version

Summary of OsREG555 (All List)

OrganismOryza sativa  
IDOsREG555  
SequenceCGCACGCG  
Annotation  
PPDB Motif 
PLACE Motif 
Total Entry Count1346  

Entry Sequences (1346 entries)

LocusGene modelSequenceDescription
Os01g0135700009-094-D06CGCGTGCGNONE 
AK062711CGCGTGCGFlagellar calcium-binding protein (calflagin) family protein. 
J065058O05CGCGTGCGNONE 
J065183A01CGCGTGCGNONE 
Os01g0139700J065118K13CGCACGCGConserved hypothetical protein. 
Os01g0167100009-183-G08CGCACGCGNONE 
AK063153CGCACGCGNONE 
J065154C02CGCACGCGNONE 
Os01g0179300AB118015CGCGTGCGNONE 
AK066179CGCGTGCGConserved hypothetical protein. 
J013027I24CGCGTGCGNONE 
J013057C04CGCGTGCGNONE 
J013114A12CGCGTGCGNONE 
J033044D13CGCGTGCGNONE 
J033088C17CGCGTGCGNONE 
J065079P13CGCGTGCGNONE 
J065097I15CGCGTGCGNONE 
J100025A19CGCGTGCGNONE 
J100027L07CGCGTGCGNONE 
J100035E12CGCGTGCGNONE 
J100076G01CGCGTGCGNONE 
Os01g0191800AK061360CGCACGCGNONE 
Os01g0205900006-057-B04CGCACGCGACGCGACNONE 
AK060687CGCACGCGACGCGACNONE 
AK105932CGCACGCGACGCGACSimilar to Class III peroxidase GvPx2b (Fragment). 
J033143I12CGCACGCGACGCGACNONE 
J075013J08CGCACGCGACGCGACNONE 
J075090B11CGCACGCGACGCGACNONE 
J075143C17CGCACGCGACGCGACNONE 
J075147O13CGCACGCGACGCGACNONE 
J075161L02CGCACGCGACGCGACNONE 
Os01g0238500006-086-E04CGCACGCGNONE 
AK067076CGCACGCGSimilar to Branched-chain-amino-acid aminotransferase-like protein 3, chloroplast precursor. 
AK104302CGCACGCGNONE 
J013093D15CGCACGCGNONE 
J065038O05CGCACGCGNONE 
J075089I20CGCACGCGNONE 
J075122B01CGCACGCGNONE 
J090086G20CGCACGCGNONE 
Os01g0242600AK067756CGCGTGCGC2 calcium/lipid-binding region, CaLB domain containing protein. 
AK098860CGCGTGCGNONE 
J013000N23CGCGTGCGNONE 
J013026B16CGCGTGCGNONE 
J013030A09CGCGTGCGNONE 
J013066I04CGCGTGCGNONE 
J013066P03CGCGTGCGNONE 
J013090L14CGCGTGCGNONE 
J013102C20CGCGTGCGNONE 
J013124H07CGCGTGCGNONE 
J023061K20CGCGTGCGNONE 
J043026K09CGCGTGCGNONE 
J090015G19CGCGTGCGNONE 
J100070B02CGCGTGCGNONE 
Os01g0244400J075054J20CGCGTGCGProtein of unknown function DUF1618 domain containing protein. 
J075101O11CGCGTGCGNONE 
J075123K08CGCGTGCGNONE 
Os01g0262700AK100901CGCGTGCGConserved hypothetical protein. 
AK119928CGCGTGCGNONE 
J033057O20CGCGTGCGNONE 
J065093J01CGCGTGCGNONE 
J075164F23CGCGTGCGNONE 
J100025E08CGCGTGCGNONE 
J100029L03CGCGTGCGNONE 
J100079F02CGCGTGCGNONE 
Os01g0266600AK058396CGCACGCGNONE 
AK069749CGCACGCGRedoxin domain containing protein. 
J023030N01CGCACGCGNONE 
J065065E03CGCACGCGNONE 
J075006N11CGCACGCGNONE 
J075017G04CGCACGCGNONE 
J075023L15CGCACGCGNONE 
J075126F05CGCACGCGNONE 
Os01g0283300006-024-F09CGCGTGCGNONE 
006-031-G06CGCGTGCGNONE 
006-049-C04CGCGTGCGNONE 
006-049-D12CGCGTGCGNONE 
006-065-G10CGCGTGCGNONE 
006-070-D01CGCGTGCGNONE 
006-082-G07CGCGTGCGNONE 
006-087-H11CGCGTGCGNONE 
006-096-E10CGCGTGCGNONE 
006-098-A11CGCGTGCGNONE 
006-099-G09CGCGTGCGNONE 
006-102-H11CGCGTGCGNONE 
006-103-C01CGCGTGCGNONE 
006-105-C06CGCGTGCGNONE 
006-109-C11CGCGTGCGNONE 
006-113-E05CGCGTGCGNONE 
009-088-E03CGCGTGCGNONE 
AK068117CGCGTGCGConserved hypothetical protein. 
AK104498CGCGTGCGNONE 
AK104803CGCGTGCGNONE 
AK106177CGCGTGCGNONE 
J013022G10CGCGTGCGNONE 
J013134A06CGCGTGCGNONE 
J013153D24CGCGTGCGNONE 
J013160O08CGCGTGCGNONE 
J023039F02CGCGTGCGNONE 
J023059M04CGCGTGCGNONE 
J023065F20CGCGTGCGNONE 
J023069F11CGCGTGCGNONE 
J033128M05CGCGTGCGNONE 
J065062O04CGCGTGCGNONE 
J065174F18CGCGTGCGNONE 
J065203G06CGCGTGCGNONE 
J090010D21CGCGTGCGNONE 
J090038L02CGCGTGCGNONE 
J090063L11CGCGTGCGNONE 
J100028P04CGCGTGCGNONE 
J100037N12CGCGTGCGNONE 
J100054M11CGCGTGCGNONE 
J100056D02CGCGTGCGNONE 
J100063C12CGCGTGCGNONE 
J100075M09CGCGTGCGNONE 
J100079D18CGCGTGCGNONE 
J100086M15CGCGTGCGNONE 
Os01g0323600J023095C13CGCACGCGNONE 
Os01g0338600AK066580CGCGTGCGCCACCTGTConserved hypothetical protein. 
J013069G24CGCGTGCGCCACCTGTNONE 
J013149K14CGCGTGCGCCACCTGTNONE 
J023105K20CGCGTGCGCCACCTGTNONE 
J065019I11CGCGTGCGCCACCTGTNONE 
J065022K19CGCGTGCGCCACCTGTNONE 
J065079N10CGCGTGCGCCACCTGTNONE 
J065091M11CGCGTGCGCCACCTGTNONE 
J065106D01CGCGTGCGCCACCTGTNONE 
J065108B08CGCGTGCGCCACCTGTNONE 
J090057L01CGCGTGCGCCACCTGTNONE 
J090065M21CGCGTGCGCCACCTGTNONE 
J100019J24CGCGTGCGCCACCTGTNONE 
J100047E09CGCGTGCGCCACCTGTNONE 
J100064E08CGCGTGCGCCACCTGTNONE 
J100084M05CGCGTGCGCCACCTGTNONE 
Os01g0550800AK064194CGCGTGCGProtein of unknown function DUF239, plant domain containing protein. 
