version

Summary of OsREG550 (All List)

OrganismOryza sativa  
IDOsREG550  
SequenceCCTGGGCC  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count1120  

Entry Sequences (1120 entries)

LocusGene modelSequenceDescription
Os01g0100700006-066-G10CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
009-108-B10CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
AK059844CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
AK121523CCTGGGCCGGGCCCGGCCCAGCCCAACASimilar to 40S ribosomal protein S5-1. 
J023037D16CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J033028P14CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J033064M07CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J033123M01CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J065026O07CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J065082A05CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J075003I02CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J075170J15CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J100040D18CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
Os01g0101600AK099952CCTGGGCCTGGRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
AK122118CCTGGGCCTGGNONE 
J013123J12CCTGGGCCTGGNONE 
J033026O19CCTGGGCCTGGNONE 
J033128C08CCTGGGCCTGGNONE 
J065116M14CCTGGGCCTGGNONE 
J090058F15CCTGGGCCTGGNONE 
J090079F20CCTGGGCCTGGNONE 
Os01g0159800015-032-D03AGTGGGCCCAGGNONE 
AK106292AGTGGGCCCAGGBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
J053031O06AGTGGGCCCAGGNONE 
J053035H22AGTGGGCCCAGGNONE 
J065095A07AGTGGGCCCAGGNONE 
J100017I21AGTGGGCCCAGGNONE 
Os01g0258600J075028F17GACGGCCCAGGCCCACGGCCCACANONE 
J075061L04GACGGCCCAGGCCCACGGCCCACAConserved hypothetical protein. 
J075071B09GACGGCCCAGGCCCACGGCCCACANONE 
J075093E04GACGGCCCAGGCCCACGGCCCACANONE 
J100033B11GACGGCCCAGGCCCACGGCCCACANONE 
Os01g0372100J075029A10CCTGGGCCCACAConserved hypothetical protein. 
Os01g0391100012-001-B05CCTGGGCCCACTTGNONE 
012-053-F01CCTGGGCCCACTTGNONE 
AK063499CCTGGGCCCACTTGNONE 
J065021A04CCTGGGCCCACTTGNONE 
J065076H06CCTGGGCCCACTTGNONE 
J065181E05CCTGGGCCCACTTGNONE 
J065187A05CCTGGGCCCACTTGNONE 
J075036C17CCTGGGCCCACTTGNONE 
J075051C18CCTGGGCCCACTTGNONE 
J075063L16CCTGGGCCCACTTGNONE 
J075079M08CCTGGGCCCACTTGNONE 
J075112H15CCTGGGCCCACTTGNONE 
J075135F10CCTGGGCCCACTTGNONE 
J075164H06CCTGGGCCCACTTGNONE 
J075195N02CCTGGGCCCACTTGNONE 
Os01g0560200AK102003TCAGGCCCAGGSimilar to Vesicle transport v-SNARE 13 (AtVTI13) (Vesicle transport v-SNARE protein VTI13) (Vesicle soluble NSF attachment protein receptor 13). 
J033079N06TCAGGCCCAGGNONE 
J065092F14TCAGGCCCAGGNONE 
J065106D04TCAGGCCCAGGNONE 
J065194K23TCAGGCCCAGGNONE 
Os01g0618200AK102319CCTGGGCCAGCCCACCAProtein phosphatase 2C family protein. 
Os01g0691500AK073675AGTGGGCCCAGGNONE 
AK107426AGTGGGCCCAGGCytidylyltransferase domain containing protein. 
J013055P17AGTGGGCCCAGGNONE 
J033050M21AGTGGGCCCAGGNONE 
Os01g0691600AK103297CCTGGGCCCACTSimilar to DNA repair helicase XPB2 (EC 3.6.1.-) (XPB homolog 2) (ERCC3 homolog 2) (RAD25 homolog 2) (AtXPB2). 
Os01g0729900AK064793CGGGCCCAGGNONE 
AK065503CGGGCCCAGGConserved hypothetical protein. 
AK104681CGGGCCCAGGNONE 
AK120504CGGGCCCAGGNONE 
Os01g0784600AK067527TTGGCCCAGGConserved hypothetical protein. 
Os01g0794900AK106644GAGGCCCAGGConserved hypothetical protein. 
Os01g0813800AK063065CCTGGGCCGGTNONE 
Os01g0827200AK073922CCTGGGCCCCANONE 
AK120476CCTGGGCCCCAPhox-like domain containing protein. 
Os01g0842200003-126-E01TCTCGGCCCAGGNONE 
AK102593TCTCGGCCCAGGNONE 
AK119896TCTCGGCCCAGGSimilar to Scarecrow-like 9 (Fragment). 
J013151G12TCTCGGCCCAGGNONE 
J033098G15TCTCGGCCCAGGNONE 
J090041L03TCTCGGCCCAGGNONE 
J090069J20TCTCGGCCCAGGNONE 
Os01g0861000AK058707CCTGGGCCGAConserved hypothetical protein. 
Os01g0870100AK067564GTTGGGCCCACCTGGGCCTGGProtein of unknown function DUF1012 family protein. 
AK072312GTTGGGCCCACCTGGGCCTGGNONE 
AK103428GTTGGGCCCACCTGGGCCTGGNONE 
Os01g0918200009-034-H02GAGGCCCAGGNONE 
009-034-H02GCGGCCCAGGNONE 
AK062434GAGGCCCAGGSimilar to Ubiquitin-like protein SMT3. 
AK062434GCGGCCCAGGSimilar to Ubiquitin-like protein SMT3. 
AK103092GAGGCCCAGGNONE 
AK103092GCGGCCCAGGNONE 
J065093P18GAGGCCCAGGNONE 
J065093P18GCGGCCCAGGNONE 
J065137C15GAGGCCCAGGNONE 
J065137C15GCGGCCCAGGNONE 
J065156G01GAGGCCCAGGNONE 
J065156G01GCGGCCCAGGNONE 
J065206H16GAGGCCCAGGNONE 
J065206H16GCGGCCCAGGNONE 
J065209D03GAGGCCCAGGNONE 
J065209D03GCGGCCCAGGNONE 
J075073K05GAGGCCCAGGNONE 
J075073K05GCGGCCCAGGNONE 
J075099B17GAGGCCCAGGNONE 
J075099B17GCGGCCCAGGNONE 
J075166N04GAGGCCCAGGNONE 
J075166N04GCGGCCCAGGNONE 
Os01g0931300012-055-E05CCTGGGCCCCACANONE 
AK068196CCTGGGCCCCACATafazzin family protein. 
AK099213CCTGGGCCCCACANONE 
Os01g0934300AK072640CCTGGGCCCCACNONE 
J013073H18CCTGGGCCCCACNONE 
J023133P13CCTGGGCCCCACNONE 
J075098G20CCTGGGCCCCACNONE 
Os01g0939700AK059803CAAGGCCCAGGNONE 
AK070588CAAGGCCCAGGSimilar to Esterase D (EC 3.1.1.1). 
AK111469CAAGGCCCAGGNONE 
J090021L11CAAGGCCCAGGNONE 
Os01g0973400AK060011TCGGCCCAGGNONE 
AK068879TCGGCCCAGGConserved hypothetical protein 48 family protein. 
AK099210TCGGCCCAGGNONE 
AK104863TCGGCCCAGGNONE 
J013170C09TCGGCCCAGGNONE 
J033106K13TCGGCCCAGGNONE 
J075018P18TCGGCCCAGGNONE 
J075039C18TCGGCCCAGGNONE 
J075104L18TCGGCCCAGGNONE 
Os02g0133800006-092-D12CCTGGGCCAAAGCCCAATTNONE 
006-111-G01CCTGGGCCAAAGCCCAATTNONE 
AK103646CCTGGGCCAAAGCCCAATTNONE 
AK109376CCTGGGCCAAAGCCCAATTProteasome subunit alpha type 1 (EC 3.4.25.1) (20S proteasome alpha subunit F) (20S proteasome subunit alpha-6) (Proteasome component C2). 
D37886CCTGGGCCAAAGCCCAATTNONE 
J033135B19CCTGGGCCAAAGCCCAATTNONE 
J065200F01CCTGGGCCAAAGCCCAATTNONE 
J065213J11CCTGGGCCAAAGCCCAATTNONE 
J075031N16CCTGGGCCAAAGCCCAATTNONE 
J075032N17CCTGGGCCAAAGCCCAATTNONE 
J075047P04CCTGGGCCAAAGCCCAATTNONE 
J075063D01CCTGGGCCAAAGCCCAATTNONE 
J075105F23CCTGGGCCAAAGCCCAATTNONE 
J075121E16CCTGGGCCAAAGCCCAATTNONE 
J075176F10CCTGGGCCAAAGCCCAATTNONE 
J075182M16CCTGGGCCAAAGCCCAATTNONE 
J075190E09CCTGGGCCAAAGCCCAATTNONE 
J075191B14CCTGGGCCAAAGCCCAATTNONE 
J100055J24CCTGGGCCAAAGCCCAATTNONE 
J100066H24CCTGGGCCAAAGCCCAATTNONE 
J100073N01CCTGGGCCAAAGCCCAATTNONE 
Os02g0140200AK066454ATTGGGCCCAGGCCCGCASimilar to Beta-amyrin synthase. 
