J023095G24TCCAACGGGCCNONE 
J033087C06TCCAACGGGCCNONE 
J053073I09TCCAACGGGCCNONE 
J065189D11TCCAACGGGCCNONE 
J090032B15TCCAACGGGCCNONE 
Os03g0413000009-180-E02ATCCAACGGNONE 
009-188-B06ATCCAACGGNONE 
AK060225ATCCAACGGNONE 
AY062181ATCCAACGGSimilar to Potential histone-like transcription factor. 
Os03g0426900AK069123ATCCAACGGCSimilar to Heat shock protein 101. 
Os03g0431500AK110714CCGTTGGATConserved hypothetical protein. 
AK110714TCCAACGGCTConserved hypothetical protein. 
Os03g0436400003-106-E12CCGTTGGATNONE 
AK060848CCGTTGGATNONE 
AK065159CCGTTGGATNONE 
AK106105CCGTTGGATSimilar to A.thaliana gene induced upon wounding stress. 
J013002B24CCGTTGGATNONE 
J013057B14CCGTTGGATNONE 
J013153B16CCGTTGGATNONE 
J023023K10CCGTTGGATNONE 
J023093L09CCGTTGGATNONE 
J043017B21CCGTTGGATNONE 
J065104D18CCGTTGGATNONE 
J075074O11CCGTTGGATNONE 
J075145F17CCGTTGGATNONE 
J090079G21CCGTTGGATNONE 
J090095A03CCGTTGGATNONE 
J100027N18CCGTTGGATNONE 
Os03g0576900AK064861ATCCAACGGCCNONE 
J013000I01ATCCAACGGCCNONE 
J013169P21ATCCAACGGCCNONE 
J023001P03ATCCAACGGCCNONE 
J023009M10ATCCAACGGCCNONE 
J023025G11ATCCAACGGCCNONE 
J033046B19ATCCAACGGCCNONE 
J033149I10ATCCAACGGCCNONE 
J090081C04ATCCAACGGCCNONE 
Os03g0666850J065037F06CCGTTGGAConserved hypothetical protein. 
Os03g0672400AK061599TCCAACGGCCConserved hypothetical protein. 
Os03g0685500009-034-F03TCCAACGGTCNONE 
009-081-B02TCCAACGGTCNONE 
AB110171TCCAACGGTCNONE 
AK062080TCCAACGGTCCHCH domain containing protein. 
AK120726TCCAACGGTCNONE 
J013099K19TCCAACGGTCNONE 
J023002L22TCCAACGGTCNONE 
J023052G18TCCAACGGTCNONE 
J023057J22TCCAACGGTCNONE 
J023095A10TCCAACGGTCNONE 
J033097N07TCCAACGGTCNONE 
J033132H15TCCAACGGTCNONE 
J065064M10TCCAACGGTCNONE 
J065069C22TCCAACGGTCNONE 
J065202I16TCCAACGGTCNONE 
J065214M17TCCAACGGTCNONE 
J075007E07TCCAACGGTCNONE 
J075016A20TCCAACGGTCNONE 
J075036C08TCCAACGGTCNONE 
J075057C03TCCAACGGTCNONE 
J075064H21TCCAACGGTCNONE 
J075078B13TCCAACGGTCNONE 
J075078D01TCCAACGGTCNONE 
J075087P03TCCAACGGTCNONE 
J075091N16TCCAACGGTCNONE 
J075110P14TCCAACGGTCNONE 
J075116J17TCCAACGGTCNONE 
J075148J23TCCAACGGTCNONE 
J075171C20TCCAACGGTCNONE 
J075175K20TCCAACGGTCNONE 
J080035F24TCCAACGGTCNONE 
J080058E06TCCAACGGTCNONE 
J080086E16TCCAACGGTCNONE 
J080301L22TCCAACGGTCNONE 
J080304O06TCCAACGGTCNONE 
J080305N09TCCAACGGTCNONE 
J080306J16TCCAACGGTCNONE 
J080306N17TCCAACGGTCNONE 
J080311O12TCCAACGGTCNONE 
J080315L06TCCAACGGTCNONE 
J080317H12TCCAACGGTCNONE 
J080317O05TCCAACGGTCNONE 
J080318L22TCCAACGGTCNONE 
J090065J21TCCAACGGTCNONE 
J090070G13TCCAACGGTCNONE 
J100028F03TCCAACGGTCNONE 
J100073D05TCCAACGGTCNONE 
Os03g0695400AK070048ATCCAACGGTCAnkyrin repeat containing protein. 
Os03g0702000011-023-H12GCCGTTGGATNONE 
AK105398GCCGTTGGATNONE 
AK119905GCCGTTGGATUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
AK121682GCCGTTGGATNONE 
J033070B15GCCGTTGGATNONE 
J033117B11GCCGTTGGATNONE 
Os03g0711400AK100286ATCCAACGGSimilar to Coatomer alpha subunit. 
Os03g0713100J013039M09ATCCAACGGCTNONE 
J023007K01ATCCAACGGCTNONE 
J023073H01ATCCAACGGCTNONE 
J023087M20ATCCAACGGCTNONE 
J023142E01ATCCAACGGCTNONE 
J033048E03ATCCAACGGCTNONE 
J033048F03ATCCAACGGCTSimilar to Dynamin-related protein 1C (Dynamin-like protein C) (Dynamin-like protein 5) (Dynamin-like protein DLP1). 
J033058C11ATCCAACGGCTNONE 
J033074M20ATCCAACGGCTNONE 
J033084M11ATCCAACGGCTNONE 
J033091I23ATCCAACGGCTNONE 
J033100C08ATCCAACGGCTNONE 
J033123K19ATCCAACGGCTNONE 
J090006P21ATCCAACGGCTNONE 
J090045O16ATCCAACGGCTNONE 
J100087M13ATCCAACGGCTNONE 
Os03g0753600AK067449ATCCAACGGCChromo domain containing protein. 
J013107L13ATCCAACGGCNONE 
Os03g0758500016-015-D02ATCCAACGGNONE 
AK059403ATCCAACGGNONE 
AK102002ATCCAACGGPlastocyanin-like domain containing protein. 
J033079N03ATCCAACGGNONE 
J065012M05ATCCAACGGNONE 
J065045H19ATCCAACGGNONE 
J065050J08ATCCAACGGNONE 
J075189D02ATCCAACGGNONE 
J090018L03ATCCAACGGNONE 
J100043O22ATCCAACGGNONE 
J100088G17ATCCAACGGNONE 
Os03g0770900AK106660TCCAACGGCTConserved hypothetical protein. 
Os03g0780400011-100-D09AGCCGTTGGATNONE 
AK061347AGCCGTTGGATNONE 
AK073162AGCCGTTGGATSimilar to Actin-depolymerizing factor 6 (ADF-6) (AtADF6). 
J065043E22AGCCGTTGGATNONE 
J065045I07AGCCGTTGGATNONE 
J090036F17AGCCGTTGGATNONE 
J090077M14AGCCGTTGGATNONE 
J100055G20AGCCGTTGGATNONE 
Os03g0788600AK069046CCGTTGGABeta-Ig-H3/fasciclin domain containing protein. 
AK106114CCGTTGGANONE 
J023009K09CCGTTGGANONE 
J033022M06CCGTTGGANONE 
J033033H18CCGTTGGANONE 
J033098E16CCGTTGGANONE 
J065138K19CCGTTGGANONE 
J065163G19CCGTTGGANONE 
J090029F21CCGTTGGANONE 
J100031D24CCGTTGGANONE 
J100047O10CCGTTGGANONE 
J100052E07CCGTTGGANONE 
J100055F20CCGTTGGANONE 
J100055O09CCGTTGGANONE 
J100065I23CCGTTGGANONE 
Os03g0799000013-010-A07GACCGTTGGATGGGNONE 
013-081-H02GACCGTTGGATGGGNONE 
AK067840GACCGTTGGATGGGSimilar to Histone H1. 
AK099211GACCGTTGGATGGGNONE 
J065066F23GACCGTTGGATGGGNONE 
J065138O20GACCGTTGGATGGGNONE 
J065163G22GACCGTTGGATGGGNONE 
J065211J01GACCGTTGGATGGGNONE 
J080027D02GACCGTTGGATGGGNONE 
J080029E20GACCGTTGGATGGGNONE 
J080045D03GACCGTTGGATGGGNONE 
J080060G13GACCGTTGGATGGGNONE 
J080067E14GACCGTTGGATGGGNONE 
J080067J04GACCGTTGGATGGGNONE 
J080067J21GACCGTTGGATGGGNONE 
J080068L09GACCGTTGGATGGGNONE 
J080077E15GACCGTTGGATGGGNONE 
J080078B03GACCGTTGGATGGGNONE 
J080086H09GACCGTTGGATGGGNONE 
J090095G02GACCGTTGGATGGGNONE 
J100058H04GACCGTTGGATGGGNONE 
Os03g0808600AK066615TCCAACGGCSimilar to Calcium-dependent protein kinase. 