Os01g0558700Os01g0558700CCCACGCGGCCACACGCACGCGConserved hypothetical protein. 
Os01g0584900AK108522CACCGCACGCGWRKY transcription factor 28-like (WRKY5) (WRKY transcription factor 77). 
AY341846CACCGCACGCGNONE 
J065161G19CACCGCACGCGNONE 
J065193D14CACCGCACGCGNONE 
J065193L05CACCGCACGCGNONE 
J065196K16CACCGCACGCGNONE 
Os01g0594900AK070921CGCACGCGConserved hypothetical protein. 
J023074J04CGCACGCGNONE 
J023078B04CGCACGCGNONE 
J023078N11CGCACGCGNONE 
J075143E19CGCACGCGNONE 
J075187L10CGCACGCGNONE 
J080010N23CGCACGCGNONE 
J080013C01CGCACGCGNONE 
J080013G03CGCACGCGNONE 
J080016I23CGCACGCGNONE 
J080017E01CGCACGCGNONE 
J080029E18CGCACGCGNONE 
J080034L24CGCACGCGNONE 
J080039N12CGCACGCGNONE 
J080067L11CGCACGCGNONE 
J080068N08CGCACGCGNONE 
J080069E19CGCACGCGNONE 
J080071E16CGCACGCGNONE 
J080077J09CGCACGCGNONE 
J080085E03CGCACGCGNONE 
J080301J09CGCACGCGNONE 
J080303L19CGCACGCGNONE 
J080308B12CGCACGCGNONE 
Os01g0611000003-117-E07CGCGTGCGNONE 
006-051-D01CGCGTGCGNONE 
006-085-B10CGCGTGCGNONE 
012-092-F03CGCGTGCGNONE 
AK060682CGCGTGCGNONE 
AK072500CGCGTGCGSimilar to Unidentified precursor. 
AK105921CGCGTGCGNONE 
J023001D07CGCGTGCGNONE 
J023075J23CGCGTGCGNONE 
J023127H12CGCGTGCGNONE 
J033024H20CGCGTGCGNONE 
J033025H03CGCGTGCGNONE 
J065057F11CGCGTGCGNONE 
J065096C07CGCGTGCGNONE 
J065103A08CGCGTGCGNONE 
J065137L11CGCGTGCGNONE 
J065179I16CGCGTGCGNONE 
J065197P22CGCGTGCGNONE 
J075089M08CGCGTGCGNONE 
J090008N14CGCGTGCGNONE 
J090011K16CGCGTGCGNONE 
J090075K24CGCGTGCGNONE 
J090079E08CGCGTGCGNONE 
Os01g0667200AK067930CGCGTGCGSimilar to Glyoxalase II. 
AK104104CGCGTGCGNONE 
AK104749CGCGTGCGNONE 
J013059D24CGCGTGCGNONE 
J013127E08CGCGTGCGNONE 
Os01g0705200011-075-B10ACGGAACGCACGCGNONE 
014-056-F05ACGGAACGCACGCGNONE 
014-072-F08ACGGAACGCACGCGNONE 
014-082-E10ACGGAACGCACGCGNONE 
014-085-E10ACGGAACGCACGCGNONE 
AK064074ACGGAACGCACGCGLate embryogenesis abundant protein repeat containing protein. 
AK073837ACGGAACGCACGCGNONE 
D26536ACGGAACGCACGCGNONE 
J033070H10ACGGAACGCACGCGNONE 
J065138A19ACGGAACGCACGCGNONE 
J065140A10ACGGAACGCACGCGNONE 
Os01g0729900AK064793CGCACGCGNONE 
AK065503CGCACGCGConserved hypothetical protein. 
AK104681CGCACGCGNONE 
AK120504CGCACGCGNONE 
Os01g0757900AK105476CGCGTGCGHaloacid dehalogenase/epoxide hydrolase family protein. 
Os01g0764500AK120433CGCGTGCGHemimethylated DNA-binding region domain containing protein. 
J013097E20CGCGTGCGNONE 
J043007F08CGCGTGCGNONE 
Os01g0774500AK069241CGCACGCGConserved hypothetical protein. 
Os01g0778100J065026M10CGCGTGCGProtein of unknown function DUF966 family protein. 
J065166E16CGCGTGCGNONE 
Os01g0802200009-092-E04CGCACGCGNONE 
AK062699CGCACGCGConserved hypothetical protein. 
J065186C19CGCACGCGNONE 
Os01g0812200003-009-E06GCCCAAAACGCACGCGNONE 
AK072651GCCCAAAACGCACGCGCyclin-like F-box domain containing protein. 
AK104334GCCCAAAACGCACGCGNONE 
J013030E13GCCCAAAACGCACGCGNONE 
J013169M21GCCCAAAACGCACGCGNONE 
J023012J16GCCCAAAACGCACGCGNONE 
J023103F22GCCCAAAACGCACGCGNONE 
J023123A01GCCCAAAACGCACGCGNONE 
J023131F07GCCCAAAACGCACGCGNONE 
J023146I01GCCCAAAACGCACGCGNONE 
J033040K02GCCCAAAACGCACGCGNONE 
J033079F06GCCCAAAACGCACGCGNONE 
J033105G06GCCCAAAACGCACGCGNONE 
J033117E08GCCCAAAACGCACGCGNONE 
J043030C01GCCCAAAACGCACGCGNONE 
J053043H16GCCCAAAACGCACGCGNONE 
J053061H01GCCCAAAACGCACGCGNONE 
J065044A03GCCCAAAACGCACGCGNONE 
J065068E12GCCCAAAACGCACGCGNONE 
J065069D09GCCCAAAACGCACGCGNONE 
J065143M19GCCCAAAACGCACGCGNONE 
J065193C10GCCCAAAACGCACGCGNONE 
J065209D07GCCCAAAACGCACGCGNONE 
J090083C17GCCCAAAACGCACGCGNONE 
J090086G06GCCCAAAACGCACGCGNONE 
J090093I09GCCCAAAACGCACGCGNONE 
J100023G21GCCCAAAACGCACGCGNONE 
J100025D15GCCCAAAACGCACGCGNONE 
J100034B13GCCCAAAACGCACGCGNONE 
J100040F10GCCCAAAACGCACGCGNONE 
J100051E15GCCCAAAACGCACGCGNONE 
J100056L08GCCCAAAACGCACGCGNONE 
J100057H04GCCCAAAACGCACGCGNONE 
J100085K20GCCCAAAACGCACGCGNONE 
J100088G21GCCCAAAACGCACGCGNONE 
Os01g0813400006-025-B06CCACGCGTGCGNONE 
006-030-C07CCACGCGTGCGNONE 
006-068-F06CCACGCGTGCGNONE 
006-096-E09CCACGCGTGCGNONE 
006-097-B11CCACGCGTGCGNONE 
006-104-H02CCACGCGTGCGNONE 
AK062251CCACGCGTGCGNONE 
AK065370CCACGCGTGCGSimilar to ADP-ribosylation factor 1. 
