version

Summary of OsREG551 (All List)

OrganismOryza sativa  
IDOsREG551  
SequenceCCTGTCAG  
Annotation  
PPDB Motif 
PLACE MotifTGAC  "A core of TGAC-containing W-box" of, e.g., Amy32b promoter; Binding site of rice WRKY71, a transcriptional repressor of the gibberellin signaling pathway; Parsley WRKY proteins bind specifically to TGAC-containing W box elements within the Pathogenesis-Related Class10 (PR-10) genes (Eulgem et al., 1999); See S000390 (TTGAC), S000442 (TGACT);  
Total Entry Count1120  

Entry Sequences (1120 entries)

LocusGene modelSequenceDescription
Os01g0130400AK063966CCTGTCAGTNONE 
AK102309CCTGTCAGTSimilar to Alpha-xylosidase precursor (Fragment). 
Os01g0167400AB051107CCTGTCAGTGSimilar to Protein synthesis inhibitor II (EC 3.2.2.22) (Ribosome-inactivating protein II) (rRNA N-glycosidase). 
AK120073CCTGTCAGTGNONE 
J065062A04CCTGTCAGTGNONE 
Os01g0200400006-024-C04AGATGGGCCCACCTGTCAGTGGNONE 
AK070272AGATGGGCCCACCTGTCAGTGGThioredoxin domain 2 containing protein. 
AK104558AGATGGGCCCACCTGTCAGTGGNONE 
J023043M23AGATGGGCCCACCTGTCAGTGGNONE 
J043001A15AGATGGGCCCACCTGTCAGTGGNONE 
J065155O20AGATGGGCCCACCTGTCAGTGGNONE 
J065183G02AGATGGGCCCACCTGTCAGTGGNONE 
J090007F17AGATGGGCCCACCTGTCAGTGGNONE 
J090034P12AGATGGGCCCACCTGTCAGTGGNONE 
Os01g0224500AK109225CCTGTCAGConserved hypothetical protein. 
Os01g0276700011-014-A12GGGTGGGCCCCACCTGTCAGTNONE 
012-092-G12GGGTGGGCCCCACCTGTCAGTNONE 
AK103164GGGTGGGCCCCACCTGTCAGTNONE 
AK103465GGGTGGGCCCCACCTGTCAGTSimilar to Pyruvate kinase, cytosolic isozyme (EC 2.7.1.40) (PK). 
J023019H09GGGTGGGCCCCACCTGTCAGTNONE 
J023084I02GGGTGGGCCCCACCTGTCAGTNONE 
J033027F20GGGTGGGCCCCACCTGTCAGTNONE 
J033029M06GGGTGGGCCCCACCTGTCAGTNONE 
J033039K13GGGTGGGCCCCACCTGTCAGTNONE 
J033057C24GGGTGGGCCCCACCTGTCAGTNONE 
J033058G20GGGTGGGCCCCACCTGTCAGTNONE 
J033060A14GGGTGGGCCCCACCTGTCAGTNONE 
J033061M21GGGTGGGCCCCACCTGTCAGTNONE 
J033068M10GGGTGGGCCCCACCTGTCAGTNONE 
J033074K16GGGTGGGCCCCACCTGTCAGTNONE 
J033076C11GGGTGGGCCCCACCTGTCAGTNONE 
J033093O13GGGTGGGCCCCACCTGTCAGTNONE 
J033119H20GGGTGGGCCCCACCTGTCAGTNONE 
J033121D22GGGTGGGCCCCACCTGTCAGTNONE 
J033129N11GGGTGGGCCCCACCTGTCAGTNONE 
J033131E12GGGTGGGCCCCACCTGTCAGTNONE 
J033150L07GGGTGGGCCCCACCTGTCAGTNONE 
J053024N17GGGTGGGCCCCACCTGTCAGTNONE 
J053034G19GGGTGGGCCCCACCTGTCAGTNONE 
J053035E18GGGTGGGCCCCACCTGTCAGTNONE 
J053046M01GGGTGGGCCCCACCTGTCAGTNONE 
J053047P04GGGTGGGCCCCACCTGTCAGTNONE 
J053048B06GGGTGGGCCCCACCTGTCAGTNONE 
J053050M22GGGTGGGCCCCACCTGTCAGTNONE 
J053053E09GGGTGGGCCCCACCTGTCAGTNONE 
J053053I07GGGTGGGCCCCACCTGTCAGTNONE 
J053059K03GGGTGGGCCCCACCTGTCAGTNONE 
J053059P12GGGTGGGCCCCACCTGTCAGTNONE 
J053060C12GGGTGGGCCCCACCTGTCAGTNONE 
J053060H24GGGTGGGCCCCACCTGTCAGTNONE 
J053064D19GGGTGGGCCCCACCTGTCAGTNONE 
J053066L15GGGTGGGCCCCACCTGTCAGTNONE 
J053073I02GGGTGGGCCCCACCTGTCAGTNONE 
J053083E15GGGTGGGCCCCACCTGTCAGTNONE 
J053094D05GGGTGGGCCCCACCTGTCAGTNONE 
J053094P18GGGTGGGCCCCACCTGTCAGTNONE 
J053095C15GGGTGGGCCCCACCTGTCAGTNONE 
J053095C21GGGTGGGCCCCACCTGTCAGTNONE 
J053099N16GGGTGGGCCCCACCTGTCAGTNONE 
J090025O19GGGTGGGCCCCACCTGTCAGTNONE 
J090049N22GGGTGGGCCCCACCTGTCAGTNONE 
J090050F17GGGTGGGCCCCACCTGTCAGTNONE 
Os01g0327500AK107756CACTGACAGGTGGGConserved hypothetical protein. 
Os01g0513400AK069619CTGACAGGTGGGCCCCACGProtein of unknown function DUF789 family protein. 
Os01g0534800AK072168CTGACAGGTGGGCCCTSimilar to PRLI-interacting factor K (Fragment). 
AK104278CTGACAGGTGGGCCCTNONE 
Os01g0579900AK065133CCTGTCAGEsterase/lipase/thioesterase domain containing protein. 
J013001P21CCTGTCAGNONE 
J090031F15CCTGTCAGNONE 
Os01g0604100AK099765CCTGTCAGUspA domain containing protein. 
J013094O21CCTGTCAGNONE 
Os01g0618200AK102319TGTTGGGCCCACCTGACAGGProtein phosphatase 2C family protein. 
Os01g0629900AK062211CTGACAGGNONE 
AK073989CTGACAGGNONE 
Os01g0663500006-024-H09CCACCTGTCAGTGNONE 
AK058452CCACCTGTCAGTGNONE 
AK060072CCACCTGTCAGTGTranscriptional coactivator/pterin dehydratase family protein. 
Os01g0685900AK064024AATGGGCCCCACCTGTCAGTNONE 
AK102005AATGGGCCCCACCTGTCAGTSimilar to 65kD microtubule associated protein. 
Os01g0788800006-075-G02CCTGTCAGNONE 
009-007-H04CCTGTCAGNONE 
AK059864CCTGTCAGNONE 
AK071723CCTGTCAGNONE 
J023110O18CCTGTCAGNONE 
J023120G04CCTGTCAGNONE 
J090040H01CCTGTCAGNONE 
J090041P20CCTGTCAGNONE 
J090073O13CCTGTCAGNONE 
J090080M14CCTGTCAGNONE 
J090081K07CCTGTCAGNONE 
J090084N10CCTGTCAGNONE 
J090085H19CCTGTCAGNONE 
J090096B04CCTGTCAGNONE 
Os01g0797800013-017-E01CACCTGTCAGNONE 
AK122155CACCTGTCAGConserved hypothetical protein. 
Os01g0799500AK109346CTGACAGGDNA glycosylase family protein. 
Os01g0867900AK061366ACTGACAGGTGGGGCCProtein of unknown function DUF502 family protein. 
Os01g0869000AK067351CTGACAGGNONE 
AK121602CTGACAGGProtein of unknown function DUF639 family protein. 
Os01g0870100AK067564CACTGACAGGTGGGGCProtein of unknown function DUF1012 family protein. 
AK072312CACTGACAGGTGGGGCNONE 
AK103428CACTGACAGGTGGGGCNONE 
Os01g0884400AK072566CCTGTCAGTGU box domain containing protein. 
Os01g0891700AK105471CTGACAGGLeucine rich repeat, N-terminal domain containing protein. 
Os01g0897200AK061505GGGCCCCACCTGTCAGTGNONE 
AK065055GGGCCCCACCTGTCAGTGNONE 
AK100403GGGCCCCACCTGTCAGTGSimilar to Ribonuclease 2 precursor (EC 3.1.27.1). 
AK105061GGGCCCCACCTGTCAGTGNONE 
AK121862GGGCCCCACCTGTCAGTGNONE 
J013001J04GGGCCCCACCTGTCAGTGNONE 
J033103A19GGGCCCCACCTGTCAGTGNONE 
J075005P18GGGCCCCACCTGTCAGTGNONE 
J090027D12GGGCCCCACCTGTCAGTGNONE 
J090032M01GGGCCCCACCTGTCAGTGNONE 
J090079K10GGGCCCCACCTGTCAGTGNONE 
J100018O17GGGCCCCACCTGTCAGTGNONE 
J100080H14GGGCCCCACCTGTCAGTGNONE 
J100088D08GGGCCCCACCTGTCAGTGNONE 
Os01g0905400012-077-F08CGGGCCCACCTGTCAGTGNONE 
AK063530CGGGCCCACCTGTCAGTGTranscriptional factor B3 family protein. 
Os01g0921600AK071344CACTGACAGGTGGGGCCGGASimilar to Mitochondrial import receptor subunit TOM20 (Translocase of outer membrane 20 kDa subunit). 