Os02g0162500009-181-F03CCTGGGCCGTCNONE 
AK058907CCTGGGCCGTCNONE 
AK121223CCTGGGCCGTCSimilar to 40S ribosomal protein S14. 
J023090I10CCTGGGCCGTCNONE 
J023136J11CCTGGGCCGTCNONE 
J053097J20CCTGGGCCGTCNONE 
J053098F01CCTGGGCCGTCNONE 
J065065B09CCTGGGCCGTCNONE 
J065082M04CCTGGGCCGTCNONE 
J065188O05CCTGGGCCGTCNONE 
J075057P15CCTGGGCCGTCNONE 
J075061J08CCTGGGCCGTCNONE 
J075061N15CCTGGGCCGTCNONE 
J075131I08CCTGGGCCGTCNONE 
J075141H13CCTGGGCCGTCNONE 
J080062E14CCTGGGCCGTCNONE 
J080062P15CCTGGGCCGTCNONE 
J080318G17CCTGGGCCGTCNONE 
J080319G19CCTGGGCCGTCNONE 
J090001L10CCTGGGCCGTCNONE 
J090024I18CCTGGGCCGTCNONE 
J090033F24CCTGGGCCGTCNONE 
J090036M16CCTGGGCCGTCNONE 
J090040I24CCTGGGCCGTCNONE 
J090048P06CCTGGGCCGTCNONE 
J090049B12CCTGGGCCGTCNONE 
J090068C02CCTGGGCCGTCNONE 
J090069O04CCTGGGCCGTCNONE 
J090084H22CCTGGGCCGTCNONE 
J100022L03CCTGGGCCGTCNONE 
J100028O14CCTGGGCCGTCNONE 
J100028O18CCTGGGCCGTCNONE 
J100032A15CCTGGGCCGTCNONE 
J100033D21CCTGGGCCGTCNONE 
J100034J23CCTGGGCCGTCNONE 
J100043K22CCTGGGCCGTCNONE 
J100052M22CCTGGGCCGTCNONE 
J100053N03CCTGGGCCGTCNONE 
J100074N24CCTGGGCCGTCNONE 
J100082J10CCTGGGCCGTCNONE 
Os02g0176300AK066588TGTTGGGCTTGGGCCTCGGCCCAGGConserved hypothetical protein. 
J013072N24TGTTGGGCTTGGGCCTCGGCCCAGGNONE 
Os02g0192700004-020-H12CCTGGGCCGTCNONE 
006-024-H06CCTGGGCCGTCNONE 
006-042-F06CCTGGGCCGTCNONE 
006-050-D04CCTGGGCCGTCNONE 
006-059-E10CCTGGGCCGTCNONE 
006-070-B02CCTGGGCCGTCNONE 
006-084-A09CCTGGGCCGTCNONE 
006-114-E11CCTGGGCCGTCNONE 
006-117-E05CCTGGGCCGTCNONE 
009-126-D11CCTGGGCCGTCNONE 
AK061629CCTGGGCCGTCSimilar to Thioredoxin peroxidase. 
AK065909CCTGGGCCGTCNONE 
J013043E11CCTGGGCCGTCNONE 
J065038I09CCTGGGCCGTCNONE 
J065078C12CCTGGGCCGTCNONE 
J065122O14CCTGGGCCGTCNONE 
J065198H04CCTGGGCCGTCNONE 
Os02g0332700009-144-D04TTGGCCCAGGNONE 
AK062975TTGGCCCAGGConserved hypothetical protein. 
Os02g0485000016-062-B12CCTGGGCCGCNONE 
AK064246CCTGGGCCGCTransferase family protein. 
Os02g0499300AK106994CCTGGGCCTAConserved hypothetical protein. 
Os02g0520800AK102815TACTGGGCCTGGGCCAGSimilar to Ubiquinol-cytochrome c reductase iron-sulfur subunit, mitochondrial precursor (EC 1.10.2.2) (Rieske iron-sulfur protein) (RISP). 
J033108M09TACTGGGCCTGGGCCAGNONE 
J100038E09TACTGGGCCTGGGCCAGNONE 
J100076G11TACTGGGCCTGGGCCAGNONE 
Os02g0542500AK109859AAGGCCCAGGConserved hypothetical protein. 
Os02g0595700006-057-E01CCTGGGCCTCNONE 
006-082-F10CCTGGGCCTCNONE 
006-087-C10CCTGGGCCTCNONE 
006-091-H03CCTGGGCCTCNONE 
006-094-A11CCTGGGCCTCNONE 
AF145053CCTGGGCCTCNONE 
AK064937CCTGGGCCTCNONE 
AK066858CCTGGGCCTCNONE 
AK104785CCTGGGCCTCNONE 
AK119587CCTGGGCCTCChloroplast translational elongation factor Tu. 
J013000P03CCTGGGCCTCNONE 
Os02g0602300AK065609GTGGTGGGCCGTGCCTGGGCCGCGCACGCGNONE 
AK066929GTGGTGGGCCGTGCCTGGGCCGCGCACGCGSimilar to Myelin transcription factor 1 (MYT1) (MYTI) (Proteolipid protein binding protein) (PLPB1). 
J013092L08GTGGTGGGCCGTGCCTGGGCCGCGCACGCGNONE 
J090040I23GTGGTGGGCCGTGCCTGGGCCGCGCACGCGNONE 
Os02g0618400AK099283CCTGGGCCGTGGNONE 
AK111807CCTGGGCCGTGGSimilar to Snapdragon myb protein 305 homolog. 
J090053M16CCTGGGCCGTGGNONE 
J090067D02CCTGGGCCGTGGNONE 
Os02g0668500006-056-A05CCAACGGCCCAGGNONE 
AK060958CCAACGGCCCAGGNONE 
AK071867CCAACGGCCCAGGCellular retinaldehyde-binding/triple function, C-terminal domain containing protein. 
J023117I15CCAACGGCCCAGGNONE 
J065013J03CCAACGGCCCAGGNONE 
J065021P16CCAACGGCCCAGGNONE 
J065044B07CCAACGGCCCAGGNONE 
J065059E23CCAACGGCCCAGGNONE 
J065087N20CCAACGGCCCAGGNONE 
J065185I04CCAACGGCCCAGGNONE 
J065190G19CCAACGGCCCAGGNONE 
J065199C15CCAACGGCCCAGGNONE 
J065213L12CCAACGGCCCAGGNONE 
J080305C01CCAACGGCCCAGGNONE 
J080308C07CCAACGGCCCAGGNONE 
J080310F02CCAACGGCCCAGGNONE 
Os02g0673000AK108650TTGGCCCAGGProtein of unknown function UPF0005 family protein. 
Os02g0725300AK120054CTGGCCCAGGNONE 
J013000L05CTGGCCCAGGNONE 
J065194M19CTGGCCCAGGNONE 
Os02g0760300009-137-D04ATCCAACGGCCCAGGNONE 
AK063850ATCCAACGGCCCAGGSimilar to Immunophilin. 
AK121481ATCCAACGGCCCAGGNONE 
J023149K16ATCCAACGGCCCAGGNONE 
J033098A18ATCCAACGGCCCAGGNONE 
J065017E05ATCCAACGGCCCAGGNONE 
J065088E24ATCCAACGGCCCAGGNONE 
J080305N16ATCCAACGGCCCAGGNONE 
J080306F22ATCCAACGGCCCAGGNONE 
J080306P07ATCCAACGGCCCAGGNONE 
J080318H06ATCCAACGGCCCAGGNONE 
J090013M21ATCCAACGGCCCAGGNONE 
J100029G11ATCCAACGGCCCAGGNONE 
Os02g0795100016-001-E07CTGGCCCAGGNONE 
AK106456CTGGCCCAGGEukaryotic transcription factor, DNA-binding domain containing protein. 
Os02g0810300AK059363AAATGGGCCAGGGCCCAGGSimilar to NBD-like protein. 
AK099203AAATGGGCCAGGGCCCAGGNONE 
Os02g0817600006-085-G03GACAGGTGGGGCCCAGGNONE 
AJ748648GACAGGTGGGGCCCAGGNONE 
AK069892GACAGGTGGGGCCCAGGAUX/IAA protein family protein. 