J013022G24CCACGCGTGCGNONE 
J013104C07CCACGCGTGCGNONE 
J023074M17CCACGCGTGCGNONE 
J043027C07CCACGCGTGCGNONE 
J065026K05CCACGCGTGCGNONE 
J065103I01CCACGCGTGCGNONE 
J090025M17CCACGCGTGCGNONE 
J100027L03CCACGCGTGCGNONE 
J100054I20CCACGCGTGCGNONE 
Os01g0814900AK058594CGCACGCGNONE 
AK071859CGCACGCGSimilar to Cytochrome b5 reductase. 
AK103964CGCACGCGNONE 
J023115I22CGCACGCGNONE 
J033079K10CGCACGCGNONE 
J100022I04CGCACGCGNONE 
J100068H17CGCACGCGNONE 
Os01g0859600011-041-F12GCGACGCGTGCGNONE 
AK072151GCGACGCGTGCGCyclin-like F-box domain containing protein. 
J013031O08GCGACGCGTGCGNONE 
J013049K06GCGACGCGTGCGNONE 
J013095P13GCGACGCGTGCGNONE 
J013108J06GCGACGCGTGCGNONE 
J013109C18GCGACGCGTGCGNONE 
J013111E15GCGACGCGTGCGNONE 
J013132O07GCGACGCGTGCGNONE 
J023086B20GCGACGCGTGCGNONE 
J023101N16GCGACGCGTGCGNONE 
J033025C17GCGACGCGTGCGNONE 
J033103E23GCGACGCGTGCGNONE 
J033105C11GCGACGCGTGCGNONE 
J033126A20GCGACGCGTGCGNONE 
J090018G15GCGACGCGTGCGNONE 
J090031F06GCGACGCGTGCGNONE 
J090056E09GCGACGCGTGCGNONE 
J090075M18GCGACGCGTGCGNONE 
J100024M05GCGACGCGTGCGNONE 
J100032F09GCGACGCGTGCGNONE 
Os01g0863300014-030-D08CGCACGCGTCCNONE 
AK111571CGCACGCGTCCSimilar to MCB2 protein. 
J013071A13CGCACGCGTCCNONE 
J075060E09CGCACGCGTCCNONE 
J075138C14CGCACGCGTCCNONE 
J075150M17CGCACGCGTCCNONE 
Os01g0866200009-039-E12CGCGTGCGNONE 
J065059P16CGCGTGCGNONE 
J065063E21CGCGTGCGNONE 
J065078B21CGCGTGCGNONE 
J065079A11CGCGTGCGNONE 
J065087H15CGCGTGCGNONE 
J065137M10CGCGTGCGNONE 
J065138K24CGCGTGCGNONE 
J065142E08CGCGTGCGNONE 
J065171G11CGCGTGCGNONE 
J065183K15CGCGTGCGNONE 
J065192J05CGCGTGCGNONE 
J075151P09CGCGTGCGNONE 
J090020B17CGCGTGCGNONE 
J090067F15CGCGTGCGNONE 
J090070K06CGCGTGCGNONE 
J090094G13CGCGTGCGNONE 
J100081M20CGCGTGCGHistone H3. 
J100089D06CGCGTGCGNONE 
Os01g0866300006-087-C06CGCGTGCGNONE 
006-114-E01CGCGTGCGNONE 
J065202L13CGCGTGCGNONE 
Os01g0871600AK103248CCACGCGTGCGTGF-beta receptor, type I/II extracellular region family protein. 
Os01g0897800AF140489CGCACGCGGAGAGNONE 
AK072409CGCACGCGGAGAGNONE 
AK072812CGCACGCGGAGAGRad21/Rec8 like protein, N-terminal domain containing protein. 
AK099099CGCACGCGGAGAGNONE 
AY288943CGCACGCGGAGAGNONE 
AY318757CGCACGCGGAGAGNONE 
J013021C23CGCACGCGGAGAGNONE 
J013027H03CGCACGCGGAGAGNONE 
J013032C02CGCACGCGGAGAGNONE 
J013068G13CGCACGCGGAGAGNONE 
J013070K16CGCACGCGGAGAGNONE 
J013070L02CGCACGCGGAGAGNONE 
J013091E15CGCACGCGGAGAGNONE 
J013109D04CGCACGCGGAGAGNONE 
J013118B04CGCACGCGGAGAGNONE 
J013129E08CGCACGCGGAGAGNONE 
J013134I15CGCACGCGGAGAGNONE 
J013146N16CGCACGCGGAGAGNONE 
J023083F05CGCACGCGGAGAGNONE 
J023107E17CGCACGCGGAGAGNONE 
J023113D21CGCACGCGGAGAGNONE 
J023123A22CGCACGCGGAGAGNONE 
J023133I24CGCACGCGGAGAGNONE 
J023134L21CGCACGCGGAGAGNONE 
J023142N24CGCACGCGGAGAGNONE 
J033051B12CGCACGCGGAGAGNONE 
J033058B04CGCACGCGGAGAGNONE 
J033068E24CGCACGCGGAGAGNONE 
J033076D01CGCACGCGGAGAGNONE 
J033088O06CGCACGCGGAGAGNONE 
J033093K15CGCACGCGGAGAGNONE 
J033101G18CGCACGCGGAGAGNONE 
J033130A01CGCACGCGGAGAGNONE 
J043027I17CGCACGCGGAGAGNONE 
J043027L17CGCACGCGGAGAGNONE 
J090001N13CGCACGCGGAGAGNONE 
J090004L10CGCACGCGGAGAGNONE 
J090027D08CGCACGCGGAGAGNONE 
J090027H18CGCACGCGGAGAGNONE 
J090031F16CGCACGCGGAGAGNONE 
J090048L18CGCACGCGGAGAGNONE 
J090050N08CGCACGCGGAGAGNONE 
J090051G05CGCACGCGGAGAGNONE 
J090063G03CGCACGCGGAGAGNONE 
J090068P21CGCACGCGGAGAGNONE 
J090072P21CGCACGCGGAGAGNONE 
J090079A14CGCACGCGGAGAGNONE 
J090086I20CGCACGCGGAGAGNONE 
J090087D19CGCACGCGGAGAGNONE 
J090099B06CGCACGCGGAGAGNONE 
J100047J19CGCACGCGGAGAGNONE 
J100058I06CGCACGCGGAGAGNONE 
Os01g0904200AK068432CGCACGCGProtein kinase-like domain containing protein. 
