version

Summary of OsREG554 (All List)

OrganismOryza sativa  
IDOsREG554  
SequenceCGCACCGC  
Annotation  
PPDB Motif 
PLACE Motif 
Total Entry Count1264  

Entry Sequences (1264 entries)

LocusGene modelSequenceDescription
Os01g0104000AK072087GACGCGACGCACCGCNONE 
AK103808GACGCGACGCACCGCC-type lectin domain containing protein. 
Os01g0104100AK072797GCGGTGCGTCGCGTCZinc finger, RING-type domain containing protein. 
AK104280GCGGTGCGTCGCGTCNONE 
Os01g0157600AK106766GCGGTGCGAnkyrin repeat containing protein. 
Os01g0175100AK071289CGCACCGCKv1.4 voltage-gated K+ channel family protein. 
J023088B10CGCACCGCNONE 
J065122H15CGCACCGCNONE 
J065140B19CGCACCGCNONE 
J100031E12CGCACCGCNONE 
J100068J03CGCACCGCNONE 
J100083E12CGCACCGCNONE 
Os01g0208600AK120865CGCACCGCActin-binding WH2 domain containing protein. 
J013021G11CGCACCGCNONE 
J013071H23CGCACCGCNONE 
J013108B13CGCACCGCNONE 
J023025D04CGCACCGCNONE 
J033032H02CGCACCGCNONE 
Os01g0276700011-014-A12CACCGCACCGCNONE 
012-092-G12CACCGCACCGCNONE 
AK103164CACCGCACCGCNONE 
AK103465CACCGCACCGCSimilar to Pyruvate kinase, cytosolic isozyme (EC 2.7.1.40) (PK). 
J023019H09CACCGCACCGCNONE 
J023084I02CACCGCACCGCNONE 
J033027F20CACCGCACCGCNONE 
J033029M06CACCGCACCGCNONE 
J033039K13CACCGCACCGCNONE 
J033057C24CACCGCACCGCNONE 
J033058G20CACCGCACCGCNONE 
J033060A14CACCGCACCGCNONE 
J033061M21CACCGCACCGCNONE 
J033068M10CACCGCACCGCNONE 
J033074K16CACCGCACCGCNONE 
J033076C11CACCGCACCGCNONE 
J033093O13CACCGCACCGCNONE 
J033119H20CACCGCACCGCNONE 
J033121D22CACCGCACCGCNONE 
J033129N11CACCGCACCGCNONE 
J033131E12CACCGCACCGCNONE 
J033150L07CACCGCACCGCNONE 
J053024N17CACCGCACCGCNONE 
J053034G19CACCGCACCGCNONE 
J053035E18CACCGCACCGCNONE 
J053046M01CACCGCACCGCNONE 
J053047P04CACCGCACCGCNONE 
J053048B06CACCGCACCGCNONE 
J053050M22CACCGCACCGCNONE 
J053053E09CACCGCACCGCNONE 
J053053I07CACCGCACCGCNONE 
J053059K03CACCGCACCGCNONE 
J053059P12CACCGCACCGCNONE 
J053060C12CACCGCACCGCNONE 
J053060H24CACCGCACCGCNONE 
J053064D19CACCGCACCGCNONE 
J053066L15CACCGCACCGCNONE 
J053073I02CACCGCACCGCNONE 
J053083E15CACCGCACCGCNONE 
J053094D05CACCGCACCGCNONE 
J053094P18CACCGCACCGCNONE 
J053095C15CACCGCACCGCNONE 
J053095C21CACCGCACCGCNONE 
J053099N16CACCGCACCGCNONE 
J090025O19CACCGCACCGCNONE 
J090049N22CACCGCACCGCNONE 
J090050F17CACCGCACCGCNONE 
Os01g0314300AK073419GCGGTGCGUncharacterized domain 2 containing protein. 
AK104939GCGGTGCGNONE 
J033044B03GCGGTGCGNONE 
J033060E12GCGGTGCGNONE 
J043037E21GCGGTGCGNONE 
J065019O18GCGGTGCGNONE 
J065025P22GCGGTGCGNONE 
J065042P06GCGGTGCGNONE 
J065074C19GCGGTGCGNONE 
J065074E13GCGGTGCGNONE 
J065094E05GCGGTGCGNONE 
J065108N08GCGGTGCGNONE 
J065134L13GCGGTGCGNONE 
J065152N24GCGGTGCGNONE 
J065162N24GCGGTGCGNONE 
J065170P16GCGGTGCGNONE 
J065177M20GCGGTGCGNONE 
J065187N01GCGGTGCGNONE 
J075012N12GCGGTGCGNONE 
J075046C17GCGGTGCGNONE 
J075055N06GCGGTGCGNONE 
J075141H03GCGGTGCGNONE 
J075150M11GCGGTGCGNONE 
J090005B16GCGGTGCGNONE 
J090079L11GCGGTGCGNONE 
J100039F16GCGGTGCGNONE 
Os01g0565600AK061216CGCACCGCProtein of unknown function DUF866, eukaryotic family protein. 
AK061216CGCACCGCProtein of unknown function DUF866, eukaryotic family protein. 
AK070666CGCACCGCNONE 
AK070666CGCACCGCNONE 
J023058O09CGCACCGCNONE 
J023058O09CGCACCGCNONE 
Os01g0571000AK121334CGCACCGCACCGCNONE 
Os01g0623600011-011-B08CGCACCGCNONE 
011-052-G08CGCACCGCNONE 
AK103106CGCACCGCNONE 
J033023J06CGCACCGCNONE 
J033036F02CGCACCGCNONE 
J033057J05CGCACCGCNONE 
J033074C10CGCACCGCNONE 
J033106K18CGCACCGCNONE 
J033118O22CGCACCGCNONE 
J033120G01CGCACCGCNONE 
J033120P07CGCACCGCSimilar to Polygalacturonase precursor (EC 3.2.1.15) (PG) (Pectinase). 
J033132C08CGCACCGCNONE 
J033136L24CGCACCGCNONE 
Os01g0623900J090025M21CGCACCGCNONE 
J090082F22CGCACCGCNONE 
J090084L02CGCACCGCSimilar to Splicing factor, arginine/serine-rich 2 (Splicing factor SC35) (SC-35) (Splicing component, 35 kDa) (PR264 protein). 
Os01g0637600AK106980CGCACCGCCAACGGCCSimilar to Peptide deformylase, chloroplast precursor (EC 3.5.1.88) (PDF) (Polypeptide deformylase). 
Os01g0639900004-009-H08CGCACCGCNONE 
006-050-F07CGCACCGCNONE 
006-120-D04CGCACCGCNONE 
AF182806CGCACCGCNONE 
AK060890CGCACCGCSimilar to Carbonic anhydrase, chloroplast precursor (EC 4.2.1.1) (Carbonate dehydratase). 
AK099825CGCACCGCNONE 
J075022I06CGCACCGCNONE 
U08404CGCACCGCNONE 
Os01g0672700AK121375CGCACCGCDNA polymerase, beta-like region domain containing protein. 
J023127C22CGCACCGCNONE 
J033092B05CGCACCGCNONE 
J033129P21CGCACCGCNONE 
J065079H18CGCACCGCNONE 
Os01g0678600AK071536CGCACCGCNONE 
Os01g0687700AK061158CGCACCGCNONE 
AK073996CGCACCGCProtein of unknown function DUF292, eukaryotic domain containing protein. 
J023004L17CGCACCGCNONE 
J033071E20CGCACCGCNONE 
Os01g0716200AK062106GTGCGGTGCGIQ calmodulin-binding region domain containing protein. 
AK098920GTGCGGTGCGNONE 
AK120664GTGCGGTGCGNONE 
J013002N06GTGCGGTGCGNONE 
J013050O19GTGCGGTGCGNONE 
J013074N19GTGCGGTGCGNONE 
J013098J01GTGCGGTGCGNONE 
J013127F17GTGCGGTGCGNONE 
J013155C17GTGCGGTGCGNONE 
J013158K07GTGCGGTGCGNONE 
J013159J10GTGCGGTGCGNONE 
J053086D01GTGCGGTGCGNONE 
Os01g0747700AK101311GCGGTGCGRNA-binding S4 domain containing protein. 
J090007I15GCGGTGCGNONE 
Os01g0748150J075112I15GCGGTGCGCupredoxin domain containing protein. 
J075161H07GCGGTGCGNONE 
Os01g0767700AK122168GCGGTGCGSimilar to DEIH-box RNA/DNA helicase. 
Os01g0805600AK111939CGCACCGCSimilar to Cyclin IaZm (Fragment). 
Os01g0844400AK070434CGCACCGCACNONE 
AK071686CGCACCGCACZinc finger, DHHC-type domain containing protein. 