AK104501GACAGGTGGGGCCCAGGNONE 
AK104802GACAGGTGGGGCCCAGGNONE 
J013027H10GACAGGTGGGGCCCAGGNONE 
J013106L07GACAGGTGGGGCCCAGGNONE 
J013118N15GACAGGTGGGGCCCAGGNONE 
J013131H01GACAGGTGGGGCCCAGGNONE 
J013170C08GACAGGTGGGGCCCAGGNONE 
J023060C13GACAGGTGGGGCCCAGGNONE 
J033024K10GACAGGTGGGGCCCAGGNONE 
J033052I08GACAGGTGGGGCCCAGGNONE 
J090010H15GACAGGTGGGGCCCAGGNONE 
J090011J11GACAGGTGGGGCCCAGGNONE 
J090038P15GACAGGTGGGGCCCAGGNONE 
J090060B02GACAGGTGGGGCCCAGGNONE 
J100079J16GACAGGTGGGGCCCAGGNONE 
Os02g0823000AK122065TAGGCCCAGGPeptidase A22B, minor histocompatibility antigen H13 family protein. 
Os02g0830700AK101172AGGGCCCAGGCCCAACTLeucine rich repeat, N-terminal domain containing protein. 
Os03g0113700AK103835CCTGGGCCGGCCCAAAASimilar to Heat shock 70 kDa protein, mitochondrial precursor. 
Os03g0113800AK065925TTTTGGGCCGGCCCAGGProtein prenyltransferase domain containing protein. 
J013047E20TTTTGGGCCGGCCCAGGNONE 
J065026F21TTTTGGGCCGGCCCAGGNONE 
J065047B03TTTTGGGCCGGCCCAGGNONE 
J065054J12TTTTGGGCCGGCCCAGGNONE 
J065079M24TTTTGGGCCGGCCCAGGNONE 
J065093M07TTTTGGGCCGGCCCAGGNONE 
J065153F02TTTTGGGCCGGCCCAGGNONE 
J065155E21TTTTGGGCCGGCCCAGGNONE 
J065179H15TTTTGGGCCGGCCCAGGNONE 
J075019N02TTTTGGGCCGGCCCAGGNONE 
J075089E01TTTTGGGCCGGCCCAGGNONE 
J090066I18TTTTGGGCCGGCCCAGGNONE 
J090087K20TTTTGGGCCGGCCCAGGNONE 
J100079F05TTTTGGGCCGGCCCAGGNONE 
Os03g0121300AK120047AAGGCCCAGGNONE 
Os03g0122200009-052-H10TAGGCCCAGGNONE 
AB042934TAGGCCCAGGNONE 
AK065033TAGGCCCAGGSimilar to 50S ribosomal protein L11. 
J013001H03TAGGCCCAGGNONE 
J023149C23TAGGCCCAGGNONE 
J065025J15TAGGCCCAGGNONE 
J065093D22TAGGCCCAGGNONE 
Os03g0130700AK110670TTGGCCCAGGNONE 
Os03g0142900011-054-A05CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
AK067103CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
AK120438CCAGGCCCAGGCCCAGGCCCGGCCCProtein of unknown function DUF946, plant family protein. 
J013097D18CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J013098E18CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J013099I17CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J013108C09CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J023045J15CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J033034E13CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J033095F07CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J033102N22CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J065016C14CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J065034E13CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J065065F21CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J065159M09CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J075012C13CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J075017P18CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J075018M03CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J075021H19CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J075070K23CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J075077B18CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J075085E20CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J075090N23CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J075137M16CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J075151E03CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J090042L02CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J090060C21CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J090089I17CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J100024L19CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J100025A06CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J100033C24CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J100052J17CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J100063H10CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J100073P04CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J100075D01CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J100077J17CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J100087F03CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
J100087F09CCAGGCCCAGGCCCAGGCCCGGCCCNONE 
Os03g0181500AK100798CCTGGGCCCGCNONE 
Os03g0197400AK071413CCTGGGCCATSimilar to COP9 signalosome complex subunit 4 (Signalosome subunit 4) (Constitutive photomorphogenesis protein 8) (FUSCA protein 4) (FUSCA4) (AtS4). 
AK104905CCTGGGCCATNONE 
J053023D18CCTGGGCCATNONE 
Os03g0206400AK066494CCTGGGCCCCACConserved hypothetical protein. 
AK107011CCTGGGCCCCACNONE 
J065162G04CCTGGGCCCCACNONE 
Os03g0214400AK067931AGGGCCCAGGSimilar to Digalactosyldiacylglycerol synthase 2. 
Os03g0284000Os03g0284000CCTGGGCCATConserved hypothetical protein. 
Os03g0312600AK073391TAGGCCCAGGSimilar to XPA-binding protein 1 (HUSSY-23). 
Os03g0333000AK109811AAGGCCCAGGCCCATTTConserved hypothetical protein. 
J065152D04AAGGCCCAGGCCCATTTNONE 
J090011B05AAGGCCCAGGCCCATTTNONE 
Os03g0333100AK101050AAATGGGCCTGGGCCTTProtein of unknown function DUF663 domain containing protein. 
Os03g0349000011-089-G05TAGGCCCAGGCCCATCTNONE 
AK099999TAGGCCCAGGCCCATCTNucleoporin interacting component family protein. 
J013134K18TAGGCCCAGGCCCATCTNONE 
J033024G23TAGGCCCAGGCCCATCTNONE 
J033098A12TAGGCCCAGGCCCATCTNONE 
J090001N18TAGGCCCAGGCCCATCTNONE 
J090058F11TAGGCCCAGGCCCATCTNONE 
J090065C04TAGGCCCAGGCCCATCTNONE 
J100067M17TAGGCCCAGGCCCATCTNONE 
J100083P13TAGGCCCAGGCCCATCTNONE 
Os03g0370000AK100033CCTGGGCCCCACCACSimilar to Pyruvate dehydrogenase kinase isoform 1 (EC 2.7.1.99). 
Os03g0561249J065016H04CCTGGGCCCCConserved hypothetical protein. 
Os03g0570300AK069396GGGGCCCAGGTranslation protein SH3-like domain containing protein. 
J013036G06GGGGCCCAGGNONE 
J023014K13GGGGCCCAGGNONE 
Os03g0577200006-030-H11ATCCGACGGCCCAGGNONE 
AK061735ATCCGACGGCCCAGGSimilar to Mps one binder kinase activator-like 1A (Mob1 homolog 1A) (Mob1A) (Mob1B) (Protein Mob4A). 
AK098953ATCCGACGGCCCAGGNONE 
AK099558ATCCGACGGCCCAGGNONE 
AK104547ATCCGACGGCCCAGGNONE 
J013034B14ATCCGACGGCCCAGGNONE 
J013066J17ATCCGACGGCCCAGGNONE 
J090033N14ATCCGACGGCCCAGGNONE 
Os03g0580200AK107849GAGGCCCAGGLipolytic enzyme, G-D-S-L family protein. 
Os03g0598900J053098D07AATTGGGCCTGGGCCATNONE 
J065063O13AATTGGGCCTGGGCCATDSBA oxidoreductase family protein. 
Os03g0668400AK119454AGCCCACGATGGCCCAGGCCCAGGCCCAGGProtein of unknown function DUF860, plant family protein. 
Os03g0683700AK065067TAGGCCCAAAGGCCCAGGProtein of unknown function DUF810 family protein. 
Os03g0685600AK111863CCTGGGCCGGGWD40-like domain containing protein. 
Os03g0688200015-014-E12AAGGCCCAGGGTGGGTCCNONE 
AK103539AAGGCCCAGGGTGGGTCCConserved hypothetical protein. 
Os03g0725000AK059294CCTGGGCCGGGNONE 
J043026H11CCTGGGCCGGGNONE 
J065187O06CCTGGGCCGGGNONE 
J090066M23CCTGGGCCGGGNONE 
Os03g0735300AK071715ATCCGACGGCCCAGGAlba, DNA/RNA-binding protein family protein. 
J065100I07ATCCGACGGCCCAGGNONE 
Os03g0745600014-030-E09CCTGGGCCCCACANONE 
J053057E07CCTGGGCCCCACANONE 
J075044L08CCTGGGCCCCACANONE 
J075069C24CCTGGGCCCCACANONE 
J075127J02CCTGGGCCCCACAProtein of unknown function UPF0005 family protein. 
J075180G21CCTGGGCCCCACANONE 
J075189M22CCTGGGCCCCACANONE 
J075192P11CCTGGGCCCCACANONE 
Os03g0746000AK073682TTTCGGCCCAGGConserved hypothetical protein. 
AK111472TTTCGGCCCAGGNONE 
J090083F05TTTCGGCCCAGGNONE 
Os03g0746400AK063445CCTGGGCCATProtein prenyltransferase domain containing protein. 
AK070923CCTGGGCCATNONE 
J065008K24CCTGGGCCATNONE 
Os03g0763000AK120812CCTGGGCCGAASimilar to Casein kinase II alpha subunit. 
Os03g0829100AK072669CCTGGGCCACSimilar to Soluble epoxide hydrolase. 
J013073C22CCTGGGCCACNONE 
J033067O15CCTGGGCCACNONE 
J065021D04CCTGGGCCACNONE 
J065102E20CCTGGGCCACNONE 
Os03g0843400009-195-F11CCTGGGCCAANONE 
AK061198CCTGGGCCAASimilar to 30S ribosomal protein S6, chloroplast precursor (Fragment). 