J013039J22CACTGACAGGTGGGGCCGGANONE 
J013109E03CACTGACAGGTGGGGCCGGANONE 
J023081J12CACTGACAGGTGGGGCCGGANONE 
J023091E24CACTGACAGGTGGGGCCGGANONE 
J033022A01CACTGACAGGTGGGGCCGGANONE 
J033074C13CACTGACAGGTGGGGCCGGANONE 
J065199E03CACTGACAGGTGGGGCCGGANONE 
J075172O04CACTGACAGGTGGGGCCGGANONE 
J090007G18CACTGACAGGTGGGGCCGGANONE 
J090052B17CACTGACAGGTGGGGCCGGANONE 
J090074H01CACTGACAGGTGGGGCCGGANONE 
J100043J09CACTGACAGGTGGGGCCGGANONE 
J100059J05CACTGACAGGTGGGGCCGGANONE 
Os01g0937000AK108620CTGACAGGPeptidase A1, pepsin family protein. 
Os01g0961200011-099-H06CCACTGACAGGNONE 
AK105424CCACTGACAGGCBS domain containing protein. 
J065169J18CCACTGACAGGNONE 
J075109H12CCACTGACAGGNONE 
Os02g0121000AK099931GTGGGTCCCACCTGTCAGTSimilar to Glutamyl-tRNA synthetase (EC 6.1.1.17) (Glutamate--tRNA ligase) (GluRS). 
Os02g0316200AK073932CACTGACAGGCyclin-like F-box domain containing protein. 
AK105757CACTGACAGGNONE 
J023039G03CACTGACAGGNONE 
J033076K03CACTGACAGGNONE 
J075157J22CACTGACAGGNONE 
J090097K02CACTGACAGGNONE 
J100053F10CACTGACAGGNONE 
Os02g0491300J065205O09CCCACCTGTCAGConserved hypothetical protein. 
Os02g0504800AK069683CTGACAGGSimilar to Delta-9 stearoyl-acyl carrier protein desaturase (EC 1.14.99.6) (Fragment). 
J023030N09CTGACAGGNONE 
Os02g0574600AK059246CACCTGTCAGTConserved hypothetical protein. 
Os02g0601800AB060276CACTGACAGGTGGNONE 
AK099539CACTGACAGGTGGNONE 
AK101873CACTGACAGGTGGBromodomain containing protein. 
AK106801CACTGACAGGTGGNONE 
AK121758CACTGACAGGTGGNONE 
AK121891CACTGACAGGTGGNONE 
J013059H01CACTGACAGGTGGNONE 
J013092F08CACTGACAGGTGGNONE 
J013146J04CACTGACAGGTGGNONE 
J023001K12CACTGACAGGTGGNONE 
J023002H16CACTGACAGGTGGNONE 
J023013B10CACTGACAGGTGGNONE 
J023081I22CACTGACAGGTGGNONE 
J023084K19CACTGACAGGTGGNONE 
J023150E24CACTGACAGGTGGNONE 
J033023B18CACTGACAGGTGGNONE 
J033025F18CACTGACAGGTGGNONE 
J033048P08CACTGACAGGTGGNONE 
J033060M24CACTGACAGGTGGNONE 
J033070G06CACTGACAGGTGGNONE 
J033088P12CACTGACAGGTGGNONE 
J033105C13CACTGACAGGTGGNONE 
J043009N18CACTGACAGGTGGNONE 
J065103G21CACTGACAGGTGGNONE 
J075039H15CACTGACAGGTGGNONE 
J090014K10CACTGACAGGTGGNONE 
J090022N02CACTGACAGGTGGNONE 
J090033F18CACTGACAGGTGGNONE 
J090033I04CACTGACAGGTGGNONE 
J090041F11CACTGACAGGTGGNONE 
J090045P20CACTGACAGGTGGNONE 
J090054B01CACTGACAGGTGGNONE 
J090055M12CACTGACAGGTGGNONE 
J090071K09CACTGACAGGTGGNONE 
J090098O16CACTGACAGGTGGNONE 
J090099P15CACTGACAGGTGGNONE 
J100050I16CACTGACAGGTGGNONE 
Os02g0602400AK059178CCTGTCAGNONE 
Os02g0725100AK071759ACTGACAGGTGTGGCCCACTNONE 
Os02g0728600AK063054CTGACAGGTGGGCCTASimilar to H/ACA ribonucleoprotein complex subunit 2 (H/ACA snoRNP protein NHP2) (High mobility group-like nuclear protein 2). 
J065121P04CTGACAGGTGGGCCTANONE 
Os02g0781700006-066-G01GGCCCCACCTGTCAGTGGNONE 
009-034-D03GGCCCCACCTGTCAGTGGNONE 
009-194-D04GGCCCCACCTGTCAGTGGNONE 
AK061791GGCCCCACCTGTCAGTGGConserved hypothetical protein. 
AK063223GGCCCCACCTGTCAGTGGNONE 
AY224477GGCCCCACCTGTCAGTGGNONE 
J013045H09GGCCCCACCTGTCAGTGGNONE 
J013061I22GGCCCCACCTGTCAGTGGNONE 
J013071F11GGCCCCACCTGTCAGTGGNONE 
J023130H07GGCCCCACCTGTCAGTGGNONE 
J043036K23GGCCCCACCTGTCAGTGGNONE 
J065010N07GGCCCCACCTGTCAGTGGNONE 
J065219I01GGCCCCACCTGTCAGTGGNONE 
J090073I15GGCCCCACCTGTCAGTGGNONE 
Os02g0782700005-009-B03CTGACAGGTGGGCCCCACCACNONE 
006-065-C12CTGACAGGTGGGCCCCACCACNONE 
011-016-A10CTGACAGGTGGGCCCCACCACNONE 
011-027-G10CTGACAGGTGGGCCCCACCACNONE 
011-078-C10CTGACAGGTGGGCCCCACCACNONE 
012-039-F02CTGACAGGTGGGCCCCACCACNONE 
012-059-F07CTGACAGGTGGGCCCCACCACNONE 
012-088-B06CTGACAGGTGGGCCCCACCACNONE 
012-088-C06CTGACAGGTGGGCCCCACCACNONE 
012-090-F01CTGACAGGTGGGCCCCACCACNONE 
015-002-C09CTGACAGGTGGGCCCCACCACNONE 
015-004-C04CTGACAGGTGGGCCCCACCACNONE 
015-024-F11CTGACAGGTGGGCCCCACCACNONE 
015-038-C01CTGACAGGTGGGCCCCACCACNONE 
015-053-H02CTGACAGGTGGGCCCCACCACNONE 
015-057-G04CTGACAGGTGGGCCCCACCACNONE 
016-010-H02CTGACAGGTGGGCCCCACCACNONE 
016-018-C07CTGACAGGTGGGCCCCACCACNONE 
016-048-B11CTGACAGGTGGGCCCCACCACNONE 
016-062-D03CTGACAGGTGGGCCCCACCACNONE 
016-077-H03CTGACAGGTGGGCCCCACCACNONE 
AF193803CTGACAGGTGGGCCCCACCACNONE 
AK064027CTGACAGGTGGGCCCCACCACNONE 
AK103783CTGACAGGTGGGCCCCACCACSimilar to Transcription factor EREBP1. 
AK119643CTGACAGGTGGGCCCCACCACNONE 
AK119885CTGACAGGTGGGCCCCACCACNONE 
J013021I16CTGACAGGTGGGCCCCACCACNONE 
J013049O14CTGACAGGTGGGCCCCACCACNONE 
J013063K17CTGACAGGTGGGCCCCACCACNONE 
J013072M15CTGACAGGTGGGCCCCACCACNONE 
J023027O06CTGACAGGTGGGCCCCACCACNONE 
J023065O13CTGACAGGTGGGCCCCACCACNONE 
J033061L05CTGACAGGTGGGCCCCACCACNONE 
J033071D23CTGACAGGTGGGCCCCACCACNONE 
J033091P12CTGACAGGTGGGCCCCACCACNONE 
J033124J07CTGACAGGTGGGCCCCACCACNONE 
J033144H23CTGACAGGTGGGCCCCACCACNONE 
J033145H23CTGACAGGTGGGCCCCACCACNONE 
J065063N13CTGACAGGTGGGCCCCACCACNONE 
J065186B09CTGACAGGTGGGCCCCACCACNONE 
J075055I18CTGACAGGTGGGCCCCACCACNONE 
J075177O06CTGACAGGTGGGCCCCACCACNONE 
J090008G10CTGACAGGTGGGCCCCACCACNONE 
J090050I24CTGACAGGTGGGCCCCACCACNONE 
J090062F21CTGACAGGTGGGCCCCACCACNONE 
J090071M09CTGACAGGTGGGCCCCACCACNONE 
J090078M03CTGACAGGTGGGCCCCACCACNONE 
J100018N15CTGACAGGTGGGCCCCACCACNONE 
J100035P04CTGACAGGTGGGCCCCACCACNONE 
J100037E03CTGACAGGTGGGCCCCACCACNONE 
J100045D04CTGACAGGTGGGCCCCACCACNONE 
J100062C01CTGACAGGTGGGCCCCACCACNONE 
J100065C13CTGACAGGTGGGCCCCACCACNONE 
J100068N10CTGACAGGTGGGCCCCACCACNONE 
J100074A11CTGACAGGTGGGCCCCACCACNONE 
J100077G20CTGACAGGTGGGCCCCACCACNONE 
Os02g0792600J090091O08CTGACAGGTGGGGCCCACGCNONE 
Os02g0793000AK070242CTGACAGGNONE 
AK099173CTGACAGGNONE 
AK105863CTGACAGGZinc finger, CCCH-type domain containing protein. 
Os02g0815200AK067252ACTGACAGGSimilar to 29 kDa ribonucleoprotein, chloroplast precursor (RNA-binding protein cp29). 
AK104489ACTGACAGGNONE 
Os02g0826200AK070787CTGACAGGdTDP-4-dehydrorhamnose reductase family protein. 
