version

Summary of OsREG552 (All List)

OrganismOryza sativa  
IDOsREG552  
SequenceCGACCCGC  
Annotation  
PPDB Motif 
PLACE Motif 
Total Entry Count428  

Entry Sequences (428 entries)

LocusGene modelSequenceDescription
Os01g0227200AK103247CGACCCGCSimilar to Somatic embryogenesis receptor kinase-like protein. 
Os01g0232400AK101990CGACCCGCSimilar to VHS1 protein (Fragment). 
AK106519CGACCCGCNONE 
Os01g0314300AK073419CGACCCGCUncharacterized domain 2 containing protein. 
AK104939CGACCCGCNONE 
J033044B03CGACCCGCNONE 
J033060E12CGACCCGCNONE 
J043037E21CGACCCGCNONE 
J065019O18CGACCCGCNONE 
J065025P22CGACCCGCNONE 
J065042P06CGACCCGCNONE 
J065074C19CGACCCGCNONE 
J065074E13CGACCCGCNONE 
J065094E05CGACCCGCNONE 
J065108N08CGACCCGCNONE 
J065134L13CGACCCGCNONE 
J065152N24CGACCCGCNONE 
J065162N24CGACCCGCNONE 
J065170P16CGACCCGCNONE 
J065177M20CGACCCGCNONE 
J065187N01CGACCCGCNONE 
J075012N12CGACCCGCNONE 
J075046C17CGACCCGCNONE 
J075055N06CGACCCGCNONE 
J075141H03CGACCCGCNONE 
J075150M11CGACCCGCNONE 
J090005B16CGACCCGCNONE 
J090079L11CGACCCGCNONE 
J100039F16CGACCCGCNONE 
Os01g0545100AK065915CGACCCGCConserved hypothetical protein. 
Os01g0593600AK069058CGACCCGCConserved hypothetical protein. 
J023004I01CGACCCGCNONE 
Os01g0673500AK065017GCGGGTCGSimilar to Katanin p60 ATPase-containing subunit A1 (EC 3.6.4.3) (Katanin p60 subunit A1) (p60 katanin). Splice isoform 2. 
AK069899GCGGGTCGNONE 
Os01g0691500AK073675CGACCCGCNONE 
AK107426CGACCCGCCytidylyltransferase domain containing protein. 
J013055P17CGACCCGCNONE 
J033050M21CGACCCGCNONE 
Os01g0705200011-075-B10CGACCCGCGCNONE 
014-056-F05CGACCCGCGCNONE 
014-072-F08CGACCCGCGCNONE 
014-082-E10CGACCCGCGCNONE 
014-085-E10CGACCCGCGCNONE 
AK064074CGACCCGCGCLate embryogenesis abundant protein repeat containing protein. 
AK073837CGACCCGCGCNONE 
D26536CGACCCGCGCNONE 
J033070H10CGACCCGCGCNONE 
J065138A19CGACCCGCGCNONE 
J065140A10CGACCCGCGCNONE 
Os01g0727100AK068181CGACCCGCGlycosyl transferase, family 8 protein. 
AK105758CGACCCGCNONE 
J013126C21CGACCCGCNONE 
J023049F24CGACCCGCNONE 
J033140G15CGACCCGCNONE 
Os01g0780900J033069J11CGACCCGCNONE 
J065054P18CGACCCGCNONE 
J065163O05CGACCCGCNONE 
J065165B05CGACCCGCNONE 
J075097O22CGACCCGCNONE 
J080029E07CGACCCGCNONE 
J080093M08CGACCCGCNONE 
J100025J07CGACCCGCNONE 
J100029N22CGACCCGCNONE 
J100041C23CGACCCGCConserved hypothetical protein. 
J100041M22CGACCCGCNONE 
J100058D11CGACCCGCNONE 
J100064E15CGACCCGCNONE 
J100066M09CGACCCGCNONE 
J100067H14CGACCCGCNONE 
Os01g0793200AK059040CGACCCGCProtein prenyltransferase domain containing protein. 