J065037E10CGCACCGCACNONE 
J065165F17CGCACCGCACNONE 
Os01g0849600AK108159CGCACCGCSimilar to ENOD18 protein (Fragment). 
Os01g0850900009-089-D11CGCACCGCNONE 
AK063822CGCACCGCNONE 
AK102887CGCACCGCSOUL heme-binding protein family protein. 
J033112K22CGCACCGCNONE 
J065087B10CGCACCGCNONE 
J065100A05CGCACCGCNONE 
J075077M10CGCACCGCNONE 
Os01g0878800AK070438CGCACCGCNONE 
AK104297CGCACCGCNONE 
AK105779CGCACCGCNONE 
Os01g0886600AK070098GCGGTGCGSimilar to CLP protease regulatory subunit CLPX precursor. 
Os01g0896800AK065268CGCACCGCNONE 
AK104693CGCACCGCEukaryotic ribosomal protein L5 family protein. 
J013126P09CGCACCGCNONE 
J033046N15CGCACCGCNONE 
J090008K02CGCACCGCNONE 
J090024F15CGCACCGCNONE 
J090074I23CGCACCGCNONE 
J090093F03CGCACCGCNONE 
J090096N02CGCACCGCNONE 
Os01g0921600AK071344GCGGTGCGSimilar to Mitochondrial import receptor subunit TOM20 (Translocase of outer membrane 20 kDa subunit). 
J013039J22GCGGTGCGNONE 
J013109E03GCGGTGCGNONE 
J023081J12GCGGTGCGNONE 
J023091E24GCGGTGCGNONE 
J033022A01GCGGTGCGNONE 
J033074C13GCGGTGCGNONE 
J065199E03GCGGTGCGNONE 
J075172O04GCGGTGCGNONE 
J090007G18GCGGTGCGNONE 
J090052B17GCGGTGCGNONE 
J090074H01GCGGTGCGNONE 
J100043J09GCGGTGCGNONE 
J100059J05GCGGTGCGNONE 
Os01g0934500AK073211CGCACCGCConserved hypothetical protein. 
Os01g0953100AK064981GCGGTGCGNONE 
AK068882GCGGTGCGProtein of unknown function DUF594 family protein. 
J013001C07GCGGTGCGNONE 
J013169K14GCGGTGCGNONE 
J033114G07GCGGTGCGNONE 
J065035K15GCGGTGCGNONE 
J065082E12GCGGTGCGNONE 
Os02g0100200AK121311GCGGTGCGSteroid nuclear receptor, ligand-binding domain containing protein. 
Os02g0125300006-047-E06CGCACCGCACCGCACNONE 
006-088-F09CGCACCGCACCGCACNONE 
006-106-F10CGCACCGCACCGCACNONE 
AB025926CGCACCGCACCGCACNONE 
AK061564CGCACCGCACCGCACNONE 
AK061953CGCACCGCACCGCACNONE 
AK101060CGCACCGCACCGCACBax inhibitor-1 (BI-1) (OsBI-1). 
J013072O21CGCACCGCACCGCACNONE 
J023097A08CGCACCGCACCGCACNONE 
J023133F03CGCACCGCACCGCACNONE 
J033022C21CGCACCGCACCGCACNONE 
J033073C21CGCACCGCACCGCACNONE 
J033116O09CGCACCGCACCGCACNONE 
J033120E01CGCACCGCACCGCACNONE 
J065088M19CGCACCGCACCGCACNONE 
J065135O04CGCACCGCACCGCACNONE 
J080304J03CGCACCGCACCGCACNONE 
J090001K14CGCACCGCACCGCACNONE 
J090038D04CGCACCGCACCGCACNONE 
J090045G09CGCACCGCACCGCACNONE 
J090076E12CGCACCGCACCGCACNONE 
J090077D21CGCACCGCACCGCACNONE 
J100018J19CGCACCGCACCGCACNONE 
J100029M12CGCACCGCACCGCACNONE 
J100049D07CGCACCGCACCGCACNONE 
J100067G21CGCACCGCACCGCACNONE 
J100090D05CGCACCGCACCGCACNONE 
Os02g0148100AF216317CGCACCGCNONE 
AF241166CGCACCGCNONE 
AK119650CGCACCGCMAP kinase MAPK2 (MAP kinase 3). 
Os02g0160200AK109618GTGCGGTGCGGTGCGGTGCGGTGCyclin-like F-box domain containing protein. 
Os02g0160900J075127G12CGCACCGCConserved hypothetical protein. 
Os02g0282900AK121560CGCACCGCACCGCSimilar to 68 kDa protein HP68. 
Os02g0471500AK120615CGCACCGCACCGCNONE 
AK120927CGCACCGCACCGCProtein phosphatase 2C-like domain containing protein. 
Os02g0497700011-094-A10CACCGCACCGCNONE 
012-073-H02CACCGCACCGCNONE 
016-056-G05CACCGCACCGCNONE 
AK070143CACCGCACCGCNONE 
J023041O14CACCGCACCGCNONE 
J023092H01CACCGCACCGCNONE 
J033048A17CACCGCACCGCNONE 
J033051K21CACCGCACCGCNONE 
J033122D01CACCGCACCGCNONE 
J090032E23CACCGCACCGCNONE 
J090055K13CACCGCACCGCNONE 
Os02g0509500009-117-G07CGCACCGCACNONE 
009-122-G08CGCACCGCACNONE 
AK105187CGCACCGCACConserved hypothetical protein. 
J065025C04CGCACCGCACNONE 
J065030F10CGCACCGCACNONE 
J065112P22CGCACCGCACNONE 
J065116I22CGCACCGCACNONE 
J065127F24CGCACCGCACNONE 
J065176E11CGCACCGCACNONE 
J065186F02CGCACCGCACNONE 
J075041F12CGCACCGCACNONE 
J075118L20CGCACCGCACNONE 
J075181D20CGCACCGCACNONE 
J090023P12CGCACCGCACNONE 
Os02g0556900012-096-G06CGCACCGCNONE 
AK063555CGCACCGCNONE 
AK067393CGCACCGCDDT domain containing protein. 
Os02g0562300AK073250GCGGTGCGGTGGGCTCalmodulin binding protein-like family protein. 
Os02g0586400006-066-D08CGCACCGCACCGTTGGATNONE 
006-073-A01CGCACCGCACCGTTGGATNONE 
J065088B17CGCACCGCACCGTTGGATNONE 
J075065L07CGCACCGCACCGTTGGATNONE 
J100017B20CGCACCGCACCGTTGGATNONE 
J100025B03CGCACCGCACCGTTGGATNONE 
Os02g0603800AK105762GCGGTGCGNONE 
AK120769GCGGTGCGSimilar to Isoprenoid biosynthesis-like protein (Fragment). 
Os02g0611500AK072083CGCACCGCSimilar to Eukaryotic initiation factor-like protein. 
Os02g0651300AK061454CGCACCGCNONE 
AK099767CGCACCGCConserved hypothetical protein. 
Os02g0653900006-024-H11CGCACCGCNONE 
006-069-F05CGCACCGCNONE 
012-005-H01CGCACCGCNONE 
AK064950CGCACCGCSimilar to Avr9/Cf-9 rapidly elicited protein 14 (Fragment). 
AK098925CGCACCGCNONE 
AK104793CGCACCGCNONE 
AK106154CGCACCGCNONE 
J013000P22CGCACCGCNONE 
J013002P22CGCACCGCNONE 
J013072L24CGCACCGCNONE 
J013110J23CGCACCGCNONE 
J013126I23CGCACCGCNONE 
J013160D23CGCACCGCNONE 
J023056H01CGCACCGCNONE 
J033058I09CGCACCGCNONE 
J065183H09CGCACCGCNONE 
J065214P06CGCACCGCNONE 
J075071L23CGCACCGCNONE 
J090042C11CGCACCGCNONE 
J090057H07CGCACCGCNONE 
J090071O22CGCACCGCNONE 
J100029M07CGCACCGCNONE 
J100040O18CGCACCGCNONE 
J100041P12CGCACCGCNONE 
J100047J02CGCACCGCNONE 
J100063L09CGCACCGCNONE 
J100065B12CGCACCGCNONE 
J100066N05CGCACCGCNONE 
J100080O21CGCACCGCNONE 
J100083F13CGCACCGCNONE 
J100087G04CGCACCGCNONE 
J100090J20CGCACCGCNONE 
J100090N08CGCACCGCNONE 
Os02g0681200006-024-F11CCAAGCCCACGACCCGCACCGCNONE 
006-051-H06CCAAGCCCACGACCCGCACCGCNONE 
006-062-F08CCAAGCCCACGACCCGCACCGCNONE 
009-172-G01CCAAGCCCACGACCCGCACCGCNONE 
AK071853CCAAGCCCACGACCCGCACCGCZinc finger, RING-type domain containing protein. 