J075022D14CTGACAGGNONE 
Os03g0152000AK102357ACTGACAGGHeavy metal transport/detoxification protein domain containing protein. 
J023072F16ACTGACAGGNONE 
J033091H19ACTGACAGGNONE 
J065037B07ACTGACAGGNONE 
J065087E11ACTGACAGGNONE 
J065098H09ACTGACAGGNONE 
J065105L15ACTGACAGGNONE 
J065165N20ACTGACAGGNONE 
J065166C14ACTGACAGGNONE 
J065183M01ACTGACAGGNONE 
J065187C11ACTGACAGGNONE 
J075001H11ACTGACAGGNONE 
J075044D12ACTGACAGGNONE 
J075088L19ACTGACAGGNONE 
J075124A10ACTGACAGGNONE 
J075155D14ACTGACAGGNONE 
J075173I10ACTGACAGGNONE 
J090009D11ACTGACAGGNONE 
J090056G24ACTGACAGGNONE 
J100028I24ACTGACAGGNONE 
J100029D09ACTGACAGGNONE 
Os03g0161000AK121425CACTGACAGGTGGGCCGGGGACGGCTNONE 
AK121425CTGACAGGTGGGNONE 
AK121425CTGACAGGTGGGGCNONE 
AK121425CTGACAGGTGGGGCNONE 
AK121425CTGACAGGTGGGGCNONE 
J023135K12CACTGACAGGTGGGCCGGGGACGGCTNONE 
J023135K12CTGACAGGTGGGNONE 
J023135K12CTGACAGGTGGGGCNONE 
J023135K12CTGACAGGTGGGGCNONE 
J023135K12CTGACAGGTGGGGCNONE 
Os03g0161200AK066932GGACACGTCTCACTGACAGGTGGGACCCACSimilar to Sulfate transporter 3.1 (AST12) (AtST1). 
Os03g0169500Os03g0169500CTGACAGGSimilar to Cellulose synthase-like A4. 
Os03g0173700AK101161CCCACCTGTCAGNONE 
AK111195CCCACCTGTCAGConserved hypothetical protein. 
J090042G17CCCACCTGTCAGNONE 
Os03g0199500J065099N05CCCACCTGTCAGTGNONE 
J065152P14CCCACCTGTCAGTGConserved hypothetical protein. 
J080009C14CCCACCTGTCAGTGNONE 
J080011K01CCCACCTGTCAGTGNONE 
J080015H12CCCACCTGTCAGTGNONE 
J080022K05CCCACCTGTCAGTGNONE 
J080034G01CCCACCTGTCAGTGNONE 
J080038I04CCCACCTGTCAGTGNONE 
J080039F20CCCACCTGTCAGTGNONE 
J080042J22CCCACCTGTCAGTGNONE 
J080042N23CCCACCTGTCAGTGNONE 
J080043E07CCCACCTGTCAGTGNONE 
J080050A12CCCACCTGTCAGTGNONE 
J080050C11CCCACCTGTCAGTGNONE 
J080052B01CCCACCTGTCAGTGNONE 
J080052H22CCCACCTGTCAGTGNONE 
J080060E02CCCACCTGTCAGTGNONE 
J080063K24CCCACCTGTCAGTGNONE 
J080067I07CCCACCTGTCAGTGNONE 
J080081H22CCCACCTGTCAGTGNONE 
J080085J10CCCACCTGTCAGTGNONE 
J080089E20CCCACCTGTCAGTGNONE 
J080092N04CCCACCTGTCAGTGNONE 
J080093B01CCCACCTGTCAGTGNONE 
J080093N04CCCACCTGTCAGTGNONE 
J080097B03CCCACCTGTCAGTGNONE 
Os03g0206600AK058618CCACTGACAGGTGGGTCCProtein of unknown function DUF588 family protein. 
Os03g0275700AK111329GGCCCACCTGTCAGTGConserved hypothetical protein. 
Os03g0286200AK105065CTGACAGGNONE 
Os03g0288300006-086-D07CTGACAGGNONE 
AK061155CTGACAGGNONE 
J065141G11CTGACAGGNONE 
J065162C12CTGACAGGNONE 
J100054H19CTGACAGGNONE 
Os03g0308800AK066789CCCACCTGTCAGNONE 
AK068534CCCACCTGTCAGProtein prenyltransferase domain containing protein. 
Os03g0370000AK100033CCCACCTGTCAGSimilar to Pyruvate dehydrogenase kinase isoform 1 (EC 2.7.1.99). 
Os03g0383800009-149-G01CCCACCTGTCAGNONE 
AK062998CCCACCTGTCAGNONE 
AK065904CCCACCTGTCAGNONE 
Os03g0418700AK099879CTGACAGGNONE 
AK101797CTGACAGGConserved hypothetical protein. 
Os03g0421800AK099491CCTGTCAGVirulence factor, pectin lyase fold family protein. 
AK099491CCTGTCAGTVirulence factor, pectin lyase fold family protein. 
J065198F08CCTGTCAGNONE 
J065198F08CCTGTCAGTNONE 
Os03g0425900AK105583CCTGTCAGTZinc finger, C2H2-type domain containing protein. 
Os03g0687800AK106820CACCTGTCAGConserved hypothetical protein. 
Os03g0699200005-016-G07CTGACAGGNONE 
AK066652CTGACAGGPescadillo, N-terminal domain containing protein. 
AK099383CTGACAGGNONE 
J013069A12CTGACAGGNONE 
J033085M11CTGACAGGNONE 
J033111P09CTGACAGGNONE 
J033128H17CTGACAGGNONE 
Os03g0726100004-005-B05TCTGGACCCACCTGTCAGTGNONE 
006-023-C08TCTGGACCCACCTGTCAGTGNONE 
006-029-H02TCTGGACCCACCTGTCAGTGNONE 
006-032-B03TCTGGACCCACCTGTCAGTGNONE 
006-035-C10TCTGGACCCACCTGTCAGTGNONE 
006-040-H05TCTGGACCCACCTGTCAGTGNONE 
006-043-C02TCTGGACCCACCTGTCAGTGNONE 
006-046-B11TCTGGACCCACCTGTCAGTGNONE 
006-046-E05TCTGGACCCACCTGTCAGTGNONE 
006-046-H04TCTGGACCCACCTGTCAGTGNONE 
006-048-A09TCTGGACCCACCTGTCAGTGNONE 
006-050-A02TCTGGACCCACCTGTCAGTGNONE 
006-063-A02TCTGGACCCACCTGTCAGTGNONE 
006-064-A09TCTGGACCCACCTGTCAGTGNONE 
006-070-G11TCTGGACCCACCTGTCAGTGNONE 
006-072-G04TCTGGACCCACCTGTCAGTGNONE 
006-077-G12TCTGGACCCACCTGTCAGTGNONE 
006-080-F04TCTGGACCCACCTGTCAGTGNONE 
006-080-H01TCTGGACCCACCTGTCAGTGNONE 
006-084-D10TCTGGACCCACCTGTCAGTGNONE 
006-084-G06TCTGGACCCACCTGTCAGTGNONE 
006-085-H10TCTGGACCCACCTGTCAGTGNONE 
006-086-C05TCTGGACCCACCTGTCAGTGNONE 
006-087-D10TCTGGACCCACCTGTCAGTGNONE 
006-096-C09TCTGGACCCACCTGTCAGTGNONE 
006-100-F10TCTGGACCCACCTGTCAGTGNONE 
006-108-D12TCTGGACCCACCTGTCAGTGNONE 
006-115-G10TCTGGACCCACCTGTCAGTGNONE 
006-119-C09TCTGGACCCACCTGTCAGTGNONE 
006-120-E05TCTGGACCCACCTGTCAGTGNONE 
011-042-H01TCTGGACCCACCTGTCAGTGNONE 
011-075-B11TCTGGACCCACCTGTCAGTGNONE 
013-003-D03TCTGGACCCACCTGTCAGTGNONE 
013-028-B11TCTGGACCCACCTGTCAGTGNONE 
013-031-A01TCTGGACCCACCTGTCAGTGNONE 
013-035-F03TCTGGACCCACCTGTCAGTGNONE 
013-051-D02TCTGGACCCACCTGTCAGTGNONE 
013-055-D06TCTGGACCCACCTGTCAGTGNONE 
013-059-H03TCTGGACCCACCTGTCAGTGNONE 
013-076-A09TCTGGACCCACCTGTCAGTGNONE 
013-076-B01TCTGGACCCACCTGTCAGTGNONE 
013-090-F09TCTGGACCCACCTGTCAGTGNONE 
013-100-A05TCTGGACCCACCTGTCAGTGNONE 
013-100-F05TCTGGACCCACCTGTCAGTGNONE 
013-100-G12TCTGGACCCACCTGTCAGTGNONE 
014-006-G08TCTGGACCCACCTGTCAGTGNONE 
015-003-B07TCTGGACCCACCTGTCAGTGNONE 
016-093-C06TCTGGACCCACCTGTCAGTGNONE 
AF030548TCTGGACCCACCTGTCAGTGNONE 
AK102194TCTGGACCCACCTGTCAGTGSimilar to Tubulin alpha-1 chain (Alpha-1 tubulin). 