Os01g0849000009-080-E02CGACCCGCNONE 
009-133-A08CGACCCGCNONE 
009-133-G02CGACCCGCNONE 
009-135-F03CGACCCGCNONE 
009-138-H06CGACCCGCNONE 
009-172-G03CGACCCGCNONE 
009-182-E02CGACCCGCNONE 
009-199-C04CGACCCGCNONE 
AK062916CGACCCGCNONE 
AK105208CGACCCGCPlant lipid transfer protein/Par allergen family protein. 
Os01g0934300AK072640CGACCCGCNONE 
J013073H18CGACCCGCNONE 
J023133P13CGACCCGCNONE 
J075098G20CGACCCGCNONE 
Os01g0939200AK110814CGACCCGCGCConserved hypothetical protein. 
Os02g0150100AK060595CGACCCGCSimilar to DEAD-box protein abstrakt. 
Os02g0186500AK068056CGCCACGTGTCCGACCCGCSimilar to Protein kinase-like protein. 
AK099031CGCCACGTGTCCGACCCGCNONE 
J013111A12CGCCACGTGTCCGACCCGCNONE 
J013127K13CGCCACGTGTCCGACCCGCNONE 
J013132O11CGCCACGTGTCCGACCCGCNONE 
J023056A11CGCCACGTGTCCGACCCGCNONE 
J023078M08CGCCACGTGTCCGACCCGCNONE 
J033081F07CGCCACGTGTCCGACCCGCNONE 
J090079E24CGCCACGTGTCCGACCCGCNONE 
J090097I02CGCCACGTGTCCGACCCGCNONE 
Os02g0521300AK120851GCGGGTCGC2 domain containing protein. 
Os02g0562300AK073250CGACCCGCGCCalmodulin binding protein-like family protein. 
Os02g0601800AB060276GACGGCCCGGATCCGACCCGCNONE 
AK099539GACGGCCCGGATCCGACCCGCNONE 
AK101873GACGGCCCGGATCCGACCCGCBromodomain containing protein. 
AK106801GACGGCCCGGATCCGACCCGCNONE 
AK121758GACGGCCCGGATCCGACCCGCNONE 
AK121891GACGGCCCGGATCCGACCCGCNONE 
J013059H01GACGGCCCGGATCCGACCCGCNONE 
J013092F08GACGGCCCGGATCCGACCCGCNONE 
J013146J04GACGGCCCGGATCCGACCCGCNONE 
J023001K12GACGGCCCGGATCCGACCCGCNONE 
J023002H16GACGGCCCGGATCCGACCCGCNONE 
J023013B10GACGGCCCGGATCCGACCCGCNONE 
J023081I22GACGGCCCGGATCCGACCCGCNONE 
J023084K19GACGGCCCGGATCCGACCCGCNONE 
J023150E24GACGGCCCGGATCCGACCCGCNONE 
J033023B18GACGGCCCGGATCCGACCCGCNONE 
J033025F18GACGGCCCGGATCCGACCCGCNONE 
J033048P08GACGGCCCGGATCCGACCCGCNONE 
J033060M24GACGGCCCGGATCCGACCCGCNONE 
J033070G06GACGGCCCGGATCCGACCCGCNONE 
J033088P12GACGGCCCGGATCCGACCCGCNONE 
J033105C13GACGGCCCGGATCCGACCCGCNONE 
J043009N18GACGGCCCGGATCCGACCCGCNONE 
J065103G21GACGGCCCGGATCCGACCCGCNONE 
J075039H15GACGGCCCGGATCCGACCCGCNONE 
J090014K10GACGGCCCGGATCCGACCCGCNONE 
J090022N02GACGGCCCGGATCCGACCCGCNONE 
J090033F18GACGGCCCGGATCCGACCCGCNONE 
J090033I04GACGGCCCGGATCCGACCCGCNONE 
J090041F11GACGGCCCGGATCCGACCCGCNONE 
J090045P20GACGGCCCGGATCCGACCCGCNONE 
J090054B01GACGGCCCGGATCCGACCCGCNONE 
J090055M12GACGGCCCGGATCCGACCCGCNONE 
J090071K09GACGGCCCGGATCCGACCCGCNONE 
J090098O16GACGGCCCGGATCCGACCCGCNONE 
J090099P15GACGGCCCGGATCCGACCCGCNONE 
J100050I16GACGGCCCGGATCCGACCCGCNONE 
Os02g0610500AK058536GCGCGGGTCGGACGGSimilar to CONSTANS-like protein CO9 (Fragment). 