Os03g0826400AK071472CCGTTGGATRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J023095J08CCGTTGGATNONE 
Os03g0837300AK111243ATCCAACGGNONE 
AK121140ATCCAACGGNicotinate phosphoribosyltransferase and related family protein. 
AY214337ATCCAACGGNONE 
J023077G12ATCCAACGGNONE 
J023078M10ATCCAACGGNONE 
J033031B10ATCCAACGGNONE 
J033067L18ATCCAACGGNONE 
J043005P09ATCCAACGGNONE 
J090013J15ATCCAACGGNONE 
J090042E10ATCCAACGGNONE 
J090045A20ATCCAACGGNONE 
J100022H02ATCCAACGGNONE 
Os03g0850600AK067191GGCCGTTGGATConserved hypothetical protein. 
J013095N12GGCCGTTGGATNONE 
J065214L06GGCCGTTGGATNONE 
J075093J10GGCCGTTGGATNONE 
Os04g0231800AK068417TCCAACGGNONE 
J013153L19TCCAACGGNONE 
J065020J04TCCAACGGNONE 
J065201K08TCCAACGGNONE 
J065214C10TCCAACGGNONE 
Os04g0271700AK059031ATCCAACGGCCCCACCUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
AK070110ATCCAACGGCCCCACCNONE 
AK099145ATCCAACGGCCCCACCNONE 
J065045A03ATCCAACGGCCCCACCNONE 
Os04g0388900AK063224CCGTTGGATSimilar to U6 snRNA-associated Sm-like protein LSm6 (Sm protein F). 
J065037N19CCGTTGGATNONE 
J065148P22CCGTTGGATNONE 
J075040G12CCGTTGGATNONE 
Os04g0462500006-073-E08TCCAACGGNONE 
AK062065TCCAACGGNONE 
AK071311TCCAACGGSimilar to 14-3-3-like protein GF14-6. 
AK071822TCCAACGGNONE 
AK099243TCCAACGGNONE 
AK101938TCCAACGGNONE 
J013056F02TCCAACGGNONE 
J023020E08TCCAACGGNONE 
J023085B16TCCAACGGNONE 
J023117D08TCCAACGGNONE 
J023133K12TCCAACGGNONE 
J033025G04TCCAACGGNONE 
J033052A15TCCAACGGNONE 
J033074G16TCCAACGGNONE 
J033090A16TCCAACGGNONE 
J033122A07TCCAACGGNONE 
J033133G09TCCAACGGNONE 
J065002F16TCCAACGGNONE 
J065030M09TCCAACGGNONE 
J065056B11TCCAACGGNONE 
J065115I10TCCAACGGNONE 
J065120O09TCCAACGGNONE 
J065124G21TCCAACGGNONE 
J075031C14TCCAACGGNONE 
J075040H07TCCAACGGNONE 
J075047F04TCCAACGGNONE 
J075065F14TCCAACGGNONE 
J075066G20TCCAACGGNONE 
J075105D01TCCAACGGNONE 
J075147B04TCCAACGGNONE 
J075149A12TCCAACGGNONE 
J075172D07TCCAACGGNONE 
J075190J11TCCAACGGNONE 
J090038H18TCCAACGGNONE 
J090087G05TCCAACGGNONE 
J100025A10TCCAACGGNONE 
J100025O10TCCAACGGNONE 
J100027D02TCCAACGGNONE 
J100027P06TCCAACGGNONE 
J100032K04TCCAACGGNONE 
J100056D21TCCAACGGNONE 
J100060J08TCCAACGGNONE 
J100063N19TCCAACGGNONE 
J100064C14TCCAACGGNONE 
J100064K18TCCAACGGNONE 
J100070L21TCCAACGGNONE 
J100072M17TCCAACGGNONE 
J100074F21TCCAACGGNONE 
J100087E05TCCAACGGNONE 
U65956TCCAACGGNONE 
Os04g0532500AK069907CCGTTGGASimilar to Transcription factor L2. 
J023001J11CCGTTGGANONE 
J023034B15CCGTTGGANONE 
J023034M24CCGTTGGANONE 
J023066O20CCGTTGGANONE 
J023126L17CCGTTGGANONE 
J023128C10CCGTTGGANONE 
J023143E06CCGTTGGANONE 
J023148M01CCGTTGGANONE 
Os04g0552400AK069623CCGTTGGASimilar to ZPT2-13. 
J023023M18CCGTTGGANONE 
J023063H11CCGTTGGANONE 
Os04g0558700AK110633ATCCAACGGCTConserved hypothetical protein. 
Os04g0578400AK060559AGCCGTTGGATSimilar to Beta-ring hydroxylase (Fragment). 
Os04g0623700AK071587CCGTTGGATNONE 
J023101P16CCGTTGGATNONE 
J100044N20CCGTTGGATNONE 
J100052H13CCGTTGGATNONE 
J100075E05CCGTTGGATNONE 
Y10118CCGTTGGATSimilar to Signal recognition particle 14 kDa protein (SRP14). 
Os04g0674700AK106615ATCCAACGGSimilar to AMP-binding protein (Adenosine monophosphate binding protein 5 AMPBP5). 
J100049J02ATCCAACGGNONE 
Os05g0110900AK073169CCGTTGGATGCCCATCCGACGGSimilar to Protein kinase APK1B, chloroplast precursor (EC 2.7.1.-). 
Os05g0295800AK070232CCGTTGGASimilar to Glyoxalase I (EC 4.4.1.5). 
J023043J03CCGTTGGANONE 
Os05g0305200J065161N15ATCCAACGGTRAF-like domain containing protein. 
Os05g0342100AK111106ATCCAACGGWound-induced WI12 family protein. 
Os05g0350500013-071-D05GCCGTTGGATNONE 
AF020787GCCGTTGGATNONE 
AK061712GCCGTTGGATNONE 
AK102897GCCGTTGGATProliferation-associated protein 1 family protein. 
J033060G23GCCGTTGGATNONE 
J033112P14GCCGTTGGATNONE 
J033127J04GCCGTTGGATNONE 
J090015L18GCCGTTGGATNONE 
J090047K03GCCGTTGGATNONE 
J090097J17GCCGTTGGATNONE 
Os05g0357850J065118C17CCGTTGGATHypothetical protein. 
J065159C03CCGTTGGATNONE 
Os05g0378900AK103841CCGTTGGATConserved hypothetical protein. 
J033148I18CCGTTGGATNONE 
J065085F12CCGTTGGATNONE 
J075041H24CCGTTGGATNONE 
J075180P06CCGTTGGATNONE 
Os05g0399100004-005-F03CCGTTGGATNONE 
009-087-E06CCGTTGGATNONE 
AK060876CCGTTGGATNONE 
J013045L10CCGTTGGATNONE 
J065010F04CCGTTGGATNONE 
J065211L20CCGTTGGATNONE 
J090068A12CCGTTGGATNONE 
J090098N18CCGTTGGATNONE 
Os05g0413200006-067-C03CCCATCCAACGGCCNONE 
006-080-C03CCCATCCAACGGCCNONE 
006-095-G10CCCATCCAACGGCCNONE 
006-115-G11CCCATCCAACGGCCNONE 
013-040-E05CCCATCCAACGGCCNONE 
AB104732CCCATCCAACGGCCNONE 
AK122099CCCATCCAACGGCCBeta-tubulin. 
J033087H20CCCATCCAACGGCCNONE 
J033117C18CCCATCCAACGGCCNONE 
J033125G10CCCATCCAACGGCCNONE 
Os05g0422900AK073629ATCCAACGGConserved hypothetical protein. 
J023126I07ATCCAACGGNONE 
J023143K12ATCCAACGGNONE 
J033051N08ATCCAACGGNONE 
J033128I04ATCCAACGGNONE 
J065067M02ATCCAACGGNONE 
J080312N05ATCCAACGGNONE 
J100032G23ATCCAACGGNONE 
Os05g0445500009-021-C05ATCCAACGGNONE 
009-129-D11ATCCAACGGNONE 
009-147-E04ATCCAACGGNONE 
009-169-C11ATCCAACGGNONE 
AK121459ATCCAACGGSimilar to 60S acidic ribosomal protein P2B. 
