version

Summary of OsREG549 (All List)

OrganismOryza sativa  
IDOsREG549  
SequenceCCTCGCCC  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count1179  

Entry Sequences (1179 entries)

LocusGene modelSequenceDescription
Os01g0253400AK108904CCTCGCCCGGCGTGGAProtein of unknown function DUF1218 family protein. 
Os01g0276700011-014-A12CCTCGCCCAACCNONE 
012-092-G12CCTCGCCCAACCNONE 
AK103164CCTCGCCCAACCNONE 
AK103465CCTCGCCCAACCSimilar to Pyruvate kinase, cytosolic isozyme (EC 2.7.1.40) (PK). 
J023019H09CCTCGCCCAACCNONE 
J023084I02CCTCGCCCAACCNONE 
J033027F20CCTCGCCCAACCNONE 
J033029M06CCTCGCCCAACCNONE 
J033039K13CCTCGCCCAACCNONE 
J033057C24CCTCGCCCAACCNONE 
J033058G20CCTCGCCCAACCNONE 
J033060A14CCTCGCCCAACCNONE 
J033061M21CCTCGCCCAACCNONE 
J033068M10CCTCGCCCAACCNONE 
J033074K16CCTCGCCCAACCNONE 
J033076C11CCTCGCCCAACCNONE 
J033093O13CCTCGCCCAACCNONE 
J033119H20CCTCGCCCAACCNONE 
J033121D22CCTCGCCCAACCNONE 
J033129N11CCTCGCCCAACCNONE 
J033131E12CCTCGCCCAACCNONE 
J033150L07CCTCGCCCAACCNONE 
J053024N17CCTCGCCCAACCNONE 
J053034G19CCTCGCCCAACCNONE 
J053035E18CCTCGCCCAACCNONE 
J053046M01CCTCGCCCAACCNONE 
J053047P04CCTCGCCCAACCNONE 
J053048B06CCTCGCCCAACCNONE 
J053050M22CCTCGCCCAACCNONE 
J053053E09CCTCGCCCAACCNONE 
J053053I07CCTCGCCCAACCNONE 
J053059K03CCTCGCCCAACCNONE 
J053059P12CCTCGCCCAACCNONE 
J053060C12CCTCGCCCAACCNONE 
J053060H24CCTCGCCCAACCNONE 
J053064D19CCTCGCCCAACCNONE 
J053066L15CCTCGCCCAACCNONE 
J053073I02CCTCGCCCAACCNONE 
J053083E15CCTCGCCCAACCNONE 
J053094D05CCTCGCCCAACCNONE 
J053094P18CCTCGCCCAACCNONE 
J053095C15CCTCGCCCAACCNONE 
J053095C21CCTCGCCCAACCNONE 
J053099N16CCTCGCCCAACCNONE 
J090025O19CCTCGCCCAACCNONE 
J090049N22CCTCGCCCAACCNONE 
J090050F17CCTCGCCCAACCNONE 
Os01g0314000015-084-B08CCTCGCCCCCACNONE 
AK106418CCTCGCCCCCACNONE 
Os01g0358400006-031-B11GGGCGAGGNONE 
006-083-B11GGGCGAGGNONE 
006-083-C09GGGCGAGGNONE 
006-088-H03GGGCGAGGNONE 
006-102-H05GGGCGAGGNONE 
AK061826GGGCGAGGSimilar to 40S ribosomal protein S4. 
J013105M07GGGCGAGGNONE 
J013155A16GGGCGAGGNONE 
J033025C03GGGCGAGGNONE 
J033072L20GGGCGAGGNONE 
J033095I15GGGCGAGGNONE 
J033105E03GGGCGAGGNONE 
J033112G18GGGCGAGGNONE 
J033125D09GGGCGAGGNONE 
J065100L16GGGCGAGGNONE 
J065176I05GGGCGAGGNONE 
J090001C14GGGCGAGGNONE 
J090058E15GGGCGAGGNONE 
J090068F07GGGCGAGGNONE 
Os01g0373400AK110973CCTCGCCCHomeodomain-like containing protein. 
Os01g0546900AK073801CCTCGCCCTranscription factor jumonji/aspartyl beta-hydroxylase domain containing protein. 
Os01g0580200AK103045GGGCGAGGSimilar to Beta-galactosidase precursor (EC 3.2.1.23) (Lactase). 
J023141C23GGGCGAGGNONE 
J033097N10GGGCGAGGNONE 
J033117F22GGGCGAGGNONE 
J053098K12GGGCGAGGNONE 
J065029C14GGGCGAGGNONE 
J065082G13GGGCGAGGNONE 
Os01g0588500AK103037CCTCGCCCSimilar to Avr9/Cf-9 induced kinase 1. 
Os01g0639900004-009-H08CCTCGCCCNONE 
006-050-F07CCTCGCCCNONE 
006-120-D04CCTCGCCCNONE 
AF182806CCTCGCCCNONE 
AK060890CCTCGCCCSimilar to Carbonic anhydrase, chloroplast precursor (EC 4.2.1.1) (Carbonate dehydratase). 
AK099825CCTCGCCCNONE 
J075022I06CCTCGCCCNONE 
U08404CCTCGCCCNONE 
Os01g0679400AK107970CCTCGCCCConserved hypothetical protein. 
Os01g0749900AK103588CCTCGCCCProtein of unknown function DUF250 domain containing protein. 
J033090O22CCTCGCCCNONE 
J033133C05CCTCGCCCNONE 
J065122N01CCTCGCCCNONE 
J065188K04CCTCGCCCNONE 
J090012D18CCTCGCCCNONE 
J100074N02CCTCGCCCNONE 
Os01g0787400006-097-H03CCTCGCCCNONE 
AK061223CCTCGCCCConserved hypothetical protein. 
J065011G11CCTCGCCCNONE 
J065161F18CCTCGCCCNONE 
Os01g0814200AK070675CCTCGCCCCCGCGNONE 
AK073107CCTCGCCCCCGCGSimilar to Type I inositol-1,4,5-trisphosphate 5-phosphatase CVP2 (EC 3.1.3.56) (Cotyledon vascular pattern 2 protein). 
J023061B19CCTCGCCCCCGCGNONE 
Os01g0859500AK101338GGGCGAGGGCCAGASimilar to Basic leucine zipper protein (Liguleless2). 
J075013I11GGGCGAGGGCCAGANONE 
J075038A10GGGCGAGGGCCAGANONE 
J075139M10GGGCGAGGGCCAGANONE 
J075146N08GGGCGAGGGCCAGANONE 
J075146P09GGGCGAGGGCCAGANONE 
J075164E07GGGCGAGGGCCAGANONE 
J075180C01GGGCGAGGGCCAGANONE 
Os01g0866400AB007193CCTCGCCCSimilar to Fructose-1,6-bisphosphatase (EC 3.1.3.11) (Fragment). 
AF378183CCTCGCCCNONE 
AK070516CCTCGCCCNONE 
AK119536CCTCGCCCNONE 
J023057C24CCTCGCCCNONE 
J023078G07CCTCGCCCNONE 
J065015D23CCTCGCCCNONE 
J065050J17CCTCGCCCNONE 
J065058B03CCTCGCCCNONE 
J065119C16CCTCGCCCNONE 
J065134N01CCTCGCCCNONE 
J065174B10CCTCGCCCNONE 
J075046D04CCTCGCCCNONE 
J075172N05CCTCGCCCNONE 
Os01g0897800AF140489CCTCGCCCNONE 
AK072409CCTCGCCCNONE 
AK072812CCTCGCCCRad21/Rec8 like protein, N-terminal domain containing protein. 