AK099314CCAAGCCCACGACCCGCACCGCNONE 
AK104122CCAAGCCCACGACCCGCACCGCNONE 
Os02g0687500J065052K07GCGGTGCGConserved hypothetical protein. 
Os02g0694100J090034G11CGCACCGCACCyclin-like F-box domain containing protein. 
Os02g0709900AB110204CGCACCGCACPrefoldin domain containing protein. 
AK109259CGCACCGCACNONE 
J013093N22CGCACCGCACNONE 
J033116F21CGCACCGCACNONE 
Os02g0713700J043034B19GCGGTGCGNONE 
J065041I10GCGGTGCGNONE 
J065121M03GCGGTGCGNONE 
J065134C21GCGGTGCGProtein of unknown function DUF296 domain containing protein. 
J065186F18GCGGTGCGNONE 
J100033H10GCGGTGCGNONE 
J100043C12GCGGTGCGNONE 
J100048E07GCGGTGCGNONE 
J100087G13GCGGTGCGNONE 
J100090J08GCGGTGCGNONE 
Os02g0766700AK072062GCGGTGCGSimilar to Abscisic acid responsive elements-binding factor (ABA-responsive element binding protein 2) (AREB2). 
J100073F09GCGGTGCGNONE 
Os02g0795900012-075-B04CGCACCGCNONE 
AK105305CGCACCGCSimilar to DEAD box-like RNA helicase (Fragment). 
J090031C21CGCACCGCNONE 
Os02g0828800AK062497CGCACCGCACConserved hypothetical protein. 
Os03g0107700014-091-A02CGCACCGCNONE 
AK063743CGCACCGCSimilar to EL2 protein. 
D64038CGCACCGCNONE 
J065001A12CGCACCGCNONE 
J065046K10CGCACCGCNONE 
J065063C24CGCACCGCNONE 
J065094D16CGCACCGCNONE 
J065152A12CGCACCGCNONE 
J065158D05CGCACCGCNONE 
J065166L15CGCACCGCNONE 
J065190D04CGCACCGCNONE 
J075056F01CGCACCGCNONE 
J075148A07CGCACCGCNONE 
J080074L17CGCACCGCNONE 
J080094A13CGCACCGCNONE 
J090044B15CGCACCGCNONE 
J090065N04CGCACCGCNONE 
Os03g0114100AK108265CGCACCGCCCAAAAConserved hypothetical protein. 
Os03g0116800012-097-D10GCGGTGCGNONE 
016-024-H10GCGGTGCGNONE 
AK066955GCGGTGCGConserved hypothetical protein. 
AK068678GCGGTGCGNONE 
AK068678GCGGTGCGNONE 
AK104839GCGGTGCGNONE 
J013033G16GCGGTGCGNONE 
J013091C10GCGGTGCGNONE 
J013158H22GCGGTGCGNONE 
J013158H22GCGGTGCGNONE 
J023106K11GCGGTGCGNONE 
J065051O15GCGGTGCGNONE 
J065129G22GCGGTGCGNONE 
J075001K02GCGGTGCGNONE 
J075011O03GCGGTGCGNONE 
J075024K04GCGGTGCGNONE 
J075026E07GCGGTGCGNONE 
J075037O14GCGGTGCGNONE 
J075071D17GCGGTGCGNONE 
J075084M05GCGGTGCGNONE 
J075114B06GCGGTGCGNONE 
J075128C23GCGGTGCGNONE 
J075153A13GCGGTGCGNONE 
J075158A15GCGGTGCGNONE 
J075165P09GCGGTGCGNONE 
J075167M21GCGGTGCGNONE 
J075170F11GCGGTGCGNONE 
J075186F12GCGGTGCGNONE 
J075186L13GCGGTGCGNONE 
J075189A01GCGGTGCGNONE 
J075192D19GCGGTGCGNONE 
Os03g0129100003-009-E09CACGGCCCGCACCGCNONE 
AF384030CACGGCCCGCACCGCNONE 
AK098993CACGGCCCGCACCGCSeven transmembrane protein MLO2. 
AK111990CACGGCCCGCACCGCNONE 
J013098A12CACGGCCCGCACCGCNONE 
J023020M16CACGGCCCGCACCGCNONE 
J043001L02CACGGCCCGCACCGCNONE 
Os03g0132000AK105769CGCACCGCACSimilar to 4-coumarate-CoA ligase-like protein. 
AK121384CGCACCGCACNONE 
Os03g0136200004-011-E10CACCGCACCGCNONE 
006-067-A08CACCGCACCGCNONE 
011-007-E02CACCGCACCGCNONE 
011-099-H10CACCGCACCGCNONE 
012-044-D08CACCGCACCGCNONE 
013-045-G12CACCGCACCGCNONE 
013-062-C09CACCGCACCGCNONE 
013-072-F09CACCGCACCGCNONE 
013-085-B12CACCGCACCGCNONE 
013-097-E09CACCGCACCGCNONE 
013-097-F09CACCGCACCGCNONE 
014-013-C09CACCGCACCGCNONE 
014-082-D08CACCGCACCGCNONE 
015-071-A09CACCGCACCGCNONE 
AF042333CACCGCACCGCNONE 
AK060887CACCGCACCGCNONE 
AK121681CACCGCACCGC24-methylenesterol C-methyltransferase 2 (EC 2.1.1.143) (24-sterol C- methyltransferase 2) (Sterol-C-methyltransferase 2). 
J013073N14CACCGCACCGCNONE 
J013123F01CACCGCACCGCNONE 
J023050A02CACCGCACCGCNONE 
J033046H22CACCGCACCGCNONE 
J033070A11CACCGCACCGCNONE 
J065059G11CACCGCACCGCNONE 
J065068F10CACCGCACCGCNONE 
J065164A10CACCGCACCGCNONE 
J075031F07CACCGCACCGCNONE 
J075054J01CACCGCACCGCNONE 
J075086M04CACCGCACCGCNONE 
J075118K23CACCGCACCGCNONE 
J075122A09CACCGCACCGCNONE 
J075123D06CACCGCACCGCNONE 
J075129A22CACCGCACCGCNONE 
J075161E07CACCGCACCGCNONE 
J075179H04CACCGCACCGCNONE 
J075181C06CACCGCACCGCNONE 
J075186A12CACCGCACCGCNONE 
J090014H16CACCGCACCGCNONE 
J090045G17CACCGCACCGCNONE 
J090048B09CACCGCACCGCNONE 
J090052J23CACCGCACCGCNONE 
J090052K22CACCGCACCGCNONE 
J090059F10CACCGCACCGCNONE 
J090080F19CACCGCACCGCNONE 
J100039J08CACCGCACCGCNONE 
J100044K02CACCGCACCGCNONE 
J100051E16CACCGCACCGCNONE 
J100053F08CACCGCACCGCNONE 
J100056F07CACCGCACCGCNONE 
J100058A10CACCGCACCGCNONE 
Os03g0137400AK072057CGCACCGCGACACGTCACGTCTCNONE 
AK101118CGCACCGCGACACGTCACGTCTCProtein of unknown function DUF221 domain containing protein. 
J013129L02CGCACCGCGACACGTCACGTCTCNONE 
J033025H22CGCACCGCGACACGTCACGTCTCNONE 
J033034L15CGCACCGCGACACGTCACGTCTCNONE 
J033044F21CGCACCGCGACACGTCACGTCTCNONE 
J033046F15CGCACCGCGACACGTCACGTCTCNONE 
J033101I17CGCACCGCGACACGTCACGTCTCNONE 
J033150K16CGCACCGCGACACGTCACGTCTCNONE 
J065042G12CGCACCGCGACACGTCACGTCTCNONE 
J065083F17CGCACCGCGACACGTCACGTCTCNONE 
J100044G19CGCACCGCGACACGTCACGTCTCNONE 
Os03g0141200AK068968CGCACCGCSimilar to Beta-amylase PCT-BMYI (EC 3.2.1.2). 
AK100092CGCACCGCNONE 
J023003L18CGCACCGCNONE 
J023022K18CGCACCGCNONE 
J023107H13CGCACCGCNONE 
J023107K02CGCACCGCNONE 
Os03g0146000006-105-H06GCGGTGCGNONE 
AK061250GCGGTGCGSimilar to RAB1X. 
AK099130GCGGTGCGNONE 
J023043D11GCGGTGCGNONE 
J043009O17GCGGTGCGNONE 
Os03g0149400AK111396GCGGTGCGGTGCGProtein prenyltransferase domain containing protein. 