D21114ATCCAACGGNONE 
J023001K23ATCCAACGGNONE 
J023107J19ATCCAACGGNONE 
J023143J09ATCCAACGGNONE 
J065049D04ATCCAACGGNONE 
J065092I06ATCCAACGGNONE 
J065188H04ATCCAACGGNONE 
Os05g0456000AK058420ATCCAACGGTCCAGAMitochondrial glycoprotein family protein. 
AK102036ATCCAACGGTCCAGANONE 
J065066F02ATCCAACGGTCCAGANONE 
Os05g0466600009-088-F09CTCCCCCATCCAACGGCNONE 
009-105-C11CTCCCCCATCCAACGGCNONE 
009-156-C06CTCCCCCATCCAACGGCNONE 
AK119240CTCCCCCATCCAACGGChistone H4 [Oryza sativa (japonica cultivar-group)]. 
Os05g0491200AK068637ATCCAACGGCSimilar to SNF1 kinase complex anchoring protein (Fragment). 
AK071229ATCCAACGGCNONE 
Os05g0519700014-100-B04ATCCAACGGNONE 
AF332981ATCCAACGGNONE 
AK100903ATCCAACGGNONE 
AK105433ATCCAACGGHeat shock protein 101. 
Os05g0519800AK069435ATCCAACGGCTProtein of unknown function DUF28 family protein. 
J023024L22ATCCAACGGCTNONE 
Os05g0560600011-097-B07ATCCAACGGCNONE 
AK067862ATCCAACGGCNONE 
AK122091ATCCAACGGCHomeodomain-like containing protein. 
J013124K11ATCCAACGGCNONE 
J033124C04ATCCAACGGCNONE 
J065013L06ATCCAACGGCNONE 
J065117J23ATCCAACGGCNONE 
Os05g0567100015-030-G11ATCCAACGGCTNONE 
AK066453ATCCAACGGCTNONE 
AK067742ATCCAACGGCTNONE 
AK098906ATCCAACGGCTNONE 
AK098911ATCCAACGGCTNONE 
AK103421ATCCAACGGCTNONE 
AK104838ATCCAACGGCTNONE 
D32144ATCCAACGGCTAspartic proteinase oryzasin 1 precursor (EC 3.4.23.-). 
J013002D14ATCCAACGGCTNONE 
J013002H22ATCCAACGGCTNONE 
J013022G01ATCCAACGGCTNONE 
J013039N15ATCCAACGGCTNONE 
J023007F19ATCCAACGGCTNONE 
J023107B10ATCCAACGGCTNONE 
J033038D21ATCCAACGGCTNONE 
J033043E23ATCCAACGGCTNONE 
J033061A06ATCCAACGGCTNONE 
Os05g0571600Os05g0571600ATCCAACGGConserved hypothetical protein. 
Os05g0571600ATCCAACGGCConserved hypothetical protein. 
Os05g0571800009-157-G07ATCCAACGGNONE 
009-157-G07ATCCAACGGCNONE 
AK063033ATCCAACGGConserved hypothetical protein. 
AK063033ATCCAACGGCConserved hypothetical protein. 
Os05g0574500006-021-A08ATCCAACGGCCNONE 
006-049-A11ATCCAACGGCCNONE 
006-086-F03ATCCAACGGCCNONE 
009-051-F06ATCCAACGGCCNONE 
AB015287ATCCAACGGCCNONE 
AB015972ATCCAACGGCCNONE 
AK061714ATCCAACGGCCNONE 
AK098889ATCCAACGGCCNONE 
AK121699ATCCAACGGCCSimilar to GTP-binding nuclear protein Ran1B (Fragment). 
J013001L15ATCCAACGGCCNONE 
J013072D17ATCCAACGGCCNONE 
J023028M04ATCCAACGGCCNONE 
J023031F01ATCCAACGGCCNONE 
J023114L22ATCCAACGGCCNONE 
J033058L12ATCCAACGGCCNONE 
J033073D17ATCCAACGGCCNONE 
J043031D08ATCCAACGGCCNONE 
J043036G01ATCCAACGGCCNONE 
J065144O04ATCCAACGGCCNONE 
J065181O08ATCCAACGGCCNONE 
J080066B20ATCCAACGGCCNONE 
Os05g0596200009-059-G06GACACGTGAGCCGTTGGATNONE 
AK062521GACACGTGAGCCGTTGGATNONE 
AK107887GACACGTGAGCCGTTGGATConserved hypothetical protein. 
AK108209GACACGTGAGCCGTTGGATNONE 
J065154B01GACACGTGAGCCGTTGGATNONE 
Os06g0107800009-133-F03TCCGGGCCGTTGGATNONE 
AK062921TCCGGGCCGTTGGATSimilar to RAV-like protein. 
Os06g0128400AK064390ATCCAACGGNONE 
AK064390ATCCAACGGCNONE 
AK121983ATCCAACGGWD40-like domain containing protein. 
AK121983ATCCAACGGCWD40-like domain containing protein. 
Os06g0134000AJ417525ATCCAACGGCCNONE 
AJ417525ATCCAACGGCCNONE 
AK062184ATCCAACGGCCNONE 
AK062184ATCCAACGGCCNONE 
AK106717ATCCAACGGCCSimilar to 40S ribosomal protein S20. 
AK106717ATCCAACGGCCSimilar to 40S ribosomal protein S20. 
AK120319ATCCAACGGCCNONE 
AK120319ATCCAACGGCCNONE 
D10402ATCCAACGGCCNONE 
D10402ATCCAACGGCCNONE 
D12632ATCCAACGGCCNONE 
D12632ATCCAACGGCCNONE 
J013056N13ATCCAACGGCCNONE 
J013056N13ATCCAACGGCCNONE 
J023100G01ATCCAACGGCCNONE 
J023100G01ATCCAACGGCCNONE 
J053059F04ATCCAACGGCCNONE 
J053059F04ATCCAACGGCCNONE 
J053068M21ATCCAACGGCCNONE 
J053068M21ATCCAACGGCCNONE 
J053078H15ATCCAACGGCCNONE 
J053078H15ATCCAACGGCCNONE 
J065050O15ATCCAACGGCCNONE 
J065050O15ATCCAACGGCCNONE 
J065060G15ATCCAACGGCCNONE 
J065060G15ATCCAACGGCCNONE 
J065080K10ATCCAACGGCCNONE 
J065080K10ATCCAACGGCCNONE 
J065108G05ATCCAACGGCCNONE 
J065108G05ATCCAACGGCCNONE 
J065186K16ATCCAACGGCCNONE 
J065186K16ATCCAACGGCCNONE 
J075150J12ATCCAACGGCCNONE 
J075150J12ATCCAACGGCCNONE 
J080002I18ATCCAACGGCCNONE 
J080002I18ATCCAACGGCCNONE 
J080005H04ATCCAACGGCCNONE 
J080005H04ATCCAACGGCCNONE 
J080008I06ATCCAACGGCCNONE 
J080008I06ATCCAACGGCCNONE 
J080010G20ATCCAACGGCCNONE 
J080010G20ATCCAACGGCCNONE 
J080010N10ATCCAACGGCCNONE 
J080010N10ATCCAACGGCCNONE 
J080018H02ATCCAACGGCCNONE 
J080018H02ATCCAACGGCCNONE 
J080022O14ATCCAACGGCCNONE 
J080022O14ATCCAACGGCCNONE 
J080023F23ATCCAACGGCCNONE 
J080023F23ATCCAACGGCCNONE 
J080025D16ATCCAACGGCCNONE 
J080025D16ATCCAACGGCCNONE 
J080027L12ATCCAACGGCCNONE 
J080027L12ATCCAACGGCCNONE 
J080030F16ATCCAACGGCCNONE 
J080030F16ATCCAACGGCCNONE 
J080038N04ATCCAACGGCCNONE 
J080038N04ATCCAACGGCCNONE 
J080048O17ATCCAACGGCCNONE 
J080048O17ATCCAACGGCCNONE 
J080056B05ATCCAACGGCCNONE 
J080056B05ATCCAACGGCCNONE 
J080061D02ATCCAACGGCCNONE 
J080061D02ATCCAACGGCCNONE 
J080062H18ATCCAACGGCCNONE 
J080062H18ATCCAACGGCCNONE 
J080064E06ATCCAACGGCCNONE 
J080064E06ATCCAACGGCCNONE 
J080066D23ATCCAACGGCCNONE 
J080066D23ATCCAACGGCCNONE 
J080071F08ATCCAACGGCCNONE 
J080071F08ATCCAACGGCCNONE 
J080089E06ATCCAACGGCCNONE 
J080089E06ATCCAACGGCCNONE 
J080089K22ATCCAACGGCCNONE 
J080089K22ATCCAACGGCCNONE 
J080091C18ATCCAACGGCCNONE 
J080091C18ATCCAACGGCCNONE 
J080095G10ATCCAACGGCCNONE 
J080095G10ATCCAACGGCCNONE 
J090038G01ATCCAACGGCCNONE 
J090038G01ATCCAACGGCCNONE 
J090062K07ATCCAACGGCCNONE 
J090062K07ATCCAACGGCCNONE 
J100051G19ATCCAACGGCCNONE 
J100051G19ATCCAACGGCCNONE 
Os06g0140100011-063-A02TCCAACGGCCCGTTNONE 
AK063371TCCAACGGCCCGTTLeucine carboxyl methyltransferase family protein. 