J100027C22CGCACGCGNONE 
J100064A19CGCACGCGNONE 
Os01g0915200AK121863CGCACGCGSimilar to Cystatin. 
Os01g0933900006-115-F10CGCGTGCGNONE 
009-130-C11CGCGTGCGNONE 
009-183-F07CGCGTGCGNONE 
009-196-F08CGCGTGCGNONE 
012-078-H05CGCGTGCGNONE 
015-004-D01CGCGTGCGNONE 
015-083-F05CGCGTGCGNONE 
AF309383CGCGTGCGSimilar to Glutathione transferase III(B) (EC 2.5.1.18). 
AK059985CGCGTGCGNONE 
AK103927CGCGTGCGNONE 
J065026P12CGCGTGCGNONE 
J065041M20CGCGTGCGNONE 
J065043H06CGCGTGCGNONE 
J065049E19CGCGTGCGNONE 
J065097D10CGCGTGCGNONE 
J065143I07CGCGTGCGNONE 
J065152F10CGCGTGCGNONE 
J065163F22CGCGTGCGNONE 
J065166O17CGCGTGCGNONE 
J065188B21CGCGTGCGNONE 
J065197D18CGCGTGCGNONE 
J065198E06CGCGTGCGNONE 
J065199D17CGCGTGCGNONE 
J065212I10CGCGTGCGNONE 
J075001L04CGCGTGCGNONE 
J090051G02CGCGTGCGNONE 
J090074K01CGCGTGCGNONE 
Os01g0972000006-090-C11CGCACGCGNONE 
AK106003CGCACGCGZinc finger, RING-type domain containing protein. 
J065184F12CGCACGCGNONE 
J075085O21CGCACGCGNONE 
Os02g0125300006-047-E06CTCGCGCGTGCGTGGGCCCCACCNONE 
006-088-F09CTCGCGCGTGCGTGGGCCCCACCNONE 
006-106-F10CTCGCGCGTGCGTGGGCCCCACCNONE 
AB025926CTCGCGCGTGCGTGGGCCCCACCNONE 
AK061564CTCGCGCGTGCGTGGGCCCCACCNONE 
AK061953CTCGCGCGTGCGTGGGCCCCACCNONE 
AK101060CTCGCGCGTGCGTGGGCCCCACCBax inhibitor-1 (BI-1) (OsBI-1). 
J013072O21CTCGCGCGTGCGTGGGCCCCACCNONE 
J023097A08CTCGCGCGTGCGTGGGCCCCACCNONE 
J023133F03CTCGCGCGTGCGTGGGCCCCACCNONE 
J033022C21CTCGCGCGTGCGTGGGCCCCACCNONE 
J033073C21CTCGCGCGTGCGTGGGCCCCACCNONE 
J033116O09CTCGCGCGTGCGTGGGCCCCACCNONE 
J033120E01CTCGCGCGTGCGTGGGCCCCACCNONE 
J065088M19CTCGCGCGTGCGTGGGCCCCACCNONE 
J065135O04CTCGCGCGTGCGTGGGCCCCACCNONE 
J080304J03CTCGCGCGTGCGTGGGCCCCACCNONE 
J090001K14CTCGCGCGTGCGTGGGCCCCACCNONE 
J090038D04CTCGCGCGTGCGTGGGCCCCACCNONE 
J090045G09CTCGCGCGTGCGTGGGCCCCACCNONE 
J090076E12CTCGCGCGTGCGTGGGCCCCACCNONE 
J090077D21CTCGCGCGTGCGTGGGCCCCACCNONE 
J100018J19CTCGCGCGTGCGTGGGCCCCACCNONE 
J100029M12CTCGCGCGTGCGTGGGCCCCACCNONE 
J100049D07CTCGCGCGTGCGTGGGCCCCACCNONE 
J100067G21CTCGCGCGTGCGTGGGCCCCACCNONE 
J100090D05CTCGCGCGTGCGTGGGCCCCACCNONE 
Os02g0177700AK119941GCCCATGGCGCACGCGTCTCProtein of unknown function DUF588 family protein. 
Os02g0188500AK102004CGCACGCGNONE 
AK106917CGCACGCGUbiquitin domain containing protein. 
J090039N13CGCACGCGNONE 
Os02g0227200009-123-E01CGCGTGCGNONE 
AB018377CGCGTGCGNONE 
AK072428CGCGTGCGNONE 
AK120885CGCGTGCGEarly nodulin. 
J013022O14CGCGTGCGNONE 
J043034L12CGCGTGCGNONE 
J065030L16CGCGTGCGNONE 
J065056C10CGCGTGCGNONE 
J065066P11CGCGTGCGNONE 
J065101I24CGCGTGCGNONE 
J065102E21CGCGTGCGNONE 
J065113P17CGCGTGCGNONE 
J065120I17CGCGTGCGNONE 
J065122P08CGCGTGCGNONE 
J065124D04CGCGTGCGNONE 
J065140K10CGCGTGCGNONE 
J065140P20CGCGTGCGNONE 
J065147O15CGCGTGCGNONE 
J065148L22CGCGTGCGNONE 
J065159N03CGCGTGCGNONE 
J065180B09CGCGTGCGNONE 
J075027C19CGCGTGCGNONE 
J075120L04CGCGTGCGNONE 
J075134I10CGCGTGCGNONE 
J075161B08CGCGTGCGNONE 
J075172F11CGCGTGCGNONE 
J090073H01CGCGTGCGNONE 
J100017B11CGCGTGCGNONE 
J100030L05CGCGTGCGNONE 
J100064A03CGCGTGCGNONE 
Os02g0245000AK119770GAGACGCGTGCGNONE 
AK119874GAGACGCGTGCGSWAP/Surp domain containing protein. 
J065038L11GAGACGCGTGCGNONE 
J100059I06GAGACGCGTGCGNONE 
J100076C23GAGACGCGTGCGNONE 
J100081P08GAGACGCGTGCGNONE 
J100084C13GAGACGCGTGCGNONE 
Os02g0299200AK105486CGCGTGCGIQ calmodulin-binding region domain containing protein. 
Os02g0437200AK065640CGCACGCGNONE 
AY900120CGCACGCGSimilar to SNAP-34. 
J013038P06CGCACGCGNONE 
J013146B13CGCACGCGNONE 
J065015L12CGCACGCGNONE 
J065089K05CGCACGCGNONE 
J065197E17CGCACGCGNONE 
J090077O07CGCACGCGNONE 
J100050L21CGCACGCGNONE 
J100074L24CGCACGCGNONE 
Os02g0465400AK100199CGCACGCGSimilar to 7-dehydrocholesterol reductase (EC 1.3.1.21) (7-DHC reductase) (Sterol delta-7-reductase) (Dwarf5 protein). 