AK119247TCTGGACCCACCTGTCAGTGNONE 
AK119362TCTGGACCCACCTGTCAGTGNONE 
AK119638TCTGGACCCACCTGTCAGTGNONE 
J013066P16TCTGGACCCACCTGTCAGTGNONE 
J023022H18TCTGGACCCACCTGTCAGTGNONE 
J023087O13TCTGGACCCACCTGTCAGTGNONE 
J023121I16TCTGGACCCACCTGTCAGTGNONE 
J023123M09TCTGGACCCACCTGTCAGTGNONE 
J033022M05TCTGGACCCACCTGTCAGTGNONE 
J033087C05TCTGGACCCACCTGTCAGTGNONE 
J065022K07TCTGGACCCACCTGTCAGTGNONE 
J065024E22TCTGGACCCACCTGTCAGTGNONE 
J065041G05TCTGGACCCACCTGTCAGTGNONE 
J065045M11TCTGGACCCACCTGTCAGTGNONE 
J065082K10TCTGGACCCACCTGTCAGTGNONE 
J065121K18TCTGGACCCACCTGTCAGTGNONE 
J065137O07TCTGGACCCACCTGTCAGTGNONE 
J065144B12TCTGGACCCACCTGTCAGTGNONE 
J065152E04TCTGGACCCACCTGTCAGTGNONE 
J065159D24TCTGGACCCACCTGTCAGTGNONE 
J065217E02TCTGGACCCACCTGTCAGTGNONE 
J075014N22TCTGGACCCACCTGTCAGTGNONE 
J075064O17TCTGGACCCACCTGTCAGTGNONE 
J080316L10TCTGGACCCACCTGTCAGTGNONE 
J080318L20TCTGGACCCACCTGTCAGTGNONE 
J090034D01TCTGGACCCACCTGTCAGTGNONE 
J090034P05TCTGGACCCACCTGTCAGTGNONE 
J090041H08TCTGGACCCACCTGTCAGTGNONE 
J090042F20TCTGGACCCACCTGTCAGTGNONE 
J090042I15TCTGGACCCACCTGTCAGTGNONE 
J090050O17TCTGGACCCACCTGTCAGTGNONE 
J090054L13TCTGGACCCACCTGTCAGTGNONE 
J090062A12TCTGGACCCACCTGTCAGTGNONE 
J090068I22TCTGGACCCACCTGTCAGTGNONE 
J090070J23TCTGGACCCACCTGTCAGTGNONE 
J090070M18TCTGGACCCACCTGTCAGTGNONE 
J090084L07TCTGGACCCACCTGTCAGTGNONE 
J090087H13TCTGGACCCACCTGTCAGTGNONE 
J090095H10TCTGGACCCACCTGTCAGTGNONE 
J090099M17TCTGGACCCACCTGTCAGTGNONE 
J100022O10TCTGGACCCACCTGTCAGTGNONE 
J100048A05TCTGGACCCACCTGTCAGTGNONE 
J100057O06TCTGGACCCACCTGTCAGTGNONE 
X91806TCTGGACCCACCTGTCAGTGNONE 
Os03g0759700011-078-B02CTGACAGGCTTTCCCNONE 
AK072833CTGACAGGCTTTCCCSimilar to ER33 protein (Fragment). 
J100036M24CTGACAGGCTTTCCCNONE 
J100047B02CTGACAGGCTTTCCCNONE 
J100062F21CTGACAGGCTTTCCCNONE 
J100066O16CTGACAGGCTTTCCCNONE 
J100082M12CTGACAGGCTTTCCCNONE 
Os03g0780400011-100-D09CCCACCTGTCAGTGACACNONE 
AK061347CCCACCTGTCAGTGACACNONE 
AK073162CCCACCTGTCAGTGACACSimilar to Actin-depolymerizing factor 6 (ADF-6) (AtADF6). 
J065043E22CCCACCTGTCAGTGACACNONE 
J065045I07CCCACCTGTCAGTGACACNONE 
J090036F17CCCACCTGTCAGTGACACNONE 
J090077M14CCCACCTGTCAGTGACACNONE 
J100055G20CCCACCTGTCAGTGACACNONE 
Os03g0811200AK069532TGGGGCCCACCTGTCAGBRCT domain containing protein. 
Os04g0283700AK063831CTGACAGGChromo domain containing protein. 
Os04g0367400006-079-G12AGGGCCCACCTGTCAGNONE 
AK061121AGGGCCCACCTGTCAGReticulon family protein. 
AK100139AGGGCCCACCTGTCAGNONE 
J065009F13AGGGCCCACCTGTCAGNONE 
J065032N11AGGGCCCACCTGTCAGNONE 
J065039P10AGGGCCCACCTGTCAGNONE 
J065124I05AGGGCCCACCTGTCAGNONE 
J065197E16AGGGCCCACCTGTCAGNONE 
Os04g0390000AK067777CCTGTCAGNONE 
AK068713CCTGTCAGNONE 
AK098921CCTGTCAGSimilar to 2-oxoglutarate dehydrogenase, E1 component. 
Os04g0390500AK066575CCAGCCCAATACACTGACAGGTGGGCCCACANONE 
AK066575CTGACAGGTGGGTCCNONE 
AK099908CCAGCCCAATACACTGACAGGTGGGCCCACANONE 
AK099908CTGACAGGTGGGTCCNONE 
AK100148CCAGCCCAATACACTGACAGGTGGGCCCACANONE 
AK100148CTGACAGGTGGGTCCNONE 
Os04g0394200AK068154CACTGACAGGTGGGCCCACCASimilar to 2-oxoglutarate dehydrogenase E2 subunit. 
AK104832CACTGACAGGTGGGCCCACCANONE 
AK121002CACTGACAGGTGGGCCCACCANONE 
J033092H19CACTGACAGGTGGGCCCACCANONE 
Os04g0476800AK070908CACTGACAGGTGGGCCCAAAASimilar to TA5 protein (Fragment). 
Os04g0482800AK068497CCACTGACAGGTGGGCCCGCSimilar to Topoisomerase-like protein. 
J065141K24CCACTGACAGGTGGGCCCGCNONE 
J065144O22CCACTGACAGGTGGGCCCGCNONE 
J065162F11CCACTGACAGGTGGGCCCGCNONE 
Os04g0504700AK068596CCTGTCAGTGConserved hypothetical protein. 
Os04g0558400AK061440ACTGACAGGAcyl-CoA thioesterase family protein. 
AK061440GGTCCCACCTGACAGGAcyl-CoA thioesterase family protein. 
AK102197ACTGACAGGNONE 
AK102197GGTCCCACCTGACAGGNONE 
J013046K23ACTGACAGGNONE 
J013046K23GGTCCCACCTGACAGGNONE 
J013090O17ACTGACAGGNONE 
J013090O17GGTCCCACCTGACAGGNONE 
J033087D05ACTGACAGGNONE 
J033087D05GGTCCCACCTGACAGGNONE 
J065029A16ACTGACAGGNONE 
J065029A16GGTCCCACCTGACAGGNONE 
J065121A13ACTGACAGGNONE 
J065121A13GGTCCCACCTGACAGGNONE 
J090063H18ACTGACAGGNONE 
J090063H18GGTCCCACCTGACAGGNONE 
J100048C18ACTGACAGGNONE 
J100048C18GGTCCCACCTGACAGGNONE 
Os04g0599000AK111508CCTGTCAGEGF-like, type 3 domain containing protein. 
Os04g0652900AK071125AGCCGTTGGGCCCACCTGTCAGPeptidyl-tRNA hydrolase, PTH2 domain containing protein. 
J023082K03AGCCGTTGGGCCCACCTGTCAGNONE 
J075142E01AGCCGTTGGGCCCACCTGTCAGNONE 
Os04g0663200006-074-D02CCTGTCAGNONE 
AK105958CCTGTCAGZinc finger, CCCH-type domain containing protein. 
AK111925CCTGTCAGNONE 
Os04g0663700012-059-B10CTGACAGGNONE 
AK068004CTGACAGGTLDc domain containing protein. 
J013129G21CTGACAGGNONE 
J100045N22CTGACAGGNONE 
J100048A18CTGACAGGNONE 
Os04g0667000AK069874ACTGACAGGTafazzin family protein. 
J100055P09ACTGACAGGNONE 
J100057O12ACTGACAGGNONE 
J100067H07ACTGACAGGNONE 
J100070D06ACTGACAGGNONE 
J100071J16ACTGACAGGNONE 
J100072C15ACTGACAGGNONE 
Os04g0679800AK060662CTTGGGCCCCACCTGTCAGTSimilar to RNA-binding protein-like protein. 
AK099987CTTGGGCCCCACCTGTCAGTNONE 
J013130B11CTTGGGCCCCACCTGTCAGTNONE 
J065049C17CTTGGGCCCCACCTGTCAGTNONE 
J075191N12CTTGGGCCCCACCTGTCAGTNONE 
J075191P12CTTGGGCCCCACCTGTCAGTNONE 
J100031C07CTTGGGCCCCACCTGTCAGTNONE 
Os04g0685800AK070891CGGGCCCACCTGTCAGSimilar to Diadenosine 5',5'''-P1,P4-tetraphosphate hydrolase (EC 3.6.1.17). 
AK071345CGGGCCCACCTGTCAGNONE 
J023069G19CGGGCCCACCTGTCAGNONE 
J023097E09CGGGCCCACCTGTCAGNONE 
J065071A01CGGGCCCACCTGTCAGNONE 
J065186F08CGGGCCCACCTGTCAGNONE 
J075044B21CGGGCCCACCTGTCAGNONE 
J075120N18CGGGCCCACCTGTCAGNONE 
J075131B22CGGGCCCACCTGTCAGNONE 
J100041H18CGGGCCCACCTGTCAGNONE 
J100042P13CGGGCCCACCTGTCAGNONE 
Os05g0148600003-016-C11CCACTGACAGGNONE 
AK066168CCACTGACAGGNONE 
AK104336CCACTGACAGGSimilar to Na+/H+ antiporter. 
AY360145CCACTGACAGGNONE 
J013055J22CCACTGACAGGNONE 
J013057M24CCACTGACAGGNONE 
J013074N03CCACTGACAGGNONE 
J013158A22CCACTGACAGGNONE 
J075118H09CCACTGACAGGNONE 
Os05g0163700AK071561ACTGACAGGTGGGCCAGASimilar to Acyl-coenzyme A oxidase 4, peroxisomal (EC 1.3.3.6) (AOX 4) (Short- chain acyl-CoA oxidase) (SAOX) (AtCX4) (G6p) (AtG6). 
