version

Summary of OsREG553 (All List)

OrganismOryza sativa  
IDOsREG553  
SequenceCGATGGGC  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count686  

Entry Sequences (686 entries)

LocusGene modelSequenceDescription
Os01g0100700006-066-G10CGATGGGCNONE 
009-108-B10CGATGGGCNONE 
AK059844CGATGGGCNONE 
AK121523CGATGGGCSimilar to 40S ribosomal protein S5-1. 
J023037D16CGATGGGCNONE 
J033028P14CGATGGGCNONE 
J033064M07CGATGGGCNONE 
J033123M01CGATGGGCNONE 
J065026O07CGATGGGCNONE 
J065082A05CGATGGGCNONE 
J075003I02CGATGGGCNONE 
J075170J15CGATGGGCNONE 
J100040D18CGATGGGCNONE 
Os01g0183500J075016J09CGATGGGCTNONE 
J075041H05CGATGGGCTCytochrome P450 family protein. 
J075165D22CGATGGGCTNONE 
Os01g0208600003-002-E10GCCCATCGNONE 
003-002-E10GCCCATCGNONE 
Os01g0590200011-100-E06CGATGGGCTGGNONE 
012-005-A05CGATGGGCTGGNONE 
AK063416CGATGGGCTGGConserved hypothetical protein. 
AK099235CGATGGGCTGGNONE 
AK105022CGATGGGCTGGNONE 
J065030D21CGATGGGCTGGNONE 
J065031C10CGATGGGCTGGNONE 
J065105A22CGATGGGCTGGNONE 
J065173M19CGATGGGCTGGNONE 
J075188F15CGATGGGCTGGNONE 
J090050C15CGATGGGCTGGNONE 
J100058K07CGATGGGCTGGNONE 
Os01g0633400AK108988TTGGCCCATCGTGGCCCAGTACBS domain containing protein. 
Os01g0651100AK119380CCCACGCGCCCATCGCCCACCACProtein prenyltransferase domain containing protein. 
Os01g0719250AK105184CGATGGGCConserved hypothetical protein. 
Os01g0773200015-072-C12CGATGGGCTNONE 
Os01g0776700J065046N20ACAGCCCATCGConserved hypothetical protein. 
J100086L02ACAGCCCATCGNONE 
Os01g0788500AK120325GCCCATCGSimilar to Disease resistance gene analog PIC21 (Fragment). 
J013057M10GCCCATCGNONE 
J013149E08GCCCATCGNONE 
J033022H20GCCCATCGNONE 
J065117B18GCCCATCGNONE 
J075105E06GCCCATCGNONE 
Os01g0850400AJ575220CGATGGGCTNONE 
AK108582CGATGGGCTSimilar to MYBY1 protein (Fragment). 
Os01g0869200AK073453GCCCATCGMg2+ transporter protein, CorA-like family protein. 
Os01g0876500J053026A07CGATGGGCCGTGRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J053076M17CGATGGGCCGTGNONE 
Os01g0921000AK071688CGATGGGCTConserved hypothetical protein. 
Os01g0946200AK071060CGATGGGCTNo apical meristem (NAM) protein domain containing protein. 
J023080K20CGATGGGCTNONE 
Os01g0954400003-009-F12CGATGGGCCAGNONE 
012-080-B09CGATGGGCCAGNONE 
AK065709CGATGGGCCAGSimilar to Hydroxyproline-rich glycoprotein DZ-HRGP precursor. 
AK104335CGATGGGCCAGNONE 
J013039J02CGATGGGCCAGNONE 
J033081E17CGATGGGCCAGNONE 
J075058B02CGATGGGCCAGNONE 
J075067K19CGATGGGCCAGNONE 
J075120E23CGATGGGCCAGNONE 
J075147I16CGATGGGCCAGNONE 
Os02g0177500009-106-B06AAATGGGCTGTGGCCCATCGNONE 
AK062715AAATGGGCTGTGGCCCATCGSimilar to Small nuclear ribonucleoprotein F (snRNP-F) (Sm protein F) (Sm-F) (SmF). 
J065049F10AAATGGGCTGTGGCCCATCGNONE 
J065063L16AAATGGGCTGTGGCCCATCGNONE 
J065102P06AAATGGGCTGTGGCCCATCGNONE 
J065137A16AAATGGGCTGTGGCCCATCGNONE 
J065212M11AAATGGGCTGTGGCCCATCGNONE 
Os02g0187600AK069783CGATGGGCCGCANONE 
AK109387CGATGGGCCGCAConserved hypothetical protein. 
J090029C18CGATGGGCCGCANONE 
Os02g0227400AK103143CGATGGGCATCCAACGNONE 
AY785765CGATGGGCATCCAACGPoly(A) polymerase, central region domain containing protein. 
Os02g0288100AK107019AGCCCATCGSimilar to Pectinesterase (EC 3.1.1.11) (Fragment). 
Os02g0312700AK072956CGATGGGCCGTGATP11 family protein. 
AK102909CGATGGGCCGTGNONE 
J065017G18CGATGGGCCGTGNONE 
J075066A05CGATGGGCCGTGNONE 
Os02g0498100009-180-H04ATGGCCCATCGNONE 
AK112058ATGGCCCATCGConserved hypothetical protein. 
Os02g0568100AK107582AGCCCATCGSimilar to Non-phototropic hypocotyl 3. 