J090036B02CGCACGCGNONE 
Os02g0497700011-094-A10CGCGTGCGNONE 
012-073-H02CGCGTGCGNONE 
016-056-G05CGCGTGCGNONE 
AK070143CGCGTGCGNONE 
J023041O14CGCGTGCGNONE 
J023092H01CGCGTGCGNONE 
J033048A17CGCGTGCGNONE 
J033051K21CGCGTGCGNONE 
J033122D01CGCGTGCGNONE 
J090032E23CGCGTGCGNONE 
J090055K13CGCGTGCGNONE 
Os02g0509500009-117-G07GGGGCCCGCGTGCGNONE 
009-122-G08GGGGCCCGCGTGCGNONE 
AK105187GGGGCCCGCGTGCGConserved hypothetical protein. 
J065025C04GGGGCCCGCGTGCGNONE 
J065030F10GGGGCCCGCGTGCGNONE 
J065112P22GGGGCCCGCGTGCGNONE 
J065116I22GGGGCCCGCGTGCGNONE 
J065127F24GGGGCCCGCGTGCGNONE 
J065176E11GGGGCCCGCGTGCGNONE 
J065186F02GGGGCCCGCGTGCGNONE 
J075041F12GGGGCCCGCGTGCGNONE 
J075118L20GGGGCCCGCGTGCGNONE 
J075181D20GGGGCCCGCGTGCGNONE 
J090023P12GGGGCCCGCGTGCGNONE 
Os02g0537700006-053-C10CGCGTGCGNONE 
006-055-F06CGCGTGCGNONE 
006-059-E11CGCGTGCGNONE 
006-088-G01CGCGTGCGNONE 
006-088-G12CGCGTGCGNONE 
009-094-G12CGCGTGCGNONE 
009-181-C07CGCGTGCGNONE 
AK068919CGCGTGCGSimilar to 2-cys peroxiredoxin BAS1, chloroplast precursor (EC 1.11.1.15) (Thiol- specific antioxidant protein) (Fragment). 
AK104703CGCGTGCGNONE 
J013070I22CGCGTGCGNONE 
J013169M13CGCGTGCGNONE 
J013170F14CGCGTGCGNONE 
J023010P12CGCGTGCGNONE 
J023095B04CGCGTGCGNONE 
J090043L04CGCGTGCGNONE 
Os02g0556800AK060580CGCACGCGACGCGACNONE 
AK100187CGCACGCGACGCGACConserved hypothetical protein. 
J065162A21CGCACGCGACGCGACNONE 
J075093B20CGCACGCGACGCGACNONE 
J075097N04CGCACGCGACGCGACNONE 
Os02g0587800J100085I19CGCGTGCGVirulence factor, pectin lyase fold family protein. 
Os02g0602300AK065609GTGGTGGGCCGTGCCTGGGCCGCGCACGCGNONE 
AK066929GTGGTGGGCCGTGCCTGGGCCGCGCACGCGSimilar to Myelin transcription factor 1 (MYT1) (MYTI) (Proteolipid protein binding protein) (PLPB1). 
J013092L08GTGGTGGGCCGTGCCTGGGCCGCGCACGCGNONE 
J090040I23GTGGTGGGCCGTGCCTGGGCCGCGCACGCGNONE 
Os02g0644500Os02g0644500CGCGTGCGConserved hypothetical protein. 
Os02g0709300009-054-A02CGCGTGCGNONE 
AK109446CGCGTGCGConserved hypothetical protein. 
Os02g0710300AK109662CGCGTGCGSimilar to INDEHISCENT protein. 
Os02g0771700011-075-D10CGCGTGCGNONE 
011-086-E10CGCGTGCGNONE 
AK058571CGCGTGCGGlycoside hydrolase, family 17 protein. 
AK102185CGCGTGCGNONE 
J023001D03CGCGTGCGNONE 
J023041N11CGCGTGCGNONE 
J033086N13CGCGTGCGNONE 
J033106K14CGCGTGCGNONE 
J033125P22CGCGTGCGNONE 
Os02g0778400AK103372CGCACGCGSimilar to UMP/CMP kinase a (EC 2.7.1.48). 
Os02g0800000J100043O08CGCGTGCGNONE 
J100064O18CGCGTGCGNONE 
Os03g0124300AK069148CGCACGCGACGCGConserved hypothetical protein. 
AK106076CGCACGCGACGCGNONE 
J023003G19CGCACGCGACGCGNONE 
Os03g0132800AK104997CGCACGCGNONE 
AK122069CGCACGCGSimilar to protein kinase-like protein [Oryza sativa (japonica cultivar-group)]. 
Os03g0141200AK068968CGCCACGTCACCCGCACGCGSimilar to Beta-amylase PCT-BMYI (EC 3.2.1.2). 
AK100092CGCCACGTCACCCGCACGCGNONE 
J023003L18CGCCACGTCACCCGCACGCGNONE 
J023022K18CGCCACGTCACCCGCACGCGNONE 
J023107H13CGCCACGTCACCCGCACGCGNONE 
J023107K02CGCCACGTCACCCGCACGCGNONE 
Os03g0145900J013045K15CGCACGCGGGTGGGNONE 
J013051O08CGCACGCGGGTGGGNONE 
J065054C08CGCACGCGGGTGGGNONE 
J075053J16CGCACGCGGGTGGGNONE 
Os03g0152300AK070875CGCACGCGHaem peroxidase family protein. 
J023010D24CGCACGCGNONE 
J023010K19CGCACGCGNONE 
J023025C09CGCACGCGNONE 
J023029P13CGCACGCGNONE 
J023041L10CGCACGCGNONE 
J023043F13CGCACGCGNONE 
J023044E05CGCACGCGNONE 
J023075H05CGCACGCGNONE 
J023077G15CGCACGCGNONE 
J023111D01CGCACGCGNONE 
J023120P18CGCACGCGNONE 
J023132I11CGCACGCGNONE 
J023141G21CGCACGCGNONE 
Os03g0157400AK066035CGCACGCGABC transporter related domain containing protein. 
Os03g0188400AK107555CGCGTGCGBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
Os03g0238300AK059494CACCGCACGCGInositol polyphosphate related phosphatase domain containing protein. 
AK122075CACCGCACGCGNONE 
J033118P13CACCGCACGCGNONE 
Os03g0238800AY224467CGCACGCGConserved hypothetical protein. 
J013042E23CGCACGCGNONE 
Os03g0246800AK070145CGCACGCGACGCGNONE 
AK102770CGCACGCGACGCGNONE 
Os03g0269900AK101153CGCACGCGProtein of unknown function DUF604 family protein. 
J065001B15CGCACGCGNONE 
Os03g0271500AK068546GCGGGCCCACCCACCGCACGCGNONE 
AK109239GCGGGCCCACCCACCGCACGCGConserved hypothetical protein. 
J013157P04GCGGGCCCACCCACCGCACGCGNONE 
J075041K23GCGGGCCCACCCACCGCACGCGNONE 
Os03g0274000AK060769CGCACGCGOxysterol-binding protein family protein. 