AK099076CCTGGGCCAANONE 
Os03g0851900AK102145AAGGCCCAGGCCCATCTAFG1-like ATPase family protein. 
J033086B08AAGGCCCAGGCCCATCTNONE 
Os04g0231800AK068417CCTGGGCCCACANONE 
J013153L19CCTGGGCCCACANONE 
J065020J04CCTGGGCCCACANONE 
J065201K08CCTGGGCCCACANONE 
J065214C10CCTGGGCCCACANONE 
Os04g0270100AK063713CGGGCCCAGGNONE 
AK107968CGGGCCCAGGNONE 
Os04g0370600AK103855AATGGGCCAGGAGGCCCAGG4Fe-4S ferredoxin, iron-sulfur binding domain containing protein. 
J023115N20AATGGGCCAGGAGGCCCAGGNONE 
J033148N10AATGGGCCAGGAGGCCCAGGNONE 
J090031L24AATGGGCCAGGAGGCCCAGGNONE 
J090089F12AATGGGCCAGGAGGCCCAGGNONE 
Os04g0428900009-068-A06CCTGGGCCGGANONE 
AK061355CCTGGGCCGGASimilar to CSN8. 
AK099153CCTGGGCCGGANONE 
AY336991CCTGGGCCGGANONE 
J023069F08CCTGGGCCGGANONE 
J065112H12CCTGGGCCGGANONE 
J075022F23CCTGGGCCGGANONE 
J090045D23CCTGGGCCGGANONE 
J090067E18CCTGGGCCGGANONE 
J090099H14CCTGGGCCGGANONE 
Os04g0447600006-023-A01CTGGCCCAGGNONE 
006-080-D11CTGGCCCAGGNONE 
006-095-D01CTGGCCCAGGNONE 
006-114-F03CTGGCCCAGGNONE 
AK061282CTGGCCCAGGSimilar to NADPH-dependent codeinone reductase (EC 1.1.1.247). 
Os04g0479000AK106344CAAGGCCCAGGSimilar to HPV16 E1 protein binding protein (Thyroid hormone receptor interactor 13) (TRIP13 protein). 
Os04g0529400J013039I24CCTGGGCCCCCGCGNONE 
J013055M04CCTGGGCCCCCGCGNONE 
J023050E21CCTGGGCCCCCGCGNONE 
J033060K22CCTGGGCCCCCGCGNONE 
J075026D13CCTGGGCCCCCGCGNONE 
J075033M03CCTGGGCCCCCGCGNONE 
J075138F11CCTGGGCCCCCGCGNONE 
J090022B15CCTGGGCCCCCGCGNONE 
Os04g0559400AK106376CCTGGGCCCACGCSimilar to Branched-chain-amino-acid aminotransferase 5, chloroplast precursor (EC 2.6.1.42) (Atbcat-5). 
Os04g0586500015-095-E09CCTGGGCCGAANONE 
AK106447CCTGGGCCGAAConserved hypothetical protein. 
J075065I17CCTGGGCCGAANONE 
J100078J08CCTGGGCCGAANONE 
Os04g0602900AK065982CCTGGGCCCAACTNONE 
AK100414CCTGGGCCCAACTIsoprenylcysteine carboxyl methyltransferase family protein. 
J013045J05CCTGGGCCCAACTNONE 
J065196I21CCTGGGCCCAACTNONE 
J065205B13CCTGGGCCCAACTNONE 
J090017J24CCTGGGCCCAACTNONE 
Os04g0636400006-064-G07TTCGGCCCAGGCCCAGCNONE 
006-097-D05TTCGGCCCAGGCCCAGCNONE 
AK061848TTCGGCCCAGGCCCAGCSimilar to Senescence-associated protein 6. 
AK099573TTCGGCCCAGGCCCAGCNONE 
J013035J20TTCGGCCCAGGCCCAGCNONE 
Os04g0669600AK110767GGGGCCCAGGCCCAAAAPhospholipase/Carboxylesterase family protein. 
J065195K10GGGGCCCAGGCCCAAAANONE 
Os04g0692200006-047-H10ATGGCCCAGGCCCAACANONE 
006-107-D08ATGGCCCAGGCCCAACANONE 
009-122-B09ATGGCCCAGGCCCAACANONE 
AK059807ATGGCCCAGGCCCAACANONE 
AK060875ATGGCCCAGGCCCAACANONE 
AK071726ATGGCCCAGGCCCAACAConserved hypothetical protein. 
J023110I24ATGGCCCAGGCCCAACANONE 
J033091O06ATGGCCCAGGCCCAACANONE 
J053027N16ATGGCCCAGGCCCAACANONE 
J053089E19ATGGCCCAGGCCCAACANONE 
J053098H12ATGGCCCAGGCCCAACANONE 
J053099N13ATGGCCCAGGCCCAACANONE 
J075031B15ATGGCCCAGGCCCAACANONE 
J080013D12ATGGCCCAGGCCCAACANONE 
J080013H05ATGGCCCAGGCCCAACANONE 
J080013H07ATGGCCCAGGCCCAACANONE 
J080088I03ATGGCCCAGGCCCAACANONE 
Os05g0100500AK071466GATCGGACGGCCCAGGSimilar to Debaryomyces hansenii chromosome F of strain CBS767 of Debaryomyces hansenii. 
Os05g0116100006-049-G01CCTGGGCCCCACANONE 
006-064-F09CCTGGGCCCCACANONE 
006-082-A03CCTGGGCCCCACANONE 
006-092-G06CCTGGGCCCCACANONE 
006-102-F09CCTGGGCCCCACANONE 
AB037970CCTGGGCCCCACANONE 
AK061836CCTGGGCCCCACANONE 
AK070895CCTGGGCCCCACADehydroascorbate reductase. 
AY074786CCTGGGCCCCACANONE 
J013022K21CCTGGGCCCCACANONE 
J013154A03CCTGGGCCCCACANONE 
J023074C02CCTGGGCCCCACANONE 
J023091I19CCTGGGCCCCACANONE 
J023135M05CCTGGGCCCCACANONE 
J065027L11CCTGGGCCCCACANONE 
J065065A08CCTGGGCCCCACANONE 
J065120A08CCTGGGCCCCACANONE 
J065174A05CCTGGGCCCCACANONE 
J065184O22CCTGGGCCCCACANONE 
J065191D07CCTGGGCCCCACANONE 
J065209D04CCTGGGCCCCACANONE 
J075014F11CCTGGGCCCCACANONE 
J075036D03CCTGGGCCCCACANONE 
J075157D23CCTGGGCCCCACANONE 
J080007F15CCTGGGCCCCACANONE 
J080008N12CCTGGGCCCCACANONE 
J080010F22CCTGGGCCCCACANONE 
J080011C19CCTGGGCCCCACANONE 
J080011F12CCTGGGCCCCACANONE 
J080012E11CCTGGGCCCCACANONE 
J080015B12CCTGGGCCCCACANONE 
J080015O16CCTGGGCCCCACANONE 
J080016G24CCTGGGCCCCACANONE 
J080016K13CCTGGGCCCCACANONE 
J080018A02CCTGGGCCCCACANONE 
J080018H03CCTGGGCCCCACANONE 
J080022M01CCTGGGCCCCACANONE 
J080023D20CCTGGGCCCCACANONE 
J080023I01CCTGGGCCCCACANONE 
J080023J05CCTGGGCCCCACANONE 
J080024A09CCTGGGCCCCACANONE 
J080024I09CCTGGGCCCCACANONE 
J080025A10CCTGGGCCCCACANONE 
J080025G04CCTGGGCCCCACANONE 
J080027D21CCTGGGCCCCACANONE 
J080029M05CCTGGGCCCCACANONE 
J080030J01CCTGGGCCCCACANONE 
J080034D10CCTGGGCCCCACANONE 
J080036F18CCTGGGCCCCACANONE 
J080038N11CCTGGGCCCCACANONE 
J080039B07CCTGGGCCCCACANONE 
J080039E01CCTGGGCCCCACANONE 
J080039K11CCTGGGCCCCACANONE 
J080040B09CCTGGGCCCCACANONE 
J080040G11CCTGGGCCCCACANONE 
J080041H08CCTGGGCCCCACANONE 
J080041H19CCTGGGCCCCACANONE 
J080041O20CCTGGGCCCCACANONE 
J080042C15CCTGGGCCCCACANONE 
J080043C16CCTGGGCCCCACANONE 
J080043F18CCTGGGCCCCACANONE 
J080044B17CCTGGGCCCCACANONE 
J080044N10CCTGGGCCCCACANONE 
J080044O07CCTGGGCCCCACANONE 
J080045H15CCTGGGCCCCACANONE 
J080045I03CCTGGGCCCCACANONE 
J080046A05CCTGGGCCCCACANONE 
J080048I06CCTGGGCCCCACANONE 
J080049L04CCTGGGCCCCACANONE 
J080049M09CCTGGGCCCCACANONE 
J080050G11CCTGGGCCCCACANONE 
J080051G20CCTGGGCCCCACANONE 
J080053C09CCTGGGCCCCACANONE 
J080053I05CCTGGGCCCCACANONE 
J080053P18CCTGGGCCCCACANONE 
J080054K10CCTGGGCCCCACANONE 
J080054P14CCTGGGCCCCACANONE 
J080057L05CCTGGGCCCCACANONE 
J080062K11CCTGGGCCCCACANONE 
J080063C19CCTGGGCCCCACANONE 
J080065B03CCTGGGCCCCACANONE 
J080066E15CCTGGGCCCCACANONE 
J080066H05CCTGGGCCCCACANONE 
J080066I05CCTGGGCCCCACANONE 
J080068O11CCTGGGCCCCACANONE 
J080070L22CCTGGGCCCCACANONE 
J080071I12CCTGGGCCCCACANONE 
J080071N20CCTGGGCCCCACANONE 
J080072D10CCTGGGCCCCACANONE 
J080072I10CCTGGGCCCCACANONE 
J080074G03CCTGGGCCCCACANONE 
J080076E23CCTGGGCCCCACANONE 
J080076N03CCTGGGCCCCACANONE 
J080077N23CCTGGGCCCCACANONE 
J080084B13CCTGGGCCCCACANONE 
J080084F07CCTGGGCCCCACANONE 
J080085J15CCTGGGCCCCACANONE 
J080085P20CCTGGGCCCCACANONE 
J080090F21CCTGGGCCCCACANONE 
J080093H16CCTGGGCCCCACANONE 
J080093J01CCTGGGCCCCACANONE 
J080093L04CCTGGGCCCCACANONE 
J080097E24CCTGGGCCCCACANONE 
J090012G04CCTGGGCCCCACANONE 
J090054K05CCTGGGCCCCACANONE 
Os05g0116600AK109828GCTGGGCCCTGGGCCATF-box associated type 1 domain containing protein. 