Os06g0146300AK101052CCGTTGGATConserved hypothetical protein. 
J075003H04CCGTTGGATNONE 
J075039J08CCGTTGGATNONE 
J075054H14CCGTTGGATNONE 
J075091E08CCGTTGGATNONE 
J075097L20CCGTTGGATNONE 
J075179P07CCGTTGGATNONE 
Os06g0152800003-125-D04TCCAACGGCTNONE 
AK099578TCCAACGGCTConserved hypothetical protein. 
Os06g0172000AK068738ATCCAACGGTCBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
Os06g0179700AK065602GACCGTTGGATSimilar to DNA-binding protein phosphatase 2C. 
Os06g0212900AK071518ATCCAACGGTCHeat shock protein Hsp70 family protein. 
AK104048ATCCAACGGTCNONE 
J023019O18ATCCAACGGTCNONE 
J023090N13ATCCAACGGTCNONE 
J023101M15ATCCAACGGTCNONE 
J023122F06ATCCAACGGTCNONE 
J075023H16ATCCAACGGTCNONE 
J090006J22ATCCAACGGTCNONE 
J090075F24ATCCAACGGTCNONE 
J090095A17ATCCAACGGTCNONE 
Os06g0498400AK058235TCCAACGGNONE 
Os06g0562700AK109753ATCCAACGGConserved hypothetical protein. 
Os06g0567000009-166-G12ATCCAACGGCCCACGGGNONE 
AK121337ATCCAACGGCCCACGGGProtein of unknown function UPF0197 family protein. 
J013122F01ATCCAACGGCCCACGGGNONE 
J023080N12ATCCAACGGCCCACGGGNONE 
J023120F03ATCCAACGGCCCACGGGNONE 
J065013B18ATCCAACGGCCCACGGGNONE 
J065039P21ATCCAACGGCCCACGGGNONE 
J065089E06ATCCAACGGCCCACGGGNONE 
J065095N19ATCCAACGGCCCACGGGNONE 
J065119H03ATCCAACGGCCCACGGGNONE 
J065121D18ATCCAACGGCCCACGGGNONE 
J065149G04ATCCAACGGCCCACGGGNONE 
J075012J04ATCCAACGGCCCACGGGNONE 
J075021G13ATCCAACGGCCCACGGGNONE 
J075106I23ATCCAACGGCCCACGGGNONE 
J075107F19ATCCAACGGCCCACGGGNONE 
J075152J22ATCCAACGGCCCACGGGNONE 
J075186J20ATCCAACGGCCCACGGGNONE 
J075188F16ATCCAACGGCCCACGGGNONE 
J080001G06ATCCAACGGCCCACGGGNONE 
J080002O09ATCCAACGGCCCACGGGNONE 
J080006E10ATCCAACGGCCCACGGGNONE 
J080006F24ATCCAACGGCCCACGGGNONE 
J080012L07ATCCAACGGCCCACGGGNONE 
J080016A10ATCCAACGGCCCACGGGNONE 
J080017D11ATCCAACGGCCCACGGGNONE 
J080017I04ATCCAACGGCCCACGGGNONE 
J080017I10ATCCAACGGCCCACGGGNONE 
J080020P06ATCCAACGGCCCACGGGNONE 
J080024A20ATCCAACGGCCCACGGGNONE 
J080027B10ATCCAACGGCCCACGGGNONE 
J080027E03ATCCAACGGCCCACGGGNONE 
J080027I01ATCCAACGGCCCACGGGNONE 
J080027K20ATCCAACGGCCCACGGGNONE 
J080041L12ATCCAACGGCCCACGGGNONE 
J080043D21ATCCAACGGCCCACGGGNONE 
J080044K11ATCCAACGGCCCACGGGNONE 
J080048I08ATCCAACGGCCCACGGGNONE 
J080049M12ATCCAACGGCCCACGGGNONE 
J080050C14ATCCAACGGCCCACGGGNONE 
J080050N21ATCCAACGGCCCACGGGNONE 
J080053F04ATCCAACGGCCCACGGGNONE 
J080054O16ATCCAACGGCCCACGGGNONE 
J080058O21ATCCAACGGCCCACGGGNONE 
J080059M11ATCCAACGGCCCACGGGNONE 
J080061A11ATCCAACGGCCCACGGGNONE 
J080063B15ATCCAACGGCCCACGGGNONE 
J080063F22ATCCAACGGCCCACGGGNONE 
J080066M18ATCCAACGGCCCACGGGNONE 
J080068D12ATCCAACGGCCCACGGGNONE 
J080070D22ATCCAACGGCCCACGGGNONE 
J080071B06ATCCAACGGCCCACGGGNONE 
J080072B17ATCCAACGGCCCACGGGNONE 
J080081O04ATCCAACGGCCCACGGGNONE 
J080089H05ATCCAACGGCCCACGGGNONE 
J080093K13ATCCAACGGCCCACGGGNONE 
J080095I05ATCCAACGGCCCACGGGNONE 
J080097F19ATCCAACGGCCCACGGGNONE 
J080304C03ATCCAACGGCCCACGGGNONE 
J080304H11ATCCAACGGCCCACGGGNONE 
J080308M21ATCCAACGGCCCACGGGNONE 
J080313O15ATCCAACGGCCCACGGGNONE 
J090020N23ATCCAACGGCCCACGGGNONE 
J100023C12ATCCAACGGCCCACGGGNONE 
Os06g0573700015-015-F02ATCCAACGGNONE 
AK106254ATCCAACGGConserved hypothetical protein. 
J065172G24ATCCAACGGNONE 
Os06g0598800011-079-A05ATCCAACGGNONE 
014-040-G10ATCCAACGGNONE 
AK101377ATCCAACGGSimilar to Fatty acid elongase 1-like protein. 
J013022A17ATCCAACGGNONE 
J023011B05ATCCAACGGNONE 
J023104L12ATCCAACGGNONE 
J033033O20ATCCAACGGNONE 
J033036C04ATCCAACGGNONE 
J065060C17ATCCAACGGNONE 
J075009D16ATCCAACGGNONE 
J075123K20ATCCAACGGNONE 
J075191A14ATCCAACGGNONE 
J090038I01ATCCAACGGNONE 
Os06g0598900AK100386ATCCAACGGCSimilar to Serine-threonine kinase receptor-associated protein (UNR-interacting protein) (WD-40 repeat protein PT-WD) (MAP activator with WD repeats). 
J013088O05ATCCAACGGCNONE 
J090043L20ATCCAACGGCNONE 
Os06g0608300AK102908TCCAACGGSimilar to Small nuclear ribonucleoprotein component. 
Os06g0638350J090023G17ATCCAACGGExostosin-like family protein. 
J090058M19ATCCAACGGNONE 
Os06g0652000AB096015ATCCAACGGCCNONE 
AB120430ATCCAACGGCCNONE 
AK069977ATCCAACGGCCSimilar to T3/T7-like RNA polymerase (Fragment). 
J023038J05ATCCAACGGCCNONE 
J033126K18ATCCAACGGCCNONE 
J043039G23ATCCAACGGCCNONE 
J090084C08ATCCAACGGCCNONE 
Os06g0663600AK100787CCGTTGGATEndonuclease V family protein. 
Os06g0664400Os06g0664400ATCCAACGGCCCAGAHMG-I and HMG-Y, DNA-binding domain containing protein. 
Os06g0714000AK069538ATCCAACGGProtein of unknown function UPF0183 family protein. 
J023020A02ATCCAACGGNONE 
J023039H03ATCCAACGGNONE 
J100042E23ATCCAACGGNONE 
J100069N01ATCCAACGGNONE 
J100089L13ATCCAACGGNONE 
Os07g0115300006-039-C05ATCCAACGGCCNONE 
AK061511ATCCAACGGCCSimilar to Peroxidase2 precursor (EC 1.11.1.7). 