Os03g0284500012-066-D02CGCGTGCGNONE 
AK105295CGCGTGCGNONE 
AK121300CGCGTGCGHAD-superfamily subfamily IIA hydrolase, CECR5 protein. 
Os03g0284600AK110712CGCGTGCGThioredoxin fold domain containing protein. 
Os03g0285800AF216315CGCACGCGNONE 
AF332873CGCACGCGNONE 
AF479883CGCACGCGNONE 
AF479884CGCACGCGNONE 
AJ250311CGCACGCGNONE 
AJ486975CGCACGCGNONE 
AK067339CGCACGCGMAP Kinase. 
AK104834CGCACGCGNONE 
J013102O17CGCACGCGNONE 
J023055N19CGCACGCGNONE 
J023099F06CGCACGCGNONE 
J065144H06CGCACGCGNONE 
J065153A14CGCACGCGNONE 
J065212K01CGCACGCGNONE 
Os03g0292100Os03g0292100CACCGCACGCGTCCProtein phosphatase 2C family protein. 
Os03g0298800009-079-B10CGCACGCGNONE 
AK103337CGCACGCGSimilar to Spliceosomal protein. 
Os03g0301200AK119578CGCACGCGNONE 
J013027D03CGCACGCGNONE 
J075035F14CGCACGCGNONE 
J090075I19CGCACGCGNONE 
J090081E22CGCACGCGNONE 
J100035I20CGCACGCGNONE 
J100051E18CGCACGCGNONE 
J100053H11CGCACGCGNONE 
J100081P07CGCACGCGNONE 
Os03g0305400009-198-D04CGCACGCGNONE 
013-012-C06CGCACGCGNONE 
014-034-D01CGCACGCGNONE 
AK071397CGCACGCGUniversal stress protein (Usp) family protein. 
J023012O22CGCACGCGNONE 
J023097A13CGCACGCGNONE 
J023107P16CGCACGCGNONE 
J023113C14CGCACGCGNONE 
Os03g0333100AK101050CGCACGCGProtein of unknown function DUF663 domain containing protein. 
Os03g0337100AK107981CGCACGCGConserved hypothetical protein. 
AK107981CGCACGCGConserved hypothetical protein. 
Os03g0341000AK111414CGCACGCGSimilar to AP2 domain containing protein RAP2.2 (Fragment). 
Os03g0386000AK072984CGCGTGCGSimilar to WD domain protein-like. 
J065009K18CGCGTGCGNONE 
J065165P09CGCGTGCGNONE 
Os03g0410900J065067F10CGCGTGCGNONE 
J065073D08CGCGTGCGNONE 
J065176C06CGCGTGCGNONE 
J065189O13CGCGTGCGNONE 
J065214E05CGCGTGCGNONE 
J080007H09CGCGTGCGNONE 
J080012B19CGCGTGCGNONE 
J080020J16CGCGTGCGNONE 
J080038J22CGCGTGCGNONE 
J080045I09CGCGTGCGNONE 
J080059M16CGCGTGCGNONE 
J080060C19CGCGTGCGNONE 
J080080P22CGCGTGCGNONE 
J080083C03CGCGTGCGNONE 
J080093M17CGCGTGCGNONE 
J100029F12CGCGTGCGLike-Sm ribonucleoprotein, core family protein. 
Os03g0623100014-072-D06CCACGCGTGCGNONE 
014-072-G11CCACGCGTGCGNONE 
AK063716CCACGCGTGCGConserved hypothetical protein. 
J065136O20CCACGCGTGCGNONE 
J075030G11CCACGCGTGCGNONE 
J075034O21CCACGCGTGCGNONE 
J075051D07CCACGCGTGCGNONE 
J075066M05CCACGCGTGCGNONE 
J075095G15CCACGCGTGCGNONE 
Os03g0639800AK103237CGCGTGCGSnf7 family protein. 
J023036L02CGCGTGCGNONE 
J033108L13CGCGTGCGNONE 
Os03g0643100AK106587GCCCACGCGTGCGHomeodomain-like containing protein. 
Os03g0650400016-019-C03CGCGTGCGNONE 
AK064367CGCGTGCGNONE 
AK101644CGCGTGCGConserved hypothetical protein. 
J033055N07CGCGTGCGNONE 
J075172F12CGCGTGCGNONE 
J090026P03CGCGTGCGNONE 
J090031K19CGCGTGCGNONE 
J100034M02CGCGTGCGNONE 
J100090M03CGCGTGCGNONE 
Os03g0656500AK121052CGCACCGCACGCGSimilar to K-exchanger-like protein. 
J065195N11CGCACCGCACGCGNONE 
J065197F16CGCACCGCACGCGNONE 
J075022O03CGCACCGCACGCGNONE 
J075056N16CGCACCGCACGCGNONE 
J075139P11CGCACCGCACGCGNONE 
Os03g0657100AK120547CGCACGCGU box domain containing protein. 
J013129M03CGCACGCGNONE 
J100025L23CGCACGCGNONE 
J100032K15CGCACGCGNONE 
J100044D22CGCACGCGNONE 
J100055K07CGCACGCGNONE 
J100067O12CGCACGCGNONE 
J100087N04CGCACGCGNONE 
Os03g0669100014-007-F05CGCACGCGNONE 
014-090-H05CGCACGCGNONE 
AK063633CGCACGCGSimilar to Deoxyuridine 5'-triphosphate nucleotidohydrolase (EC 3.6.1.23) (dUTPase) (dUTP pyrophosphatase) (P18). 
AK063742CGCACGCGNONE 
J065030M17CGCACGCGNONE 
J065132J05CGCACGCGNONE 
J065176B11CGCACGCGNONE 
J065201F08CGCACGCGNONE 
Os03g0676400AK109228CGCACGCGVQ domain containing protein. 
Os03g0681900006-042-F08CGCACGCGNONE 
009-043-F12CGCACGCGNONE 
AK061750CGCACGCGNONE 
AK062094CGCACGCGSimilar to RGP-3 (Fragment). 
J033034F01CGCACGCGNONE 
J033131F11CGCACGCGNONE 
J033143N03CGCACGCGNONE 
Os03g0698500AK109500CGCACGCGSimilar to Yippee-like protein 3. 
J013021I06CGCACGCGNONE 
J013088A20CGCACGCGNONE 
J013122K04CGCACGCGNONE 
J023034E20CGCACGCGNONE 
J023058F07CGCACGCGNONE 
J023083O05CGCACGCGNONE 
J075004C15CGCACGCGNONE 
J075022A22CGCACGCGNONE 
J075073G13CGCACGCGNONE 
J075105J05CGCACGCGNONE 
J075182F11CGCACGCGNONE 
J090037C16CGCACGCGNONE 
J100036I09CGCACGCGNONE 
J100059I07CGCACGCGNONE 
Os03g0699600AK070428CACCGCACGCGCyclin-like F-box domain containing protein. 