Os05g0121000009-181-E02TAGGCCCAGGNONE 
AK058867TAGGCCCAGGNONE 
AK071341TAGGCCCAGGProtein of unknown function DUF1218 family protein. 
J023024H24TAGGCCCAGGNONE 
J023090B22TAGGCCCAGGNONE 
J023111G15TAGGCCCAGGNONE 
J023134K14TAGGCCCAGGNONE 
J033057C05TAGGCCCAGGNONE 
J033067J15TAGGCCCAGGNONE 
J033084L15TAGGCCCAGGNONE 
J033088B04TAGGCCCAGGNONE 
J043027A08TAGGCCCAGGNONE 
J043029L03TAGGCCCAGGNONE 
J053031K22TAGGCCCAGGNONE 
J053046I01TAGGCCCAGGNONE 
J053070B05TAGGCCCAGGNONE 
J053072C10TAGGCCCAGGNONE 
J065097M22TAGGCCCAGGNONE 
J065164I17TAGGCCCAGGNONE 
J075058I08TAGGCCCAGGNONE 
J075064C09TAGGCCCAGGNONE 
J080304C16TAGGCCCAGGNONE 
J080304H16TAGGCCCAGGNONE 
J080306E17TAGGCCCAGGNONE 
J080310L03TAGGCCCAGGNONE 
J080316J07TAGGCCCAGGNONE 
J080317L23TAGGCCCAGGNONE 
J080319A10TAGGCCCAGGNONE 
J090060F01TAGGCCCAGGNONE 
J100042N16TAGGCCCAGGNONE 
J100047F05TAGGCCCAGGNONE 
J100075J19TAGGCCCAGGNONE 
Os05g0128100009-051-B07CCTGGGCCTGANONE 
009-127-B08CCTGGGCCTGANONE 
009-144-H03CCTGGGCCTGANONE 
009-176-B05CCTGGGCCTGANONE 
AK108556CCTGGGCCTGANONE 
AK119308CCTGGGCCTGANONE 
AK120934CCTGGGCCTGAConserved hypothetical protein. 
J023036J15CCTGGGCCTGANONE 
J065122L01CCTGGGCCTGANONE 
J075104P10CCTGGGCCTGANONE 
Os05g0161200AB042936CTGGCCCAGGGCCGGCCCNONE 
AK121808CTGGCCCAGGGCCGGCCCDNA polymerase III clamp loader subunit, C-terminal domain containing protein. 
Os05g0172100006-076-G10CAGGCCCAGGNONE 
AK068467CAGGCCCAGGGalactose oxidase, central domain containing protein. 
AK105962CAGGCCCAGGNONE 
J013156C03CAGGCCCAGGNONE 
J053091E24CAGGCCCAGGNONE 
Os05g0172800AK108688CCTGGGCCCACCTGConserved hypothetical protein. 
J075027E19CCTGGGCCCACCTGNONE 
J075174L13CCTGGGCCCACCTGNONE 
Os05g0184901Os05g0184901CCTGGGCCCAGTTSigma factor, regions 3 and 4 domain containing protein. 
Os05g0327000014-005-A12CCTGGGCCATNONE 
AK064059CCTGGGCCATCyclin-like domain containing protein. 
AK101588CCTGGGCCATNONE 
J033051A05CCTGGGCCATNONE 
J065106E02CCTGGGCCATNONE 
J065183D01CCTGGGCCATNONE 
Os05g0415600AK065818TGCGGCCCAGGNONE 
J013042K21TGCGGCCCAGGNONE 
J013114E15TGCGGCCCAGGNONE 
J013131H02TGCGGCCCAGGNONE 
J023041G06TGCGGCCCAGGNONE 
J100037M21TGCGGCCCAGGNONE 
Os05g0486200009-099-B03CCTGGGCCACNONE 
AK121022CCTGGGCCACConserved hypothetical protein. 
J023049I09CCTGGGCCACNONE 
J033029N07CCTGGGCCACNONE 
J075074I18CCTGGGCCACNONE 
Os05g0490000011-076-C07CCTGGGCCTCNONE 
015-026-D07CCTGGGCCTCNONE 
015-074-A08CCTGGGCCTCNONE 
AK064335CCTGGGCCTCNONE 
AK101340CCTGGGCCTCKrr1 family protein. 
J033034J18CCTGGGCCTCNONE 
Os05g0495100AK108028CCTGGGCCGTGGConserved hypothetical protein. 
Os05g0503000AK068335CCTGGGCCCACCSimilar to Secretory carrier membrane protein. 
AK104049CCTGGGCCCACCNONE 
J013149D04CCTGGGCCCACCNONE 
J075085A06CCTGGGCCCACCNONE 
Os05g0526300AK099438CCTGGGCCGCNONE 
Os05g0561500006-066-D12ATTTGGGCTAGGCCCAGGNONE 
AK061788ATTTGGGCTAGGCCCAGGSimilar to CMP-KDO synthetase (EC 2.7.7.38) (Fragment). 
AK098862ATTTGGGCTAGGCCCAGGNONE 
J013000O09ATTTGGGCTAGGCCCAGGNONE 
J033145C24ATTTGGGCTAGGCCCAGGNONE 
Os05g0579500AK121528CCTGGGCCCACGAConserved hypothetical protein. 
J033030I07CCTGGGCCCACGANONE 
Os05g0586600AB096011GGTGGGCCCAGGGACCCGPlastid sigma factor SIG5. 
AB096071GGTGGGCCCAGGGACCCGNONE 
AK105697GGTGGGCCCAGGGACCCGNONE 
Os05g0596200009-059-G06AGTTGGGCCCAGGNONE 
AK062521AGTTGGGCCCAGGNONE 
AK107887AGTTGGGCCCAGGConserved hypothetical protein. 
AK108209AGTTGGGCCCAGGNONE 
J065154B01AGTTGGGCCCAGGNONE 
Os06g0103400009-138-H04AAGGCCCAGGCCCACCANONE 
AK067021AAGGCCCAGGCCCACCANucleic acid-binding, OB-fold domain containing protein. 
AK071627AAGGCCCAGGCCCACCANONE 
J080307A01AAGGCCCAGGCCCACCANONE 
Os06g0114600015-077-E06CCTGGGCCGGGCCNONE 
AK067972CCTGGGCCGGGCCConserved hypothetical protein. 
Os06g0119300AK067271CCTGGGCCTGAProtein of unknown function DUF594 family protein. 
Os06g0125200015-099-F09TTGGCCCAGGGCCGTCNONE 
AK102200TTGGCCCAGGGCCGTCProtein of unknown function DUF581 family protein. 
J033030E04TTGGCCCAGGGCCGTCNONE 
J033058K06TTGGCCCAGGGCCGTCNONE 
J033060O13TTGGCCCAGGGCCGTCNONE 
J033068B04TTGGCCCAGGGCCGTCNONE 
J033087E11TTGGCCCAGGGCCGTCNONE 
J033113N12TTGGCCCAGGGCCGTCNONE 
J065110P15TTGGCCCAGGGCCGTCNONE 
J075174B01TTGGCCCAGGGCCGTCNONE 
Os06g0152800003-125-D04ATTTGGGCCGGCCCAGGNONE 
AK099578ATTTGGGCCGGCCCAGGConserved hypothetical protein. 