AK099099CCTCGCCCNONE 
AY288943CCTCGCCCNONE 
AY318757CCTCGCCCNONE 
J013021C23CCTCGCCCNONE 
J013027H03CCTCGCCCNONE 
J013032C02CCTCGCCCNONE 
J013068G13CCTCGCCCNONE 
J013070K16CCTCGCCCNONE 
J013070L02CCTCGCCCNONE 
J013091E15CCTCGCCCNONE 
J013109D04CCTCGCCCNONE 
J013118B04CCTCGCCCNONE 
J013129E08CCTCGCCCNONE 
J013134I15CCTCGCCCNONE 
J013146N16CCTCGCCCNONE 
J023083F05CCTCGCCCNONE 
J023107E17CCTCGCCCNONE 
J023113D21CCTCGCCCNONE 
J023123A22CCTCGCCCNONE 
J023133I24CCTCGCCCNONE 
J023134L21CCTCGCCCNONE 
J023142N24CCTCGCCCNONE 
J033051B12CCTCGCCCNONE 
J033058B04CCTCGCCCNONE 
J033068E24CCTCGCCCNONE 
J033076D01CCTCGCCCNONE 
J033088O06CCTCGCCCNONE 
J033093K15CCTCGCCCNONE 
J033101G18CCTCGCCCNONE 
J033130A01CCTCGCCCNONE 
J043027I17CCTCGCCCNONE 
J043027L17CCTCGCCCNONE 
J090001N13CCTCGCCCNONE 
J090004L10CCTCGCCCNONE 
J090027D08CCTCGCCCNONE 
J090027H18CCTCGCCCNONE 
J090031F16CCTCGCCCNONE 
J090048L18CCTCGCCCNONE 
J090050N08CCTCGCCCNONE 
J090051G05CCTCGCCCNONE 
J090063G03CCTCGCCCNONE 
J090068P21CCTCGCCCNONE 
J090072P21CCTCGCCCNONE 
J090079A14CCTCGCCCNONE 
J090086I20CCTCGCCCNONE 
J090087D19CCTCGCCCNONE 
J090099B06CCTCGCCCNONE 
J100047J19CCTCGCCCNONE 
J100058I06CCTCGCCCNONE 
Os01g0913600AK071735CCTCGCCCCCCGCGACGCSimilar to Rho GDP-dissociation inhibitor 1 (Rho GDI-1) (AtRhoGDI1). 
J023003J11CCTCGCCCCCCGCGACGCNONE 
J023037O11CCTCGCCCCCCGCGACGCNONE 
J023109K10CCTCGCCCCCCGCGACGCNONE 
Os01g0948900AK100894CCTCGCCCAnkyrin repeat containing protein. 
AK100932CCTCGCCCNONE 
J023131A22CCTCGCCCNONE 
J023135M02CCTCGCCCNONE 
Os02g0189900012-074-E11CCTCGCCCATGTNONE 
AK063528CCTCGCCCATGTHepatocellular carcinoma-associated antigen 59 family protein. 
Os02g0332700009-144-D04GGGCGAGGNONE 
AK062975GGGCGAGGConserved hypothetical protein. 
Os02g0473000AK065460GTGGTGGGCGAGGRiboflavin biosynthesis protein RibD family protein. 
Os02g0497700011-094-A10GGGCGAGGNONE 
012-073-H02GGGCGAGGNONE 
016-056-G05GGGCGAGGNONE 
AK070143GGGCGAGGNONE 
J023041O14GGGCGAGGNONE 
J023092H01GGGCGAGGNONE 
J033048A17GGGCGAGGNONE 
J033051K21GGGCGAGGNONE 
J033122D01GGGCGAGGNONE 
J090032E23GGGCGAGGNONE 
J090055K13GGGCGAGGNONE 
Os02g0506600AK107967CCTCGCCCACAAConserved hypothetical protein. 
J065142J01CCTCGCCCACAANONE 
J100044B16CCTCGCCCACAANONE 
J100079K18CCTCGCCCACAANONE 
J100086M04CCTCGCCCACAANONE 
Os02g0608500AK071922GGGCGAGGNONE 
Os02g0626100003-107-B06CCTCGCCCNONE 
AK120127CCTCGCCCNONE 
Os02g0628600J100044L04CCTCGCCCTranscriptional factor B3 family protein. 
Os02g0638900AK111517GGGCGAGGWD40-like domain containing protein. 
J013002G07GGGCGAGGNONE 
J075146G03GGGCGAGGNONE 
J075149F01GGGCGAGGNONE 
J100026G01GGGCGAGGNONE 
Os02g0701300AK063983CCTCGCCCSimilar to Transcription activator GRF2 (Fragment). 
Os02g0732200AK102091CCTCGCCCU box domain containing protein. 
Os02g0742200006-110-B12GGGCGAGGNONE 
AB029510GGGCGAGGNONE 
AK059970GGGCGAGGNONE 
AK069345GGGCGAGGSmall GTP-binding protein OsRac3. 
J023067B08GGGCGAGGNONE 
J033026H13GGGCGAGGNONE 
Os02g0748300009-089-D04CCTCGCCCNONE 
AK100919CCTCGCCCNONE 
J023133K05CCTCGCCCNONE 
Os02g0762400AK103084CCTCGCCCCyclin-dependent kinase inhibitor family protein. 
Os02g0769100AK107987CCTCGCCCAuxin responsive SAUR protein family protein. 
Os02g0781700006-066-G01CCTCGCCCNONE 
009-034-D03CCTCGCCCNONE 
009-194-D04CCTCGCCCNONE 
AK061791CCTCGCCCConserved hypothetical protein. 
AK063223CCTCGCCCNONE 
AY224477CCTCGCCCNONE 
J013045H09CCTCGCCCNONE 
J013061I22CCTCGCCCNONE 
J013071F11CCTCGCCCNONE 
J023130H07CCTCGCCCNONE 
J043036K23CCTCGCCCNONE 
J065010N07CCTCGCCCNONE 
J065219I01CCTCGCCCNONE 
J090073I15CCTCGCCCNONE 
Os02g0803200AK063404GGGCGAGGSimilar to 30S ribosomal protein S15. 
Os03g0108500AK108704CCTCGCCCAATASimilar to 4,4-dimethyl-sterol C4-methyl-oxidase (Fragment). 
Os03g0123300003-131-G09CCTCGCCCNONE 
AK058595CCTCGCCCNONE 
J075056B01CCTCGCCCNONE 
Os03g0188400AK107555CCTCGCCCCTCGCGCGBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
Os03g0227800J013091I04GGGCGAGGNONE 
J080305J16GGGCGAGGNONE 
Os03g0257900009-150-G06CCTCGCCCACCAACNONE 
009-181-H05CCTCGCCCACCAACNONE 
AK063892CCTCGCCCACCAACNONE 
AK100114CCTCGCCCACCAACSimilar to Lectin-like receptor kinase 7;2. 
AK103486CCTCGCCCACCAACNONE 
J023006K11CCTCGCCCACCAACNONE 
J075005E15CCTCGCCCACCAACNONE 
J075007K24CCTCGCCCACCAACNONE 
J075034G06CCTCGCCCACCAACNONE 
J075051I19CCTCGCCCACCAACNONE 
J075076A08CCTCGCCCACCAACNONE 
J075096H04CCTCGCCCACCAACNONE 
J075115I09CCTCGCCCACCAACNONE 
J075132K23CCTCGCCCACCAACNONE 
J075147C17CCTCGCCCACCAACNONE 
J090059O20CCTCGCCCACCAACNONE 
Os03g0275700AK111329CCTCGCCCConserved hypothetical protein. 
Os03g0300200AK102070GGGCGAGGSimilar to Ubiquitin-specific protease 16. 
Os03g0327100006-119-C12CGTGGGGGCGAGGNONE 
011-018-C10CGTGGGGGCGAGGNONE 
AK065989CGTGGGGGCGAGGSimilar to CUC1. 