Os03g0708800009-180-H07CGCACGCGNONE 
AK063141CGCACGCGNONE 
Os03g0710000006-023-G11CGCACGCGNONE 
006-050-E05CGCACGCGNONE 
AK060065CGCACGCGProtein of unknown function DUF292, eukaryotic domain containing protein. 
AK099364CGCACGCGNONE 
AK104418CGCACGCGNONE 
J033051P12CGCACGCGNONE 
J065046L09CGCACGCGNONE 
J075021F06CGCACGCGNONE 
J075106P12CGCACGCGNONE 
Os03g0735200011-051-E04CGCACGCGNONE 
AK063345CGCACGCGTetratricopeptide-like helical domain containing protein. 
Os03g0748500AK110695CGCACGCGCGAGNONE 
AK110695CGCGTGCGNONE 
Os03g0751100AK102404CGCGTGCGSimilar to Isp4 protein-like. 
Os03g0752800AB041020CGCACGCGTCGCNONE 
AF058697CGCACGCGTCGCMADS14 protein. 
AF139664CGCACGCGTCGCNONE 
AK121171CGCACGCGTCGCNONE 
AY332478CGCACGCGTCGCNONE 
AY551916CGCACGCGTCGCNONE 
J023081C04CGCACGCGTCGCNONE 
Os03g0819900006-058-B05CGCACGCGCGCGACNONE 
AK111912CGCACGCGCGCGACNONE 
AK112029CGCACGCGCGCGACSimilar to RAB8C. 
AY576526CGCACGCGCGCGACNONE 
AY579410CGCACGCGCGCGACNONE 
J075041G24CGCACGCGCGCGACNONE 
J100070N08CGCACGCGCGCGACNONE 
Os03g0823200AK072964CGCGTGCGNONE 
Os04g0208600AK100900CGCGTGCGCyclin-like F-box domain containing protein. 
Os04g0269900J065139P11CGCGTGCGNONE 
J100034P12CGCGTGCGNONE 
J100045D21CGCGTGCGNONE 
Os04g0412100AK108223CCGATCCGCGTGCGConserved hypothetical protein. 
Os04g0414100006-038-F07CGCACGCGNONE 
AK061508CGCACGCGNONE 
Os04g0434400014-079-B10CGCACGCGCGCGAGNONE 
AK063725CGCACGCGCGCGAGConserved hypothetical protein. 
Os04g0457700J075145N15CGCACGCGConserved hypothetical protein. 
Os04g0460300AK106202CGCGTGCGAmino acid/polyamine transporter II family protein. 
Os04g0481100AK099817CGCACGCGSimilar to Seed imbibition protein (Fragment). 
AK100197CGCACGCGNONE 
AK111421CGCACGCGNONE 
Os04g0494100006-033-D05CGCACGCGNONE 
006-058-H11CGCACGCGNONE 
006-071-F12CGCACGCGNONE 
006-075-E02CGCACGCGNONE 
006-088-A06CGCACGCGNONE 
006-118-F03CGCACGCGNONE 
006-120-C07CGCACGCGNONE 
AB096140CGCACGCGNONE 
AK071013CGCACGCGSimilar to Chitinase. 
AK104242CGCACGCGNONE 
AK104426CGCACGCGNONE 
J023002I19CGCACGCGNONE 
J023080F19CGCACGCGNONE 
Os04g0525900AK065806CGCGTGCGMajor facilitator superfamily protein. 
AK065806CGCGTGCGMajor facilitator superfamily protein. 
Os04g0529100AK107680CGCACGCGTCGCGPathogenesis-related transcriptional factor and ERF domain containing protein. 
Os04g0576300J065199E10CGCACGCGPseudouridylate synthase TruB, N-terminal domain containing protein. 
Os04g0576400AK109276CGCACGCGConserved hypothetical protein. 
Os04g0579200AK100603GCCCCACGCACGCGZinc finger, RING-type domain containing protein. 
Os04g0589600011-100-F04CGCACGCGNONE 
AK061833CGCACGCGGlycosyl transferase, group 1 domain containing protein. 
AK098964CGCACGCGNONE 
AK100053CGCACGCGNONE 
Os04g0602800AK100925CGCACGCGSimilar to Yarrowia lipolytica chromosome D of strain CLIB99 of Yarrowia lipolytica. 
Os04g0638800AK070319CACCGCACGCGProtein of unknown function DUF617, plant family protein. 
AK071753CACCGCACGCGNONE 
Os04g0647800AK065350CGCACGCGSimilar to Glycerol kinase 2 (EC 2.7.1.30). 
AK069876CGCACGCGNONE 
AK104069CGCACGCGNONE 
Os04g0648600AK108279CGCACGCGConserved hypothetical protein. 
Os04g0660200AK120239CGCGTGCGABC-1 domain containing protein. 
Os04g0661300AK070723CGCACGCGConserved hypothetical protein. 
AK103942CGCACGCGNONE 
Os04g0669300AK071148CGCGTGCGDynamin family protein. 
Os04g0674800AK119913CGCGTGCGCCCACGASimilar to CEL1=CELLULASE 1 (Fragment). 
Os05g0121800AK101222CGCACGCGTCTCConserved hypothetical protein. 
J033031D02CGCACGCGTCTCNONE 
J065078F10CGCACGCGTCTCNONE 
J065151J16CGCACGCGTCTCNONE 
J065151K04CGCACGCGTCTCNONE 
J090057E18CGCACGCGTCTCNONE 
Os05g0146100AK106767CGCGTGCGPeptidase, trypsin-like serine and cysteine domain containing protein. 
Os05g0179300AK100028CGCGTGCGTransferase family protein. 
Os05g0209500009-103-C11CGCACGCGNONE 
009-147-H05CGCACGCGNONE 
AK105188CGCACGCGConserved hypothetical protein. 
J065076G22CGCACGCGNONE 
J065095C01CGCACGCGNONE 
J065168J16CGCACGCGNONE 
J065198O13CGCACGCGNONE 
J065212K19CGCACGCGNONE 
Os05g0342900013-038-A01CGCGTGCGNONE 
016-009-H08CGCGTGCGNONE 
AK064169CGCGTGCGTetratricopeptide-like helical domain containing protein. 
J065104H07CGCGTGCGNONE 
J065158N02CGCGTGCGNONE 
J065163N05CGCGTGCGNONE 
J075071G06CGCGTGCGNONE 
J075173L11CGCGTGCGNONE 
J090017D12CGCGTGCGNONE 
J100072G13CGCGTGCGNONE 
J100089I06CGCGTGCGNONE 
Os05g0349800011-076-D06CGCACGCGNONE 
014-037-D12CGCACGCGNONE 
AK063677CGCACGCGEmbryonic abundant protein 1. 