Os02g0573400Os02g0573400CAAGTGGGCCCATCGPeptidase C19, ubiquitin carboxyl-terminal hydrolase 2 family protein. 
Os02g0656500011-045-C08AGCCCATCGNONE 
011-045-E06AGCCCATCGNONE 
016-046-A01AGCCCATCGNONE 
016-046-B01AGCCCATCGNONE 
AK062239AGCCCATCGNONE 
AK066420AGCCCATCGDnaJ-like protein. 
J013067J21AGCCCATCGNONE 
J065047L09AGCCCATCGNONE 
J065104M20AGCCCATCGNONE 
J065134B04AGCCCATCGNONE 
J065152C10AGCCCATCGNONE 
J065161O03AGCCCATCGNONE 
J065169F18AGCCCATCGNONE 
J065210M21AGCCCATCGNONE 
J065217B03AGCCCATCGNONE 
J065218C10AGCCCATCGNONE 
J075041F09AGCCCATCGNONE 
J075048A02AGCCCATCGNONE 
J075083F21AGCCCATCGNONE 
J080005F10AGCCCATCGNONE 
J080013P21AGCCCATCGNONE 
J080027J09AGCCCATCGNONE 
J080037O17AGCCCATCGNONE 
J080039F02AGCCCATCGNONE 
J080039G01AGCCCATCGNONE 
J080041I09AGCCCATCGNONE 
J080043M01AGCCCATCGNONE 
J080060H17AGCCCATCGNONE 
J080062O07AGCCCATCGNONE 
J080079F05AGCCCATCGNONE 
J080093H04AGCCCATCGNONE 
J080096B15AGCCCATCGNONE 
J080097H24AGCCCATCGNONE 
J090032O11AGCCCATCGNONE 
J090044F01AGCCCATCGNONE 
J090045E04AGCCCATCGNONE 
J090048O03AGCCCATCGNONE 
J090049E04AGCCCATCGNONE 
J090070E19AGCCCATCGNONE 
J090079E13AGCCCATCGNONE 
J090089L14AGCCCATCGNONE 
J090095K13AGCCCATCGNONE 
J090096I19AGCCCATCGNONE 
J090098B04AGCCCATCGNONE 
J100027P13AGCCCATCGNONE 
J100048H06AGCCCATCGNONE 
J100060J15AGCCCATCGNONE 
J100070K16AGCCCATCGNONE 
J100074O22AGCCCATCGNONE 
Os02g0767900009-154-G01AGGTGGGCCTAGCCCATCGNONE 
009-172-H09AGGTGGGCCTAGCCCATCGNONE 
AK099885AGGTGGGCCTAGCCCATCGGlutaredoxin 2 family protein. 
Os02g0830100J013032G02CGATGGGCCCACCACNONE 
J013052O21CGATGGGCCCACCACNONE 
J023078A05CGATGGGCCCACCACNONE 
J033114C07CGATGGGCCCACCACNONE 
J033125M07CGATGGGCCCACCACNONE 
J053045C11CGATGGGCCCACCACNONE 
J100055G05CGATGGGCCCACCACNONE 
J100080J22CGATGGGCCCACCACNONE 
Os02g0832200AK108268TCAGGCCCATCGConserved hypothetical protein. 
J065053F07TCAGGCCCATCGNONE 
J065095B09TCAGGCCCATCGNONE 
J065137I11TCAGGCCCATCGNONE 
J065187O12TCAGGCCCATCGNONE 
J075193O05TCAGGCCCATCGNONE 
Os03g0108500AK108704CTGGCCCATCGSimilar to 4,4-dimethyl-sterol C4-methyl-oxidase (Fragment). 
Os03g0122000AK101458AGAGTGGGCCCATCGTGTCAGTGProtein kinase-like domain containing protein. 
J013035K10AGAGTGGGCCCATCGTGTCAGTGNONE 
J013050E10AGAGTGGGCCCATCGTGTCAGTGNONE 
J033040C13AGAGTGGGCCCATCGTGTCAGTGNONE 
Os03g0125000006-032-D09CGATGGGCCGAANONE 
006-033-B05CGATGGGCCGAANONE 
006-048-G06CGATGGGCCGAANONE 
006-048-G09CGATGGGCCGAANONE 
006-052-D09CGATGGGCCGAANONE 
006-072-A04CGATGGGCCGAANONE 
006-076-F12CGATGGGCCGAANONE 
006-080-B03CGATGGGCCGAANONE 
006-092-H03CGATGGGCCGAANONE 
006-103-G04CGATGGGCCGAANONE 
009-079-E01CGATGGGCCGAANONE 
009-150-F03CGATGGGCCGAANONE 
AF095708CGATGGGCCGAANONE 
AK059557CGATGGGCCGAANONE 
AK070779CGATGGGCCGAASimilar to 50S ribosomal protein L5, chloroplast. 
AK098999CGATGGGCCGAANONE 
AK104137CGATGGGCCGAANONE 
J065002D07CGATGGGCCGAANONE 
J065167E24CGATGGGCCGAANONE 
J075199O14CGATGGGCCGAANONE 
J100083L01CGATGGGCCGAANONE 
Os03g0136600009-009-A05GCCCATCGNONE 
009-093-E02GCCCATCGNONE 
AK062705GCCCATCGComplex 1 LYR protein family protein. 