AK071561CACTGACAGGTGGGGCCCACGCSimilar to Acyl-coenzyme A oxidase 4, peroxisomal (EC 1.3.3.6) (AOX 4) (Short- chain acyl-CoA oxidase) (SAOX) (AtCX4) (G6p) (AtG6). 
AK071561CCACCTGTCAGTGGSimilar to Acyl-coenzyme A oxidase 4, peroxisomal (EC 1.3.3.6) (AOX 4) (Short- chain acyl-CoA oxidase) (SAOX) (AtCX4) (G6p) (AtG6). 
Os05g0208000AK059612CCCACGGGCCCACCTGTCAGTNONE 
AK063666CCCACGGGCCCACCTGTCAGTNONE 
AK071500CCCACGGGCCCACCTGTCAGTSimilar to 2-oxoglutarate/malate translocator. 
Os05g0350500013-071-D05GGACCCACCTGTCAGTGNONE 
AF020787GGACCCACCTGTCAGTGNONE 
AK061712GGACCCACCTGTCAGTGNONE 
AK102897GGACCCACCTGTCAGTGProliferation-associated protein 1 family protein. 
J033060G23GGACCCACCTGTCAGTGNONE 
J033112P14GGACCCACCTGTCAGTGNONE 
J033127J04GGACCCACCTGTCAGTGNONE 
J090015L18GGACCCACCTGTCAGTGNONE 
J090047K03GGACCCACCTGTCAGTGNONE 
J090097J17GGACCCACCTGTCAGTGNONE 
Os05g0361900006-033-D04ACTGACAGGTGGGCCCAGCCCNONE 
AK060107ACTGACAGGTGGGCCCAGCCCMitochondrial substrate carrier family protein. 
AK104602ACTGACAGGTGGGCCCAGCCCNONE 
AK104747ACTGACAGGTGGGCCCAGCCCNONE 
J033133L03ACTGACAGGTGGGCCCAGCCCNONE 
J080001O06ACTGACAGGTGGGCCCAGCCCNONE 
J080004F05ACTGACAGGTGGGCCCAGCCCNONE 
J080005D12ACTGACAGGTGGGCCCAGCCCNONE 
J080008G19ACTGACAGGTGGGCCCAGCCCNONE 
J080015D10ACTGACAGGTGGGCCCAGCCCNONE 
J080015H22ACTGACAGGTGGGCCCAGCCCNONE 
J080016K15ACTGACAGGTGGGCCCAGCCCNONE 
J080018D12ACTGACAGGTGGGCCCAGCCCNONE 
J080020A01ACTGACAGGTGGGCCCAGCCCNONE 
J080027A09ACTGACAGGTGGGCCCAGCCCNONE 
J080032F05ACTGACAGGTGGGCCCAGCCCNONE 
J080039D09ACTGACAGGTGGGCCCAGCCCNONE 
J080043J19ACTGACAGGTGGGCCCAGCCCNONE 
J080052G22ACTGACAGGTGGGCCCAGCCCNONE 
J080052M15ACTGACAGGTGGGCCCAGCCCNONE 
J080053D22ACTGACAGGTGGGCCCAGCCCNONE 
J080061I18ACTGACAGGTGGGCCCAGCCCNONE 
J080064O14ACTGACAGGTGGGCCCAGCCCNONE 
J080075K01ACTGACAGGTGGGCCCAGCCCNONE 
J080082I02ACTGACAGGTGGGCCCAGCCCNONE 
J080095C14ACTGACAGGTGGGCCCAGCCCNONE 
J100028N14ACTGACAGGTGGGCCCAGCCCNONE 
Os05g0380900AK067214CAGGTGGGCCCCACCTGTCAGSimilar to Polcalcin Jun o 2 (Calcium-binding pollen allergen Jun o 2). 
AK099962CAGGTGGGCCCCACCTGTCAGNONE 
J065083M07CAGGTGGGCCCCACCTGTCAGNONE 
Os05g0441500AK120434ACAGCCCAGGCCCACCTGTCAGNONE 
J013097F13ACAGCCCAGGCCCACCTGTCAGNONE 
J013097F15ACAGCCCAGGCCCACCTGTCAGNONE 
J065152G07ACAGCCCAGGCCCACCTGTCAGNONE 
Os05g0451300AK108341GGGCCCCACCTGTCAGConserved hypothetical protein. 
Os05g0467300006-113-H02GCGGCCCACCTGTCAGTGNONE 
AK061873GCGGCCCACCTGTCAGTGSelT/selW/selH selenoprotein family protein. 
AK098945GCGGCCCACCTGTCAGTGNONE 
J013050H09GCGGCCCACCTGTCAGTGNONE 
J023108B17GCGGCCCACCTGTCAGTGNONE 
J065189J01GCGGCCCACCTGTCAGTGNONE 
J075011H05GCGGCCCACCTGTCAGTGNONE 
J075019G20GCGGCCCACCTGTCAGTGNONE 
Os05g0477100AK108641ACTGACAGGConserved hypothetical protein. 
Os05g0535100AK063362CCACCTGTCAGSimilar to Beta-1,3-glucanase-like protein. 
Os05g0549100AK072422CACTGACAGGTGGGCCAASimilar to Serine/threonine-protein kinase SNT7, chloroplast precursor (EC 2.7.1.37) (Stt7 homolog). 
Os06g0161800AK064664CCTGTCAGProtein of unknown function DUF569 family protein. 
Os06g0199100AK120323CCTGTCAGProtein prenyltransferase domain containing protein. 
Os06g0233200AK108060CCTGTCAGSimilar to RING-H2 finger protein ATL1R (RING-H2 finger protein ATL8). 
Os06g0258900AK060181CTGACAGGNONE 
Os06g0668200011-004-A12CTGACAGGTGGNONE 
AK070705CTGACAGGTGGSimilar to Phosphoglycerate kinase, cytosolic (EC 2.7.2.3). 
AK101622CTGACAGGTGGNONE 
D10408CTGACAGGTGGNONE 
J033044L05CTGACAGGTGGNONE 
J033052L01CTGACAGGTGGNONE 
J033086F09CTGACAGGTGGNONE 
J033096I19CTGACAGGTGGNONE 
J053072J20CTGACAGGTGGNONE 
J065074N09CTGACAGGTGGNONE 
J065075K09CTGACAGGTGGNONE 
J065130L15CTGACAGGTGGNONE 
J065136P12CTGACAGGTGGNONE 
J065137M09CTGACAGGTGGNONE 
J065139O15CTGACAGGTGGNONE 
J075003J03CTGACAGGTGGNONE 
J075021J20CTGACAGGTGGNONE 
Os06g0708200J013149K22CTGACAGGTGGGCCACNONE 
J053032C24CTGACAGGTGGGCCACNONE 
J053037F13CTGACAGGTGGGCCACNONE 
J053037L10CTGACAGGTGGGCCACNONE 
J053043J18CTGACAGGTGGGCCACNONE 
J053098E09CTGACAGGTGGGCCACNONE 
J075036L07CTGACAGGTGGGCCACNONE 
J075057O05CTGACAGGTGGGCCACNONE 
J090092L13CTGACAGGTGGGCCACNONE 
Os06g0708500AK060865AGGGCCCACCTGTCAGNONE 
AK072490AGGGCCCACCTGTCAGSimilar to Cyclophilin. 
J013052B11AGGGCCCACCTGTCAGNONE 
J013052B13AGGGCCCACCTGTCAGNONE 
J065214H07AGGGCCCACCTGTCAGNONE 
J075192D20AGGGCCCACCTGTCAGNONE 
J090090C15AGGGCCCACCTGTCAGNONE 
J100051J18AGGGCCCACCTGTCAGNONE 
J100055A07AGGGCCCACCTGTCAGNONE 
J100060B10AGGGCCCACCTGTCAGNONE 
J100061D02AGGGCCCACCTGTCAGNONE 
Os06g0714000AK069538CCCACCTGTCAGTProtein of unknown function UPF0183 family protein. 
AK069538CCCACCTGTCAGTGProtein of unknown function UPF0183 family protein. 
J023020A02CCCACCTGTCAGTNONE 
J023020A02CCCACCTGTCAGTGNONE 
J023039H03CCCACCTGTCAGTNONE 
J023039H03CCCACCTGTCAGTGNONE 
J100042E23CCCACCTGTCAGTNONE 
J100042E23CCCACCTGTCAGTGNONE 
J100069N01CCCACCTGTCAGTNONE 
J100069N01CCCACCTGTCAGTGNONE 
J100089L13CCCACCTGTCAGTNONE 
J100089L13CCCACCTGTCAGTGNONE 
Os06g0715700AK121440ACTGACAGGProtein of unknown function DUF803 family protein. 
Os06g0727400AK069558CACTGACAGGTGGGCCCCSimilar to Protein kinase APK1A, chloroplast precursor (EC 2.7.1.-). 
Os07g0133500015-010-H05CCACTGACAGGTGGGNONE 
AB110179CCACTGACAGGTGGGNONE 
AK106244CCACTGACAGGTGGGProtein of unknown function DUF1005 family protein. 
J090075I21CCACTGACAGGTGGGNONE 
Os07g0185200AK066157CCACTGACAGGTGGGCCCAGATSimilar to Membrane related protein-like. 
Os07g0245100J023048C16GGGCCCCACCTGTCAGTNONE 
J023110L14GGGCCCCACCTGTCAGTNONE 
J053023B18GGGCCCCACCTGTCAGTNONE 
J053031L17GGGCCCCACCTGTCAGTNONE 
J065035I22GGGCCCCACCTGTCAGTNONE 
J065043D21GGGCCCCACCTGTCAGTNONE 
J065072L16GGGCCCCACCTGTCAGTNONE 
J065214I23GGGCCCCACCTGTCAGTNONE 
Os07g0438800AK060412CCCGGCCCCACCTGTCAGNONE 
AK100065CCCGGCCCCACCTGTCAGSimilar to Phosphate starvation regulator protein (Regulatory protein of P- starvation acclimation response Psr1). 