Os06g0181500AK068950CCTGGGCCTCNONE 
AK100878CCTGGGCCTCSimilar to Plasma membrane H+-ATPase (EC 3.6.1.3). 
J023001P16CCTGGGCCTCNONE 
Os06g0316100011-089-C01ACATGGGCCGGGCCCAGGNONE 
015-030-D11ACATGGGCCGGGCCCAGGNONE 
015-044-H10ACATGGGCCGGGCCCAGGNONE 
AK105260ACATGGGCCGGGCCCAGGConserved hypothetical protein. 
AK119646ACATGGGCCGGGCCCAGGNONE 
Os06g0343100AK058622CAGGCCCAGGNONE 
Os06g0486900AK064610CCTGGGCCCTSimilar to Formate dehydrogenase, mitochondrial precursor (EC 1.2.1.2) (NAD- dependent formate dehydrogenase) (FDH). 
Os06g0505700009-010-E06CCTGGGCCCACANONE 
AK121505CCTGGGCCCACAHypothetical protein. 
J033022N03CCTGGGCCCACANONE 
Os06g0539066J065210J16CCTGGGCCTTConserved hypothetical protein. 
Os06g0560400AK103575TCAGGCCCAGGGCCCAGGNONE 
AK108074TCAGGCCCAGGGCCCAGGProtein of unknown function DUF862, eukaryotic domain containing protein. 
Os06g0609600AK072533CCTGGGCCCCACCTGEF-Hand type domain containing protein. 
AK099872CCTGGGCCCCACCTGNONE 
BT014680CCTGGGCCCCACCTGNONE 
J023008M02CCTGGGCCCCACCTGNONE 
J023127M12CCTGGGCCCCACCTGNONE 
J065049L24CCTGGGCCCCACCTGNONE 
J065102K24CCTGGGCCCCACCTGNONE 
J065205O14CCTGGGCCCCACCTGNONE 
J075127F01CCTGGGCCCCACCTGNONE 
J080033F07CCTGGGCCCCACCTGNONE 
Os07g0105300AK107419GCCGGGCCTGGGCCGGCConserved hypothetical protein. 
AK109521GCCGGGCCTGGGCCGGCNONE 
Os07g0164500J013094M18CCTGGGCCGGCNONE 
J013153L05CCTGGGCCGGCNONE 
J023011J18CCTGGGCCGGCNONE 
J023106H21CCTGGGCCGGCNONE 
J033105F10CCTGGGCCGGCNONE 
J065210M20CCTGGGCCGGCSimilar to Dolichyl pyrophosphate Man9GlcNAc2 alpha-1,3-glucosyltransferase (EC 2.4.1.-) (Dolichyl-P-Glc:Man9GlcNAc2-PP-dolichyl glucosyltransferase). 
J090060F05CCTGGGCCGGCNONE 
J090061C13CCTGGGCCGGCNONE 
J090074K15CCTGGGCCGGCNONE 
Os07g0185700012-040-A11CCTGGGCCGANONE 
AK070572CCTGGGCCGAConserved hypothetical protein. 
J065116D10CCTGGGCCGANONE 
J065122F20CCTGGGCCGANONE 
Os07g0242600AK065752CCTGGGCCGGACyclin-like F-box domain containing protein. 
J013037K22CCTGGGCCGGANONE 
Os07g0262950J033120B02CCTGGGCCCCConserved hypothetical protein. 
J075040G05CCTGGGCCCCNONE 
J075160F23CCTGGGCCCCNONE 
Os07g0413800006-021-H08CCTGGGCCTANONE 
006-030-D01CCTGGGCCTANONE 
006-034-B05CCTGGGCCTANONE 
006-034-G03CCTGGGCCTANONE 
006-040-B11CCTGGGCCTANONE 
006-043-D03CCTGGGCCTANONE 
006-052-B04CCTGGGCCTANONE 
006-054-H11CCTGGGCCTANONE 
006-081-A04CCTGGGCCTANONE 
006-095-D10CCTGGGCCTANONE 
006-102-A01CCTGGGCCTANONE 
006-111-E02CCTGGGCCTANONE 
009-136-D03CCTGGGCCTANONE 
009-163-H08CCTGGGCCTANONE 
009-164-D03CCTGGGCCTANONE 
AK060411CCTGGGCCTANONE 
AK061478CCTGGGCCTAConserved hypothetical protein. 
AK104124CCTGGGCCTANONE 
AK104173CCTGGGCCTANONE 
AK120684CCTGGGCCTANONE 
J065112P06CCTGGGCCTANONE 
Os07g0438800AK060412GTGGCCCAGGNONE 
AK100065GTGGCCCAGGSimilar to Phosphate starvation regulator protein (Regulatory protein of P- starvation acclimation response Psr1). 
AK103195GTGGCCCAGGNONE 
AY224478GTGGCCCAGGNONE 
J013160O05GTGGCCCAGGNONE 
J023030C05GTGGCCCAGGNONE 
J033025O04GTGGCCCAGGNONE 
J033121P15GTGGCCCAGGNONE 
J043034I23GTGGCCCAGGNONE 
J065022N01GTGGCCCAGGNONE 
J065022N02GTGGCCCAGGNONE 
J065023M01GTGGCCCAGGNONE 
J065101G13GTGGCCCAGGNONE 
J075058P13GTGGCCCAGGNONE 
J075186K10GTGGCCCAGGNONE 
J075199F17GTGGCCCAGGNONE 
Os07g0486000AK069343AAATGGGCCCAGGCCCSimilar to MSH4. 
Os07g0502200006-027-C06GCCGGCCCAGGNONE 
012-007-C05GCCGGCCCAGGNONE 
AK120682GCCGGCCCAGGMulti antimicrobial extrusion protein MatE family protein. 
J053045G13GCCGGCCCAGGNONE 
J053064I18GCCGGCCCAGGNONE 
J053091G24GCCGGCCCAGGNONE 
J065016E10GCCGGCCCAGGNONE 
J065021B18GCCGGCCCAGGNONE 
J065022A17GCCGGCCCAGGNONE 
J065059D18GCCGGCCCAGGNONE 
J065063N19GCCGGCCCAGGNONE 
J065065O10GCCGGCCCAGGNONE 
J065196F12GCCGGCCCAGGNONE 
J065208I01GCCGGCCCAGGNONE 
J065218G15GCCGGCCCAGGNONE 
J100040G01GCCGGCCCAGGNONE 
J100060M03GCCGGCCCAGGNONE 
J100061P09GCCGGCCCAGGNONE 
J100065P05GCCGGCCCAGGNONE 
Os07g0506700AK073959CTGGCCCAGGWD40-like domain containing protein. 
Os07g0565600AK071983CCTGGGCCGTTSimilar to Peptidyl-prolyl cis-trans isomerase TLP38, chloroplast precursor (EC 5.2.1.8) (PPIase) (Rotamase) (Thylakoid lumen PPIase of 38 kDa) (p38). 
AK107481CCTGGGCCGTTNONE 
Os07g0567700AK059008CCTGGGCCGCNONE 
Os07g0582400003-104-B09CCTGGGCCCACCTNONE 
AK059423CCTGGGCCCACCTNONE 
AK102676CCTGGGCCCACCTNONE 
J065001F09CCTGGGCCCACCTNONE 
J065005K22CCTGGGCCCACCTNONE 
J065006D10CCTGGGCCCACCTNONE 
J065006P17CCTGGGCCCACCTNONE 
J065015G23CCTGGGCCCACCTNONE 
J065020F21CCTGGGCCCACCTNONE 
J065028I05CCTGGGCCCACCTNONE 
J065042N09CCTGGGCCCACCTNONE 
J065043P03CCTGGGCCCACCTNONE 
J065059E15CCTGGGCCCACCTNONE 
J065090I12CCTGGGCCCACCTNONE 
J065130I02CCTGGGCCCACCTNONE 
J065131P05CCTGGGCCCACCTNONE 
J065163I24CCTGGGCCCACCTNONE 
J065168I21CCTGGGCCCACCTNONE 
J065174A12CCTGGGCCCACCTNONE 
J065178K16CCTGGGCCCACCTNONE 
J065182P03CCTGGGCCCACCTNONE 
J065186B07CCTGGGCCCACCTNONE 
J065189M13CCTGGGCCCACCTNONE 
J065208J22CCTGGGCCCACCTNONE 
J065211E11CCTGGGCCCACCTNONE 
J075054E08CCTGGGCCCACCTNONE 
J075067K14CCTGGGCCCACCTNONE 
J075104E20CCTGGGCCCACCTNONE 
J075152M07CCTGGGCCCACCTNONE 
Os07g0598100AK068136GTATGGGCCTGGGCCGTASimilar to Hydroxyproline-rich glycoprotein DZ-HRGP precursor. 
Os07g0604500009-018-C07CCTGGGCCTANONE 
009-194-C02CCTGGGCCTANONE 
011-023-C06CCTGGGCCTANONE 
015-035-B10CCTGGGCCTANONE 
AK064312CCTGGGCCTASimilar to Mitochondrial import inner membrane translocase subunit Tim17. 