Os03g0181100AK067971GCCCAACCGCACCGCACNONE 
AK120087GCCCAACCGCACCGCACZIM domain containing protein. 
J013123K19GCCCAACCGCACCGCACNONE 
J100077H14GCCCAACCGCACCGCACNONE 
Os03g0188400AK107555CGCACCGCBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
Os03g0192600006-033-B01CGCACCGCNONE 
006-079-H12CGCACCGCNONE 
009-092-E03CGCACCGCNONE 
AK061461CGCACCGCNONE 
AK105970CGCACCGCPlant lipid transfer protein/Par allergen family protein. 
J065152D05CGCACCGCNONE 
J100056I22CGCACCGCNONE 
Os03g0212700009-144-B11CGCACCGCNONE 
AK060718CGCACCGCNONE 
Os03g0220300006-066-A07GCGGTGCGNONE 
AK061070GCGGTGCGNONE 
AK070005GCGGTGCGNONE 
AK120487GCGGTGCGConserved hypothetical protein. 
J013114B13GCGGTGCGNONE 
Os03g0293500015-054-D06CGCACCGCACNONE 
AK101594CGCACCGCACSimilar to Pyruvate decarboxylase isozyme 3 (EC 4.1.1.1) (PDC) (Fragment). 
AK119500CGCACCGCACNONE 
J033051F01CGCACCGCACNONE 
J090058D14CGCACCGCACNONE 
J100037N18CGCACCGCACNONE 
J100042J23CGCACCGCACNONE 
J100053E20CGCACCGCACNONE 
J100060G07CGCACCGCACNONE 
U27350CGCACCGCACNONE 
Os03g0298300AK061180CGCACCGCGCCACGTProtein of unknown function DUF588 family protein. 
AK099089CGCACCGCGCCACGTNONE 
Os03g0307900AK072469GCGGTGCGConserved hypothetical protein. 
Os03g0428800AK060233CGCACCGCTetratricopeptide-like helical domain containing protein. 
Os03g0607200013-002-F05GCGGTGCGNONE 
013-021-H08GCGGTGCGNONE 
013-038-E10GCGGTGCGNONE 
014-009-E05GCGGTGCGNONE 
014-034-H01GCGGTGCGNONE 
014-038-A08GCGGTGCGNONE 
014-072-G08GCGGTGCGNONE 
014-083-B06GCGGTGCGNONE 
014-088-G10GCGGTGCGNONE 
AK070268GCGGTGCGGibberellin regulated protein family protein. 
J023044E14GCGGTGCGNONE 
J065199F02GCGGTGCGNONE 
J075001C09GCGGTGCGNONE 
J075019F02GCGGTGCGNONE 
J075061J21GCGGTGCGNONE 
J075068G03GCGGTGCGNONE 
J075126F10GCGGTGCGNONE 
J075153F19GCGGTGCGNONE 
J080305I04GCGGTGCGNONE 
J080307F24GCGGTGCGNONE 
J080312E23GCGGTGCGNONE 
J080315M20GCGGTGCGNONE 
J080317E18GCGGTGCGNONE 
J090043I11GCGGTGCGNONE 
Os03g0656500AK121052CGCACCGCACGCGSimilar to K-exchanger-like protein. 
J065195N11CGCACCGCACGCGNONE 
J065197F16CGCACCGCACGCGNONE 
J075022O03CGCACCGCACGCGNONE 
J075056N16CGCACCGCACGCGNONE 
J075139P11CGCACCGCACGCGNONE 
Os03g0659300J065130F16GTGCGGTGCGGlyoxalase/bleomycin resistance protein/dioxygenase domain containing protein. 
Os03g0675300015-081-H08CGCACCGCACCGCNONE 
AK106417CGCACCGCACCGCAntihaemostatic protein domain containing protein. 
Os03g0716200Os03g0716200GCGACGCGCACCGCACCGCConserved hypothetical protein. 
Os03g0752700011-093-A02GTGCGGTGCGNONE 
AK122157GTGCGGTGCGHeat shock protein DnaJ, N-terminal domain containing protein. 
J013135C03GTGCGGTGCGNONE 
J033096O19GTGCGGTGCGNONE 
J033145P19GTGCGGTGCGNONE 
J065008K09GTGCGGTGCGNONE 
J065027J08GTGCGGTGCGNONE 
J065073H12GTGCGGTGCGNONE 
J065078G14GTGCGGTGCGNONE 
J065092L12GTGCGGTGCGNONE 
J065108D11GTGCGGTGCGNONE 
J065140G10GTGCGGTGCGNONE 
J065161D24GTGCGGTGCGNONE 
J065170F04GTGCGGTGCGNONE 
J075004K20GTGCGGTGCGNONE 
J075069F16GTGCGGTGCGNONE 
J075085B12GTGCGGTGCGNONE 
J075087D24GTGCGGTGCGNONE 
J075102G15GTGCGGTGCGNONE 
J075123M06GTGCGGTGCGNONE 
J090058D24GTGCGGTGCGNONE 
J090068I12GTGCGGTGCGNONE 
J090094A19GTGCGGTGCGNONE 
Os03g0762400AK071181CATCCACCGCACCGCSimilar to Peroxidase2 precursor (EC 1.11.1.7). 
J023084I20CATCCACCGCACCGCNONE 
J033039C18CATCCACCGCACCGCNONE 
J033108N03CATCCACCGCACCGCNONE 
J043017N16CATCCACCGCACCGCNONE 
J065026C13CATCCACCGCACCGCNONE 
J065045C01CATCCACCGCACCGCNONE 
J065045D11CATCCACCGCACCGCNONE 
J065050N09CATCCACCGCACCGCNONE 
J065058P21CATCCACCGCACCGCNONE 
J065075I20CATCCACCGCACCGCNONE 
J065077I17CATCCACCGCACCGCNONE 
J065081I20CATCCACCGCACCGCNONE 
J065085B14CATCCACCGCACCGCNONE 
J065101K21CATCCACCGCACCGCNONE 
J065112A17CATCCACCGCACCGCNONE 
J065112N13CATCCACCGCACCGCNONE 
J065118J02CATCCACCGCACCGCNONE 
J065123E01CATCCACCGCACCGCNONE 
J065134N12CATCCACCGCACCGCNONE 
J065139L04CATCCACCGCACCGCNONE 
J065141I11CATCCACCGCACCGCNONE 
J065161J24CATCCACCGCACCGCNONE 
J065164I10CATCCACCGCACCGCNONE 
J065171L01CATCCACCGCACCGCNONE 
J065178P21CATCCACCGCACCGCNONE 
J065185L24CATCCACCGCACCGCNONE 
J065219C04CATCCACCGCACCGCNONE 
J075029B07CATCCACCGCACCGCNONE 
J075033G20CATCCACCGCACCGCNONE 
J075054N01CATCCACCGCACCGCNONE 
J075068B22CATCCACCGCACCGCNONE 
J075096N11CATCCACCGCACCGCNONE 
J075098C11CATCCACCGCACCGCNONE 
J075115J22CATCCACCGCACCGCNONE 
J075127D11CATCCACCGCACCGCNONE 
J075156J21CATCCACCGCACCGCNONE 
J075166G08CATCCACCGCACCGCNONE 
J075166P17CATCCACCGCACCGCNONE 
J075170O18CATCCACCGCACCGCNONE 
J075181A16CATCCACCGCACCGCNONE 
J075195J11CATCCACCGCACCGCNONE 
Os03g0764200Os03g0764200GGGTGGGCGCACCGCNONE 
Os03g0773800006-117-H02CGCACCGCNONE 
AK064972CGCACCGCNONE 
AK067105CGCACCGCSimilar to Malate dehydrogenase, glyoxysomal precursor (EC 1.1.1.37) (mbNAD-MDH). 
AK104821CGCACCGCNONE 
J013001B17CGCACCGCNONE 
J013089E13CGCACCGCNONE 
J013091B15CGCACCGCNONE 
J013108B21CGCACCGCNONE 
J013153I05CGCACCGCNONE 
J023110L02CGCACCGCNONE 
J065023O13CGCACCGCNONE 
J065041G09CGCACCGCNONE 
J075092N22CGCACCGCNONE 
J075123H07CGCACCGCNONE 
J075161F04CGCACCGCNONE 
J080077G22CGCACCGCNONE 
Os03g0793700AK121667CGCACCGCCupin 1 domain containing protein. 
AY098743CGCACCGCNONE 
Os03g0796600003-113-D10CCCGGGCCCAGCGCACCGCCACGTCNONE 
011-076-B12CCCGGGCCCAGCGCACCGCCACGTCNONE 
AK105257CCCGGGCCCAGCGCACCGCCACGTCProtein of unknown function DUF506, plant family protein. 