J100029A06GCCCATCGNONE 
Os03g0197000AK071163GGACGGCCCATCGConserved hypothetical protein. 
J023079A07GGACGGCCCATCGNONE 
Os03g0213600AK100407GCCCATCGConserved hypothetical protein. 
Os03g0213800AK103114CGATGGGCCGTTGMitochondrial substrate carrier family protein. 
Os03g0266100AK058507GGGGCCCATCGLIM, zinc-binding domain containing protein. 
J033099G10GGGGCCCATCGNONE 
J065196N19GGGGCCCATCGNONE 
Os03g0284800AJ550618CGATGGGCTNONE 
AK073184CGATGGGCTSpo11/DNA topoisomerase VI, subunit A family protein. 
Os03g0298800009-079-B10TACGGCCCATCGNONE 
AK103337TACGGCCCATCGSimilar to Spliceosomal protein. 
Os03g0655400009-090-G04CGATGGGCCTTNONE 
009-133-B12CGATGGGCCTTNONE 
009-136-A10CGATGGGCCTTNONE 
009-156-C02CGATGGGCCTTNONE 
009-157-C04CGATGGGCCTTNONE 
009-159-F06CGATGGGCCTTNONE 
009-192-A07CGATGGGCCTTNONE 
009-192-B05CGATGGGCCTTNONE 
011-082-F01CGATGGGCCTTNONE 
013-041-G11CGATGGGCCTTNONE 
013-077-E04CGATGGGCCTTNONE 
014-001-A12CGATGGGCCTTNONE 
015-039-A12CGATGGGCCTTNONE 
016-094-G11CGATGGGCCTTNONE 
AB011368CGATGGGCCTTNONE 
AF010584CGATGGGCCTTSimilar to Water stress induced protein. 
AK059150CGATGGGCCTTNONE 
D26538CGATGGGCCTTNONE 
J065013M08CGATGGGCCTTNONE 
J065021G11CGATGGGCCTTNONE 
J065027K20CGATGGGCCTTNONE 
J065034A02CGATGGGCCTTNONE 
J065040F23CGATGGGCCTTNONE 
J065098G21CGATGGGCCTTNONE 
J065153J21CGATGGGCCTTNONE 
J065163C13CGATGGGCCTTNONE 
J065173C23CGATGGGCCTTNONE 
J065178I22CGATGGGCCTTNONE 
J065198K21CGATGGGCCTTNONE 
J065201H19CGATGGGCCTTNONE 
J065205F11CGATGGGCCTTNONE 
J100080E05CGATGGGCCTTNONE 
Os03g0685700AK066043CGATGGGCCTTGGGCTTTProtein prenyltransferase domain containing protein. 
J013048F08CGATGGGCCTTGGGCTTTNONE 
Os03g0701000J075172J23GCCCATCGNONE 
Os03g0702000011-023-H12GCCCATCGNONE 
AK105398GCCCATCGNONE 
AK119905GCCCATCGUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
AK121682GCCCATCGNONE 
J033070B15GCCCATCGNONE 
J033117B11GCCCATCGNONE 
Os03g0725400015-060-D03ATGGCCCATCGNONE 
AK105499ATGGCCCATCGSimilar to WD-repeat protein 5 (BMP2-induced 3-kb gene protein) (WD-repeat protein BIG-3). 
AK111860ATGGCCCATCGNONE 
AK112085ATGGCCCATCGNONE 
J100068K06ATGGCCCATCGNONE 
J100073K24ATGGCCCATCGNONE 
J100084M24ATGGCCCATCGNONE 
Os03g0740700011-093-H12CGGGCCGATGGGCCGANONE 
AK102723CGGGCCGATGGGCCGAProtein similar to CwfJ, C-terminal 1 domain containing protein. 
J013059N19CGGGCCGATGGGCCGANONE 
J013126N16CGGGCCGATGGGCCGANONE 
J033105J16CGGGCCGATGGGCCGANONE 
J090059D19CGGGCCGATGGGCCGANONE 
Os03g0744700AK071178CGATGGGCCGGCConserved hypothetical protein. 
J075006D24CGATGGGCCGGCNONE 
J075165F21CGATGGGCCGGCNONE 
Os03g0784400AK103474AAAAGCCCATCGProtein of unknown function DUF1692 domain containing protein. 
J023135I15AAAAGCCCATCGNONE 
J033130D12AAAAGCCCATCGNONE 
J043035E20AAAAGCCCATCGNONE 
J065206K15AAAAGCCCATCGNONE 
J075053J20AAAAGCCCATCGNONE 
J075129B11AAAAGCCCATCGNONE 
J090003E22AAAAGCCCATCGNONE 
J100023E23AAAAGCCCATCGNONE 
Os03g0784900006-053-H11CGATGGGCCGAGANONE 
009-165-F11CGATGGGCCGAGANONE 
AK060949CGATGGGCCGAGAConserved hypothetical protein. 