Os07g0167200003-103-H10ATCCAACGGCTNONE 
012-001-G01ATCCAACGGCTNONE 
AK120608ATCCAACGGCTSimilar to Zinc finger POZ domain protein (Fragment). 
J023093N23ATCCAACGGCTNONE 
J100059P15ATCCAACGGCTNONE 
Os07g0296200AK064362CCGTTGGARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
AK103153CCGTTGGANONE 
J033120O12CCGTTGGANONE 
Os07g0408500AK103596AGCCGTTGGASimilar to Rac GTPase activating protein 3 (Fragment). 
Os07g0474300AK108961ATCCAACGGTCConserved hypothetical protein. 
AK108961GATCCGACCGTTGGAConserved hypothetical protein. 
Os07g0516900009-108-C10ATCCAACGGCNONE 
AK062798ATCCAACGGCNONE 
Os07g0530600AK120747TCCAACGGCProtein of unknown function DUF299 family protein. 
Os07g0531500J065122B10TCCAACGGCCHarpin-induced 1 domain containing protein. 
Os07g0586700AK102792ATCCAACGGCCConserved hypothetical protein. 
Os07g0594400J065137M02CCGTTGGAConserved hypothetical protein. 
J065218E03CCGTTGGANONE 
Os07g0631000AK066723ATCCAACGGProtein of unknown function DUF298 family protein. 
Os07g0657600J065001N02AGCCGTTGGATNONE 
J065002E03AGCCGTTGGATDNA glycosylase family protein. 
Os07g0681000AK066982CCGTTGGATSimilar to Eukaryotic translation initiation factor 2 beta subunit (eIF-2-beta) (P38). 
Os07g0688300AK068325GACCGTTGGASimilar to Importin alpha 1. 
AK099611GACCGTTGGANONE 
Os08g0369400J065116P10ATCCAACGGTCAnkyrin repeat containing protein. 
Os08g0440100AK068551CCGTTGGATSimilar to Temperature stress-induced lipocalin. 
J013155M04CCGTTGGATNONE 
J033041C20CCGTTGGATNONE 
J043031L02CCGTTGGATNONE 
J043038J23CCGTTGGATNONE 
J065006F20CCGTTGGATNONE 
J065030H05CCGTTGGATNONE 
J065069H05CCGTTGGATNONE 
J065078M19CCGTTGGATNONE 
J065146E24CCGTTGGATNONE 
J065154J17CCGTTGGATNONE 
J065158L04CCGTTGGATNONE 
J065182J20CCGTTGGATNONE 
J065211P16CCGTTGGATNONE 
J075020M18CCGTTGGATNONE 
J075035J01CCGTTGGATNONE 
J075037K13CCGTTGGATNONE 
J075052E12CCGTTGGATNONE 
J075056I12CCGTTGGATNONE 
J075064H18CCGTTGGATNONE 
J075121E06CCGTTGGATNONE 
J075123H03CCGTTGGATNONE 
J075146P20CCGTTGGATNONE 
J075156O06CCGTTGGATNONE 
J075158A14CCGTTGGATNONE 
J075169L03CCGTTGGATNONE 
J090013K02CCGTTGGATNONE 
Os08g0473600011-035-H09CCGTTGGANONE 
011-052-E06CCGTTGGANONE 
012-004-D02CCGTTGGANONE 
012-006-G11CCGTTGGANONE 
012-025-G01CCGTTGGANONE 
012-026-E10CCGTTGGANONE 
012-034-F07CCGTTGGANONE 
012-038-A04CCGTTGGANONE 
012-043-A07CCGTTGGANONE 
012-050-C12CCGTTGGANONE 
012-060-A06CCGTTGGANONE 
012-062-A07CCGTTGGANONE 
012-066-G07CCGTTGGANONE 
012-067-G12CCGTTGGANONE 
012-075-F02CCGTTGGANONE 
012-082-H06CCGTTGGANONE 
012-088-C08CCGTTGGANONE 
012-088-D06CCGTTGGANONE 
012-089-D12CCGTTGGANONE 
012-091-H05CCGTTGGANONE 
012-092-C06CCGTTGGANONE 
012-093-H01CCGTTGGANONE 
012-100-C09CCGTTGGANONE 
013-033-C02CCGTTGGANONE 
014-042-F10CCGTTGGANONE 
014-050-E03CCGTTGGANONE 
014-075-F10CCGTTGGANONE 
015-004-G11CCGTTGGANONE 
015-005-E07CCGTTGGANONE 
015-005-G08CCGTTGGANONE 
015-013-D03CCGTTGGANONE 
015-013-F04CCGTTGGANONE 
015-017-D03CCGTTGGANONE 
015-048-D02CCGTTGGANONE 
015-049-D02CCGTTGGANONE 
015-092-F03CCGTTGGANONE 
016-019-H02CCGTTGGANONE 
016-027-F03CCGTTGGANONE 
016-096-D06CCGTTGGANONE 
AK064071CCGTTGGANONE 
AK064300CCGTTGGAAlpha-amylase isozyme 3E precursor (EC 3.2.1.1) (1,4-alpha-D-glucan glucanohydrolase). 
AK103413CCGTTGGANONE 
AK106526CCGTTGGANONE 
J033030A15CCGTTGGANONE 
J033040E10CCGTTGGANONE 
J033057P15CCGTTGGANONE 
J033127G12CCGTTGGANONE 
J033128G11CCGTTGGANONE 
J053054F05CCGTTGGANONE 
J065006J19CCGTTGGANONE 
J065007M11CCGTTGGANONE 
J065013H10CCGTTGGANONE 
J065015G17CCGTTGGANONE 
J065019C10CCGTTGGANONE 
J065020H22CCGTTGGANONE 
J065022H12CCGTTGGANONE 
J065024C08CCGTTGGANONE 
J065029F11CCGTTGGANONE 
J065036D04CCGTTGGANONE 
J065039F22CCGTTGGANONE 
J065042G09CCGTTGGANONE 
J065045L16CCGTTGGANONE 
J065046M13CCGTTGGANONE 
J065049E18CCGTTGGANONE 
J065052H21CCGTTGGANONE 
J065053G17CCGTTGGANONE 
J065066H10CCGTTGGANONE 
J065069M24CCGTTGGANONE 
J065070P07CCGTTGGANONE 
J065073O06CCGTTGGANONE 
J065078G19CCGTTGGANONE 
J065082P16CCGTTGGANONE 
J065086P15CCGTTGGANONE 
J065093H11CCGTTGGANONE 
J065097A14CCGTTGGANONE 
J065103D19CCGTTGGANONE 
J065105A18CCGTTGGANONE 
J065108N23CCGTTGGANONE 
J065109N14CCGTTGGANONE 
J065121K22CCGTTGGANONE 
J065122C18CCGTTGGANONE 
J065129L03CCGTTGGANONE 
J065130B11CCGTTGGANONE 
J065135P07CCGTTGGANONE 
J065139B03CCGTTGGANONE 
J065144O11CCGTTGGANONE 
J065163I17CCGTTGGANONE 
J065163J15CCGTTGGANONE 
J065177G16CCGTTGGANONE 
J065186D17CCGTTGGANONE 
J065187D02CCGTTGGANONE 
J065188L03CCGTTGGANONE 
J065191L02CCGTTGGANONE 
J065193F09CCGTTGGANONE 
J065197J03CCGTTGGANONE 
J065200F07CCGTTGGANONE 
J065208K11CCGTTGGANONE 
J065211I22CCGTTGGANONE 
J065213O22CCGTTGGANONE 
J065213P22CCGTTGGANONE 
Os08g0483600AK099543CCGTTGGATConserved hypothetical protein. 
J100053G23CCGTTGGATNONE 
J100084K09CCGTTGGATNONE 
Os08g0485400AK068155CCGTTGGASimilar to 2-nitropropane dioxygenase-like protein. 
AK100705CCGTTGGANONE 
J065112C18CCGTTGGANONE 
J065217I09CCGTTGGANONE 
J100073C22CCGTTGGANONE 
J100073F01CCGTTGGANONE 
J100082I01CCGTTGGANONE 
Os08g0485700AK068131CCAAGCCCAGATCCAACGGTCNONE 
AK069097CCAAGCCCAGATCCAACGGTCMethyl-CpG binding domain containing protein. 