J013046E14CGTGGGGGCGAGGNONE 
J065066N20CGTGGGGGCGAGGNONE 
Os03g0342900006-032-D01CCTCGCCCNONE 
006-032-D01CTGGCCCACCTCGCCCCACGNONE 
006-033-E10CCTCGCCCNONE 
006-033-E10CTGGCCCACCTCGCCCCACGNONE 
006-051-G06CCTCGCCCNONE 
006-051-G06CTGGCCCACCTCGCCCCACGNONE 
006-053-E05CCTCGCCCNONE 
006-053-E05CTGGCCCACCTCGCCCCACGNONE 
006-056-B05CCTCGCCCNONE 
006-056-B05CTGGCCCACCTCGCCCCACGNONE 
006-058-F04CCTCGCCCNONE 
006-058-F04CTGGCCCACCTCGCCCCACGNONE 
006-059-E05CCTCGCCCNONE 
006-059-E05CTGGCCCACCTCGCCCCACGNONE 
006-060-F10CCTCGCCCNONE 
006-060-F10CTGGCCCACCTCGCCCCACGNONE 
006-104-D12CCTCGCCCNONE 
006-104-D12CTGGCCCACCTCGCCCCACGNONE 
009-129-C12CCTCGCCCNONE 
009-129-C12CTGGCCCACCTCGCCCCACGNONE 
AK060136CCTCGCCCNONE 
AK060136CTGGCCCACCTCGCCCCACGNONE 
AK060980CCTCGCCCNONE 
AK060980CTGGCCCACCTCGCCCCACGNONE 
AK064815CCTCGCCCDormancyauxin associated family protein. 
AK064815CTGGCCCACCTCGCCCCACGDormancyauxin associated family protein. 
AK104244CCTCGCCCNONE 
AK104244CTGGCCCACCTCGCCCCACGNONE 
AK104391CCTCGCCCNONE 
AK104391CTGGCCCACCTCGCCCCACGNONE 
AK104590CCTCGCCCNONE 
AK104590CTGGCCCACCTCGCCCCACGNONE 
AK104744CCTCGCCCNONE 
AK104744CTGGCCCACCTCGCCCCACGNONE 
AK106100CCTCGCCCNONE 
AK106100CTGGCCCACCTCGCCCCACGNONE 
J013000E10CCTCGCCCNONE 
J013000E10CTGGCCCACCTCGCCCCACGNONE 
J075027O22CCTCGCCCNONE 
J075027O22CTGGCCCACCTCGCCCCACGNONE 
J075052J03CCTCGCCCNONE 
J075052J03CTGGCCCACCTCGCCCCACGNONE 
J075066E15CCTCGCCCNONE 
J075066E15CTGGCCCACCTCGCCCCACGNONE 
J075095C17CCTCGCCCNONE 
J075095C17CTGGCCCACCTCGCCCCACGNONE 
J075118N05CCTCGCCCNONE 
J075118N05CTGGCCCACCTCGCCCCACGNONE 
J075187K22CCTCGCCCNONE 
J075187K22CTGGCCCACCTCGCCCCACGNONE 
J090026L04CCTCGCCCNONE 
J090026L04CTGGCCCACCTCGCCCCACGNONE 
J090059G16CCTCGCCCNONE 
J090059G16CTGGCCCACCTCGCCCCACGNONE 
J100055P20CCTCGCCCNONE 
J100055P20CTGGCCCACCTCGCCCCACGNONE 
J100062A10CCTCGCCCNONE 
J100062A10CTGGCCCACCTCGCCCCACGNONE 
J100068G20CCTCGCCCNONE 
J100068G20CTGGCCCACCTCGCCCCACGNONE 
Os03g0646100AK100526CCATGGGCCTCGCCCSimilar to Plastid division protein ftsZ1 precursor. 
Os03g0670200011-069-G05CGCGTGGGCGAGGNONE 
AK069553CGCGTGGGCGAGGSimilar to YJR013Wp (Fragment). 
J023020O11CGCGTGGGCGAGGNONE 
J023114J22CGCGTGGGCGAGGNONE 
J100084F17CGCGTGGGCGAGGNONE 
J100087A11CGCGTGGGCGAGGNONE 
Os03g0711600X88799CCTCGCCCSimilar to DNA binding protein (Fragment). 
Os03g0726900AK072553GGGCGAGGConserved hypothetical protein. 
AK100280GGGCGAGGNONE 
Os03g0752000AK121199CCTCGCCCConserved hypothetical protein. 
Os03g0752800AB041020CCTCGCCCNONE 
AF058697CCTCGCCCMADS14 protein. 
AF139664CCTCGCCCNONE 
AK121171CCTCGCCCNONE 
AY332478CCTCGCCCNONE 
AY551916CCTCGCCCNONE 
J023081C04CCTCGCCCNONE 
Os03g0759500AB099524GGGCGAGGNONE 
AK063449GGGCGAGGOrigin recognition complex 5. 
J065152N07GGGCGAGGNONE 
Os03g0773600AK103310CCTCGCCCKinesin, motor region domain containing protein. 
Os03g0786900AK121531CCTCGCCCTetratricopeptide-like helical domain containing protein. 
Os03g0799100AK058959CCTCGCCCACGCNONE 
AK102772CCTCGCCCACGCSimilar to WAVE-DAMPENED2. 
J023093D03CCTCGCCCACGCNONE 
J033099D22CCTCGCCCACGCNONE 
J090054G18CCTCGCCCACGCNONE 
J100031H24CCTCGCCCACGCNONE 
J100065H09CCTCGCCCACGCNONE 
J100082G10CCTCGCCCACGCNONE 
Os03g0805400AK071708CCTCGCCCAcid phosphatase/vanadium-dependent haloperoxidase family protein. 
AK102189CCTCGCCCNONE 
J100053J07CCTCGCCCNONE 
J100054I10CCTCGCCCNONE 
J100064K03CCTCGCCCNONE 
Os03g0845000AK105971CCTCGCCCSimilar to Pirin-like protein. 
Os03g0855600006-029-G09GGGCGAGGNONE 
006-033-E02GGGCGAGGNONE 
006-069-G07GGGCGAGGNONE 
006-083-A02GGGCGAGGNONE 
006-098-H04GGGCGAGGNONE 
009-054-C04GGGCGAGGNONE 
AK060030GGGCGAGGNONE 
AK061467GGGCGAGGConserved hypothetical protein. 
AK067858GGGCGAGGNONE 
AK106030GGGCGAGGNONE 
J013123A10GGGCGAGGNONE 
J065001I24GGGCGAGGNONE 
J065015N21GGGCGAGGNONE 
J065016H07GGGCGAGGNONE 
J065040A05GGGCGAGGNONE 
J065040F01GGGCGAGGNONE 
J065066G17GGGCGAGGNONE 
J065077I09GGGCGAGGNONE 
J065099M22GGGCGAGGNONE 
J065135B13GGGCGAGGNONE 
J065144H19GGGCGAGGNONE 
J065146I03GGGCGAGGNONE 
J065169E02GGGCGAGGNONE 
J065177D21GGGCGAGGNONE 
J065189L20GGGCGAGGNONE 
J065207H13GGGCGAGGNONE 
J065210D24GGGCGAGGNONE 
J065212I03GGGCGAGGNONE 
J075007E21GGGCGAGGNONE 
J075013H07GGGCGAGGNONE 
J075023K06GGGCGAGGNONE 
J075031D23GGGCGAGGNONE 
J075038K09GGGCGAGGNONE 
J075084C08GGGCGAGGNONE 
J075098K20GGGCGAGGNONE 
J090028E04GGGCGAGGNONE 
J090031E20GGGCGAGGNONE 
J090042F06GGGCGAGGNONE 
J090049L05GGGCGAGGNONE 
J090086G03GGGCGAGGNONE 
J090096J04GGGCGAGGNONE 
J100035O03GGGCGAGGNONE 
J100053H24GGGCGAGGNONE 
J100056L17GGGCGAGGNONE 
J100058K06GGGCGAGGNONE 
J100059G09GGGCGAGGNONE 
J100081C15GGGCGAGGNONE 
Os04g0303900AK108051CCTCGCCCEndothelial monocyte-activating polypeptide II precursor pro-EMAP II family protein. 