AK103195CCCGGCCCCACCTGTCAGNONE 
AY224478CCCGGCCCCACCTGTCAGNONE 
J013160O05CCCGGCCCCACCTGTCAGNONE 
J023030C05CCCGGCCCCACCTGTCAGNONE 
J033025O04CCCGGCCCCACCTGTCAGNONE 
J033121P15CCCGGCCCCACCTGTCAGNONE 
J043034I23CCCGGCCCCACCTGTCAGNONE 
J065022N01CCCGGCCCCACCTGTCAGNONE 
J065022N02CCCGGCCCCACCTGTCAGNONE 
J065023M01CCCGGCCCCACCTGTCAGNONE 
J065101G13CCCGGCCCCACCTGTCAGNONE 
J075058P13CCCGGCCCCACCTGTCAGNONE 
J075186K10CCCGGCCCCACCTGTCAGNONE 
J075199F17CCCGGCCCCACCTGTCAGNONE 
Os07g0459400AK101767CTGACAGGTGRegulator of chromosome condensation/beta-lactamase-inhibitor protein II domain containing protein. 
Os07g0479300AK120117CACTGACAGGPeptidase S10, serine carboxypeptidase family protein. 
D17587CACTGACAGGNONE 
Os07g0490400AK067941CACTGACAGGTGGGCCCACCCCCCCGCGCGCGCGAPeptidylprolyl isomerase, FKBP-type domain containing protein. 
J013121F22CACTGACAGGTGGGCCCACCCCCCCGCGCGCGCGANONE 
Os07g0546000AF188065CTGACAGGTGGGCCCACCACNONE 
AK061800CTGACAGGTGGGCCCACCACNONE 
AK065871CTGACAGGTGGGCCCACCACSimilar to Isopentenyl pyrophosphate:dimethyllallyl pyrophosphate isomerase (EC 5.3.3.2) (Fragment). 
J013024C02CTGACAGGTGGGCCCACCACNONE 
J013035F03CTGACAGGTGGGCCCACCACNONE 
J013044J20CTGACAGGTGGGCCCACCACNONE 
Os07g0546400AK069172CCTGTCAGNPH3 domain containing protein. 
J013147K21CCTGTCAGNONE 
J023004J07CCTGTCAGNONE 
Os07g0556000AK121938CTGACAGGTGGGCCCCACCCyclin-like domain containing protein. 
J065161E07CTGACAGGTGGGCCCCACCNONE 
Os07g0568300AK067784CCACTGACAGGTGGGTCCCACNONE 
AK067895CCACTGACAGGTGGGTCCCACSimilar to ZF protein (Fragment). 
J013119M01CCACTGACAGGTGGGTCCCACNONE 
J013120B09CCACTGACAGGTGGGTCCCACNONE 
J013123G12CCACTGACAGGTGGGTCCCACNONE 
J023012C12CCACTGACAGGTGGGTCCCACNONE 
J023020G17CCACTGACAGGTGGGTCCCACNONE 
J023037E23CCACTGACAGGTGGGTCCCACNONE 
J033076I01CCACTGACAGGTGGGTCCCACNONE 
J033108A07CCACTGACAGGTGGGTCCCACNONE 
J033138J02CCACTGACAGGTGGGTCCCACNONE 
J075033L09CCACTGACAGGTGGGTCCCACNONE 
J075049E02CCACTGACAGGTGGGTCCCACNONE 
J075060N23CCACTGACAGGTGGGTCCCACNONE 
J075094H13CCACTGACAGGTGGGTCCCACNONE 
J075179L18CCACTGACAGGTGGGTCCCACNONE 
J080005P09CCACTGACAGGTGGGTCCCACNONE 
J080044J03CCACTGACAGGTGGGTCCCACNONE 
J080062G20CCACTGACAGGTGGGTCCCACNONE 
J080063L23CCACTGACAGGTGGGTCCCACNONE 
J080065B16CCACTGACAGGTGGGTCCCACNONE 
J080071K09CCACTGACAGGTGGGTCCCACNONE 
J080089C23CCACTGACAGGTGGGTCCCACNONE 
J090008P21CCACTGACAGGTGGGTCCCACNONE 
J090046B22CCACTGACAGGTGGGTCCCACNONE 
J090094C19CCACTGACAGGTGGGTCCCACNONE 
J090096B19CCACTGACAGGTGGGTCCCACNONE 
J100060G03CCACTGACAGGTGGGTCCCACNONE 
J100082D16CCACTGACAGGTGGGTCCCACNONE 
Os07g0592200AK099740GCCCCCACCTGTCAGPeptidase A1, pepsin family protein. 
AK110717GCCCCCACCTGTCAGNONE 
Os07g0620200AK099859ACTGACAGGTGGGCCCCHeat shock protein DnaJ, N-terminal domain containing protein. 
J013110N04ACTGACAGGTGGGCCCCNONE 
Os07g0622900006-108-G01CCTGTCAGTNONE 
AK059960CCTGTCAGTConserved hypothetical protein. 
J065176B03CCTGTCAGTNONE 
J080005P16CCTGTCAGTNONE 
J080009F09CCTGTCAGTNONE 
J080013F07CCTGTCAGTNONE 
J080016L01CCTGTCAGTNONE 
J080021K23CCTGTCAGTNONE 
J080023D15CCTGTCAGTNONE 
J080025D04CCTGTCAGTNONE 
J080039C01CCTGTCAGTNONE 
J080039G22CCTGTCAGTNONE 
J080043K06CCTGTCAGTNONE 
J080049H15CCTGTCAGTNONE 
J080051K09CCTGTCAGTNONE 
J080053I18CCTGTCAGTNONE 
J080067C12CCTGTCAGTNONE 
J080067G19CCTGTCAGTNONE 
J080068L22CCTGTCAGTNONE 
J080068M23CCTGTCAGTNONE 
J080077I06CCTGTCAGTNONE 
J080077J19CCTGTCAGTNONE 
J080080A18CCTGTCAGTNONE 
J080092J08CCTGTCAGTNONE 
Os07g0647100AK065269TCTGGGCCCACCTGTCAGArmadillo-like helical domain containing protein. 
J013002K24TCTGGGCCCACCTGTCAGNONE 
Os07g0671100Os07g0671100CTGACAGGConserved hypothetical protein. 
Os07g0681500AK103662TCCGGGCCCACCTGACAGGNONE 
AK121650TCCGGGCCCACCTGACAGGAnkyrin repeat containing protein. 
Os07g0690300AK062111CTGACAGGNONE 
Os08g0121900AK101512CACTGACAGGProtein of unknown function DUF23 family protein. 
Os08g0157900012-025-H08CCACTGACAGGNONE 
012-069-E02CCACTGACAGGNONE 
012-074-H11CCACTGACAGGNONE 
AK065294CCACTGACAGGSimilar to NAM protein. 
J013002N10CCACTGACAGGNONE 
J013042J10CCACTGACAGGNONE 
J023060K03CCACTGACAGGNONE 
J023145N12CCACTGACAGGNONE 
J033040L20CCACTGACAGGNONE 
J033044L13CCACTGACAGGNONE 
J033057C19CCACTGACAGGNONE 
J033107E01CCACTGACAGGNONE 
J033123M07CCACTGACAGGNONE 
J033136I18CCACTGACAGGNONE 
J065051P18CCACTGACAGGNONE 
J065055L08CCACTGACAGGNONE 
J065196D15CCACTGACAGGNONE 
Os08g0191900AK067587CTGACAGGTGGGCCCCProtein prenyltransferase domain containing protein. 
AK099016CTGACAGGTGGGCCCCNONE 
J013032I08CTGACAGGTGGGCCCCNONE 
J013050I24CTGACAGGTGGGCCCCNONE 
J013128E05CTGACAGGTGGGCCCCNONE 
Os08g0282400AK100935ACTGACAGGSimilar to Alpha-SNAP (Fragment). 
Os08g0326600AK065219TGGGTCCCACCTGTCAGSimilar to GMP synthetase. 
Os08g0360100AK066365CCTGTCAGCGCCACGTCRS1/YhbY domain containing protein. 
Os08g0366100AK061882AGGTGGGCCCCACCTGTCAGNONE 
AK120339AGGTGGGCCCCACCTGTCAGSimilar to Endothelial differentiation-related factor 1 (EDF-1) (Multiprotein bridging factor 1) (MBF1). 
J013060M10AGGTGGGCCCCACCTGTCAGNONE 
J023135H23AGGTGGGCCCCACCTGTCAGNONE 
J033095L23AGGTGGGCCCCACCTGTCAGNONE 
J065010L09AGGTGGGCCCCACCTGTCAGNONE 
J065016A02AGGTGGGCCCCACCTGTCAGNONE 
J065041H14AGGTGGGCCCCACCTGTCAGNONE 
J065043F09AGGTGGGCCCCACCTGTCAGNONE 
J065045E03AGGTGGGCCCCACCTGTCAGNONE 
J065058F23AGGTGGGCCCCACCTGTCAGNONE 
J065075L19AGGTGGGCCCCACCTGTCAGNONE 
J065078N12AGGTGGGCCCCACCTGTCAGNONE 
J065105J19AGGTGGGCCCCACCTGTCAGNONE 
J065162I03AGGTGGGCCCCACCTGTCAGNONE 
J065164D10AGGTGGGCCCCACCTGTCAGNONE 
J065170B05AGGTGGGCCCCACCTGTCAGNONE 
J075039K19AGGTGGGCCCCACCTGTCAGNONE 
J075039M06AGGTGGGCCCCACCTGTCAGNONE 
J075057L17AGGTGGGCCCCACCTGTCAGNONE 
J075059F17AGGTGGGCCCCACCTGTCAGNONE 
J075109J04AGGTGGGCCCCACCTGTCAGNONE 
J075120B14AGGTGGGCCCCACCTGTCAGNONE 
J075153I11AGGTGGGCCCCACCTGTCAGNONE 
J075156C19AGGTGGGCCCCACCTGTCAGNONE 
J075166J20AGGTGGGCCCCACCTGTCAGNONE 
J090052H04AGGTGGGCCCCACCTGTCAGNONE 
J100051E13AGGTGGGCCCCACCTGTCAGNONE 
J100057L03AGGTGGGCCCCACCTGTCAGNONE 
J100059G23AGGTGGGCCCCACCTGTCAGNONE 
Os08g0379300AK103923CTGACAGGTGNONE 
Os08g0425800009-168-F06CCACTGACAGGTGGGTCCNONE 
AK061339CCACTGACAGGTGGGTCCConserved hypothetical protein. 