J075105C03CCCGGGCCCAGCGCACCGCCACGTCNONE 
J080036O17CCCGGGCCCAGCGCACCGCCACGTCNONE 
J080064E16CCCGGGCCCAGCGCACCGCCACGTCNONE 
J080069E03CCCGGGCCCAGCGCACCGCCACGTCNONE 
J080079E23CCCGGGCCCAGCGCACCGCCACGTCNONE 
J090036H20CCCGGGCCCAGCGCACCGCCACGTCNONE 
J100029L10CCCGGGCCCAGCGCACCGCCACGTCNONE 
J100055G09CCCGGGCCCAGCGCACCGCCACGTCNONE 
Os03g0802200009-047-D08CGCACCGCNONE 
013-057-D02CGCACCGCNONE 
013-089-F02CGCACCGCNONE 
014-079-D02CGCACCGCNONE 
016-004-A11CGCACCGCNONE 
AK111769CGCACCGCConserved hypothetical protein. 
J075006H18CGCACCGCNONE 
J075060G07CGCACCGCNONE 
Os03g0808300006-053-B11CGCACCGCACCGCNONE 
006-057-A01CGCACCGCACCGCNONE 
006-090-F05CGCACCGCACCGCNONE 
006-106-G01CGCACCGCACCGCNONE 
006-120-D10CGCACCGCACCGCNONE 
009-139-H09CGCACCGCACCGCNONE 
AK109389CGCACCGCACCGCRemorin, C-terminal region domain containing protein. 
J033065F13CGCACCGCACCGCNONE 
J053045H15CGCACCGCACCGCNONE 
J065021C02CGCACCGCACCGCNONE 
J065021D01CGCACCGCACCGCNONE 
J065039B14CGCACCGCACCGCNONE 
J065064J22CGCACCGCACCGCNONE 
J065167I09CGCACCGCACCGCNONE 
J065170A13CGCACCGCACCGCNONE 
J065183J10CGCACCGCACCGCNONE 
J065202K10CGCACCGCACCGCNONE 
J065218F21CGCACCGCACCGCNONE 
J075028D07CGCACCGCACCGCNONE 
J100048J08CGCACCGCACCGCNONE 
J100050H06CGCACCGCACCGCNONE 
J100054M24CGCACCGCACCGCNONE 
J100068G07CGCACCGCACCGCNONE 
J100079F23CGCACCGCACCGCNONE 
Os03g0815100006-022-A04CGCACCGCNONE 
006-032-F09CGCACCGCNONE 
012-044-F04CGCACCGCNONE 
012-051-A11CGCACCGCNONE 
014-094-A11CGCACCGCNONE 
016-048-F09CGCACCGCNONE 
AK067690CGCACCGCSimilar to OsNAC6 protein. 
AK099245CGCACCGCNONE 
AK104551CGCACCGCNONE 
AK104712CGCACCGCNONE 
AY596808CGCACCGCNONE 
J013023I21CGCACCGCNONE 
J013027O21CGCACCGCNONE 
J013027P22CGCACCGCNONE 
J013039E09CGCACCGCNONE 
J013070D18CGCACCGCNONE 
J013120D02CGCACCGCNONE 
J013124K09CGCACCGCNONE 
J023010G16CGCACCGCNONE 
J023012B04CGCACCGCNONE 
J023012O20CGCACCGCNONE 
J023019D19CGCACCGCNONE 
J023045H15CGCACCGCNONE 
J023049M06CGCACCGCNONE 
J023052G12CGCACCGCNONE 
J023052L12CGCACCGCNONE 
J023056N15CGCACCGCNONE 
J023082P03CGCACCGCNONE 
J023130J01CGCACCGCNONE 
J023136J03CGCACCGCNONE 
J033032A20CGCACCGCNONE 
J033048C16CGCACCGCNONE 
J033081C19CGCACCGCNONE 
J033086J21CGCACCGCNONE 
J033139O19CGCACCGCNONE 
J043013G20CGCACCGCNONE 
J043040J11CGCACCGCNONE 
J065010G15CGCACCGCNONE 
J065020E20CGCACCGCNONE 
J065039K24CGCACCGCNONE 
J065056M11CGCACCGCNONE 
J065065I09CGCACCGCNONE 
J065103L22CGCACCGCNONE 
J065117P20CGCACCGCNONE 
J065167C22CGCACCGCNONE 
J065168L06CGCACCGCNONE 
J065182A21CGCACCGCNONE 
J065191E11CGCACCGCNONE 
J065215E01CGCACCGCNONE 
J090015D12CGCACCGCNONE 
J090024E16CGCACCGCNONE 
J090077P07CGCACCGCNONE 
J100024A01CGCACCGCNONE 
J100029O14CGCACCGCNONE 
J100036E17CGCACCGCNONE 
J100059P22CGCACCGCNONE 
J100067K06CGCACCGCNONE 
J100080A22CGCACCGCNONE 
J100086A03CGCACCGCNONE 
Os03g0835600AK101677GCGGTGCGAcyl-coA-binding protein, ACBP family protein. 
Os03g0853800006-064-F07GCGGTGCGNONE 
006-069-B11GCGGTGCGNONE 
006-104-B10GCGGTGCGNONE 
AK059849GCGGTGCGNONE 
AK102872GCGGTGCGNONE 
AK120043GCGGTGCGProtein of unknown function DUF1301 family protein. 
J033112B07GCGGTGCGNONE 
J053059J20GCGGTGCGNONE 
J065155F15GCGGTGCGNONE 
Os03g0856500AK061449GTGCGGTGCGSimilar to Plastid-specific 30S ribosomal protein 1, chloroplast precursor (CS- S5) (CS5) (S22) (Ribosomal protein 1) (PSRP-1). 
AK071750GTGCGGTGCGNONE 
AK104733GTGCGGTGCGNONE 
Os04g0194500AK121164CGCACCGCSimilar to ABC transporter-like protein. 
Os04g0231200J075131N11CGCACCGCNONE 
J075169M11CGCACCGCNONE 
Os04g0387600009-148-E01CGCACCGCNONE 
009-155-A11CGCACCGCNONE 
009-175-F04CGCACCGCNONE 
AK063862CGCACCGCConserved hypothetical protein. 
J065035F12CGCACCGCNONE 
J065162C13CGCACCGCNONE 
J065169L19CGCACCGCNONE 
Os04g0477500AK063950CGCACCGCACCGCNONE 
AK063950CGCACCGCCCACCACNONE 
AK067372CGCACCGCACCGCGlycosyl transferase, family 17 protein. 
AK067372CGCACCGCCCACCACGlycosyl transferase, family 17 protein. 
AK100897CGCACCGCACCGCNONE 
AK100897CGCACCGCCCACCACNONE 
J013106K01CGCACCGCACCGCNONE 
J013106K01CGCACCGCCCACCACNONE 
J043012L06CGCACCGCACCGCNONE 
J043012L06CGCACCGCCCACCACNONE 
J065025M07CGCACCGCACCGCNONE 
J065025M07CGCACCGCCCACCACNONE 
J065025M08CGCACCGCACCGCNONE 
J065025M08CGCACCGCCCACCACNONE 
Os04g0489600003-130-E01CGCACCGCACNONE 
AK062301CGCACCGCACNONE 
AK068039CGCACCGCACBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
Os04g0531100013-046-D02CGCACCGCNONE 
AF090698CGCACCGCNONE 
AK063584CGCACCGCC2 calcium/lipid-binding region, CaLB domain containing protein. 
J065025M20CGCACCGCNONE 
J065028L15CGCACCGCNONE 
J065048O03CGCACCGCNONE 
J065053K10CGCACCGCNONE 
J065072H10CGCACCGCNONE 
J065081H10CGCACCGCNONE 
J065082N17CGCACCGCNONE 
J065104K08CGCACCGCNONE 
J065106M03CGCACCGCNONE 
J065119I05CGCACCGCNONE 
J065122F04CGCACCGCNONE 
J065140N24CGCACCGCNONE 
J065153G09CGCACCGCNONE 
J065171H07CGCACCGCNONE 
J065172M23CGCACCGCNONE 
J065173K13CGCACCGCNONE 
J065177D22CGCACCGCNONE 
J065189H10CGCACCGCNONE 
J065198H24CGCACCGCNONE 
J065204D19CGCACCGCNONE 
J075006C08CGCACCGCNONE 
J075029I08CGCACCGCNONE 
J075039A16CGCACCGCNONE 
J075107I24CGCACCGCNONE 
J075135M22CGCACCGCNONE 
J075181P06CGCACCGCNONE 
J075190O11CGCACCGCNONE 
J075193F04CGCACCGCNONE 
Os04g0560600Os04g0560600CGCACCGCSimilar to Calcium-dependent protein kinase 3 (Fragment). 