AK099097CGATGGGCCGAGANONE 
J023019M19CGATGGGCCGAGANONE 
J065024O11CGATGGGCCGAGANONE 
J065106D20CGATGGGCCGAGANONE 
J065201L15CGATGGGCCGAGANONE 
J075031B04CGATGGGCCGAGANONE 
J075033C19CGATGGGCCGAGANONE 
J075035F11CGATGGGCCGAGANONE 
J075074K14CGATGGGCCGAGANONE 
J075083A22CGATGGGCCGAGANONE 
J075120O10CGATGGGCCGAGANONE 
J075153L20CGATGGGCCGAGANONE 
J075159G02CGATGGGCCGAGANONE 
J080001J18CGATGGGCCGAGANONE 
J080015I03CGATGGGCCGAGANONE 
J080027E23CGATGGGCCGAGANONE 
J080046D24CGATGGGCCGAGANONE 
J080053B17CGATGGGCCGAGANONE 
J080070P07CGATGGGCCGAGANONE 
J080076D18CGATGGGCCGAGANONE 
J080078E13CGATGGGCCGAGANONE 
J080090H03CGATGGGCCGAGANONE 
J100024F19CGATGGGCCGAGANONE 
J100052D15CGATGGGCCGAGANONE 
J100079B14CGATGGGCCGAGANONE 
Os03g0823500AK058972TAGGCCCATCGTGF-beta receptor, type I/II extracellular region family protein. 
AK099193TAGGCCCATCGNONE 
J023109G05TAGGCCCATCGNONE 
J023114H09TAGGCCCATCGNONE 
J065017L13TAGGCCCATCGNONE 
J065093G04TAGGCCCATCGNONE 
J065218D16TAGGCCCATCGNONE 
J090036G14TAGGCCCATCGNONE 
Os03g0846400AK067706CGATGGGCCACNONE 
AK070549CGATGGGCCACPeptidase, trypsin-like serine and cysteine domain containing protein. 
Os03g0855700AK070400GCCCATCGNucleic acid-binding, OB-fold domain containing protein. 
Os03g0857500AK072880TAGGCCCATCGProtein of unknown function DUF303, acetylesterase putative domain containing protein. 
Os03g0861700AK066129CGATGGGCTTARhodanese-like domain containing protein. 
J013051M12CGATGGGCTTANONE 
J013104N13CGATGGGCTTANONE 
J065052E12CGATGGGCTTANONE 
Os03g0861800AF358762TAAGCCCATCGNONE 
AK068434TAAGCCCATCGCyclin-like F-box domain containing protein. 
AK109388TAAGCCCATCGNONE 
J013154L15TAAGCCCATCGNONE 
J013170I23TAAGCCCATCGNONE 
J023031D05TAAGCCCATCGNONE 
J023082E07TAAGCCCATCGNONE 
J023095M10TAAGCCCATCGNONE 
J023127D14TAAGCCCATCGNONE 
J023138M15TAAGCCCATCGNONE 
J023138M16TAAGCCCATCGNONE 
J033060B18TAAGCCCATCGNONE 
J033060F13TAAGCCCATCGNONE 
J033096J11TAAGCCCATCGNONE 
J033122C07TAAGCCCATCGNONE 
J053029A10TAAGCCCATCGNONE 
J053062O16TAAGCCCATCGNONE 
J053064J08TAAGCCCATCGNONE 
J053086F22TAAGCCCATCGNONE 
J065036C04TAAGCCCATCGNONE 
J065072J23TAAGCCCATCGNONE 
J065120D04TAAGCCCATCGNONE 
J065161D04TAAGCCCATCGNONE 
J065172H02TAAGCCCATCGNONE 
J065207B01TAAGCCCATCGNONE 
J075019H18TAAGCCCATCGNONE 
J075082E16TAAGCCCATCGNONE 
J075089A10TAAGCCCATCGNONE 
J075099G02TAAGCCCATCGNONE 
J075134M04TAAGCCCATCGNONE 
J075144K19TAAGCCCATCGNONE 
J075147F17TAAGCCCATCGNONE 
J090004O14TAAGCCCATCGNONE 
J090013A07TAAGCCCATCGNONE 
J090047K14TAAGCCCATCGNONE 
Os04g0397901J065050P16TCGGCCCATCGConserved hypothetical protein. 
Os04g0407300AK101793GACGGCCCATCGNONE 
AK121980GACGGCCCATCGHypothetical protein. 
J033065K23GACGGCCCATCGNONE 
J033108L11GACGGCCCATCGNONE 
Os04g0447600006-023-A01GCCCATCGNONE 
006-080-D11GCCCATCGNONE 
006-095-D01GCCCATCGNONE 
006-114-F03GCCCATCGNONE 
AK061282GCCCATCGSimilar to NADPH-dependent codeinone reductase (EC 1.1.1.247). 
Os04g0488100AK073406GCCCATCGRad21/Rec8 like protein, N-terminal domain containing protein. 
AY371047GCCCATCGNONE 
J033043K15GCCCATCGNONE 
J033095D15GCCCATCGNONE 
J033119B01GCCCATCGNONE 
J043006E22GCCCATCGNONE 
J043029B10GCCCATCGNONE 
Os04g0500700AK072528AGCCCATCGSimilar to Hydroxyanthranilate hydroxycinnamoyltransferase 3. 
AK104637AGCCCATCGNONE 
AK119237AGCCCATCGNONE 
Os04g0510900012-083-A10GCCCATCGNONE 
014-002-F04GCCCATCGNONE 
AK063625GCCCATCGSimilar to Embryo-specific protein 1 (ATS1). 
J065136I20GCCCATCGNONE 
J065144F23GCCCATCGNONE 
J065153D08GCCCATCGNONE 
J065178A02GCCCATCGNONE 
J065178B01GCCCATCGNONE 
J065195M21GCCCATCGNONE 
Os04g0525000AK067753TGGATGGGCCCATCGConserved hypothetical protein. 