AK100097GCGCGGGTCGGACGGNONE 
J090016D17GCGCGGGTCGGACGGNONE 
J090077O10GCGCGGGTCGGACGGNONE 
J090097J09GCGCGGGTCGGACGGNONE 
J100054K15GCGCGGGTCGGACGGNONE 
J100066N13GCGCGGGTCGGACGGNONE 
J100072H14GCGCGGGTCGGACGGNONE 
Os02g0681200006-024-F11CCAAGCCCACGACCCGCACCGCNONE 
006-051-H06CCAAGCCCACGACCCGCACCGCNONE 
006-062-F08CCAAGCCCACGACCCGCACCGCNONE 
009-172-G01CCAAGCCCACGACCCGCACCGCNONE 
AK071853CCAAGCCCACGACCCGCACCGCZinc finger, RING-type domain containing protein. 
AK099314CCAAGCCCACGACCCGCACCGCNONE 
AK104122CCAAGCCCACGACCCGCACCGCNONE 
Os02g0686700AK111294GCGGGTCGProtein of unknown function DUF581 family protein. 
Os02g0782100AK065421CGGCTCGGCGGGTCGChorismate synthase family protein. 
J065038A03CGGCTCGGCGGGTCGNONE 
Os02g0796300006-087-C02CGACCCGCNONE 
AK061820CGACCCGCNONE 
AK073025CGACCCGCNONE 
AK119386CGACCCGCSimilar to CCR4-NOT transcription complex subunit 7 (CCR4-associated factor 1) (CAF1) (BTG1 binding factor 1). 
J013033A22CGACCCGCNONE 
J013096K18CGACCCGCNONE 
J023072E02CGACCCGCNONE 
J023113M08CGACCCGCNONE 
J023149N08CGACCCGCNONE 
Os02g0811800011-036-F07CGACCCGCNONE 
AK063935CGACCCGCSimilar to Cinnamoyl-CoA reductase (EC 1.2.1.44). 
AK119257CGACCCGCNONE 
J033022E13CGACCCGCNONE 
J033023F12CGACCCGCNONE 
J033028M20CGACCCGCNONE 
J033035L05CGACCCGCNONE 
J033043C20CGACCCGCNONE 
J033051O11CGACCCGCNONE 
J033071L10CGACCCGCNONE 
J033084E05CGACCCGCNONE 
J033101O21CGACCCGCNONE 
J033108A10CGACCCGCNONE 
J033115N15CGACCCGCNONE 
J033116N18CGACCCGCNONE 
J033117A11CGACCCGCNONE 
J033121C24CGACCCGCNONE 
J033131H15CGACCCGCNONE 
J033136O11CGACCCGCNONE 
J033138D20CGACCCGCNONE 
J033147C09CGACCCGCNONE 
J043036O15CGACCCGCNONE 
Os03g0278200AK103544GCGGGTCGNAD-dependent epimerase/dehydratase family protein. 
Os03g0586300AK100442CGACCCGCReticulon family protein. 
J023031G06CGACCCGCNONE 
J023089N19CGACCCGCNONE 
J023099N13CGACCCGCNONE 
J065026N17CGACCCGCNONE 
J065045N16CGACCCGCNONE 
J065163L12CGACCCGCNONE 
Os03g0685600AK111863CCCGGCCCCGACCCGCWD40-like domain containing protein. 
AK111863CGACCCGCWD40-like domain containing protein. 
Os03g0705300AK102312GCGGGTCGNONE 
Os03g0708400006-108-F11CGACCCGCGCNONE 
AK066216CGACCCGCGCProtein of unknown function DUF1295 family protein. 