J065056K02CCTCGCCCNONE 
J065073D15CCTCGCCCNONE 
J065122I04CCTCGCCCNONE 
J065180E23CCTCGCCCNONE 
J075093I21CCTCGCCCNONE 
J075095D07CCTCGCCCNONE 
J075106N24CCTCGCCCNONE 
J075175D03CCTCGCCCNONE 
J075189B01CCTCGCCCNONE 
Os04g0325300AK071605GGGCGAGGHypothetical protein. 
Os04g0482900AK100146GGGCGAGGConserved hypothetical protein. 
J065167L22GGGCGAGGNONE 
J065203J02GGGCGAGGNONE 
J075162M08GGGCGAGGNONE 
J080302C10GGGCGAGGNONE 
J080303F07GGGCGAGGNONE 
J080311E16GGGCGAGGNONE 
J080311N07GGGCGAGGNONE 
J080317N13GGGCGAGGNONE 
Os04g0500700AK072528CCTCGCCCCACGCGGCCCCCACCCGSimilar to Hydroxyanthranilate hydroxycinnamoyltransferase 3. 
AK104637CCTCGCCCCACGCGGCCCCCACCCGNONE 
AK119237CCTCGCCCCACGCGGCCCCCACCCGNONE 
Os04g0551800016-049-G12CCATGGGCGAGGNONE 
016-049-G12CGCGGGGGCGAGGNONE 
AK121568CCATGGGCGAGGSimilar to T-complex protein 1, alpha subunit (TCP-1-alpha) (CCT-alpha). 
AK121568CGCGGGGGCGAGGSimilar to T-complex protein 1, alpha subunit (TCP-1-alpha) (CCT-alpha). 
J013073O06CCATGGGCGAGGNONE 
J013073O06CGCGGGGGCGAGGNONE 
J013111B11CCATGGGCGAGGNONE 
J013111B11CGCGGGGGCGAGGNONE 
J013121H23CCATGGGCGAGGNONE 
J013121H23CGCGGGGGCGAGGNONE 
J023012A17CCATGGGCGAGGNONE 
J023012A17CGCGGGGGCGAGGNONE 
J023092M05CCATGGGCGAGGNONE 
J023092M05CGCGGGGGCGAGGNONE 
J033026P14CCATGGGCGAGGNONE 
J033026P14CGCGGGGGCGAGGNONE 
J033033C10CCATGGGCGAGGNONE 
J033033C10CGCGGGGGCGAGGNONE 
J033033M10CCATGGGCGAGGNONE 
J033033M10CGCGGGGGCGAGGNONE 
J033035C24CCATGGGCGAGGNONE 
J033035C24CGCGGGGGCGAGGNONE 
J033052E19CCATGGGCGAGGNONE 
J033052E19CGCGGGGGCGAGGNONE 
J033140K19CCATGGGCGAGGNONE 
J033140K19CGCGGGGGCGAGGNONE 
J065036F18CCATGGGCGAGGNONE 
J065036F18CGCGGGGGCGAGGNONE 
J065067L12CCATGGGCGAGGNONE 
J065067L12CGCGGGGGCGAGGNONE 
J065095G09CCATGGGCGAGGNONE 
J065095G09CGCGGGGGCGAGGNONE 
J065115B08CCATGGGCGAGGNONE 
J065115B08CGCGGGGGCGAGGNONE 
J065218E24CCATGGGCGAGGNONE 
J065218E24CGCGGGGGCGAGGNONE 
J090002N13CCATGGGCGAGGNONE 
J090002N13CGCGGGGGCGAGGNONE 
J090008B12CCATGGGCGAGGNONE 
J090008B12CGCGGGGGCGAGGNONE 
J090016F24CCATGGGCGAGGNONE 
J090016F24CGCGGGGGCGAGGNONE 
J090019H14CCATGGGCGAGGNONE 
J090019H14CGCGGGGGCGAGGNONE 
J090020G20CCATGGGCGAGGNONE 
J090020G20CGCGGGGGCGAGGNONE 
J090029L18CCATGGGCGAGGNONE 
J090029L18CGCGGGGGCGAGGNONE 
J090057C23CCATGGGCGAGGNONE 
J090057C23CGCGGGGGCGAGGNONE 
J090073H23CCATGGGCGAGGNONE 
J090073H23CGCGGGGGCGAGGNONE 
J090081C16CCATGGGCGAGGNONE 
J090081C16CGCGGGGGCGAGGNONE 
J090081E21CCATGGGCGAGGNONE 
J090081E21CGCGGGGGCGAGGNONE 
J090084L14CCATGGGCGAGGNONE 
J090084L14CGCGGGGGCGAGGNONE 
J090086M01CCATGGGCGAGGNONE 
J090086M01CGCGGGGGCGAGGNONE 
J090089E16CCATGGGCGAGGNONE 
J090089E16CGCGGGGGCGAGGNONE 
J100031P12CCATGGGCGAGGNONE 
J100031P12CGCGGGGGCGAGGNONE 
J100090N23CCATGGGCGAGGNONE 
J100090N23CGCGGGGGCGAGGNONE 
Os04g0669100AK070188CCTCGCCCNONE 
AK103123CCTCGCCCConserved hypothetical protein. 
J065098M24CCTCGCCCNONE 
J065152J19CCTCGCCCNONE 
J065187P07CCTCGCCCNONE 
J075105F05CCTCGCCCNONE 
Os04g0685300004-013-B09GGGCGAGGNONE 
006-021-B12GGGCGAGGNONE 
006-021-F10GGGCGAGGNONE 
006-026-C01GGGCGAGGNONE 
006-031-B06GGGCGAGGNONE 
006-038-H03GGGCGAGGNONE 
006-040-B07GGGCGAGGNONE 
006-058-C03GGGCGAGGNONE 
006-062-B02GGGCGAGGNONE 
006-067-B11GGGCGAGGNONE 
006-069-H12GGGCGAGGNONE 
006-072-D01GGGCGAGGNONE 
006-081-E05GGGCGAGGNONE 
006-086-B07GGGCGAGGNONE 
006-092-G07GGGCGAGGNONE 
006-095-G09GGGCGAGGNONE 
006-098-A06GGGCGAGGNONE 
006-099-G01GGGCGAGGNONE 
006-102-E01GGGCGAGGNONE 
006-103-E10GGGCGAGGNONE 
006-114-A05GGGCGAGGNONE 
006-115-B09GGGCGAGGNONE 
006-118-F06GGGCGAGGNONE 
006-119-E10GGGCGAGGNONE 
006-120-A01GGGCGAGGNONE 
AF039532GGGCGAGGNONE 
AK070446GGGCGAGGHarpin-induced 1 domain containing protein. 
AK104363GGGCGAGGNONE 
J013039E18GGGCGAGGNONE 
J013056F20GGGCGAGGNONE 
J013131C19GGGCGAGGNONE 
J013153O17GGGCGAGGNONE 
J023054G10GGGCGAGGNONE 
J023067E19GGGCGAGGNONE 
J033027N17GGGCGAGGNONE 
J065016D15GGGCGAGGNONE 
J065110L17GGGCGAGGNONE 
J065127H09GGGCGAGGNONE 
J065128G08GGGCGAGGNONE 
J065144I11GGGCGAGGNONE 
J065157E01GGGCGAGGNONE 
J075017K12GGGCGAGGNONE 
J075025L07GGGCGAGGNONE 
J075045F11GGGCGAGGNONE 
J075052C08GGGCGAGGNONE 
J075070M16GGGCGAGGNONE 
J075142H09GGGCGAGGNONE 
J080001L06GGGCGAGGNONE 
J080014O08GGGCGAGGNONE 
J080015D20GGGCGAGGNONE 
J080016M09GGGCGAGGNONE 
J080017L03GGGCGAGGNONE 
J080018B13GGGCGAGGNONE 
J080031O11GGGCGAGGNONE 
J080032P12GGGCGAGGNONE 
J080034G03GGGCGAGGNONE 
J080034G17GGGCGAGGNONE 
J080034K17GGGCGAGGNONE 
J080036K13GGGCGAGGNONE 
J080057I07GGGCGAGGNONE 
J080058N24GGGCGAGGNONE 
J080063M08GGGCGAGGNONE 
J080067C21GGGCGAGGNONE 
J080070D01GGGCGAGGNONE 
J080075H16GGGCGAGGNONE 
J080078F06GGGCGAGGNONE 
J080082L03GGGCGAGGNONE 
J080083D21GGGCGAGGNONE 
J080083F23GGGCGAGGNONE 
J080086F13GGGCGAGGNONE 
J080086N16GGGCGAGGNONE 
J080090C17GGGCGAGGNONE 
J080097I15GGGCGAGGNONE 
J080097N15GGGCGAGGNONE 
J100051G03GGGCGAGGNONE 
J100071H01GGGCGAGGNONE 
J100080G18GGGCGAGGNONE 
Os05g0148300009-031-A08CCTCGCCCACGANONE 
AK062421CCTCGCCCACGARibosomal protein S27, mitochondrial family protein. 