J013118G14TGGATGGGCCCATCGNONE 
J065026J15TGGATGGGCCCATCGNONE 
J065184H21TGGATGGGCCCATCGNONE 
J065186H22TGGATGGGCCCATCGNONE 
J065193D20TGGATGGGCCCATCGNONE 
J075060D12TGGATGGGCCCATCGNONE 
J075179L24TGGATGGGCCCATCGNONE 
Os04g0561700AK067397CGATGGGCConserved hypothetical protein. 
Os04g0564700AK111615CGATGGGCNONE 
Os04g0570600AK106747CGATGGGCCytochrome P450 family protein. 
J080319G08CGATGGGCNONE 
Os04g0612800016-010-G05CGATGGGCCTTGTAATGGGCCACGGCCCAACANONE 
AK071230CGATGGGCCTTGTAATGGGCCACGGCCCAACAProtein prenyltransferase domain containing protein. 
Os04g0661200AK102842GCCCATCGProtein of unknown function DUF941 family protein. 
J033075E19GCCCATCGNONE 
J033109O19GCCCATCGNONE 
J065002J12GCCCATCGNONE 
J065026E22GCCCATCGNONE 
J065061F05GCCCATCGNONE 
J065068D22GCCCATCGNONE 
J065072N14GCCCATCGNONE 
J065085F02GCCCATCGNONE 
J075055G19GCCCATCGNONE 
J075105B14GCCCATCGNONE 
J075118M17GCCCATCGNONE 
J075193H02GCCCATCGNONE 
J100040O05GCCCATCGNONE 
J100064I04GCCCATCGNONE 
Os04g0661600009-165-G04CGATGGGCNONE 
AK105225CGATGGGCNONE 
J065086K17CGATGGGCNONE 
Os05g0121400AK099528GCCCATCGNONE 
Os05g0129900AK060436AGCCCATCGTetratricopeptide-like helical domain containing protein. 
AK102515AGCCCATCGNONE 
Os05g0182100006-094-F11AGCCCATCGNONE 
015-006-H06AGCCCATCGNONE 
AK071095AGCCCATCGTetratricopeptide-like helical domain containing protein. 
AK106020AGCCCATCGNONE 
J023079N14AGCCCATCGNONE 
J065059G19AGCCCATCGNONE 
J065193B20AGCCCATCGNONE 
J075097H12AGCCCATCGNONE 
J075103B21AGCCCATCGNONE 
J075150G24AGCCCATCGNONE 
J075177C14AGCCCATCGNONE 
J100056A14AGCCCATCGNONE 
Os05g0186300AK070360GCCCATCGSimilar to NADP-malic enzyme. 
AK099249GCCCATCGNONE 
AY435404GCCCATCGNONE 
J023006D11GCCCATCGNONE 
J023059P07GCCCATCGNONE 
Os05g0332600AK098926GCCCATCGNONE 
Os05g0346300009-033-C06GCGGCCCAGCAAGGCCCATCGNONE 
AF529175GCGGCCCAGCAAGGCCCATCGNONE 
AK061627GCGGCCCAGCAAGGCCCATCGSimilar to 40S ribosomal protein S7. 
AK103081GCGGCCCAGCAAGGCCCATCGNONE 
AK104191GCGGCCCAGCAAGGCCCATCGNONE 
J013049B09GCGGCCCAGCAAGGCCCATCGNONE 
J023142E24GCGGCCCAGCAAGGCCCATCGNONE 
J033052M14GCGGCCCAGCAAGGCCCATCGNONE 
J033089N04GCGGCCCAGCAAGGCCCATCGNONE 
J033118F01GCGGCCCAGCAAGGCCCATCGNONE 
J065054E07GCGGCCCAGCAAGGCCCATCGNONE 
J065066L18GCGGCCCAGCAAGGCCCATCGNONE 
J065078C21GCGGCCCAGCAAGGCCCATCGNONE 
J065127G23GCGGCCCAGCAAGGCCCATCGNONE 
J065128N24GCGGCCCAGCAAGGCCCATCGNONE 
J065144P17GCGGCCCAGCAAGGCCCATCGNONE 
J065147P14GCGGCCCAGCAAGGCCCATCGNONE 
J065170E16GCGGCCCAGCAAGGCCCATCGNONE 
J065175D17GCGGCCCAGCAAGGCCCATCGNONE 
J065176M05GCGGCCCAGCAAGGCCCATCGNONE 
J065218G20GCGGCCCAGCAAGGCCCATCGNONE 
J090074J12GCGGCCCAGCAAGGCCCATCGNONE 
J100019H16GCGGCCCAGCAAGGCCCATCGNONE 
J100031N24GCGGCCCAGCAAGGCCCATCGNONE 
J100072G08GCGGCCCAGCAAGGCCCATCGNONE 
J100086I23GCGGCCCAGCAAGGCCCATCGNONE 
Os05g0417200AK071955TAATGGGCCACGATGGGCCTTThioredoxin-like fold domain containing protein. 
Os05g0443800AK106590CGATGGGCCTASimilar to Plastid division protein ftsZ1 precursor. 
Os05g0450300AK071191GCGGCCCATCGConserved hypothetical protein. 
J023084G11GCGGCCCATCGNONE 
Os05g0500500AK110627CGATGGGCTTCHSP20-like chaperone domain containing protein. 