AK101198CCACTGACAGGTGGGTCCNONE 
J033030L06CCACTGACAGGTGGGTCCNONE 
J100036D08CCACTGACAGGTGGGTCCNONE 
J100052I22CCACTGACAGGTGGGTCCNONE 
Os08g0442300006-067-F05CTGACAGGNONE 
AK059843CTGACAGGNONE 
AK071719CTGACAGGSimilar to Calcineurin-like protein. 
AK102411CTGACAGGNONE 
J023108H11CTGACAGGNONE 
J033092P05CTGACAGGNONE 
J075109C09CTGACAGGNONE 
J090070B02CTGACAGGNONE 
J090076M14CTGACAGGNONE 
J100064B16CTGACAGGNONE 
Os08g0490100009-038-D02CTGACAGGTGGGACCCGNONE 
J065152E11CTGACAGGTGGGACCCGSimilar to PBF protein. 
J090050K03CTGACAGGTGGGACCCGNONE 
J090053L01CTGACAGGTGGGACCCGNONE 
Os08g0525000AK103220AGTGGGCCCCACCTGTCAGRas GTPase family protein. 
J033122O18AGTGGGCCCCACCTGTCAGNONE 
J065026M15AGTGGGCCCCACCTGTCAGNONE 
J075007I01AGTGGGCCCCACCTGTCAGNONE 
J075031E01AGTGGGCCCCACCTGTCAGNONE 
J075043N14AGTGGGCCCCACCTGTCAGNONE 
J075074O16AGTGGGCCCCACCTGTCAGNONE 
J075092O04AGTGGGCCCCACCTGTCAGNONE 
J075141D16AGTGGGCCCCACCTGTCAGNONE 
J075172C22AGTGGGCCCCACCTGTCAGNONE 
J075173A05AGTGGGCCCCACCTGTCAGNONE 
Os08g0532300009-122-A05CCTGTCAGTTTGTGGGCCCACCTNONE 
009-129-H05CCTGTCAGTTTGTGGGCCCACCTNONE 
AB011262CCTGTCAGTTTGTGGGCCCACCTNONE 
AK065141CCTGTCAGTTTGTGGGCCCACCTNONE 
AK119730CCTGTCAGTTTGTGGGCCCACCTSimilar to Nuclear transport factor 2 (NTF-2) (Allergen Cla h ?). 
J013002A14CCTGTCAGTTTGTGGGCCCACCTNONE 
J013042K23CCTGTCAGTTTGTGGGCCCACCTNONE 
J023057J08CCTGTCAGTTTGTGGGCCCACCTNONE 
J023057N10CCTGTCAGTTTGTGGGCCCACCTNONE 
J023113C21CCTGTCAGTTTGTGGGCCCACCTNONE 
J053054E03CCTGTCAGTTTGTGGGCCCACCTNONE 
J053062B07CCTGTCAGTTTGTGGGCCCACCTNONE 
J053075O17CCTGTCAGTTTGTGGGCCCACCTNONE 
J053075P09CCTGTCAGTTTGTGGGCCCACCTNONE 
J065024H05CCTGTCAGTTTGTGGGCCCACCTNONE 
J065049F22CCTGTCAGTTTGTGGGCCCACCTNONE 
J065063L03CCTGTCAGTTTGTGGGCCCACCTNONE 
J065102O07CCTGTCAGTTTGTGGGCCCACCTNONE 
J065104M12CCTGTCAGTTTGTGGGCCCACCTNONE 
J065119E04CCTGTCAGTTTGTGGGCCCACCTNONE 
J065153E10CCTGTCAGTTTGTGGGCCCACCTNONE 
J065168M24CCTGTCAGTTTGTGGGCCCACCTNONE 
J065173I10CCTGTCAGTTTGTGGGCCCACCTNONE 
J065181L04CCTGTCAGTTTGTGGGCCCACCTNONE 
J065184I18CCTGTCAGTTTGTGGGCCCACCTNONE 
J065203M15CCTGTCAGTTTGTGGGCCCACCTNONE 
J075004C21CCTGTCAGTTTGTGGGCCCACCTNONE 
J075047B11CCTGTCAGTTTGTGGGCCCACCTNONE 
J075055F18CCTGTCAGTTTGTGGGCCCACCTNONE 
J075065G09CCTGTCAGTTTGTGGGCCCACCTNONE 
J075094O14CCTGTCAGTTTGTGGGCCCACCTNONE 
J075143C22CCTGTCAGTTTGTGGGCCCACCTNONE 
J075153K18CCTGTCAGTTTGTGGGCCCACCTNONE 
J075164N10CCTGTCAGTTTGTGGGCCCACCTNONE 
J075197C11CCTGTCAGTTTGTGGGCCCACCTNONE 
J080001A01CCTGTCAGTTTGTGGGCCCACCTNONE 
J080003B11CCTGTCAGTTTGTGGGCCCACCTNONE 
J080006G17CCTGTCAGTTTGTGGGCCCACCTNONE 
J080007J06CCTGTCAGTTTGTGGGCCCACCTNONE 
J080010H12CCTGTCAGTTTGTGGGCCCACCTNONE 
J080014I01CCTGTCAGTTTGTGGGCCCACCTNONE 
J080015C16CCTGTCAGTTTGTGGGCCCACCTNONE 
J080016P19CCTGTCAGTTTGTGGGCCCACCTNONE 
J080020G24CCTGTCAGTTTGTGGGCCCACCTNONE 
J080021E12CCTGTCAGTTTGTGGGCCCACCTNONE 
J080023I11CCTGTCAGTTTGTGGGCCCACCTNONE 
J080024H24CCTGTCAGTTTGTGGGCCCACCTNONE 
J080025G18CCTGTCAGTTTGTGGGCCCACCTNONE 
J080028H08CCTGTCAGTTTGTGGGCCCACCTNONE 
J080030G08CCTGTCAGTTTGTGGGCCCACCTNONE 
J080031H20CCTGTCAGTTTGTGGGCCCACCTNONE 
J080034C20CCTGTCAGTTTGTGGGCCCACCTNONE 
J080040H13CCTGTCAGTTTGTGGGCCCACCTNONE 
J080044M04CCTGTCAGTTTGTGGGCCCACCTNONE 
J080047D02CCTGTCAGTTTGTGGGCCCACCTNONE 
J080049D17CCTGTCAGTTTGTGGGCCCACCTNONE 
J080049J17CCTGTCAGTTTGTGGGCCCACCTNONE 
J080050A05CCTGTCAGTTTGTGGGCCCACCTNONE 
J080051C11CCTGTCAGTTTGTGGGCCCACCTNONE 
J080051K06CCTGTCAGTTTGTGGGCCCACCTNONE 
J080053A07CCTGTCAGTTTGTGGGCCCACCTNONE 
J080053I08CCTGTCAGTTTGTGGGCCCACCTNONE 
J080056L12CCTGTCAGTTTGTGGGCCCACCTNONE 
J080061I19CCTGTCAGTTTGTGGGCCCACCTNONE 
J080075G09CCTGTCAGTTTGTGGGCCCACCTNONE 
J080078C23CCTGTCAGTTTGTGGGCCCACCTNONE 
J080080I21CCTGTCAGTTTGTGGGCCCACCTNONE 
J080084F04CCTGTCAGTTTGTGGGCCCACCTNONE 
J080085K16CCTGTCAGTTTGTGGGCCCACCTNONE 
J080097A12CCTGTCAGTTTGTGGGCCCACCTNONE 
J080097N01CCTGTCAGTTTGTGGGCCCACCTNONE 
J090027L10CCTGTCAGTTTGTGGGCCCACCTNONE 
J100034N17CCTGTCAGTTTGTGGGCCCACCTNONE 
Os08g0532400AK101608AGGTGGGCCCACAAACTGACAGGSimilar to AT.I.24-7 protein. 
Os08g0537900AK119425CACTGACAGGTGGGTCCNONE 
AY341827CACTGACAGGTGGGTCCSimilar to Ethylene-responsive transcription factor 3 (Ethylene-responsive element binding factor 3) (EREBP-3) (AtERF3). 
Os08g0547200AK101130AGTGACACTGACAGGTGGGCCCCACGRabGAP/TBC domain containing protein. 
AK101130CCACTGACAGGTGGGGCCCCACCRabGAP/TBC domain containing protein. 
AK119577AGTGACACTGACAGGTGGGCCCCACGNONE 
AK119577CCACTGACAGGTGGGGCCCCACCNONE 
Os08g0549200AK069066CCTGTCAGTGlycoside hydrolase, family 35 protein. 
J023007A22CCTGTCAGTNONE 
J023030P18CCTGTCAGTNONE 
J023056L18CCTGTCAGTNONE 
J023090P11CCTGTCAGTNONE 
J023104P10CCTGTCAGTNONE 
J023115M06CCTGTCAGTNONE 
Os09g0309500J100027L22CACTGACAGGGTGGGCCCGCConserved hypothetical protein. 