Os04g0574100006-087-B01CGCACCGCNONE 
AK061150CGCACCGCNONE 
AK069178CGCACCGCExostosin-like family protein. 
AK121041CGCACCGCNONE 
J023008D04CGCACCGCNONE 
J023052A13CGCACCGCNONE 
J065046P18CGCACCGCNONE 
J065105D10CGCACCGCNONE 
Os04g0630800AK067411CGCACCGCACSimilar to Anthocyanidin reductase. 
J013104E10CGCACCGCACNONE 
J065017A11CGCACCGCACNONE 
J065042H18CGCACCGCACNONE 
J065058D07CGCACCGCACNONE 
J065079F24CGCACCGCACNONE 
J065114F06CGCACCGCACNONE 
J065131N19CGCACCGCACNONE 
J065160M03CGCACCGCACNONE 
J075033N11CGCACCGCACNONE 
J075065B11CGCACCGCACNONE 
J075074A20CGCACCGCACNONE 
J075108C15CGCACCGCACNONE 
J100065B08CGCACCGCACNONE 
J100083G02CGCACCGCACNONE 
Os04g0661200AK102842GCCACGTGGGCCCGCACCGCProtein of unknown function DUF941 family protein. 
J033075E19GCCACGTGGGCCCGCACCGCNONE 
J033109O19GCCACGTGGGCCCGCACCGCNONE 
J065002J12GCCACGTGGGCCCGCACCGCNONE 
J065026E22GCCACGTGGGCCCGCACCGCNONE 
J065061F05GCCACGTGGGCCCGCACCGCNONE 
J065068D22GCCACGTGGGCCCGCACCGCNONE 
J065072N14GCCACGTGGGCCCGCACCGCNONE 
J065085F02GCCACGTGGGCCCGCACCGCNONE 
J075055G19GCCACGTGGGCCCGCACCGCNONE 
J075105B14GCCACGTGGGCCCGCACCGCNONE 
J075118M17GCCACGTGGGCCCGCACCGCNONE 
J075193H02GCCACGTGGGCCCGCACCGCNONE 
J100040O05GCCACGTGGGCCCGCACCGCNONE 
J100064I04GCCACGTGGGCCCGCACCGCNONE 
Os05g0155100006-075-B02CGCACCGCNONE 
AK061929CGCACCGCNONE 
AK102810CGCACCGCNONE 
AK120877CGCACCGCSimilar to 60S ribosomal protein L18. 
J013023E03CGCACCGCNONE 
J013038C16CGCACCGCNONE 
J013120M14CGCACCGCNONE 
J013153B04CGCACCGCNONE 
J013159B07CGCACCGCNONE 
J023012A02CGCACCGCNONE 
J023027F08CGCACCGCNONE 
J023027I12CGCACCGCNONE 
J023120F05CGCACCGCNONE 
J023138O03CGCACCGCNONE 
J023142H13CGCACCGCNONE 
J023143P06CGCACCGCNONE 
J033023P09CGCACCGCNONE 
J033035O14CGCACCGCNONE 
J033042N19CGCACCGCNONE 
J033043B12CGCACCGCNONE 
J033065D10CGCACCGCNONE 
J033081A12CGCACCGCNONE 
J033084N05CGCACCGCNONE 
J033085M03CGCACCGCNONE 
J033112D15CGCACCGCNONE 
J033114O07CGCACCGCNONE 
J033119D15CGCACCGCNONE 
J033140E06CGCACCGCNONE 
J033141K23CGCACCGCNONE 
J043040I22CGCACCGCNONE 
J053050B21CGCACCGCNONE 
J053065I18CGCACCGCNONE 
J053074O16CGCACCGCNONE 
J065072K13CGCACCGCNONE 
J065211I09CGCACCGCNONE 
J090004K04CGCACCGCNONE 
J090016L06CGCACCGCNONE 
J090040F22CGCACCGCNONE 
J090063F22CGCACCGCNONE 
J090081J09CGCACCGCNONE 
J100032A10CGCACCGCNONE 
J100037G20CGCACCGCNONE 
J100056O10CGCACCGCNONE 
J100071D10CGCACCGCNONE 
J100075K13CGCACCGCNONE 
J100079F16CGCACCGCNONE 
J100080O16CGCACCGCNONE 
J100086N05CGCACCGCNONE 
Os05g0358500AK060575CGCACCGCGACGCACGCCACNONE 
AK100777CGCACCGCGACGCACGCCACProtein phosphatase 2C-like domain containing protein. 
Os05g0367900Os05g0367900CGCACCGCHarpin-induced 1 domain containing protein. 
Os05g0442400AK107134CGCACCGCSimilar to MybSt1. 
Os05g0455600AK060152CGCACCGCACGCGPrenylated rab acceptor PRA1 family protein. 
AK103269CGCACCGCACGCGNONE 
AK105995CGCACCGCACGCGNONE 
J023109E13CGCACCGCACGCGNONE 
J023120K13CGCACCGCACGCGNONE 
J033124H03CGCACCGCACGCGNONE 
Os05g0465100AK065821CGCACCGCGCGCGACRabGAP/TBC domain containing protein. 
Os05g0522500AF372831CGCACCGCACNONE 
AK065207CGCACCGCACSimilar to Hexokinase 1 (EC 2.7.1.1). 
J013002F14CGCACCGCACNONE 
J013059E21CGCACCGCACNONE 
J023039E02CGCACCGCACNONE 
J023061P10CGCACCGCACNONE 
J023093D12CGCACCGCACNONE 
J023093H05CGCACCGCACNONE 
J033052F21CGCACCGCACNONE 
J043012F23CGCACCGCACNONE 
Os05g0541200AK068633CGCACCGCConserved hypothetical protein 730 family protein. 
J013157L23CGCACCGCNONE 
Os06g0152800003-125-D04CGCACCGCNONE 
AK099578CGCACCGCConserved hypothetical protein. 
Os06g0217300AK111859CGCACCGCACSimilar to Transcription factor MADS55. 
AY345223CGCACCGCACNONE 
Os06g0498400AK103463GCGGTGCGSimilar to Alpha-glucan water dikinase, chloroplast precursor (EC 2.7.9.4) (Starch-related R1 protein). 
Os06g0553100J065130H10CGCACCGCNONE 
J075102G23CGCACCGCNONE 
J075147H23CGCACCGCHeat shock factor (HSF)-type, DNA-binding domain containing protein. 
Os06g0602600AK121619CGCACCGCAlba, DNA/RNA-binding protein family protein. 
J033044O03CGCACCGCNONE 
J043036G04CGCACCGCNONE 
J075107E08CGCACCGCNONE 
J090060N14CGCACCGCNONE 
J090094K04CGCACCGCNONE 
Os06g0717600AK061850GCGGTGCGNONE 
AK067113GCGGTGCGZinc finger, RING-type domain containing protein. 
Os07g0108300003-106-A05GCGGTGCGNONE 
AK060835GCGGTGCGNONE 
Os07g0184900AK102066TCGGCCCGTGGGCCGTGTTGGGCCGAGGCCCACGTGGGAGTGGGAAGGCCCACGCACCGCSimilar to Ku70-like protein. 
Os07g0294800AK065831CGCACCGCConserved hypothetical protein. 
J013037A06CGCACCGCNONE 
J065191M21CGCACCGCNONE 
Os07g0297400AK059367GCGGTGCGNONE 
AK101219GCGGTGCGConserved hypothetical protein. 
J033031C14GCGGTGCGNONE 
J033133E01GCGGTGCGNONE 
J100053J24GCGGTGCGNONE 
J100058N23GCGGTGCGNONE 
Os07g0406300AK064867GCGGTGCGSimilar to Glucose-6-phosphate 1-dehydrogenase precursor (EC 1.1.1.49). 
AK099891GCGGTGCGNONE 
AY339367GCGGTGCGNONE 
Os07g0564600AK061125GCGGTGCGNONE 
AK102110GCGGTGCGSimilar to Secretory carrier membrane protein. 