Os05g0173700012-035-H08CCTCGCCCNONE 
AK063470CCTCGCCCSimilar to DNA replication licensing factor MCM3 homolog (Replication origin activator) (ROA protein) (Fragment). 
Os05g0388500AK065313CCTCGCCCSimilar to 50S ribosomal protein L1. 
AK098990CCTCGCCCNONE 
AK104689CCTCGCCCNONE 
J013094L23CCTCGCCCNONE 
J065118O04CCTCGCCCNONE 
Os05g0413400AK060336GGGCGAGGSimilar to Isopentenyl diphosphate isomerase 1. 
AK099027GGGCGAGGNONE 
Os05g0451300AK108341AGTGGGCCACCTCGCCCGGCCCAACCConserved hypothetical protein. 
Os05g0455200AK100916CCTCGCCCSimilar to Homeodomain protein JUBEL2. 
Os05g0459000AK106756GGGCGAGGSimilar to Gag/env/c-myb protein (Fragment). 
Os05g0463500AK108773CCTCGCCCConserved hypothetical protein. 
Os05g0540900006-038-F02CCTCGCCCNONE 
AK060489CCTCGCCCNONE 
AK072284CCTCGCCCConserved hypothetical protein. 
Os06g0211200011-063-B02CCTCGCCCNONE 
AK103188CCTCGCCCSimilar to Abscisic acid responsive elements-binding factor (ABA-responsive element binding protein 1) (AREB1). 
AK105312CCTCGCCCNONE 
J065214N03CCTCGCCCNONE 
J090046C13CCTCGCCCNONE 
J090049L03CCTCGCCCNONE 
J100074P03CCTCGCCCNONE 
Os06g0225300AK065224CGCGTCGCCTCGCCCNONE 
AK100258CGCGTCGCCTCGCCCSimilar to SERK1 (Fragment). 
J013002G23CGCGTCGCCTCGCCCNONE 
Os06g0258000AK107483CCTCGCCCSimilar to Typical P-type R2R3 Myb protein (Fragment). 
Os06g0282000J100029K16CCTCGCCCNONE 
J100090N09CCTCGCCCUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
Os06g0498400AK103463CCTCGCCCSimilar to Alpha-glucan water dikinase, chloroplast precursor (EC 2.7.9.4) (Starch-related R1 protein). 
Os06g0650900AK071882CCTCGCCCNONE 
AK107961CCTCGCCCHeat shock protein DnaJ family protein. 
Os07g0102000AK070220CCTCGCCCTetraacyldisaccharide-1-P 4'-kinase family protein. 
Os07g0121500J100066O17CCTCGCCCNONE 
J100066O17CCTCGCCCNONE 
Os07g0159800AK059284CCTCGCCCNONE 
Os07g0162900015-020-H06CCTCGCCCNONE 
AK106266CCTCGCCCEsterase/lipase/thioesterase domain containing protein. 
Os07g0178800AF017356CCTCGCCCSimilar to Low molecular mass early light-inducible protein HV90, chloroplast precursor (ELIP). 
Os07g0186400006-104-G07GGGCGAGGNONE 
AK101850GGGCGAGGBromo adjacent region domain containing protein. 
J033033F13GGGCGAGGNONE 
J033060I18GGGCGAGGNONE 
J033069K07GGGCGAGGNONE 
J033069L08GGGCGAGGNONE 
J065073O16GGGCGAGGNONE 
J065093M09GGGCGAGGNONE 
J100024F04GGGCGAGGNONE 
J100047O14GGGCGAGGNONE 
J100060K06GGGCGAGGNONE 
Os07g0205900AK070209CCTCGCCCArmadillo-like helical domain containing protein. 
Os07g0419800J080309B06CCTCGCCCNONE 
Os07g0502200006-027-C06CCTCGCCCAAACNONE 
012-007-C05CCTCGCCCAAACNONE 
AK120682CCTCGCCCAAACMulti antimicrobial extrusion protein MatE family protein. 
J053045G13CCTCGCCCAAACNONE 
J053064I18CCTCGCCCAAACNONE 
J053091G24CCTCGCCCAAACNONE 
J065016E10CCTCGCCCAAACNONE 
J065021B18CCTCGCCCAAACNONE 
J065022A17CCTCGCCCAAACNONE 
J065059D18CCTCGCCCAAACNONE 
J065063N19CCTCGCCCAAACNONE 
J065065O10CCTCGCCCAAACNONE 
J065196F12CCTCGCCCAAACNONE 
J065208I01CCTCGCCCAAACNONE 
J065218G15CCTCGCCCAAACNONE 
J100040G01CCTCGCCCAAACNONE 
J100060M03CCTCGCCCAAACNONE 
J100061P09CCTCGCCCAAACNONE 
J100065P05CCTCGCCCAAACNONE 
Os07g0549600J080302I11GCGCGCGAGGGCGAGGBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
J080304E08GCGCGCGAGGGCGAGGNONE 
J080306P15GCGCGCGAGGGCGAGGNONE 
J080312F02GCGCGCGAGGGCGAGGNONE 
J080316C13GCGCGCGAGGGCGAGGNONE 
J080316K21GCGCGCGAGGGCGAGGNONE 
J080319K19GCGCGCGAGGGCGAGGNONE 
Os07g0577600006-021-H11CCTCGCCCNONE 
006-022-B11CCTCGCCCNONE 
006-022-D10CCTCGCCCNONE 
006-022-E02CCTCGCCCNONE 
006-022-F03CCTCGCCCNONE 
006-023-C11CCTCGCCCNONE 
006-024-C10CCTCGCCCNONE 
006-024-C12CCTCGCCCNONE 
006-024-G12CCTCGCCCNONE 
006-026-C04CCTCGCCCNONE 
006-026-E05CCTCGCCCNONE 
006-026-E11CCTCGCCCNONE 
006-026-F09CCTCGCCCNONE 
006-026-H05CCTCGCCCNONE 
006-027-D03CCTCGCCCNONE 
006-028-C04CCTCGCCCNONE 
006-029-G10CCTCGCCCNONE 
006-030-A11CCTCGCCCNONE 
006-030-D12CCTCGCCCNONE 
006-031-G05CCTCGCCCNONE 
006-032-H06CCTCGCCCNONE 
006-033-A02CCTCGCCCNONE 
006-033-A06CCTCGCCCNONE 
006-034-B10CCTCGCCCNONE 
006-034-F07CCTCGCCCNONE 
006-035-A08CCTCGCCCNONE 
006-035-F07CCTCGCCCNONE 
006-036-A04CCTCGCCCNONE 
006-036-B04CCTCGCCCNONE 
006-037-D02CCTCGCCCNONE 
006-037-F12CCTCGCCCNONE 