AK069085CCTGGGCCTANONE 
J090050I12CCTGGGCCTANONE 
J100027C10CCTGGGCCTANONE 
J100029A05CCTGGGCCTANONE 
J100031P17CCTGGGCCTANONE 
J100039E20CCTGGGCCTANONE 
J100064L15CCTGGGCCTANONE 
J100066K08CCTGGGCCTANONE 
Os07g0637300AF323611CCACTGACACCTGGGCCCCACCNONE 
AK069157CCACTGACACCTGGGCCCCACCNONE 
J023007C01CCACTGACACCTGGGCCCCACCNONE 
Os07g0661600006-050-D12CCTGGGCCCCACCNONE 
009-124-B10CCTGGGCCCCACCNONE 
AK061123CCTGGGCCCCACCNONE 
AK066432CCTGGGCCCCACCSimilar to RNA-binding protein-like protein. 
AK104664CCTGGGCCCCACCNONE 
J013064M13CCTGGGCCCCACCNONE 
J013122O12CCTGGGCCCCACCNONE 
J033044A16CCTGGGCCCCACCNONE 
J033144D14CCTGGGCCCCACCNONE 
J090078P13CCTGGGCCCCACCNONE 
Os07g0671400AK067933CCTGGGCCCACAHeavy metal transport/detoxification protein domain containing protein. 
Os08g0116800AK063695CTCGGCCCAGGExoribonuclease domain containing protein. 
AK063695TCTCGGCCCAGGExoribonuclease domain containing protein. 
Os08g0126700AK111805GAGGCCCAGGNONE 
AK111902GAGGCCCAGGZinc finger, CCCH-type domain containing protein. 
Os08g0133600AK073987AACGGGCCCAGGNONE 
AK105436AACGGGCCCAGGConserved hypothetical protein. 
Os08g0135100AK108618TTGTGGGCCCAGGSimilar to Phosphate/phosphoenolpyruvate translocator protein-like. 
Os08g0195400006-057-E04CCTGGGCCGTGNONE 
006-060-B10CCTGGGCCGTGNONE 
AK070464CCTGGGCCGTGConserved hypothetical protein. 
AK104389CCTGGGCCGTGNONE 
AK106140CCTGGGCCGTGNONE 
J023013G08CCTGGGCCGTGNONE 
J023054K19CCTGGGCCGTGNONE 
J023089D18CCTGGGCCGTGNONE 
J023092K05CCTGGGCCGTGNONE 
J033025A08CCTGGGCCGTGNONE 
J033067P12CCTGGGCCGTGNONE 
J033098A10CCTGGGCCGTGNONE 
J065219L04CCTGGGCCGTGNONE 
J090021P06CCTGGGCCGTGNONE 
J090062M05CCTGGGCCGTGNONE 
J090079F15CCTGGGCCGTGNONE 
J100041H19CCTGGGCCGTGNONE 
Os08g0208200009-112-E06CCTGGGCCTANONE 
AK062824CCTGGGCCTAPeptidase A1, pepsin family protein. 
Os08g0224200AK101331CTCGGCCCAGGSimilar to Ythdf2-prov protein. 
AK101331GGCCGGGCCTGGGCCGTGSimilar to Ythdf2-prov protein. 
AK101331TGTTGGGCCGTGCCTGGGCCGTGSimilar to Ythdf2-prov protein. 
Os08g0474700AK064878AACTGGGCCCTGGGCCTGGSimilar to COPII subunit Sec23 (Fragment). 
Os08g0490300011-064-F08GGGGCCCAGGNONE 
015-050-C06GGGGCCCAGGNONE 
AK066895GGGGCCCAGGRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J013090I22GGGGCCCAGGNONE 
J090060F02GGGGCCCAGGNONE 
Os08g0544800009-168-G01ACGCGTCCTGGGCCGTCGGATCNONE 
011-046-D09ACGCGTCCTGGGCCGTCGGATCNONE 
012-003-C08ACGCGTCCTGGGCCGTCGGATCNONE 
012-042-B06ACGCGTCCTGGGCCGTCGGATCNONE 
013-035-H12ACGCGTCCTGGGCCGTCGGATCNONE 
013-072-A10ACGCGTCCTGGGCCGTCGGATCNONE 
014-010-B11ACGCGTCCTGGGCCGTCGGATCNONE 
014-097-E06ACGCGTCCTGGGCCGTCGGATCNONE 
015-003-E12ACGCGTCCTGGGCCGTCGGATCNONE 
015-040-B04ACGCGTCCTGGGCCGTCGGATCNONE 
AK060536ACGCGTCCTGGGCCGTCGGATCNONE 
AK102666ACGCGTCCTGGGCCGTCGGATCNONE 
AK119660ACGCGTCCTGGGCCGTCGGATCPCF2. 
D87261ACGCGTCCTGGGCCGTCGGATCNONE 
J090049N23ACGCGTCCTGGGCCGTCGGATCNONE 
J090084G06ACGCGTCCTGGGCCGTCGGATCNONE 
Os09g0265050J065112H09CCTGGGCCCCConserved hypothetical protein. 
Os09g0325300011-005-H08GCGGCCCAGGNONE 
AK068435GCGGCCCAGGConserved hypothetical protein. 
AK073998GCGGCCCAGGNONE 
J033071H21GCGGCCCAGGNONE 
J065214H05GCGGCCCAGGNONE 
Os09g0330200AK111018GCCGGGCCCAGGCCACGTCConserved hypothetical protein. 
Os09g0344700J080011F14CCTGGGCCGANONE 
J080011G13CCTGGGCCGANONE 
J080016C06CCTGGGCCGANONE 
J080034K13CCTGGGCCGANONE 
J080043N08CCTGGGCCGANONE 
J080068E01CCTGGGCCGAConserved hypothetical protein. 
J080068L12CCTGGGCCGANONE 
J080071N01CCTGGGCCGANONE 
J080075D11CCTGGGCCGANONE 
J080076D14CCTGGGCCGANONE 
J080093L23CCTGGGCCGANONE 
J080093N22CCTGGGCCGANONE 
Os09g0369500013-023-F11TGCGGGCCCCACGCCTGGGCCCCNONE 
AK105322TGCGGGCCCCACGCCTGGGCCCCNONE 
AK105479TGCGGGCCCCACGCCTGGGCCCCConserved hypothetical protein. 
Os09g0385300AK073247AATTGGGCCTGGGCCATHypothetical protein. 
AK120455AATTGGGCCTGGGCCATNONE 
J013104G23AATTGGGCCTGGGCCATNONE 
J023110A14AATTGGGCCTGGGCCATNONE 
J033143F07AATTGGGCCTGGGCCATNONE 
J065036P14AATTGGGCCTGGGCCATNONE 
J065041I11AATTGGGCCTGGGCCATNONE 
J065103K11AATTGGGCCTGGGCCATNONE 
J065138M15AATTGGGCCTGGGCCATNONE 
J065138P09AATTGGGCCTGGGCCATNONE 
J065141J20AATTGGGCCTGGGCCATNONE 
J075063J16AATTGGGCCTGGGCCATNONE 
J075063K19AATTGGGCCTGGGCCATNONE 
J075085H08AATTGGGCCTGGGCCATNONE 
J075093C12AATTGGGCCTGGGCCATNONE 
J075127N08AATTGGGCCTGGGCCATNONE 
J075134E09AATTGGGCCTGGGCCATNONE 
J075166D06AATTGGGCCTGGGCCATNONE 
J075168K24AATTGGGCCTGGGCCATNONE 
J075197G05AATTGGGCCTGGGCCATNONE 
J080034J24AATTGGGCCTGGGCCATNONE 
Os09g0395600015-050-D12GAGGCCCAGGNONE 
015-089-A12GAGGCCCAGGNONE 
016-076-D03GAGGCCCAGGNONE 
AK060495GAGGCCCAGGConcanavalin A-like lectin/glucanase domain containing protein. 
AK122079GAGGCCCAGGNONE 
Os09g0406900012-044-F05AGGGCCCAGGNONE 
AK063485AGGGCCCAGGNONE 
AK067460AGGGCCCAGGConserved hypothetical protein. 
Os09g0525500AK107918GAGGCCCAGGYY1 protein precursor. 
D50575GAGGCCCAGGNONE 
Os09g0535000AK058712GGGCCGGCCCAGGSimilar to Triosephosphate isomerase, chloroplast precursor (EC 5.3.1.1) (TIM) (Triose-phosphate isomerase). 
AK069488GGGCCGGCCCAGGNONE 
AK069832GGGCCGGCCCAGGNONE 
J100065D20GGGCCGGCCCAGGNONE 
Os09g0554000J065123C23CCTGGGCCATSimilar to Mitochondrial phosphate transporter. 