Os07g0568600AK073000CGCACCGCNONE 
J013149I06CGCACCGCNONE 
J023001B19CGCACCGCNONE 
J023048N08CGCACCGCNONE 
J023103E22CGCACCGCNONE 
J023105O15CGCACCGCNONE 
J023140F09CGCACCGCNONE 
J023142J02CGCACCGCNONE 
J023150P10CGCACCGCNONE 
J033023P10CGCACCGCNONE 
J033095G19CGCACCGCNONE 
J033136G24CGCACCGCNONE 
J043034O10CGCACCGCNONE 
J065211F12CGCACCGCNONE 
J075006H24CGCACCGCNONE 
J075028C06CGCACCGCNONE 
J075073F13CGCACCGCNONE 
J075075E01CGCACCGCNONE 
J075080K13CGCACCGCNONE 
J075106I16CGCACCGCNONE 
J075121F22CGCACCGCNONE 
J075134L06CGCACCGCNONE 
J075170G20CGCACCGCNONE 
J090020G23CGCACCGCNONE 
J090052D22CGCACCGCNONE 
J090067K16CGCACCGCNONE 
J100037C17CGCACCGCNONE 
Os07g0568700005-009-E12CACCGCACCGCNONE 
006-100-D05CACCGCACCGCNONE 
AF466357CACCGCACCGCNONE 
AK061685CACCGCACCGCNONE 
AK101897CACCGCACCGCPolygalacturonase inhibitor 1 precursor (Polygalacturonase-inhibiting protein) (Floral organ regulator 1). 
J013067A12CACCGCACCGCNONE 
J013129M22CACCGCACCGCNONE 
J013170I15CACCGCACCGCNONE 
J023008C13CACCGCACCGCNONE 
J023010N01CACCGCACCGCNONE 
J023024B08CACCGCACCGCNONE 
J023026P11CACCGCACCGCNONE 
J023030D12CACCGCACCGCNONE 
J023031A19CACCGCACCGCNONE 
J023061K19CACCGCACCGCNONE 
J023065P08CACCGCACCGCNONE 
J023074J10CACCGCACCGCNONE 
J023078B17CACCGCACCGCNONE 
J023080N22CACCGCACCGCNONE 
J023098E21CACCGCACCGCNONE 
J023101G13CACCGCACCGCNONE 
J023106D07CACCGCACCGCNONE 
J023123F20CACCGCACCGCNONE 
J023133B22CACCGCACCGCNONE 
J023148C22CACCGCACCGCNONE 
J033060O10CACCGCACCGCNONE 
J033068F12CACCGCACCGCNONE 
J033070P18CACCGCACCGCNONE 
J033075F21CACCGCACCGCNONE 
J033079P04CACCGCACCGCNONE 
J033082B10CACCGCACCGCNONE 
J033086E07CACCGCACCGCNONE 
J033108N11CACCGCACCGCNONE 
J033122I16CACCGCACCGCNONE 
J033145B19CACCGCACCGCNONE 
J043040A18CACCGCACCGCNONE 
J065081A15CACCGCACCGCNONE 
J080004O13CACCGCACCGCNONE 
J080005J19CACCGCACCGCNONE 
J080011E13CACCGCACCGCNONE 
J080014F24CACCGCACCGCNONE 
J080021L01CACCGCACCGCNONE 
J080025E09CACCGCACCGCNONE 
J080037I21CACCGCACCGCNONE 
J080039G24CACCGCACCGCNONE 
J080044I04CACCGCACCGCNONE 
J080053A18CACCGCACCGCNONE 
J080053C03CACCGCACCGCNONE 
J080054D10CACCGCACCGCNONE 
J080058J03CACCGCACCGCNONE 
J080068I04CACCGCACCGCNONE 
J080077G15CACCGCACCGCNONE 
J080086L13CACCGCACCGCNONE 
J080092F14CACCGCACCGCNONE 
J080092I21CACCGCACCGCNONE 
J080094G12CACCGCACCGCNONE 
J090003H04CACCGCACCGCNONE 
J090031A07CACCGCACCGCNONE 
Os07g0596600AK067238CGCACCGCSimilar to Cdc2MsC protein. 
Os07g0672500AK067432CGCACCGCACCGCACSMAD/FHA domain containing protein. 
AK119940CGCACCGCACCGCACNONE 
Os07g0682800AK066262CGCACCGCSimilar to Apyrase-like protein. 
Os08g0267900AK107040CGCACCGCConserved hypothetical protein. 
Os08g0345700012-051-H01CGCACCGCACNONE 
AK099939CGCACCGCACSimilar to Fructose-6-phosphate 1-phosphotransferase (Fragment). 
AK101073CGCACCGCACNONE 
AY224499CGCACCGCACNONE 
J023023P15CGCACCGCACNONE 
J023150I11CGCACCGCACNONE 
J033027K12CGCACCGCACNONE 
J033096J12CGCACCGCACNONE 
J033120O05CGCACCGCACNONE 
J033128J22CGCACCGCACNONE 
J033135H10CGCACCGCACNONE 
J033148L22CGCACCGCACNONE 
J065112J19CGCACCGCACNONE 
J065132K06CGCACCGCACNONE 
J065141B09CGCACCGCACNONE 
J090069F12CGCACCGCACNONE 
J100022K08CGCACCGCACNONE 
J100025F21CGCACCGCACNONE 
J100026I24CGCACCGCACNONE 
J100057F02CGCACCGCACNONE 
J100074F15CGCACCGCACNONE 
Os08g0409500AK109792CGCACCGCACVQ domain containing protein. 
Os08g0414300AK072217CGCACCGCConserved hypothetical protein. 
J065039C07CGCACCGCNONE 
J065098N11CGCACCGCNONE 
J065120J15CGCACCGCNONE 
J075076H12CGCACCGCNONE 
J075101N16CGCACCGCNONE 
J080010A07CGCACCGCNONE 
J080023C16CGCACCGCNONE 
J080027G22CGCACCGCNONE 
J080053D02CGCACCGCNONE 
J080065E17CGCACCGCNONE 
J080068C15CGCACCGCNONE 
J090061J10CGCACCGCNONE 
Os08g0438100AK107904GCGGTGCGSimilar to ZF-HD homeobox protein. 
Os08g0441500006-053-D04GCCACACGCGGTGCGNONE 
006-120-F03GCCACACGCGGTGCGNONE 
AK072872GCCACACGCGGTGCGSimilar to Cinnamoyl-CoA reductase. 
AK102061GCCACACGCGGTGCGNONE 
AK105802GCCACACGCGGTGCGNONE 
AK105870GCCACACGCGGTGCGNONE 
J023108K19GCCACACGCGGTGCGNONE 
J023143B20GCCACACGCGGTGCGNONE 
J033119I24GCCACACGCGGTGCGNONE 
J043029L11GCCACACGCGGTGCGNONE 
J065045L03GCCACACGCGGTGCGNONE 
J065077B13GCCACACGCGGTGCGNONE 
J065213C08GCCACACGCGGTGCGNONE 
J075004B13GCCACACGCGGTGCGNONE 
J075009D18GCCACACGCGGTGCGNONE 
J075028F01GCCACACGCGGTGCGNONE 
J075028F02GCCACACGCGGTGCGNONE 
J075061I19GCCACACGCGGTGCGNONE 
J075129B20GCCACACGCGGTGCGNONE 
J075129I17GCCACACGCGGTGCGNONE 
J075157E11GCCACACGCGGTGCGNONE 
J080005B20GCCACACGCGGTGCGNONE 
J080010G02GCCACACGCGGTGCGNONE 
J080012F23GCCACACGCGGTGCGNONE 
J080013H17GCCACACGCGGTGCGNONE 
J080013O09GCCACACGCGGTGCGNONE 
J080016J07GCCACACGCGGTGCGNONE 
J080016J11GCCACACGCGGTGCGNONE 
J080017C17GCCACACGCGGTGCGNONE 
J080024D05GCCACACGCGGTGCGNONE 
J080024D23GCCACACGCGGTGCGNONE 
J080024N24GCCACACGCGGTGCGNONE 
J080025J02GCCACACGCGGTGCGNONE 
J080025M18GCCACACGCGGTGCGNONE 
J080026G22GCCACACGCGGTGCGNONE 
J080038O03GCCACACGCGGTGCGNONE 
J080039A12GCCACACGCGGTGCGNONE 
J080040A10GCCACACGCGGTGCGNONE 
J080040B19GCCACACGCGGTGCGNONE 
J080044L12GCCACACGCGGTGCGNONE 
J080045L03GCCACACGCGGTGCGNONE 
J080046E07GCCACACGCGGTGCGNONE 
J080048I23GCCACACGCGGTGCGNONE 
J080050D21GCCACACGCGGTGCGNONE 
J080051F06GCCACACGCGGTGCGNONE 
J080051O07GCCACACGCGGTGCGNONE 
J080053H15GCCACACGCGGTGCGNONE 
J080054G19GCCACACGCGGTGCGNONE 
J080055G12GCCACACGCGGTGCGNONE 
J080055M14GCCACACGCGGTGCGNONE 
J080057A07GCCACACGCGGTGCGNONE 
J080060F15GCCACACGCGGTGCGNONE 
J080060I09GCCACACGCGGTGCGNONE 
J080060L20GCCACACGCGGTGCGNONE 
J080061G05GCCACACGCGGTGCGNONE 
J080066C16GCCACACGCGGTGCGNONE 
J080067E20GCCACACGCGGTGCGNONE 
J080068F18GCCACACGCGGTGCGNONE 
J080069D21GCCACACGCGGTGCGNONE 
J080079D15GCCACACGCGGTGCGNONE 
J080079M07GCCACACGCGGTGCGNONE 
J080080D24GCCACACGCGGTGCGNONE 
J080080P21GCCACACGCGGTGCGNONE 
J080084G21GCCACACGCGGTGCGNONE 
J080084L07GCCACACGCGGTGCGNONE 
J080089L22GCCACACGCGGTGCGNONE 
J080090P15GCCACACGCGGTGCGNONE 
J080091G06GCCACACGCGGTGCGNONE 
J080092H02GCCACACGCGGTGCGNONE 
J080092O09GCCACACGCGGTGCGNONE 
J080093D01GCCACACGCGGTGCGNONE 
J090082D09GCCACACGCGGTGCGNONE 
J100040B01GCCACACGCGGTGCGNONE 
J100067F14GCCACACGCGGTGCGNONE 
Os08g0537900AK119425GCGGTGCGNONE 
AY341827GCGGTGCGSimilar to Ethylene-responsive transcription factor 3 (Ethylene-responsive element binding factor 3) (EREBP-3) (AtERF3). 