Os03g0797700005-001-F11CGACCCGCNONE 
AK061648CGACCCGCConserved hypothetical protein. 
AK098876CGACCCGCNONE 
J013001D18CGACCCGCNONE 
J033070I21CGACCCGCNONE 
J065124F13CGACCCGCNONE 
J065218D02CGACCCGCNONE 
J090080A22CGACCCGCNONE 
J100032P18CGACCCGCNONE 
Os03g0822100AK101094CAAGTGGGGCGGGTCGSimilar to Transposase (Fragment). 
J033024N05CAAGTGGGGCGGGTCGNONE 
Os04g0174800J080313L24CGACCCGCNONE 
J080318C03CGACCCGCNONE 
Os04g0457700J075145N15GCGGGTCGConserved hypothetical protein. 
Os04g0502900AK059306CGACCCGCEF-Hand type domain containing protein. 
AK099122CGACCCGCNONE 
Os04g0602400AK071005CGACCCGCSimilar to Maltose excess protein 1, chloroplast precursor (Root cap protein 1). 
J023078D11CGACCCGCNONE 
Os04g0619500011-051-B09CGACCCGCNONE 
016-006-B12CGACCCGCNONE 
016-012-H10CGACCCGCNONE 
AK066247CGACCCGCOvarian tumour, otubain domain containing protein. 
J013052H21CGACCCGCNONE 
J033136I05CGACCCGCNONE 
J090080J12CGACCCGCNONE 
J100065N24CGACCCGCNONE 
J100087L02CGACCCGCNONE 
Os05g0155100006-075-B02CGACCCGCNONE 
AK061929CGACCCGCNONE 
AK102810CGACCCGCNONE 
AK120877CGACCCGCSimilar to 60S ribosomal protein L18. 
J013023E03CGACCCGCNONE 
J013038C16CGACCCGCNONE 
J013120M14CGACCCGCNONE 
J013153B04CGACCCGCNONE 
J013159B07CGACCCGCNONE 
J023012A02CGACCCGCNONE 
J023027F08CGACCCGCNONE 
J023027I12CGACCCGCNONE 
J023120F05CGACCCGCNONE 
J023138O03CGACCCGCNONE 
J023142H13CGACCCGCNONE 
J023143P06CGACCCGCNONE 
J033023P09CGACCCGCNONE 
J033035O14CGACCCGCNONE 
J033042N19CGACCCGCNONE 
J033043B12CGACCCGCNONE 
J033065D10CGACCCGCNONE 
J033081A12CGACCCGCNONE 
J033084N05CGACCCGCNONE 
J033085M03CGACCCGCNONE 
J033112D15CGACCCGCNONE 
J033114O07CGACCCGCNONE 
J033119D15CGACCCGCNONE 
J033140E06CGACCCGCNONE 
J033141K23CGACCCGCNONE 
J043040I22CGACCCGCNONE 
J053050B21CGACCCGCNONE 
J053065I18CGACCCGCNONE 
J053074O16CGACCCGCNONE 
J065072K13CGACCCGCNONE 
J065211I09CGACCCGCNONE 
J090004K04CGACCCGCNONE 
J090016L06CGACCCGCNONE 
J090040F22CGACCCGCNONE 
J090063F22CGACCCGCNONE 
J090081J09CGACCCGCNONE 
J100032A10CGACCCGCNONE 
J100037G20CGACCCGCNONE 
J100056O10CGACCCGCNONE 
J100071D10CGACCCGCNONE 
J100075K13CGACCCGCNONE 
J100079F16CGACCCGCNONE 
J100080O16CGACCCGCNONE 
J100086N05CGACCCGCNONE 
Os05g0406800AK062566GCGGGTCGNONE 
AK099640GCGGGTCGLeucine rich repeat, N-terminal domain containing protein. 
J013060B14GCGGGTCGNONE 
J090013F14GCGGGTCGNONE 
J090062E13GCGGGTCGNONE 
J090063D09GCGGGTCGNONE 
J090075H10GCGGGTCGNONE 
J090096E22GCGGGTCGNONE 
Os05g0437200014-036-D04CGACCCGCGCNONE 
AK059283CGACCCGCGCNONE 
AK121867CGACCCGCGCProtein of unknown function DUF502 family protein. 