006-037-H12CCTCGCCCNONE 
006-040-G12CCTCGCCCNONE 
006-040-H03CCTCGCCCNONE 
006-040-H06CCTCGCCCNONE 
006-042-B12CCTCGCCCNONE 
006-042-H10CCTCGCCCNONE 
006-044-G09CCTCGCCCNONE 
006-045-C04CCTCGCCCNONE 
006-046-B10CCTCGCCCNONE 
006-047-A05CCTCGCCCNONE 
006-048-D05CCTCGCCCNONE 
006-049-A08CCTCGCCCNONE 
006-050-C07CCTCGCCCNONE 
006-050-H10CCTCGCCCNONE 
006-051-G03CCTCGCCCNONE 
006-052-A01CCTCGCCCNONE 
006-052-A05CCTCGCCCNONE 
006-052-B03CCTCGCCCNONE 
006-052-D10CCTCGCCCNONE 
006-054-D03CCTCGCCCNONE 
006-055-A12CCTCGCCCNONE 
006-055-C05CCTCGCCCNONE 
006-055-F05CCTCGCCCNONE 
006-055-H10CCTCGCCCNONE 
006-056-A02CCTCGCCCNONE 
006-056-D07CCTCGCCCNONE 
006-057-A03CCTCGCCCNONE 
006-057-B06CCTCGCCCNONE 
006-057-H08CCTCGCCCNONE 
006-058-C04CCTCGCCCNONE 
006-058-F06CCTCGCCCNONE 
006-059-C10CCTCGCCCNONE 
006-059-G08CCTCGCCCNONE 
006-060-E10CCTCGCCCNONE 
006-061-B10CCTCGCCCNONE 
006-062-A05CCTCGCCCNONE 
006-062-B04CCTCGCCCNONE 
006-063-A04CCTCGCCCNONE 
006-063-D01CCTCGCCCNONE 
006-063-G12CCTCGCCCNONE 
006-064-D12CCTCGCCCNONE 
006-066-A03CCTCGCCCNONE 
006-066-C03CCTCGCCCNONE 
006-067-A03CCTCGCCCNONE 
006-067-G07CCTCGCCCNONE 
006-068-A06CCTCGCCCNONE 
006-069-D04CCTCGCCCNONE 
006-069-G05CCTCGCCCNONE 
006-070-H08CCTCGCCCNONE 
006-071-A05CCTCGCCCNONE 
006-071-H11CCTCGCCCNONE 
006-072-A07CCTCGCCCNONE 
006-072-B02CCTCGCCCNONE 
006-072-D11CCTCGCCCNONE 
006-072-H12CCTCGCCCNONE 
006-075-G06CCTCGCCCNONE 
006-077-B09CCTCGCCCNONE 
006-078-D01CCTCGCCCNONE 
006-078-D02CCTCGCCCNONE 
006-078-E05CCTCGCCCNONE 
006-078-G07CCTCGCCCNONE 
006-079-C03CCTCGCCCNONE 
006-079-F12CCTCGCCCNONE 
006-079-H01CCTCGCCCNONE 
006-080-D04CCTCGCCCNONE 
006-080-H04CCTCGCCCNONE 
006-081-A10CCTCGCCCNONE 
006-082-G02CCTCGCCCNONE 
006-082-H07CCTCGCCCNONE 
006-083-B03CCTCGCCCNONE 
006-085-A09CCTCGCCCNONE 
006-085-A12CCTCGCCCNONE 
006-085-F07CCTCGCCCNONE 
006-086-B11CCTCGCCCNONE 
006-086-D01CCTCGCCCNONE 
006-086-G04CCTCGCCCNONE 
006-087-E04CCTCGCCCNONE 
006-087-G09CCTCGCCCNONE 
006-088-E11CCTCGCCCNONE 
006-088-G10CCTCGCCCNONE 
006-088-H01CCTCGCCCNONE 
006-089-B04CCTCGCCCNONE 
006-089-D05CCTCGCCCNONE 
006-089-F07CCTCGCCCNONE 
006-089-H07CCTCGCCCNONE 
006-090-B06CCTCGCCCNONE 
006-090-H05CCTCGCCCNONE 
006-091-E11CCTCGCCCNONE 
006-092-H01CCTCGCCCNONE 
006-093-B08CCTCGCCCNONE 
006-093-C07CCTCGCCCNONE 
006-093-F02CCTCGCCCNONE 
006-093-G05CCTCGCCCNONE 
006-093-G06CCTCGCCCNONE 
006-094-D10CCTCGCCCNONE 
006-094-H07CCTCGCCCNONE 
006-095-G03CCTCGCCCNONE 
006-096-A06CCTCGCCCNONE 
006-096-E03CCTCGCCCNONE 
006-097-B03CCTCGCCCNONE 
006-097-D03CCTCGCCCNONE 
006-098-B07CCTCGCCCNONE 
006-098-G05CCTCGCCCNONE 
006-099-F05CCTCGCCCNONE 
006-100-H10CCTCGCCCNONE 
006-100-H12CCTCGCCCNONE 
006-101-A06CCTCGCCCNONE 
006-101-A08CCTCGCCCNONE 
006-101-A12CCTCGCCCNONE 
006-101-D04CCTCGCCCNONE 
006-101-G07CCTCGCCCNONE 
006-102-B12CCTCGCCCNONE 
006-102-E09CCTCGCCCNONE 
006-102-F02CCTCGCCCNONE 
006-103-D09CCTCGCCCNONE 
006-105-D05CCTCGCCCNONE 
006-105-D08CCTCGCCCNONE 
006-106-C07CCTCGCCCNONE 
006-106-F12CCTCGCCCNONE 
006-107-D01CCTCGCCCNONE 
006-109-C05CCTCGCCCNONE 
006-109-C08CCTCGCCCNONE 
006-109-D02CCTCGCCCNONE 
006-111-F03CCTCGCCCNONE 
006-112-C12CCTCGCCCNONE 
006-112-D08CCTCGCCCNONE 
006-113-A01CCTCGCCCNONE 
006-113-B03CCTCGCCCNONE 
006-113-C11CCTCGCCCNONE 
006-113-E07CCTCGCCCNONE 
006-113-F08CCTCGCCCNONE 
006-114-D08CCTCGCCCNONE 
006-114-H08CCTCGCCCNONE 
006-115-A08CCTCGCCCNONE 
006-115-A09CCTCGCCCNONE 
006-115-G05CCTCGCCCNONE 
006-117-B06CCTCGCCCNONE 
006-117-B09CCTCGCCCNONE 
006-117-F11CCTCGCCCNONE 
006-117-G10CCTCGCCCNONE 
006-117-H08CCTCGCCCNONE 
006-118-C06CCTCGCCCNONE 
006-118-G11CCTCGCCCNONE 
006-119-H03CCTCGCCCNONE 
006-120-D01CCTCGCCCNONE 
006-120-D12CCTCGCCCNONE 
006-120-H04CCTCGCCCNONE 
009-022-E12CCTCGCCCNONE 
009-044-H02CCTCGCCCNONE 
009-074-B08CCTCGCCCNONE 
009-145-B08CCTCGCCCNONE 
009-156-D09CCTCGCCCNONE 
009-163-F03CCTCGCCCNONE 
009-193-G03CCTCGCCCNONE 
AF010321CCTCGCCCNONE 
AK060987CCTCGCCCNONE 
AK070051CCTCGCCCNONE 
AK103966CCTCGCCCNONE 
AK104016CCTCGCCCNONE 
AK104127CCTCGCCCNONE 
AK104177CCTCGCCCNONE 
AK104283CCTCGCCCNONE 
AK104608CCTCGCCCNONE 
AK104651CCTCGCCCNONE 
AK119176CCTCGCCCSimilar to Type II chlorophyll a/b binding protein from photosystem I precursor. 