J013130L03CCAAGCCCAGATCCAACGGTCNONE 
Os08g0523600009-189-E05ATCCAACGGNONE 
AK063901ATCCAACGGSimilar to CTV.22. 
Os08g0558000J080005K14ATCCAACGGCTNONE 
Os08g0558400AK071334ATCCAACGGCCSimilar to Kinesin heavy chain (Fragment). 
Os09g0103700AK071092CCGTTGGAZinc finger, CCHC-type domain containing protein. 
J023079K08CCGTTGGANONE 
J033029O16CCGTTGGANONE 
J033044A14CCGTTGGANONE 
J033046C06CCGTTGGANONE 
J033124N19CCGTTGGANONE 
J033126D01CCGTTGGANONE 
J075027F13CCGTTGGANONE 
J075115L11CCGTTGGANONE 
Os09g0127800AK103786ATCCAACGGCSimilar to Coatomer alpha subunit. 
Os09g0244200AK065536CCGTTGGATConserved hypothetical protein. 
Os09g0315200006-022-A10ATCCAACGGNONE 
AK105900ATCCAACGGConserved hypothetical protein. 
Os09g0319800AK066759CCGTTGGATerpenoid cylases/protein prenyltransferase alpha-alpha toroid domain containing protein. 
Os09g0322300AK107151ATCCAACGGHypothetical protein. 
AK107151ATCCAACGGTCCAGAHypothetical protein. 
J075023P17ATCCAACGGNONE 
J075023P17ATCCAACGGTCCAGANONE 
J075143O05ATCCAACGGNONE 
J075143O05ATCCAACGGTCCAGANONE 
Os09g0358500Os09g0358500ATCCAACGGCCNONE 
Os09g0439400AK121407ATCCAACGGCTGCGGTGCGVirulence factor, pectin lyase fold family protein. 
Os09g0458200AK108675ATCCAACGGConserved hypothetical protein. 
Os09g0464000AK060777ATCCAACGGCCNONE 
AK069530ATCCAACGGCCSimilar to Carbonate dehydratase-like protein. 
Os09g0526600011-054-D09CCGTTGGANONE 
AK105409CCGTTGGANONE 
Os09g0536000AK103074TCCAACGGCExodeoxyribonuclease III xth family protein. 
J033128L03TCCAACGGCNONE 
Os09g0538450J080302B10AGCCGTTGGAHypothetical protein. 
Os09g0547200016-021-H03GGTGGGGCCCACTCCAACGGNONE 
AK073078GGTGGGGCCCACTCCAACGGProtein of unknown function DUF292, eukaryotic domain containing protein. 
AK104984GGTGGGGCCCACTCCAACGGNONE 
J065005L05GGTGGGGCCCACTCCAACGGNONE 
J065039C06GGTGGGGCCCACTCCAACGGNONE 
J065116H17GGTGGGGCCCACTCCAACGGNONE 
J100046A17GGTGGGGCCCACTCCAACGGNONE 
Os11g0112300AK120830CCGTTGGASimilar to GCN5-like protein 1 (RT14 protein homolog). 
J023019I07CCGTTGGANONE 
J053056F03CCGTTGGANONE 
J075030L11CCGTTGGANONE 
J090083G17CCGTTGGANONE 
J090085P04CCGTTGGANONE 
Os11g0132600AK102526ATCCAACGGSimilar to Arabinoxylan arabinofuranohydrolase isoenzyme AXAH-II. 
Os11g0137500AK070070GTCGAGTCCAACGGTCTranscription factor TFIIE, alpha subunit family protein. 
Os11g0206300016-010-D02CGGGCCGTTGGATNONE 
AK064170CGGGCCGTTGGATMitochodrial transcription termination factor-related family protein. 
Os11g0448400AB095094TCCAACGGTCSimilar to Sigma factor SIG2A. 
J075053H03TCCAACGGTCNONE 
J075062F23TCCAACGGTCNONE 
J090029D08TCCAACGGTCNONE 
Os11g0547000AK100677GCCGTTGGATSimilar to FKF1. 
Os11g0584100AK069971CCGTTGGATNONE 
AK106960CCGTTGGATProtein of unknown function DUF295 family protein. 
J065029I16CCGTTGGATNONE 
J075075K05CCGTTGGATNONE 
Os11g0610700012-090-B04GCCGTTGGATNONE 
AK099760GCCGTTGGATWD40-like domain containing protein. 
J065026G23GCCGTTGGATNONE 
J065062A01GCCGTTGGATNONE 
J065065J18GCCGTTGGATNONE 
J100026C05GCCGTTGGATNONE 
Os11g0703900011-004-D05ATCCAACGGCTNONE 
011-014-C03ATCCAACGGCTNONE 
011-016-C01ATCCAACGGCTNONE 
011-017-B04ATCCAACGGCTNONE 
011-017-E09ATCCAACGGCTNONE 
011-019-E12ATCCAACGGCTNONE 
011-021-H12ATCCAACGGCTNONE 
011-025-H02ATCCAACGGCTNONE 
011-027-B09ATCCAACGGCTNONE 
011-039-G07ATCCAACGGCTNONE 
011-044-G07ATCCAACGGCTNONE 
011-046-F11ATCCAACGGCTNONE 
011-070-F02ATCCAACGGCTNONE 
011-071-A07ATCCAACGGCTNONE 
011-082-A03ATCCAACGGCTNONE 
011-086-B09ATCCAACGGCTNONE 
011-092-C04ATCCAACGGCTNONE 
012-006-F02ATCCAACGGCTNONE 
012-011-G08ATCCAACGGCTNONE 
012-026-C06ATCCAACGGCTNONE 
012-026-G06ATCCAACGGCTNONE 
012-028-E05ATCCAACGGCTNONE 
012-040-A05ATCCAACGGCTNONE 
012-045-C01ATCCAACGGCTNONE 
012-046-A10ATCCAACGGCTNONE 
012-047-H09ATCCAACGGCTNONE 
012-059-A12ATCCAACGGCTNONE 
012-072-D06ATCCAACGGCTNONE 
012-073-D05ATCCAACGGCTNONE 
012-076-D08ATCCAACGGCTNONE 
012-079-G05ATCCAACGGCTNONE 
012-080-A04ATCCAACGGCTNONE 
012-080-E01ATCCAACGGCTNONE 
012-083-C03ATCCAACGGCTNONE 
012-083-G06ATCCAACGGCTNONE 
012-086-G02ATCCAACGGCTNONE 
012-091-A07ATCCAACGGCTNONE 
012-094-G10ATCCAACGGCTNONE 
012-098-A07ATCCAACGGCTNONE 
012-100-G04ATCCAACGGCTNONE 
015-001-A11ATCCAACGGCTNONE 
015-033-E01ATCCAACGGCTNONE 
015-047-F12ATCCAACGGCTNONE 
015-054-E05ATCCAACGGCTNONE 
015-063-H02ATCCAACGGCTNONE 
015-075-E10ATCCAACGGCTNONE 
015-086-F05ATCCAACGGCTNONE 
016-031-A08ATCCAACGGCTNONE 
016-053-A03ATCCAACGGCTNONE 
016-054-C09ATCCAACGGCTNONE 
016-079-C08ATCCAACGGCTNONE 
AK065431ATCCAACGGCTHeat shock protein 70. 