Os08g0565800009-034-G02AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCANONE 
009-034-G02CGCACCGCNONE 
009-111-D12AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCANONE 
009-111-D12CGCACCGCNONE 
AK062431AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCASimilar to Glutaredoxin. 
AK062431CGCACCGCSimilar to Glutaredoxin. 
AK062820AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCANONE 
AK062820CGCACCGCNONE 
J075022E05AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCANONE 
J075022E05CGCACCGCNONE 
J075066F07AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCANONE 
J075066F07CGCACCGCNONE 
J075146B21AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCANONE 
J075146B21CGCACCGCNONE 
Os09g0251800006-100-E12CGCACCGCNONE 
AK061218CGCACCGCC2 calcium/lipid-binding region, CaLB domain containing protein. 
AK104010CGCACCGCNONE 
J065048A02CGCACCGCNONE 
J065073P10CGCACCGCNONE 
J065075B09CGCACCGCNONE 
J065112B05CGCACCGCNONE 
J090014H10CGCACCGCNONE 
Os09g0325700011-041-G03GCGGTGCGNONE 
AK063334GCGGTGCGSimilar to Protein phpsphatase 2C (PP2C) (EC 3.1.3.16). 
J080317M24GCGGTGCGNONE 
Os09g0394300AK105580GCGGTGCGGlycoside hydrolase, family 9 protein. 
J100046E13GCGGTGCGNONE 
J100049L10GCGGTGCGNONE 
J100074H21GCGGTGCGNONE 
J100090G03GCGGTGCGNONE 
Os09g0418000006-022-F01CGCACCGCACNONE 
006-038-G10CGCACCGCACNONE 
006-089-G04CGCACCGCACNONE 
006-098-F07CGCACCGCACNONE 
AK061220CGCACCGCACNONE 
AK061493CGCACCGCACNONE 
AK100881CGCACCGCACNONE 
AK119760CGCACCGCACProtein kinase-like domain containing protein. 
J023127H10CGCACCGCACNONE 
J033122J01CGCACCGCACNONE 
J065162D08CGCACCGCACNONE 
J065214P03CGCACCGCACNONE 
J090009B17CGCACCGCACNONE 
J090093C21CGCACCGCACNONE 
J100067C01CGCACCGCACNONE 
J100067P06CGCACCGCACNONE 
Os09g0423700AK061595CGCACCGCConserved hypothetical protein. 
Os09g0438000AK109935CGCACCGCACCGCNONE 
AK120739CGCACCGCACCGCSimilar to RbohAOsp (Fragment). 
Os09g0439400AK121407ATCCAACGGCTGCGGTGCGVirulence factor, pectin lyase fold family protein. 
Os09g0456200015-025-E01CGCACCGCNONE 
AK065873CGCACCGCSimilar to BZIP transcription factor ABI5. 
J013049N23CGCACCGCNONE 
J033128E10CGCACCGCNONE 
Os09g0461500006-107-E02GTGCGGTGCGCCCAGCCNONE 
011-089-D02GTGCGGTGCGCCCAGCCNONE 
AK063400GTGCGGTGCGCCCAGCCNONE 
AK102328GTGCGGTGCGCCCAGCCEsterase/lipase/thioesterase domain containing protein. 
J033090L22GTGCGGTGCGCCCAGCCNONE 
J065031O14GTGCGGTGCGCCCAGCCNONE 
J065083D22GTGCGGTGCGCCCAGCCNONE 
J065182N14GTGCGGTGCGCCCAGCCNONE 
J065190H22GTGCGGTGCGCCCAGCCNONE 
J065219H11GTGCGGTGCGCCCAGCCNONE 
J075007O22GTGCGGTGCGCCCAGCCNONE 
J075025E09GTGCGGTGCGCCCAGCCNONE 
J075041K24GTGCGGTGCGCCCAGCCNONE 
J075046F11GTGCGGTGCGCCCAGCCNONE 
J090032E12GTGCGGTGCGCCCAGCCNONE 
Os09g0476100AK099938CGCACCGCACRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os09g0502500AK109664GTGCGGTGCGAlcohol dehydrogenase superfamily, zinc-containing protein. 
Os09g0505300AK061352GCGGTGCGGTGSimilar to Br FatA1. 
Os09g0526700011-075-B12CGCACCGCNONE 
AB097460CGCACCGCNONE 
AK073610CGCACCGCSimilar to UDP-glucose 4-epimerase (EC 5.1.3.2) (Galactowaldenase) (UDP-galactose 4-epimerase). 
AK104977CGCACCGCNONE 
Os09g0535100AK069888CGCACCGCZinc finger, RING-type domain containing protein. 
J100027B09CGCACCGCNONE 
J100038A04CGCACCGCNONE 
J100059F10CGCACCGCNONE 
Os11g0602900006-069-F01CGCACCGCGCACGCGNONE 
006-088-E03CGCACCGCGCACGCGNONE 
AK059904CGCACCGCGCACGCGNONE 
AK068821CGCACCGCGCACGCGPeptidyl-prolyl cis-trans isomerase, cyclophilin type domain containing protein. 
AK104231CGCACCGCGCACGCGNONE 
J053052O17CGCACCGCGCACGCGNONE 
J065060I12CGCACCGCGCACGCGNONE 
J065063E04CGCACCGCGCACGCGNONE 
J065065K12CGCACCGCGCACGCGNONE 
J065097O13CGCACCGCGCACGCGNONE 
J065149K01CGCACCGCGCACGCGNONE 
J065176B15CGCACCGCGCACGCGNONE 
J090051M01CGCACCGCGCACGCGNONE 
Os11g0708000006-046-G03CGCACCGCNONE 
AK072065CGCACCGCNONE 
AK120102CGCACCGCConserved hypothetical protein. 
J013022N13CGCACCGCNONE 
J013062I09CGCACCGCNONE 
J013066H01CGCACCGCNONE 
J013067A19CGCACCGCNONE 
J033107A16CGCACCGCNONE 
J065068A18CGCACCGCNONE 
J065118D08CGCACCGCNONE 
J075056H13CGCACCGCNONE 
J075156I15CGCACCGCNONE 
J100045J12CGCACCGCNONE 
Os11g0708600AK066096CGCACCGCACNONE 
AK072117CGCACCGCACSimilar to RECQL1 protein. 
J075092G05CGCACCGCACNONE 
J075093M01CGCACCGCACNONE 
J075147H14CGCACCGCACNONE 
J075158E01CGCACCGCACNONE 
J075194L18CGCACCGCACNONE 
J090085H06CGCACCGCACNONE 
Os12g0236400AK059754GCGGTGCGNONE 
AK069870GCGGTGCGNONE 
D10334GCGGTGCGAdenylate kinase A (EC 2.7.4.3) (ATP-AMP transphosphorylase). 
D10429GCGGTGCGNONE 
J023039H09GCGGTGCGNONE 
J033075J04GCGGTGCGNONE 
J033088L16GCGGTGCGNONE 
J053037D11GCGGTGCGNONE 
J090084M20GCGGTGCGNONE 
J100078B20GCGGTGCGNONE 
Os12g0510500AK066140GTGCGGTGCGDisease resistance protein family protein. 
AK098997GTGCGGTGCGNONE 
J013051F22GTGCGGTGCGNONE 
Os12g0638500AK072720CGCACCGCConserved hypothetical protein. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.