Os09g0363700AK103667CTGACAGGTGGGCCCCConserved hypothetical protein. 
J075001L14CTGACAGGTGGGCCCCNONE 
J075049M23CTGACAGGTGGGCCCCNONE 
J075051I04CTGACAGGTGGGCCCCNONE 
J075073L04CTGACAGGTGGGCCCCNONE 
J075077E03CTGACAGGTGGGCCCCNONE 
J075083J11CTGACAGGTGGGCCCCNONE 
J075094J22CTGACAGGTGGGCCCCNONE 
J075112E08CTGACAGGTGGGCCCCNONE 
J075137J23CTGACAGGTGGGCCCCNONE 
J075192E02CTGACAGGTGGGCCCCNONE 
J100039K04CTGACAGGTGGGCCCCNONE 
Os09g0426800AK060786ACTGACAGGTGNONE 
AK120227ACTGACAGGTGSimilar to Glossy1 protein. 
Os09g0438700006-093-A11CCTGTCAGNONE 
AK061837CCTGTCAGNONE 
AK098903CCTGTCAGSimilar to 20 kDa chaperonin, chloroplast precursor (Protein Cpn21) (Chloroplast protein Cpn10) (Chloroplast chaperonin 10) (Ch-CPN10) (Chaperonin 20). 
J013002C22CCTGTCAGNONE 
J065053C07CCTGTCAGNONE 
J065118J22CCTGTCAGNONE 
J065213B13CCTGTCAGNONE 
J075065H24CCTGTCAGNONE 
Os09g0457400012-003-H07CTGACAGGNONE 
012-011-F04CTGACAGGNONE 
012-033-D08CTGACAGGNONE 
012-034-F08CTGACAGGNONE 
012-038-H07CTGACAGGNONE 
012-042-D09CTGACAGGNONE 
012-045-D05CTGACAGGNONE 
012-050-G08CTGACAGGNONE 
012-054-A07CTGACAGGNONE 
012-058-F01CTGACAGGNONE 
012-074-F01CTGACAGGNONE 
012-077-F09CTGACAGGNONE 
012-097-F04CTGACAGGNONE 
012-097-H02CTGACAGGNONE 
016-015-E11CTGACAGGNONE 
016-054-B07CTGACAGGNONE 
016-058-B06CTGACAGGNONE 
016-079-D06CTGACAGGNONE 
AK063988CTGACAGGAlpha-amylase isozyme 3A precursor (EC 3.2.1.1) (1,4-alpha-D-glucan glucanohydrolase). 
AK099330CTGACAGGNONE 
AK099392CTGACAGGNONE 
J065001D14CTGACAGGNONE 
J065015G14CTGACAGGNONE 
J065017L14CTGACAGGNONE 
J065027P03CTGACAGGNONE 
J065036D10CTGACAGGNONE 
J065048K11CTGACAGGNONE 
J065052O20CTGACAGGNONE 
J065062D03CTGACAGGNONE 
J065062F04CTGACAGGNONE 
J065065N15CTGACAGGNONE 
J065066I23CTGACAGGNONE 
J065078C11CTGACAGGNONE 
J065080E16CTGACAGGNONE 
J065086D18CTGACAGGNONE 
J065087O07CTGACAGGNONE 
J065089L10CTGACAGGNONE 
J065092H11CTGACAGGNONE 
J065103P20CTGACAGGNONE 
J065104C17CTGACAGGNONE 
J065106G18CTGACAGGNONE 
J065112L18CTGACAGGNONE 
J065117L05CTGACAGGNONE 
J065119F12CTGACAGGNONE 
J065127C04CTGACAGGNONE 
J065130E06CTGACAGGNONE 
J065139L13CTGACAGGNONE 
J065165F06CTGACAGGNONE 
J065167J01CTGACAGGNONE 
J065185H04CTGACAGGNONE 
J065199K13CTGACAGGNONE 
J065201P09CTGACAGGNONE 
J065205J02CTGACAGGNONE 
J065211H18CTGACAGGNONE 
J065212F23CTGACAGGNONE 
J065214A09CTGACAGGNONE 
J065216O16CTGACAGGNONE 
J065217M24CTGACAGGNONE 
Os09g0477700AK121644CACTGACAGGTGGGTCCCACGGGConserved hypothetical protein. 
Os09g0482740006-098-F12CACTGACAGGTGGGCCCGNONE 
AK061852CACTGACAGGTGGGCCCGProtein of unknown function DUF1664 family protein. 
J013032I17CACTGACAGGTGGGCCCGNONE 
J013119L22CACTGACAGGTGGGCCCGNONE 
J065114C06CACTGACAGGTGGGCCCGNONE 
J090059O06CACTGACAGGTGGGCCCGNONE 
J090062K09CACTGACAGGTGGGCCCGNONE 
J100031O03CACTGACAGGTGGGCCCGNONE 
J100038P06CACTGACAGGTGGGCCCGNONE 
J100051M18CACTGACAGGTGGGCCCGNONE 
J100075H20CACTGACAGGTGGGCCCGNONE 
J100077O11CACTGACAGGTGGGCCCGNONE 
Os09g0518700AK064305ACTGACAGGNONE 
AK102571ACTGACAGGInositol 1, 3, 4-trisphosphate 56-kinase family protein. 
Os09g0527900AK122172TCTGGCCCCACCTGTCAGTGSimilar to Hd1-like protein. 
J033148H23TCTGGCCCCACCTGTCAGTGNONE 
J080070L07TCTGGCCCCACCTGTCAGTGNONE 
J090088G19TCTGGCCCCACCTGTCAGTGNONE 
Os09g0554000J065123C23CACTGACAGGTGGSimilar to Mitochondrial phosphate transporter. 
Os11g0142400AK067423CCTGTCAGStrictosidine synthase family protein. 
J013105O10CCTGTCAGNONE 
Os11g0187500012-002-D06CTGACAGGTGGGGCCNONE 
012-035-H04CTGACAGGTGGGGCCNONE 
012-065-F08CTGACAGGTGGGGCCNONE 
AK063977CTGACAGGTGGGGCCSimilar to Heat shock protein 70. 
AK103083CTGACAGGTGGGGCCNONE 
J033118G15CTGACAGGTGGGGCCNONE 
J065115E02CTGACAGGTGGGGCCNONE 
J065178K04CTGACAGGTGGGGCCNONE 
J065178L03CTGACAGGTGGGGCCNONE 
J090064A22CTGACAGGTGGGGCCNONE 
Os11g0481600AK109900CCTGTCAGConserved hypothetical protein. 
Os11g0539800AK105673CCTGTCAGSimilar to Xaa-Pro aminopeptidase 1. 
Os11g0568300016-075-B02CCACCTGTCAGNONE 
AK064398CCACCTGTCAGHMG-I and HMG-Y, DNA-binding domain containing protein. 
AK103282CCACCTGTCAGNONE 
J033124M10CCACCTGTCAGNONE 
J065120I21CCACCTGTCAGNONE 
J065144H16CCACCTGTCAGNONE 
Os11g0580000AK119421CTGACAGGTGGGCCCCAGArmadillo-like helical domain containing protein. 
AK121905CTGACAGGTGGGCCCCAGNONE 
J033105I06CTGACAGGTGGGCCCCAGNONE 
J090022C10CTGACAGGTGGGCCCCAGNONE 
J090024J23CTGACAGGTGGGCCCCAGNONE 
J090044F24CTGACAGGTGGGCCCCAGNONE 
Os11g0672900014-017-A02GGTCCCACCTGTCAGNONE 
AK105350GGTCCCACCTGTCAGProtein of unknown function DUF1645 family protein. 
Os12g0114000009-177-C09CCTGTCAGNONE 
AK063119CCTGTCAGHypothetical protein. 
J065113E12CCTGTCAGNONE 
Os12g0141000J065041B13CCTGTCAGConserved hypothetical protein. 
J065110D03CCTGTCAGNONE 
J065183O10CCTGTCAGNONE 
Os12g0168000AK065623GGTCCCACCTGTCAGTG5-formyltetrahydrofolate cyclo-ligase family protein. 
AK072953GGTCCCACCTGTCAGTGNONE 
J100024I20GGTCCCACCTGTCAGTGNONE 
Os12g0197400J013068J02CTGGGGCCCACCTGTCAGNONE 
J013074K04CTGGGGCCCACCTGTCAGNONE 
J013089J21CTGGGGCCCACCTGTCAGNONE 
J013170B12CTGGGGCCCACCTGTCAGNONE 
J033029L11CTGGGGCCCACCTGTCAGNONE 
J033051A07CTGGGGCCCACCTGTCAGGTP-binding protein, HSR1-related domain containing protein. 
J033092L18CTGGGGCCCACCTGTCAGNONE 
J065101D01CTGGGGCCCACCTGTCAGNONE 
J065144J23CTGGGGCCCACCTGTCAGNONE 
J065206D18CTGGGGCCCACCTGTCAGNONE 
Os12g0244000AK106408GGCCCCACCTGTCAGHypothetical protein. 
Os12g0297500AK072331CCTGTCAGTGlycoside hydrolase, starch-binding domain containing protein. 
Os12g0472800AK063278AGGGCCCACCTGTCAGB repeat unit of collagen binding surface protein (cna) containing protein. 
Os12g0500700AK073408CCCACCTGTCAGTSimilar to Vacuolar sorting protein-like; embryogenesis protein H beta 58-like protein. 
Os12g0503200014-087-C11CCTGTCAGTGGNONE 
AK105377CCTGTCAGTGGNONE 
Os12g0599900AK101252ATGGCCCACCTGTCAGTetratricopeptide region domain containing protein. 
J033032F05ATGGCCCACCTGTCAGNONE 
Os12g0605800AK121511CTGACAGGTGGGTCCCACTCCSimilar to 3-methylcrotonyl CoA carboxylase biotin-containing subunit (Fragment). 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.