AK119255ATCCAACGGCTNONE 
J013021C12ATCCAACGGCTNONE 
J013021C17ATCCAACGGCTNONE 
J023027B08ATCCAACGGCTNONE 
J023078A21ATCCAACGGCTNONE 
J023097M06ATCCAACGGCTNONE 
J023100O04ATCCAACGGCTNONE 
J023107B17ATCCAACGGCTNONE 
J023108L24ATCCAACGGCTNONE 
J023109L05ATCCAACGGCTNONE 
J033022M22ATCCAACGGCTNONE 
J033023K21ATCCAACGGCTNONE 
J033031L11ATCCAACGGCTNONE 
J033034H10ATCCAACGGCTNONE 
J033037B16ATCCAACGGCTNONE 
J033037F16ATCCAACGGCTNONE 
J033037H07ATCCAACGGCTNONE 
J033046E22ATCCAACGGCTNONE 
J033050N12ATCCAACGGCTNONE 
J033064F10ATCCAACGGCTNONE 
J033064N10ATCCAACGGCTNONE 
J033066O09ATCCAACGGCTNONE 
J033068H01ATCCAACGGCTNONE 
J033068J07ATCCAACGGCTNONE 
J033070B10ATCCAACGGCTNONE 
J033070G13ATCCAACGGCTNONE 
J033073O13ATCCAACGGCTNONE 
J033075B07ATCCAACGGCTNONE 
J033079L15ATCCAACGGCTNONE 
J033081J06ATCCAACGGCTNONE 
J033086G13ATCCAACGGCTNONE 
J033086N07ATCCAACGGCTNONE 
J033086O05ATCCAACGGCTNONE 
J033091A15ATCCAACGGCTNONE 
J033091D05ATCCAACGGCTNONE 
J033094C12ATCCAACGGCTNONE 
J033099P03ATCCAACGGCTNONE 
J033107L09ATCCAACGGCTNONE 
J033108D16ATCCAACGGCTNONE 
J033109E12ATCCAACGGCTNONE 
J033109K14ATCCAACGGCTNONE 
J033112P22ATCCAACGGCTNONE 
J033116F12ATCCAACGGCTNONE 
J033116K01ATCCAACGGCTNONE 
J033118F19ATCCAACGGCTNONE 
J033121J10ATCCAACGGCTNONE 
J033126H04ATCCAACGGCTNONE 
J033131G17ATCCAACGGCTNONE 
J033131L05ATCCAACGGCTNONE 
J033136A08ATCCAACGGCTNONE 
J033136H22ATCCAACGGCTNONE 
J033143F01ATCCAACGGCTNONE 
J065040M10ATCCAACGGCTNONE 
J065046F17ATCCAACGGCTNONE 
J065048G20ATCCAACGGCTNONE 
J065071N06ATCCAACGGCTNONE 
J065084I24ATCCAACGGCTNONE 
J065171B01ATCCAACGGCTNONE 
J065191J21ATCCAACGGCTNONE 
J065199I20ATCCAACGGCTNONE 
J075076C02ATCCAACGGCTNONE 
J090002P12ATCCAACGGCTNONE 
J090003A11ATCCAACGGCTNONE 
J090003H11ATCCAACGGCTNONE 
J090009M22ATCCAACGGCTNONE 
J090009O11ATCCAACGGCTNONE 
J090014N09ATCCAACGGCTNONE 
J090015A18ATCCAACGGCTNONE 
J090016E16ATCCAACGGCTNONE 
J090016I07ATCCAACGGCTNONE 
J090017O07ATCCAACGGCTNONE 
J090019E10ATCCAACGGCTNONE 
J090020D24ATCCAACGGCTNONE 
J090021M16ATCCAACGGCTNONE 
J090022F13ATCCAACGGCTNONE 
J090023H03ATCCAACGGCTNONE 
J090024E15ATCCAACGGCTNONE 
J090024G19ATCCAACGGCTNONE 
J090026J19ATCCAACGGCTNONE 
J090030E20ATCCAACGGCTNONE 
J090030I15ATCCAACGGCTNONE 
J090032F04ATCCAACGGCTNONE 
J090033N22ATCCAACGGCTNONE 
J090033O19ATCCAACGGCTNONE 
J090036F08ATCCAACGGCTNONE 
J090039A13ATCCAACGGCTNONE 
J090042N07ATCCAACGGCTNONE 
J090043C15ATCCAACGGCTNONE 
J090043N09ATCCAACGGCTNONE 
J090053J10ATCCAACGGCTNONE 
J090054F14ATCCAACGGCTNONE 
J090057N12ATCCAACGGCTNONE 
J090061P13ATCCAACGGCTNONE 
J090062F17ATCCAACGGCTNONE 
J090065H15ATCCAACGGCTNONE 
J090067P11ATCCAACGGCTNONE 
J090068M09ATCCAACGGCTNONE 
J090069E24ATCCAACGGCTNONE 
J090069K16ATCCAACGGCTNONE 
J090070N07ATCCAACGGCTNONE 
J090072M09ATCCAACGGCTNONE 
J090075I24ATCCAACGGCTNONE 
J090075M04ATCCAACGGCTNONE 
J090077D24ATCCAACGGCTNONE 
J090080M17ATCCAACGGCTNONE 
J090080O14ATCCAACGGCTNONE 
J090081C12ATCCAACGGCTNONE 
J090084N21ATCCAACGGCTNONE 
J090084O21ATCCAACGGCTNONE 
J090087J18ATCCAACGGCTNONE 
J090092L17ATCCAACGGCTNONE 
J090097A08ATCCAACGGCTNONE 
J100017E24ATCCAACGGCTNONE 
J100018K11ATCCAACGGCTNONE 
J100019A16ATCCAACGGCTNONE 
J100023I23ATCCAACGGCTNONE 
J100024D07ATCCAACGGCTNONE 
J100025H12ATCCAACGGCTNONE 
J100027K19ATCCAACGGCTNONE 
J100028C23ATCCAACGGCTNONE 
J100029A14ATCCAACGGCTNONE 
J100029O19ATCCAACGGCTNONE 
J100030I09ATCCAACGGCTNONE 
J100030J16ATCCAACGGCTNONE 
J100031C01ATCCAACGGCTNONE 
J100031N06ATCCAACGGCTNONE 
J100033H04ATCCAACGGCTNONE 
J100034L20ATCCAACGGCTNONE 
J100036K13ATCCAACGGCTNONE 
J100039M02ATCCAACGGCTNONE 
J100040J01ATCCAACGGCTNONE 
J100042O21ATCCAACGGCTNONE 
J100042P20ATCCAACGGCTNONE 
J100047K22ATCCAACGGCTNONE 
J100049B16ATCCAACGGCTNONE 
J100052M10ATCCAACGGCTNONE 
J100053B05ATCCAACGGCTNONE 
J100053B20ATCCAACGGCTNONE 
J100055I11ATCCAACGGCTNONE 
J100056A13ATCCAACGGCTNONE 
J100057C08ATCCAACGGCTNONE 
J100057N11ATCCAACGGCTNONE 
J100057P07ATCCAACGGCTNONE 
J100059E16ATCCAACGGCTNONE 
J100063N14ATCCAACGGCTNONE 
J100069H01ATCCAACGGCTNONE 
J100071C17ATCCAACGGCTNONE 
J100071K09ATCCAACGGCTNONE 
J100077D07ATCCAACGGCTNONE 
J100078P22ATCCAACGGCTNONE 
J100080F11ATCCAACGGCTNONE 
J100081L07ATCCAACGGCTNONE 
J100083B10ATCCAACGGCTNONE 
J100083K17ATCCAACGGCTNONE 
J100085B22ATCCAACGGCTNONE 
J100085L21ATCCAACGGCTNONE 
J100086B11ATCCAACGGCTNONE 
J100087E06ATCCAACGGCTNONE 
J100087P07ATCCAACGGCTNONE 
J100089H24ATCCAACGGCTNONE 
Os11g0707000003-106-C01CCGTTGGANONE 
003-130-G06CCGTTGGANONE 
006-021-F04CCGTTGGANONE 
006-031-E07CCGTTGGANONE 
006-035-C03CCGTTGGANONE 
006-038-D10CCGTTGGANONE 
006-043-A10CCGTTGGANONE 
006-043-G08CCGTTGGANONE 
006-046-C03CCGTTGGANONE 
006-055-G09CCGTTGGANONE 
006-085-A03CCGTTGGANONE 
006-118-E05CCGTTGGANONE 
AF349638CCGTTGGANONE 
AK060841CCGTTGGANONE 
AK104332CCGTTGGASimilar to Ribulose-bisphosphate carboxylase activase (EC 6.3.4.-) (Fragments). 