Os05g0506000AF031609CGTGTGGCCCATCGNONE 
AK062012CGTGTGGCCCATCGNONE 
AK098900CGTGTGGCCCATCGNONE 
AK122090CGTGTGGCCCATCGSimilar to MS5-like protein (Fragment). 
J013002B13CGTGTGGCCCATCGNONE 
J023149G13CGTGTGGCCCATCGNONE 
J033123O20CGTGTGGCCCATCGNONE 
J080315O17CGTGTGGCCCATCGNONE 
Os05g0519700014-100-B04CGCGTCGCCCATCGNONE 
AF332981CGCGTCGCCCATCGNONE 
AK100903CGCGTCGCCCATCGNONE 
AK105433CGCGTCGCCCATCGHeat shock protein 101. 
Os05g0558900AK101679TAAGCCCATCGSimilar to Frsb-prov protein. 
J013028M08TAAGCCCATCGNONE 
J013074E16TAAGCCCATCGNONE 
J013096L01TAAGCCCATCGNONE 
J023085M19TAAGCCCATCGNONE 
J033058I10TAAGCCCATCGNONE 
J033091D18TAAGCCCATCGNONE 
J033111H13TAAGCCCATCGNONE 
J033114C18TAAGCCCATCGNONE 
Os05g0591900AK107074GCCCATCGNONE 
Os06g0105700011-082-E11GCCCATCGNONE 
AK111956GCCCATCGProtein of unknown function DUF6, transmembrane domain containing protein. 
Os06g0166000009-023-G02CGATGGGCNONE 
AK060317CGATGGGCCyclin-like F-box domain containing protein. 
J075052L22CGATGGGCNONE 
J075078E03CGATGGGCNONE 
J075115M08CGATGGGCNONE 
J075192G08CGATGGGCNONE 
J100036C01CGATGGGCNONE 
J100070J02CGATGGGCNONE 
J100088C24CGATGGGCNONE 
Os06g0199500AK060939GCCCATCGNONE 
AK064613GCCCATCGSimilar to Phosphopantothenoylcysteine decarboxylase (EC 4.1.1.36) (Halotolerance protein Hal3a) (AtHal3a) (PPCDC) (AtCoaC). 
AK100138GCCCATCGNONE 
Os06g0202900AK109607TAAGCCCATCGProtein kinase-like domain containing protein. 
Os06g0266800009-057-G11GCCCATCGNONE 
AK062516GCCCATCGSimilar to GAST1 protein precursor. 
Os06g0343900AK070940CGATGGGCTConserved hypothetical protein. 
Os06g0499900J065053E01CGATGGGCCGGCCGATGGGCTNONE 
J065078C19CGATGGGCCGGCCGATGGGCTNONE 
J065122P11CGATGGGCCGGCCGATGGGCTNONE 
J065209B15CGATGGGCCGGCCGATGGGCTNONE 
J065218E19CGATGGGCCGGCCGATGGGCTNONE 
Os06g0547900AK100950CGATGGGCCTTSimilar to Shaggy-related protein kinase eta (EC 2.7.1.-) (ASK-eta) (BRASSINOSTEROID-INSENSITIVE 2) (ULTRACURVATA1). 
AK105665CGATGGGCCTTNONE 
J023139I22CGATGGGCCTTNONE 
J090066J10CGATGGGCCTTNONE 
Y13437CGATGGGCCTTNONE 
Os06g0560400AK103575GCCGGCCCATCGNONE 
AK108074GCCGGCCCATCGProtein of unknown function DUF862, eukaryotic domain containing protein. 
Os06g0678200AK059456CCAGGCCCATCGNONE 
AK071299CCAGGCCCATCGSimilar to Geranyl diphosphate synthase. 
Os07g0185700012-040-A11AGGGCCCACGGGCCCATCGNONE 
AK070572AGGGCCCACGGGCCCATCGConserved hypothetical protein. 
J065116D10AGGGCCCACGGGCCCATCGNONE 
J065122F20AGGGCCCACGGGCCCATCGNONE 
Os07g0205000009-018-A12AGATGGGCCGGCCCATCGGCCCATCANONE 
AK103963AGATGGGCCGGCCCATCGGCCCATCANONE 
AK121368AGATGGGCCGGCCCATCGGCCCATCANONE 
J023001M20AGATGGGCCGGCCCATCGGCCCATCANONE 
J023125I03AGATGGGCCGGCCCATCGGCCCATCANONE 
J053034L22AGATGGGCCGGCCCATCGGCCCATCANONE 
J065078A21AGATGGGCCGGCCCATCGGCCCATCANONE 
J065089G24AGATGGGCCGGCCCATCGGCCCATCANONE 
J065096G23AGATGGGCCGGCCCATCGGCCCATCANONE 
J065103N06AGATGGGCCGGCCCATCGGCCCATCANONE 
J065146J22AGATGGGCCGGCCCATCGGCCCATCANONE 
J065159K18AGATGGGCCGGCCCATCGGCCCATCANONE 
J065204L04AGATGGGCCGGCCCATCGGCCCATCANONE 
J065207N07AGATGGGCCGGCCCATCGGCCCATCANONE 
J065208E24AGATGGGCCGGCCCATCGGCCCATCANONE 
J075057F19AGATGGGCCGGCCCATCGGCCCATCANONE 
J075058K01AGATGGGCCGGCCCATCGGCCCATCANONE 
J075072H13AGATGGGCCGGCCCATCGGCCCATCANONE 
J080003D08AGATGGGCCGGCCCATCGGCCCATCANONE 
J080025F02AGATGGGCCGGCCCATCGGCCCATCANONE 
Os07g0243200AK121036CCCACTCTTCTCGGCCCATCGSimilar to ADP-glucose pyrophosphorylase large subunit 2 (EC 2.7.7.27) (Fragment). 