Os05g0514300AK061747CGACCCGCSimilar to Tubby-like protein 3. 
AK098851CGACCCGCNONE 
Os05g0540900006-038-F02GCGGGTCGNONE 
AK060489GCGGGTCGNONE 
AK072284GCGGGTCGConserved hypothetical protein. 
Os06g0153200AK072625CGACCCGCNONE 
AK106752CGACCCGCProtein of unknown function DUF250 domain containing protein. 
Os06g0308300AK059211CGACCCGCGCNONE 
AK101549CGACCCGCGCNONE 
AK102553CGACCCGCGCSimilar to 65kD microtubule associated protein. 
J090014G18CGACCCGCGCNONE 
J090082B01CGACCCGCGCNONE 
Os06g0325700AK111131CGACCCGCConserved hypothetical protein. 
Os06g0602600AK121619CGACCCGCAlba, DNA/RNA-binding protein family protein. 
J033044O03CGACCCGCNONE 
J043036G04CGACCCGCNONE 
J075107E08CGACCCGCNONE 
J090060N14CGACCCGCNONE 
J090094K04CGACCCGCNONE 
Os06g0639000AK102470CGACCCGCNONE 
J013106M02CGACCCGCNONE 
J100051K23CGACCCGCNONE 
Os06g0709100AK059732GCGGGTCGNONE 
AK070881GCGGGTCGCyclin-like F-box domain containing protein. 
AK103683GCGGGTCGNONE 
Os07g0567700006-108-A09CGACCCGCGCNONE 
AK061242CGACCCGCGCSimilar to SCARECROW. 
AK120140CGACCCGCGCNONE 
J075098N22CGACCCGCGCNONE 
J075194P18CGACCCGCGCNONE 
J080054H07CGACCCGCGCNONE 
Os07g0568300AK067784GCGGGTCGNONE 
AK067895GCGGGTCGSimilar to ZF protein (Fragment). 
J013119M01GCGGGTCGNONE 
J013120B09GCGGGTCGNONE 
J013123G12GCGGGTCGNONE 
J023012C12GCGGGTCGNONE 
J023020G17GCGGGTCGNONE 
J023037E23GCGGGTCGNONE 
J033076I01GCGGGTCGNONE 
J033108A07GCGGGTCGNONE 
J033138J02GCGGGTCGNONE 
J075033L09GCGGGTCGNONE 
J075049E02GCGGGTCGNONE 
J075060N23GCGGGTCGNONE 
J075094H13GCGGGTCGNONE 
J075179L18GCGGGTCGNONE 
J080005P09GCGGGTCGNONE 
J080044J03GCGGGTCGNONE 
J080062G20GCGGGTCGNONE 
J080063L23GCGGGTCGNONE 
J080065B16GCGGGTCGNONE 
J080071K09GCGGGTCGNONE 
J080089C23GCGGGTCGNONE 
J090008P21GCGGGTCGNONE 
J090046B22GCGGGTCGNONE 
J090094C19GCGGGTCGNONE 
J090096B19GCGGGTCGNONE 
J100060G03GCGGGTCGNONE 
J100082D16GCGGGTCGNONE 
Os07g0657600J065001N02CGACCCGCNONE 
J065002E03CGACCCGCDNA glycosylase family protein. 
Os08g0119500J080315K03CGACCCGCGCMethyltransferase type 11 domain containing protein. 
Os08g0160600AK106763GCGGGTCGConserved hypothetical protein. 
Os08g0374800012-075-F07CGACCCGCNONE 
AB096863CGACCCGCNONE 
AK066269CGACCCGCSimilar to UDP-galactose 4-epimerase-like protein. 