J065013J05CCTCGCCCNONE 
J065129D23CCTCGCCCNONE 
J065138E06CCTCGCCCNONE 
J065179N22CCTCGCCCNONE 
J065192A07CCTCGCCCNONE 
J065208G16CCTCGCCCNONE 
J075013K01CCTCGCCCNONE 
J075017B12CCTCGCCCNONE 
J075018O17CCTCGCCCNONE 
J075023H05CCTCGCCCNONE 
J075053L02CCTCGCCCNONE 
J075067I01CCTCGCCCNONE 
J075083D19CCTCGCCCNONE 
J075083G03CCTCGCCCNONE 
J075084F12CCTCGCCCNONE 
J075088K18CCTCGCCCNONE 
J075094A18CCTCGCCCNONE 
J075094I22CCTCGCCCNONE 
J075097E17CCTCGCCCNONE 
J075098I24CCTCGCCCNONE 
J075110K19CCTCGCCCNONE 
J075118G21CCTCGCCCNONE 
J075118J20CCTCGCCCNONE 
J075120G14CCTCGCCCNONE 
J075120H20CCTCGCCCNONE 
J075127H23CCTCGCCCNONE 
J075139M03CCTCGCCCNONE 
J075142E17CCTCGCCCNONE 
J075149N17CCTCGCCCNONE 
J075152A20CCTCGCCCNONE 
J075157N22CCTCGCCCNONE 
J075159K21CCTCGCCCNONE 
J075173B20CCTCGCCCNONE 
J075192N20CCTCGCCCNONE 
J075196A07CCTCGCCCNONE 
J075199N04CCTCGCCCNONE 
J080005P10CCTCGCCCNONE 
J080025I24CCTCGCCCNONE 
J080064D09CCTCGCCCNONE 
J080064N24CCTCGCCCNONE 
J080068B02CCTCGCCCNONE 
J080097K04CCTCGCCCNONE 
J080097K19CCTCGCCCNONE 
J080097N20CCTCGCCCNONE 
J100055P07CCTCGCCCNONE 
Os07g0588600AK108320CCTCGCCCZinc finger, C2H2-type domain containing protein. 
Os07g0616900AK071047GGGCGAGGProtein of unknown function DUF500 family protein. 
J013106G03GGGCGAGGNONE 
J013124C20GGGCGAGGNONE 
J033096D16GGGCGAGGNONE 
J043005E08GGGCGAGGNONE 
J065197K12GGGCGAGGNONE 
J065211I03GGGCGAGGNONE 
Os07g0661400006-083-E05CCTCGCCCNONE 
006-084-B12CCTCGCCCNONE 
006-096-B03CCTCGCCCNONE 
009-013-C12CCTCGCCCNONE 
009-017-C10CCTCGCCCNONE 
009-027-A02CCTCGCCCNONE 
009-035-A06CCTCGCCCNONE 
009-047-H11CCTCGCCCNONE 
009-050-B11CCTCGCCCNONE 
009-051-C02CCTCGCCCNONE 
009-089-G06CCTCGCCCNONE 
009-091-C05CCTCGCCCNONE 
009-095-B11CCTCGCCCNONE 
009-151-C01CCTCGCCCNONE 
009-154-F06CCTCGCCCNONE 
009-169-F02CCTCGCCCNONE 
009-171-G01CCTCGCCCNONE 
009-179-F07CCTCGCCCNONE 
013-018-H06CCTCGCCCNONE 
013-024-E05CCTCGCCCNONE 
013-038-F09CCTCGCCCNONE 
013-099-F06CCTCGCCCNONE 
014-042-E09CCTCGCCCNONE 
014-086-C02CCTCGCCCNONE 
014-093-B08CCTCGCCCNONE 
015-039-G11CCTCGCCCNONE 
016-036-E05CCTCGCCCNONE 
AK068814CCTCGCCCNONE 
AK102682CCTCGCCCNONE 
AK105973CCTCGCCCNONE 
AK107202CCTCGCCCConserved hypothetical protein. 
J053035N21CCTCGCCCNONE 
J053099D11CCTCGCCCNONE 
J065023B18CCTCGCCCNONE 
J065031M15CCTCGCCCNONE 
J065035G23CCTCGCCCNONE 
J065060M18CCTCGCCCNONE 
J065073J18CCTCGCCCNONE 
J065103E20CCTCGCCCNONE 
J065105N19CCTCGCCCNONE 
J065137A08CCTCGCCCNONE 
J065152K09CCTCGCCCNONE 
J065156M12CCTCGCCCNONE 
J065162G23CCTCGCCCNONE 
J065162L13CCTCGCCCNONE 
J065163H16CCTCGCCCNONE 
J065165E06CCTCGCCCNONE 
J065171J04CCTCGCCCNONE 
J065180L23CCTCGCCCNONE 
J065183K23CCTCGCCCNONE 
J065186H13CCTCGCCCNONE 
J065195D10CCTCGCCCNONE 
J065209G11CCTCGCCCNONE 
J075006J08CCTCGCCCNONE 
J075112O07CCTCGCCCNONE 
J080301H14CCTCGCCCNONE 
J100058C17CCTCGCCCNONE 
J100077I23CCTCGCCCNONE 
J100080I24CCTCGCCCNONE 
Os07g0674100AB183706GGGCGAGGUDP-glucuronic acid decarboxylase. 
AK099614GGGCGAGGNONE 
J013050E02GGGCGAGGNONE 
J065162F06GGGCGAGGNONE 
J065180F10GGGCGAGGNONE 
J090049F09GGGCGAGGNONE 
J100064L11GGGCGAGGNONE 
Os07g0683900004-013-C10CCTCGCCCNONE 
AK060899CCTCGCCCNONE 
J065096G16CCTCGCCCNONE 
J090003A20CCTCGCCCNONE 
J090058E17CCTCGCCCNONE 
J100028P13CCTCGCCCNONE 
J100046H21CCTCGCCCNONE 
J100078H20CCTCGCCCNONE 
Os08g0155100AK069865CGCCACGTCACGCCTCGCCCMajor sperm protein domain containing protein. 
AK104886CGCCACGTCACGCCTCGCCCNONE 
J013089M01CGCCACGTCACGCCTCGCCCNONE 
J023037M15CGCCACGTCACGCCTCGCCCNONE 
J033068E03CGCCACGTCACGCCTCGCCCNONE 
J090021P19CGCCACGTCACGCCTCGCCCNONE 
Os08g0163400AB005290CCTCGCCCSigma-70 factor family protein. 
AK065997CCTCGCCCNONE 
AK071725CCTCGCCCNONE 
Os08g0244100012-067-B02GGGCGAGGNONE 
AK064015GGGCGAGGNONE 
AK101898GGGCGAGGNONE 
AK102977GGGCGAGGt-snare domain containing protein. 
J033071B08GGGCGAGGNONE 
J033115N03GGGCGAGGNONE 
J065031I08GGGCGAGGNONE 
J065091O05GGGCGAGGNONE 
J065116E21GGGCGAGGNONE 
J065131F08GGGCGAGGNONE 
J065196N04GGGCGAGGNONE 
J075064N17GGGCGAGGNONE 
J075078P10GGGCGAGGNONE 
J075108N23GGGCGAGGNONE 
J075142C18GGGCGAGGNONE 
J075163I12GGGCGAGGNONE 
J075177B18GGGCGAGGNONE 
J075178A18GGGCGAGGNONE 
J075191N04GGGCGAGGNONE 
Os08g0418600AK108371CCTCGCCCConserved hypothetical protein. 
Os08g0449850J075182C20GGGCGAGGConserved hypothetical protein. 
Os08g0490600AK108305CCTCGCCCBeta-Ig-H3/fasciclin domain containing protein. 
Os08g0553800006-058-A04CCTCGCCCNONE 
006-061-F09CCTCGCCCNONE 
AK065711CCTCGCCCNONE 
AK066697CCTCGCCCNmrA-like family protein. 
AK073638CCTCGCCCNONE 
AK104428CCTCGCCCNONE 
AK105897CCTCGCCCNONE 
J075001A06CCTCGCCCNONE 
J075041H20CCTCGCCCNONE 
J075123J24CCTCGCCCNONE 
Os08g0557600AB026731CCTCGCCCNONE 
AK102459CCTCGCCCSimilar to Monodehydroascorbate reductase (EC 1.6.5.4) (MDAR) (Ascorbate free radical reductase) (AFR reductase). 