D21272CCCACTCTTCTCGGCCCATCGNONE 
Os07g0568900009-083-H02AACTGGGCCCATTTTGGGCTAAGCCCATCGNONE 
AK062660AACTGGGCCCATTTTGGGCTAAGCCCATCGConserved hypothetical protein. 
Os07g0569000AK073915CGATGGGCTTAGCCCAAAATGGGCCCAGTTConserved hypothetical protein. 
Os07g0595700003-103-G05CGATGGGCCACACGNONE 
AK108488CGATGGGCCACACGConserved hypothetical protein. 
J065136O05CGATGGGCCACACGNONE 
Os07g0595800011-069-G09CGTGTGGCCCATCGNONE 
AK066349CGTGTGGCCCATCGPrefoldin related, ubiquitously expressed transcript family protein. 
J013062C05CGTGTGGCCCATCGNONE 
Os07g0608400AK109447CGATGGGCCGGGGCCCACCASimilar to nucleic acid binding protein [Oryza sativa (japonica cultivar-group)]. 
Os07g0641400009-078-A04TTGGCCCATGTCCAGCCCATCGNONE 
AK062634TTGGCCCATGTCCAGCCCATCGHypothetical protein. 
Os08g0117400006-086-A09GAAGCCCATCGNONE 
006-103-C02GAAGCCCATCGNONE 
AK059891GAAGCCCATCGSimilar to Calmodulin 1 (Fragment). 
AK103863GAAGCCCATCGNONE 
AY224521GAAGCCCATCGNONE 
J033149E23GAAGCCCATCGNONE 
J065062E05GAAGCCCATCGNONE 
J065083O05GAAGCCCATCGNONE 
J065116D14GAAGCCCATCGNONE 
J065158F16GAAGCCCATCGNONE 
J065179N16GAAGCCCATCGNONE 
J065206N23GAAGCCCATCGNONE 
Os08g0151400AK059440CCCAGCCCATCGSimilar to Small nuclear ribonucleoprotein homolog. 
Os08g0195400006-057-E04CGATGGGCCGTCNONE 
006-060-B10CGATGGGCCGTCNONE 
AK070464CGATGGGCCGTCConserved hypothetical protein. 
AK104389CGATGGGCCGTCNONE 
AK106140CGATGGGCCGTCNONE 
J023013G08CGATGGGCCGTCNONE 
J023054K19CGATGGGCCGTCNONE 
J023089D18CGATGGGCCGTCNONE 
J023092K05CGATGGGCCGTCNONE 
J033025A08CGATGGGCCGTCNONE 
J033067P12CGATGGGCCGTCNONE 
J033098A10CGATGGGCCGTCNONE 
J065219L04CGATGGGCCGTCNONE 
J090021P06CGATGGGCCGTCNONE 
J090062M05CGATGGGCCGTCNONE 
J090079F15CGATGGGCCGTCNONE 
J100041H19CGATGGGCCGTCNONE 
Os08g0243600AB110183CGATGGGCCTCNONE 
AK101443CGATGGGCCTCHaloacid dehalogenase-like hydrolase domain containing protein. 
Os08g0327400AK070992CGATGGGCTTCSimilar to Enoyl-ACP reductase (Fragment). 
J023077K10CGATGGGCTTCNONE 
J065075F06CGATGGGCTTCNONE 
J065112N14CGATGGGCTTCNONE 
J090028K07CGATGGGCTTCNONE 
J090039C15CGATGGGCTTCNONE 
J090048I11CGATGGGCTTCNONE 
J090083M10CGATGGGCTTCNONE 
Os08g0390700009-094-H10CGATGGGCNONE 
AK062714CGATGGGCSimilar to 2-oxoglutarate-dependent oxygenase. 
Os08g0459300AK060409AGCCCATCGConserved hypothetical protein. 
AK101386AGCCCATCGNONE 
J033034E20AGCCCATCGNONE 
J033036F14AGCCCATCGNONE 
J065047G22AGCCCATCGNONE 
J065173C14AGCCCATCGNONE 
J065188O22AGCCCATCGNONE 
J065189C17AGCCCATCGNONE 
J065197I16AGCCCATCGNONE 
J065202E05AGCCCATCGNONE 
J075022D03AGCCCATCGNONE 
J075023K21AGCCCATCGNONE 
J075096D12AGCCCATCGNONE 
J075129K24AGCCCATCGNONE 
Os08g0471900015-099-E10ACAGCCCAACAAGGCCCATCGNONE 
AK069434ACAGCCCAACAAGGCCCATCGZinc finger, ZPR1-type domain containing protein. 
Os08g0483600AK099543CGATGGGCConserved hypothetical protein. 
J100053G23CGATGGGCNONE 
J100084K09CGATGGGCNONE 
Os08g0484700J065041E01TCGGCCCATCGHomeodomain-like containing protein. 
Os08g0500800AK101328CGATGGGCPUG domain containing protein. 