Os11g0184900011-088-C07TGCGGCCCAGGCCCACGCNONE 
015-036-B03TGCGGCCCAGGCCCACGCNONE 
016-087-F07TGCGGCCCAGGCCCACGCNONE 
AB028184TGCGGCCCAGGCCCACGCNONE 
AK063399TGCGGCCCAGGCCCACGCSimilar to NAC-domain protein 5-7. 
AK064292TGCGGCCCAGGCCCACGCNONE 
AK102475TGCGGCCCAGGCCCACGCNONE 
J033094I01TGCGGCCCAGGCCCACGCNONE 
J090087J16TGCGGCCCAGGCCCACGCNONE 
Os11g0219400AK069850CTCGGCCCAGGAnkyrin repeat containing protein. 
AK069850TATTGGGCCGTGCCTGGGCCGTGAnkyrin repeat containing protein. 
AK099123CTCGGCCCAGGNONE 
AK099123TATTGGGCCGTGCCTGGGCCGTGNONE 
J023143G18CTCGGCCCAGGNONE 
J023143G18TATTGGGCCGTGCCTGGGCCGTGNONE 
Os11g0233900J065063O08CCTGGGCCATHypothetical protein. 
Os11g0417700J075031P16CCTGGGCCATConserved hypothetical protein. 
J075031P16CCTGGGCCCACAConserved hypothetical protein. 
J075034C16CCTGGGCCATNONE 
J075034C16CCTGGGCCCACANONE 
J075034J22CCTGGGCCATNONE 
J075034J22CCTGGGCCCACANONE 
J075042C07CCTGGGCCATNONE 
J075042C07CCTGGGCCCACANONE 
J075046O07CCTGGGCCATNONE 
J075046O07CCTGGGCCCACANONE 
J075062O13CCTGGGCCATNONE 
J075062O13CCTGGGCCCACANONE 
J075091G08CCTGGGCCATNONE 
J075091G08CCTGGGCCCACANONE 
J075135H20CCTGGGCCATNONE 
J075135H20CCTGGGCCCACANONE 
J075172B13CCTGGGCCATNONE 
J075172B13CCTGGGCCCACANONE 
J075179G14CCTGGGCCATNONE 
J075179G14CCTGGGCCCACANONE 
Os11g0549665006-027-H01GCCACACGGCCCAAGTAGGCCCAGGNONE 
006-083-C01GCCACACGGCCCAAGTAGGCCCAGGNONE 
AK072644GCCACACGGCCCAAGTAGGCCCAGGNONE 
AK101587GCCACACGGCCCAAGTAGGCCCAGGConserved hypothetical protein. 
AK106162GCCACACGGCCCAAGTAGGCCCAGGNONE 
J013051C18GCCACACGGCCCAAGTAGGCCCAGGNONE 
J013067E02GCCACACGGCCCAAGTAGGCCCAGGNONE 
J013169N16GCCACACGGCCCAAGTAGGCCCAGGNONE 
J023049M16GCCACACGGCCCAAGTAGGCCCAGGNONE 
J023050I19GCCACACGGCCCAAGTAGGCCCAGGNONE 
J023063H21GCCACACGGCCCAAGTAGGCCCAGGNONE 
J023063K01GCCACACGGCCCAAGTAGGCCCAGGNONE 
J023108O17GCCACACGGCCCAAGTAGGCCCAGGNONE 
J023115H08GCCACACGGCCCAAGTAGGCCCAGGNONE 
J023117O16GCCACACGGCCCAAGTAGGCCCAGGNONE 
J023129J01GCCACACGGCCCAAGTAGGCCCAGGNONE 
J023133I23GCCACACGGCCCAAGTAGGCCCAGGNONE 
J023143P10GCCACACGGCCCAAGTAGGCCCAGGNONE 
J033045J08GCCACACGGCCCAAGTAGGCCCAGGNONE 
J033050I15GCCACACGGCCCAAGTAGGCCCAGGNONE 
J033051A04GCCACACGGCCCAAGTAGGCCCAGGNONE 
J033060C24GCCACACGGCCCAAGTAGGCCCAGGNONE 
J033069L21GCCACACGGCCCAAGTAGGCCCAGGNONE 
J033103H04GCCACACGGCCCAAGTAGGCCCAGGNONE 
J033112L21GCCACACGGCCCAAGTAGGCCCAGGNONE 
J033118O16GCCACACGGCCCAAGTAGGCCCAGGNONE 
J033126B10GCCACACGGCCCAAGTAGGCCCAGGNONE 
J033133P10GCCACACGGCCCAAGTAGGCCCAGGNONE 
J033144H19GCCACACGGCCCAAGTAGGCCCAGGNONE 
J033145H19GCCACACGGCCCAAGTAGGCCCAGGNONE 
J043029L04GCCACACGGCCCAAGTAGGCCCAGGNONE 
J075066N17GCCACACGGCCCAAGTAGGCCCAGGNONE 
J075150D02GCCACACGGCCCAAGTAGGCCCAGGNONE 
J075158D05GCCACACGGCCCAAGTAGGCCCAGGNONE 
J090009I10GCCACACGGCCCAAGTAGGCCCAGGNONE 
J090048D05GCCACACGGCCCAAGTAGGCCCAGGNONE 
J090085E02GCCACACGGCCCAAGTAGGCCCAGGNONE 
J090085H13GCCACACGGCCCAAGTAGGCCCAGGNONE 
J100029L21GCCACACGGCCCAAGTAGGCCCAGGNONE 
J100041M06GCCACACGGCCCAAGTAGGCCCAGGNONE 
J100045B04GCCACACGGCCCAAGTAGGCCCAGGNONE 
J100077C04GCCACACGGCCCAAGTAGGCCCAGGNONE 
Os11g0664700012-064-D03TCATGGGCCTGGGCCTGNONE 
AK100084TCATGGGCCTGGGCCTGConserved hypothetical protein. 
J023002K05TCATGGGCCTGGGCCTGNONE 
J023037C21TCATGGGCCTGGGCCTGNONE 
J033029N10TCATGGGCCTGGGCCTGNONE 
J090047F07TCATGGGCCTGGGCCTGNONE 
Os12g0134000AK066940CTGGGGCCCAGGSimilar to Hydroxymethylglutaryl-CoA lyase. 
Os12g0151500AK058389CCCGGCCCCTGGGCCCCACCSimilar to Alpha-2,8-sialyltransferase 8B (EC 2.4.99.-) (ST8Sia II) (Sialyltransferase X) (STX). 
AK105865CCCGGCCCCTGGGCCCCACCNONE 
Os12g0168200015-027-H11AACTGGGCCGGCCCAGGNONE 
AK069543AACTGGGCCGGCCCAGGSsu72-like protein family protein. 
J023025N02AACTGGGCCGGCCCAGGNONE 
Os12g0244500AK102026CCTGGGCCCTConserved hypothetical protein. 
J023014D06CCTGGGCCCTNONE 
J023060C12CCTGGGCCCTNONE 
J033080M18CCTGGGCCCTNONE 
J090017I22CCTGGGCCCTNONE 
J090023D21CCTGGGCCCTNONE 
J090036J05CCTGGGCCCTNONE 
J090053M19CCTGGGCCCTNONE 
Os12g0255866J075127N18CCTGGGCCCCConserved hypothetical protein. 
Os12g0299700AK071145CCCGGCCCAGGConserved hypothetical protein. 
J023082N05CCCGGCCCAGGNONE 
Os12g0508300009-006-G07GCCGGCCCAGGNONE 
009-133-E05GCCGGCCCAGGNONE 
009-137-F10GCCGGCCCAGGNONE 
014-024-A06GCCGGCCCAGGNONE 
AK059123GCCGGCCCAGGRibosomal protein S14 family protein. 
J100088E22GCCGGCCCAGGNONE 
Os12g0557800AK121691CCTGGGCCGTGProtein prenyltransferase domain containing protein. 
AK121691GCCGGGCCTGGGCCGGCProtein prenyltransferase domain containing protein. 
J013095M03CCTGGGCCGTGNONE 
J013095M03GCCGGGCCTGGGCCGGCNONE 
J033071H11CCTGGGCCGTGNONE 
J033071H11GCCGGGCCTGGGCCGGCNONE 
J065101B02CCTGGGCCGTGNONE 
J065101B02GCCGGGCCTGGGCCGGCNONE 
Os12g0588900AK069966GGACGGCCCAGGConserved hypothetical protein. 
J023038A10GGACGGCCCAGGNONE 
J065061J23GGACGGCCCAGGNONE 
J065176O08GGACGGCCCAGGNONE 
J075143K13GGACGGCCCAGGNONE 
Os12g0597500AK101904CCCACTCCTGGGCCCAGCCCATCCANONE 
AK103799CCCACTCCTGGGCCCAGCCCATCCAAmidase, hydantoinase/carbamoylase family protein. 
J065206A02CCCACTCCTGGGCCCAGCCCATCCANONE 
J100078O15CCCACTCCTGGGCCCAGCCCATCCANONE 
Os12g0632000J080016B03CCTGGGCCACNONE 
J080071M07CCTGGGCCACNONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.