J013070N15CCGTTGGANONE 
J013074C16CCGTTGGANONE 
J013112C07CCGTTGGANONE 
J013112N16CCGTTGGANONE 
J013123B03CCGTTGGANONE 
J013158I17CCGTTGGANONE 
J013159L01CCGTTGGANONE 
J023001H04CCGTTGGANONE 
J023020K06CCGTTGGANONE 
J023031J19CCGTTGGANONE 
J023034A05CCGTTGGANONE 
J023034E21CCGTTGGANONE 
J023041M12CCGTTGGANONE 
J023041P06CCGTTGGANONE 
J023044C04CCGTTGGANONE 
J023047H01CCGTTGGANONE 
J023048D08CCGTTGGANONE 
J023052H08CCGTTGGANONE 
J023054D24CCGTTGGANONE 
J023063G11CCGTTGGANONE 
J023074C13CCGTTGGANONE 
J023078O06CCGTTGGANONE 
J023089K10CCGTTGGANONE 
J023100O05CCGTTGGANONE 
J023120L08CCGTTGGANONE 
J023123N23CCGTTGGANONE 
J023127M10CCGTTGGANONE 
J023128C22CCGTTGGANONE 
J023129C04CCGTTGGANONE 
J023146H08CCGTTGGANONE 
J053063N05CCGTTGGANONE 
J053066F02CCGTTGGANONE 
J053066N18CCGTTGGANONE 
J053076G01CCGTTGGANONE 
J065012O05CCGTTGGANONE 
J065035L06CCGTTGGANONE 
J065037M01CCGTTGGANONE 
J065045N23CCGTTGGANONE 
J065058F09CCGTTGGANONE 
J065072E14CCGTTGGANONE 
J065073I20CCGTTGGANONE 
J065076B05CCGTTGGANONE 
J065093B09CCGTTGGANONE 
J065117A22CCGTTGGANONE 
J065149J21CCGTTGGANONE 
J065155M04CCGTTGGANONE 
J065161J21CCGTTGGANONE 
J065163H19CCGTTGGANONE 
J065192A15CCGTTGGANONE 
J075001K13CCGTTGGANONE 
J075002J24CCGTTGGANONE 
J075004N18CCGTTGGANONE 
J075025H21CCGTTGGANONE 
J075028F20CCGTTGGANONE 
J075039F23CCGTTGGANONE 
J075043M08CCGTTGGANONE 
J075057D02CCGTTGGANONE 
J075059I01CCGTTGGANONE 
J075069P10CCGTTGGANONE 
J075073D08CCGTTGGANONE 
J075089I04CCGTTGGANONE 
J075093O18CCGTTGGANONE 
J075097N13CCGTTGGANONE 
J075114B02CCGTTGGANONE 
J075123E10CCGTTGGANONE 
J075128C19CCGTTGGANONE 
J075135F05CCGTTGGANONE 
J075136A04CCGTTGGANONE 
J075141B05CCGTTGGANONE 
J075169H18CCGTTGGANONE 
J075183L14CCGTTGGANONE 
J075191N03CCGTTGGANONE 
J080001C11CCGTTGGANONE 
J080004F18CCGTTGGANONE 
J080004H21CCGTTGGANONE 
J080004O09CCGTTGGANONE 
J080005J02CCGTTGGANONE 
J080006I03CCGTTGGANONE 
J080006J17CCGTTGGANONE 
J080009I09CCGTTGGANONE 
J080010I06CCGTTGGANONE 
J080011A17CCGTTGGANONE 
J080014N22CCGTTGGANONE 
J080016E24CCGTTGGANONE 
J080016P08CCGTTGGANONE 
J080017G22CCGTTGGANONE 
J080017P09CCGTTGGANONE 
J080018D23CCGTTGGANONE 
J080018E15CCGTTGGANONE 
J080020K04CCGTTGGANONE 
J080024P09CCGTTGGANONE 
J080025G15CCGTTGGANONE 
J080025N11CCGTTGGANONE 
J080026H10CCGTTGGANONE 
J080026N06CCGTTGGANONE 
J080027C07CCGTTGGANONE 
J080027M21CCGTTGGANONE 
J080028I03CCGTTGGANONE 
J080028K11CCGTTGGANONE 
J080029B19CCGTTGGANONE 
J080029G14CCGTTGGANONE 
J080029G20CCGTTGGANONE 
J080030A16CCGTTGGANONE 
J080031C05CCGTTGGANONE 
J080033M16CCGTTGGANONE 
J080034C24CCGTTGGANONE 
J080034F11CCGTTGGANONE 
J080036B03CCGTTGGANONE 
J080036C14CCGTTGGANONE 
J080037C01CCGTTGGANONE 
J080038M20CCGTTGGANONE 
J080040M24CCGTTGGANONE 
J080040P19CCGTTGGANONE 
J080042L24CCGTTGGANONE 
J080042O06CCGTTGGANONE 
J080043A22CCGTTGGANONE 
J080043N19CCGTTGGANONE 
J080044A18CCGTTGGANONE 
J080044P14CCGTTGGANONE 
J080045K12CCGTTGGANONE 
J080045N16CCGTTGGANONE 
J080047A16CCGTTGGANONE 
J080047B09CCGTTGGANONE 
J080047E08CCGTTGGANONE 
J080047G06CCGTTGGANONE 
J080048H04CCGTTGGANONE 
J080049B17CCGTTGGANONE 
J080049D05CCGTTGGANONE 
J080049G23CCGTTGGANONE 
J080050D03CCGTTGGANONE 
J080050J24CCGTTGGANONE 
J080050O20CCGTTGGANONE 
J080052E24CCGTTGGANONE 
J080052K11CCGTTGGANONE 
J080053B04CCGTTGGANONE 
J080053D20CCGTTGGANONE 
J080053E16CCGTTGGANONE 
J080054H20CCGTTGGANONE 
J080054H22CCGTTGGANONE 
J080054N24CCGTTGGANONE 
J080055H08CCGTTGGANONE 
J080056H08CCGTTGGANONE 
J080056H12CCGTTGGANONE 
J080057N11CCGTTGGANONE 
J080058D08CCGTTGGANONE 
J080058D21CCGTTGGANONE 
J080058E10CCGTTGGANONE 
J080060J10CCGTTGGANONE 
J080061O04CCGTTGGANONE 
J080065M18CCGTTGGANONE 
J080066D15CCGTTGGANONE 
J080067E22CCGTTGGANONE 
J080067N20CCGTTGGANONE 
J080068F02CCGTTGGANONE 
J080069G20CCGTTGGANONE 
J080069O13CCGTTGGANONE 
J080070I20CCGTTGGANONE 
J080071H11CCGTTGGANONE 
J080071H17CCGTTGGANONE 
J080071O18CCGTTGGANONE 
J080077G14CCGTTGGANONE 
J080077H17CCGTTGGANONE 
J080078B18CCGTTGGANONE 
J080078D24CCGTTGGANONE 
J080079H02CCGTTGGANONE 
J080079J02CCGTTGGANONE 
J080081O20CCGTTGGANONE 
J080082E02CCGTTGGANONE 
J080082N12CCGTTGGANONE 
J080084E18CCGTTGGANONE 
J080085P08CCGTTGGANONE 
J080086B21CCGTTGGANONE 
J080086L10CCGTTGGANONE 
J080086L18CCGTTGGANONE 
J080087D12CCGTTGGANONE 
J080087E24CCGTTGGANONE 
J080087G12CCGTTGGANONE 
J080088J22CCGTTGGANONE 
J080090C18CCGTTGGANONE 
J080090L02CCGTTGGANONE 
J080092N05CCGTTGGANONE 
J080092P20CCGTTGGANONE 
J080094D15CCGTTGGANONE 
J080095A11CCGTTGGANONE 
J080095K13CCGTTGGANONE 
J080096L16CCGTTGGANONE 
J080097F16CCGTTGGANONE 
J080305J21CCGTTGGANONE 
J080308I22CCGTTGGANONE 
J080310E21CCGTTGGANONE 
J080310G09CCGTTGGANONE 
J090003A12CCGTTGGANONE 
J090032M14CCGTTGGANONE 
J090045I12CCGTTGGANONE 
J090076M15CCGTTGGANONE 
J090088C17CCGTTGGANONE 
J090094B06CCGTTGGANONE 
Os12g0116900J023029P11TCCAACGGNONE 
J023150B17TCCAACGGNONE 
J075053O04TCCAACGGNONE 
J075152K05TCCAACGGNONE 
J075168M02TCCAACGGNONE 
Os12g0125200J065062L18ATCCAACGGConserved hypothetical protein. 
Os12g0137500011-018-C07GCCGTTGGATNONE 
AY224436GCCGTTGGATSimilar to Avr9/Cf-9 rapidly elicited protein 271 (Fragment). 
J013147P17GCCGTTGGATNONE 
J013153A04GCCGTTGGATNONE 
J023006N14GCCGTTGGATNONE 
J023045C20GCCGTTGGATNONE 
J033065M21GCCGTTGGATNONE 
J033070P21GCCGTTGGATNONE 
J090010P14GCCGTTGGATNONE 
J090024N03GCCGTTGGATNONE 
J090027L04GCCGTTGGATNONE 
J090068E18GCCGTTGGATNONE 
Os12g0149000AK108734ATCCAACGGCConserved hypothetical protein. 
Os12g0211000AK101792TCCAACGGCCCACGAAConserved hypothetical protein. 
J033065K09TCCAACGGCCCACGAANONE 
Os12g0223000AK110855CCGTTGGATConserved hypothetical protein. 
Os12g0502100Os12g0502100GCCGTTGGATCTGGGCConserved hypothetical protein. 
Os12g0610950J075157D04AGCCGTTGGATHypothetical protein. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.