Os08g0550100AB070258CGATGGGCCTGANONE 
AK061287CGATGGGCCTGASimilar to 26S proteasome subunit RPN3a. 
Os08g0558400AK071334AGCCCATCGSimilar to Kinesin heavy chain (Fragment). 
Os09g0115500006-023-A12CGATGGGCCCATGTNONE 
006-042-G01CGATGGGCCCATGTNONE 
AK061717CGATGGGCCCATGTCBS domain containing protein. 
AK065986CGATGGGCCCATGTNONE 
J013043C13CGATGGGCCCATGTNONE 
J013111D13CGATGGGCCCATGTNONE 
J023114K12CGATGGGCCCATGTNONE 
J065102N18CGATGGGCCCATGTNONE 
Os09g0329800AK069775CGGGCCGATGGGCCAGGCCCConserved hypothetical protein. 
Os09g0329900Os09g0329900CGGGCCGATGGGCCAGGCCCNONE 
Os09g0445600AK107839CGATGGGCTConserved hypothetical protein. 
Os09g0458300AK108581CGATGGGCLeucine rich repeat, N-terminal domain containing protein. 
Os09g0463600AK072780CGATGGGCNONE 
AK121134CGATGGGCProtein of unknown function DUF617, plant family protein. 
J023139I23CGATGGGCNONE 
Os11g0109900011-064-B04CAAGTGGGCCCATCGCTGGGCCTCNONE 
AK063961CAAGTGGGCCCATCGCTGGGCCTCDouble-stranded RNA binding domain containing protein. 
AK121852CAAGTGGGCCCATCGCTGGGCCTCNONE 
J065183M14CAAGTGGGCCCATCGCTGGGCCTCNONE 
Os11g0116400AK059833GCTGGGCCGATGGGCTTCSimilar to Elongation factor P (EF-P). 
Os11g0145400009-117-C07GAGGCCCATAGCCCATCGSimilar to Ubiquitin-like protein 5. 
009-189-E08GAGGCCCATAGCCCATCGNONE 
J023127F18GAGGCCCATAGCCCATCGNONE 
J065071G10GAGGCCCATAGCCCATCGNONE 
J065118J21GAGGCCCATAGCCCATCGNONE 
J065184P05GAGGCCCATAGCCCATCGNONE 
J080301B06GAGGCCCATAGCCCATCGNONE 
J080303C06GAGGCCCATAGCCCATCGNONE 
J080304F18GAGGCCCATAGCCCATCGNONE 
J080308D02GAGGCCCATAGCCCATCGNONE 
J080309H09GAGGCCCATAGCCCATCGNONE 
J080311O09GAGGCCCATAGCCCATCGNONE 
J080311O15GAGGCCCATAGCCCATCGNONE 
J080312N11GAGGCCCATAGCCCATCGNONE 
J080313G04GAGGCCCATAGCCCATCGNONE 
J080313I06GAGGCCCATAGCCCATCGNONE 
J100077F22GAGGCCCATAGCCCATCGNONE 
Os12g0188900012-030-C08CGATGGGCCCGNONE 
J013027N23CGATGGGCCCGConserved hypothetical protein. 
J013156K23CGATGGGCCCGNONE 
J023134K02CGATGGGCCCGNONE 
J033051M18CGATGGGCCCGNONE 
J033143K05CGATGGGCCCGNONE 
J080003C24CGATGGGCCCGNONE 
J080004K05CGATGGGCCCGNONE 
J080009D14CGATGGGCCCGNONE 
J080014L12CGATGGGCCCGNONE 
J080020E23CGATGGGCCCGNONE 
J080021K20CGATGGGCCCGNONE 
J080024B19CGATGGGCCCGNONE 
J080024C12CGATGGGCCCGNONE 
J080031K10CGATGGGCCCGNONE 
J080034G09CGATGGGCCCGNONE 
J080036C10CGATGGGCCCGNONE 
J080037K18CGATGGGCCCGNONE 
J080039J17CGATGGGCCCGNONE 
J080040A20CGATGGGCCCGNONE 
J080042B06CGATGGGCCCGNONE 
J080046P07CGATGGGCCCGNONE 
J080047G02CGATGGGCCCGNONE 
J080049E12CGATGGGCCCGNONE 
J080056N14CGATGGGCCCGNONE 
J080059K10CGATGGGCCCGNONE 
J080064F05CGATGGGCCCGNONE 
J080064I04CGATGGGCCCGNONE 
J080064K17CGATGGGCCCGNONE 
J080069A15CGATGGGCCCGNONE 
J080071E22CGATGGGCCCGNONE 
J080071M24CGATGGGCCCGNONE 
J080074C17CGATGGGCCCGNONE 
J080075J07CGATGGGCCCGNONE 
J080079F11CGATGGGCCCGNONE 
J080083F15CGATGGGCCCGNONE 
J080084N21CGATGGGCCCGNONE 
J080086O03CGATGGGCCCGNONE 
J080089K02CGATGGGCCCGNONE 
J080092K22CGATGGGCCCGNONE 
J080093P09CGATGGGCCCGNONE 
J090001N04CGATGGGCCCGNONE 
J090041M02CGATGGGCCCGNONE 
Os12g0592200Os12g0592200TAAGCCCATCGConserved hypothetical protein. 
Os12g0630600J100033A04CGATGGGCCCATCAConserved hypothetical protein. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.