J023088J22CCTCGCCCNONE 
J033094C01CCTCGCCCNONE 
J033125C20CCTCGCCCNONE 
J065039E01CCTCGCCCNONE 
J065212L01CCTCGCCCNONE 
J075076D03CCTCGCCCNONE 
J090019L14CCTCGCCCNONE 
J090053K23CCTCGCCCNONE 
Os09g0109600013-044-D05CCTCGCCCNONE 
AK063582CCTCGCCCConserved hypothetical protein. 
Os09g0322300AK107151CCTCGCCCHypothetical protein. 
J075023P17CCTCGCCCNONE 
J075143O05CCTCGCCCNONE 
Os09g0372900006-044-C02CCTCGCCCNONE 
AK059785CCTCGCCCCyclin-like F-box domain containing protein. 
AK067586CCTCGCCCNONE 
AK100129CCTCGCCCNONE 
J023009I10CCTCGCCCNONE 
J065195A19CCTCGCCCNONE 
J065202M02CCTCGCCCNONE 
J065215H14CCTCGCCCNONE 
Os09g0448100AK070293CCTCGCCCATAACyclin-like F-box domain containing protein. 
AK070628CCTCGCCCATAANONE 
J023050H06CCTCGCCCATAANONE 
J053091I22CCTCGCCCATAANONE 
J065051I11CCTCGCCCATAANONE 
J065066L13CCTCGCCCATAANONE 
Os09g0497000AK099705CCTCGCCCMitochondrial substrate carrier family protein. 
Os09g0517700011-058-H11GGGCGAGGNONE 
012-050-D08GGGCGAGGNONE 
AK071305GGGCGAGGThioesterase superfamily domain containing protein. 
AK101141GGGCGAGGNONE 
J023088I03GGGCGAGGNONE 
J033026N19GGGCGAGGNONE 
J065060F07GGGCGAGGNONE 
J065073B06GGGCGAGGNONE 
J065138A05GGGCGAGGNONE 
J100047C23GGGCGAGGNONE 
J100078F20GGGCGAGGNONE 
Os09g0517800012-034-H10CCTCGCCCNONE 
012-034-H10GGGCGAGGNONE 
AK121391CCTCGCCCCyclin-like F-box domain containing protein. 
AK121391GGGCGAGGCyclin-like F-box domain containing protein. 
J023129D04CCTCGCCCNONE 
J023129D04GGGCGAGGNONE 
J043012D11CCTCGCCCNONE 
J043012D11GGGCGAGGNONE 
Os09g0518500016-035-G02GGGCGAGGNONE 
AK100826GGGCGAGGAnkyrin repeat containing protein. 
Os09g0526600011-054-D09GGGCGAGGNONE 
AK105409GGGCGAGGNONE 
Os09g0526800014-002-D10CTCTCCGCCCACGCCTCGCCCNONE 
AK060048CTCTCCGCCCACGCCTCGCCCNONE 
AK072174CTCTCCGCCCACGCCTCGCCCNONE 
AK105121CTCTCCGCCCACGCCTCGCCCNC domain containing protein. 
J013135P13CTCTCCGCCCACGCCTCGCCCNONE 
J033135C23CTCTCCGCCCACGCCTCGCCCNONE 
J043036C17CTCTCCGCCCACGCCTCGCCCNONE 
J065066N16CTCTCCGCCCACGCCTCGCCCNONE 
Os09g0527700AK111128CCTCGCCCSimilar to Auxin-induced protein IAA4. 
J065124H12CCTCGCCCNONE 
J065181I07CCTCGCCCNONE 
J065207G14CCTCGCCCNONE 
Os09g0531900AK073015CCTCGCCCACAAATGGGCCGAAASimilar to Glycosyltransferase QUASIMODO1 (EC 2.4.1.-). 
Os09g0558200016-083-C09GGGCGAGGCGTGGTCAGTGGNONE 
AK068834GGGCGAGGCGTGGTCAGTGGNONE 
AK103673GGGCGAGGCGTGGTCAGTGGHomeodomain-like containing protein. 
J013159M18GGGCGAGGCGTGGTCAGTGGNONE 
J065022I04GGGCGAGGCGTGGTCAGTGGNONE 
J065089B19GGGCGAGGCGTGGTCAGTGGNONE 
Os11g0454300009-010-F05CCTCGCCCNONE 
011-073-B07CCTCGCCCNONE 
011-089-D03CCTCGCCCNONE 
012-041-B07CCTCGCCCNONE 
012-042-D12CCTCGCCCNONE 
012-046-G11CCTCGCCCNONE 
012-072-D10CCTCGCCCNONE 
012-090-F06CCTCGCCCNONE 
013-009-A10CCTCGCCCNONE 
013-096-B03CCTCGCCCNONE 
014-002-F10CCTCGCCCNONE 
014-006-A10CCTCGCCCNONE 
014-006-C05CCTCGCCCNONE 
014-006-E01CCTCGCCCNONE 
014-006-H04CCTCGCCCNONE 
014-009-D05CCTCGCCCNONE 
014-010-D07CCTCGCCCNONE 
014-012-A10CCTCGCCCNONE 
014-013-F08CCTCGCCCNONE 
014-014-D01CCTCGCCCNONE 
014-016-D07CCTCGCCCNONE 
014-020-F09CCTCGCCCNONE 
014-023-C07CCTCGCCCNONE 
014-024-A03CCTCGCCCNONE 
014-025-D11CCTCGCCCNONE 
014-027-D02CCTCGCCCNONE 
014-030-F11CCTCGCCCNONE 
014-032-H06CCTCGCCCNONE 
014-034-D06CCTCGCCCNONE 
014-037-E04CCTCGCCCNONE 
014-038-C02CCTCGCCCNONE 
014-041-B08CCTCGCCCNONE 
014-044-A10CCTCGCCCNONE 
014-045-C11CCTCGCCCNONE 
014-046-B04CCTCGCCCNONE 
014-047-D01CCTCGCCCNONE 
014-053-C03CCTCGCCCNONE 
014-053-C09CCTCGCCCNONE 
014-072-D09CCTCGCCCNONE 
014-073-D09CCTCGCCCNONE 
014-073-F01CCTCGCCCNONE 
014-081-B04CCTCGCCCNONE 
014-081-G07CCTCGCCCNONE 
014-084-C10CCTCGCCCNONE 
014-084-F03CCTCGCCCNONE 
014-085-D08CCTCGCCCNONE 
014-087-H10CCTCGCCCNONE 
014-095-E02CCTCGCCCNONE 
014-095-G07CCTCGCCCNONE 
AK121952CCTCGCCCSimilar to Water-stress inducible protein RAB21. 
J033107K14CCTCGCCCNONE 
J065021B08CCTCGCCCNONE 
J065059D24CCTCGCCCNONE 
J065066D13CCTCGCCCNONE 
J065070K11CCTCGCCCNONE 
J065081I18CCTCGCCCNONE 
J065120F19CCTCGCCCNONE 
J065186M13CCTCGCCCNONE 
J075031E22CCTCGCCCNONE 
J075046F04CCTCGCCCNONE 
J075069L13CCTCGCCCNONE 
J075097G09CCTCGCCCNONE 
J075099C23CCTCGCCCNONE 
J075149N21CCTCGCCCNONE 
J075150G23CCTCGCCCNONE 
J075170K09CCTCGCCCNONE 
J075173A09CCTCGCCCNONE 
J075177C21CCTCGCCCNONE 
Os11g0635000AK071927CCTCGCCCHypothetical protein. 
J013069M04CCTCGCCCNONE 
Os12g0273700AK071152CCTCGCCCConserved hypothetical protein. 
Os12g0564400009-069-F12CCTCGCCCACCAACNONE 
AK059949CCTCGCCCACCAACSimilar to Thylakoid lumenal 21.5 kDa protein, chloroplast precursor. 
AK104548CCTCGCCCACCAACNONE 
Os12g0599800AK111139GGCTGGGCGAGGConserved hypothetical protein. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.