J013059D16CGACCCGCNONE 
J033132O05CGACCCGCNONE 
J065044E20CGACCCGCNONE 
J065139E23CGACCCGCNONE 
J075065B03CGACCCGCNONE 
J090050M10CGACCCGCNONE 
J090094F08CGACCCGCNONE 
J100031C21CGACCCGCNONE 
J100050I23CGACCCGCNONE 
J100081I16CGACCCGCNONE 
Os08g0465800AY428025CGACCCGCNONE 
J013029M24CGACCCGCNONE 
J013030K15CGACCCGCNONE 
J013048G12CGACCCGCNONE 
J023041H10CGACCCGCNONE 
J023065G12CGACCCGCNONE 
J023074A02CGACCCGCNONE 
J023092B20CGACCCGCNONE 
J023147A01CGACCCGCNONE 
J023150L07CGACCCGCNONE 
J043007P21CGACCCGCNONE 
J090004P19CGACCCGCNONE 
J100030K13CGACCCGCNONE 
J100060N03CGACCCGCNONE 
Os08g0564300015-019-C05GCGGGTCGNONE 
AK063134GCGGGTCGNONE 
AK106260GCGGGTCGNONE 
AK119880GCGGGTCGABC transporter, transmembrane region domain containing protein. 
AK121506GCGGGTCGNONE 
J033022P13GCGGGTCGNONE 
Os08g0565200AK108143GCGGGTCGPathogenesis-related transcriptional factor and ERF domain containing protein. 
Os09g0434900AK109104CGACCCGCNONE 
AK120863CGACCCGCZinc finger, RING-type domain containing protein. 
Os09g0453800AK119212GACTCGACCCGCNONE 
J023081A04GACTCGACCCGCNONE 
J065180G14GACTCGACCCGCNONE 
J100024A17GACTCGACCCGCNONE 
J100030A05GACTCGACCCGCNONE 
J100042I11GACTCGACCCGCNONE 
J100054N05GACTCGACCCGCNONE 
J100075G23GACTCGACCCGCNONE 
Os09g0493700015-091-G11GCGGGTCGCGCGNONE 
AK068501GCGGGTCGCGCGSimilar to CUC2. 
AK099237GCGGGTCGCGCGNONE 
J013155B08GCGGGTCGCGCGNONE 
J023006E01GCGGGTCGCGCGNONE 
J023060K23GCGGGTCGCGCGNONE 
J023100B11GCGGGTCGCGCGNONE 
J033026L19GCGGGTCGCGCGNONE 
J033129J12GCGGGTCGCGCGNONE 
J033149K09GCGGGTCGCGCGNONE 
J065045I06GCGGGTCGCGCGNONE 
J065061A10GCGGGTCGCGCGNONE 
J065101H05GCGGGTCGCGCGNONE 
J065135A03GCGGGTCGCGCGNONE 
J065169C16GCGGGTCGCGCGNONE 
J100047C11GCGGGTCGCGCGNONE 
J100047K07GCGGGTCGCGCGNONE 
Os09g0521700014-005-C08GCGGGTCGCTGGGCCTCNONE 
AK063628GCGGGTCGCTGGGCCTCSimilar to H/ACA ribonucleoprotein complex subunit 1 (Nucleolar protein family A member 1) (snoRNP protein GAR1). 
AK064507GCGGGTCGCTGGGCCTCNONE 
Os12g0143150009-090-F09CGACCCGCUbiquitin domain containing protein. 
J013121D01CGACCCGCNONE 
J065129G09CGACCCGCNONE 
J080311D13CGACCCGCNONE 
J090014O10CGACCCGCNONE 
J090045E21CGACCCGCNONE 
J100047D12CGACCCGCNONE 
Os12g0194800011-016-B07GCGGGTCGNONE 
AK101810GCGGGTCGtRNA pseudouridine synthase family protein. 
AK107780GCGGGTCGNONE 
J043034C07GCGGGTCGNONE 
Os12g0235800AK058700CGACCCGCNONE 
Os12g0481100AK073151CGACCCGCSimilar to RNA helicase. 
Os12g0535900006-061-F02GCGCGGGTCGNONE 
AK069422GCGCGGGTCGPlus-3 domain containing protein. 
AK109358GCGCGGGTCGNONE 
Os12g0634900AK106811CGACCCGCTetratricopeptide-like helical domain containing protein. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.