AK119674CGCACGCGNONE 
J053027D20CGCACGCGNONE 
J053039D11CGCACGCGNONE 
J053047P16CGCACGCGNONE 
J053048F05CGCACGCGNONE 
J053058E11CGCACGCGNONE 
J053060C03CGCACGCGNONE 
J053082N12CGCACGCGNONE 
J065017B15CGCACGCGNONE 
J065117G02CGCACGCGNONE 
J065212K21CGCACGCGNONE 
J075001H18CGCACGCGNONE 
J075003F20CGCACGCGNONE 
J075026F11CGCACGCGNONE 
J075035F13CGCACGCGNONE 
J075055C12CGCACGCGNONE 
J075067L20CGCACGCGNONE 
J075067O13CGCACGCGNONE 
J075070A12CGCACGCGNONE 
J075089E05CGCACGCGNONE 
J075128J17CGCACGCGNONE 
J075134M19CGCACGCGNONE 
J075192L11CGCACGCGNONE 
J075199D14CGCACGCGNONE 
Os05g0391500AK119412CGCACGCGSimilar to Endo-beta-mannosidase. 
Os05g0392000AK060457CGCGTGCGConserved hypothetical protein. 
J065021J01CGCGTGCGNONE 
Os05g0392700AK058728CGCACGCGNONE 
AK073425CGCACGCGNONE 
AK104407CGCACGCGMitochondrial substrate carrier family protein. 
Os05g0397700AK067298CGCACGCGSecY protein family protein. 
Os05g0405400J090016P17GGCCCGCACGCGNONE 
Os05g0438500006-102-F01CGCACGCGNONE 
AK059951CGCACGCGSimilar to Soluble inorganic pyrophosphatase (EC 3.6.1.1) (Pyrophosphate phospho- hydrolase) (PPase). 
Os05g0441400AK108756CGCGTGCGProtein of unknown function DUF623, plant domain containing protein. 
Os05g0444200AK102658CTCGCGCGCACGCGSimilar to T6J4.5 protein (WIP6 protein). 
Os05g0451200AK073037CGCACGCGConserved hypothetical protein. 
Os05g0455600AK060152CGCACCGCACGCGPrenylated rab acceptor PRA1 family protein. 
AK103269CGCACCGCACGCGNONE 
AK105995CGCACCGCACGCGNONE 
J023109E13CGCACCGCACGCGNONE 
J023120K13CGCACCGCACGCGNONE 
J033124H03CGCACCGCACGCGNONE 
Os05g0457800Os05g0457800CGCACGCGSimilar to Glycerol-3-phosphate acyltransferase 5 (EC 2.3.1.15) (AtGPAT5). 
Os05g0464300009-043-G06CGCGTGCGNONE 
AK062470CGCGTGCGConserved hypothetical protein. 
Os05g0495900AK069244CGCACGCGSimilar to Beta-1,3-glucanase precursor (Fragment). 
J013157P10CGCACGCGNONE 
J023031M04CGCACGCGNONE 
J065063H10CGCACGCGNONE 
Os05g0510700AK070308CGCACGCGBSD domain containing protein. 
Os05g0524100AK067043CGCACGCGConserved hypothetical protein. 
J013091B04CGCACGCGNONE 
J013158F14CGCACGCGNONE 
J033069I09CGCACGCGNONE 
J065191P07CGCACGCGNONE 
J090046D16CGCACGCGNONE 
Os05g0539400AK068572CGCACGCGGlycoside hydrolase, family 35 protein. 
J013063P08CGCACGCGNONE 
J013110N24CGCACGCGNONE 
J013156K22CGCACGCGNONE 
J043038A08CGCACGCGNONE 
J090004K18CGCACGCGNONE 
J090085F03CGCACGCGNONE 
Os05g0545400006-068-A09CGCGTGCGNONE 
AK105946CGCGTGCGProtein kinase-like domain containing protein. 
Os05g0547800009-166-F08CGCACGCGNONE 
AK073272CGCACGCGConserved hypothetical protein. 
J033029C12CGCACGCGNONE 
Os05g0555300009-032-C03CGCGTGCGCTGGCCCACGGNONE 
009-125-E08CGCGTGCGCTGGCCCACGGNONE 
009-149-C12CGCGTGCGCTGGCCCACGGNONE 
009-172-C01CGCGTGCGCTGGCCCACGGNONE 
AK062890CGCGTGCGCTGGCCCACGGFerredoxin domain containing protein. 
AK062997CGCGTGCGCTGGCCCACGGNONE 
Os05g0557200AK062090CGCACGCGNONE 
AK102111CGCACGCGArmadillo-like helical domain containing protein. 
J013047E13CGCACGCGNONE 
J013089P04CGCACGCGNONE 
J013130H17CGCACGCGNONE 
J013132C20CGCACGCGNONE 
J023001E06CGCACGCGNONE 
J023108C09CGCACGCGNONE 
J023125C12CGCACGCGNONE 
J033023O10CGCACGCGNONE 
J033033K16CGCACGCGNONE 
J033064C11CGCACGCGNONE 
J033071P07CGCACGCGNONE 
J033072H14CGCACGCGNONE 
J033084F06CGCACGCGNONE 
J033084H11CGCACGCGNONE 
J033097C05CGCACGCGNONE 
J043009E20CGCACGCGNONE 
J053035M10CGCACGCGNONE 
J053043J22CGCACGCGNONE 
J053082K10CGCACGCGNONE 
J053094N13CGCACGCGNONE 
Os05g0574500006-021-A08CGCGTGCGNONE 
006-049-A11CGCGTGCGNONE 
006-086-F03CGCGTGCGNONE 
009-051-F06CGCGTGCGNONE 
AB015287CGCGTGCGNONE 
AB015972CGCGTGCGNONE 
AK061714CGCGTGCGNONE 
AK098889CGCGTGCGNONE 
AK121699CGCGTGCGSimilar to GTP-binding nuclear protein Ran1B (Fragment). 
J013001L15CGCGTGCGNONE 
J013072D17CGCGTGCGNONE 
J023028M04CGCGTGCGNONE 
J023031F01CGCGTGCGNONE 
J023114L22CGCGTGCGNONE 
J033058L12CGCGTGCGNONE 
J033073D17CGCGTGCGNONE 
J043031D08CGCGTGCGNONE 
J043036G01CGCGTGCGNONE 
J065144O04CGCGTGCGNONE 
J065181O08CGCGTGCGNONE 
J080066B20CGCGTGCGNONE 
Os05g0577200AK069756CGCACGCGTCCCarboxylesterase, type B family protein. 
Os05g0585900AK062575CGCGTGCGMitochondrial substrate carrier family protein. 
AK098854CGCGTGCGNONE 
J013000H16CGCGTGCGNONE 
J033118D07CGCGTGCGNONE 
Os06g0161800AK064664CGCGTGCGProtein of unknown function DUF569 family protein. 
Os06g0163200AK068888CGCACGCGEsterase/lipase/thioesterase domain containing protein. 
J023001E15CGCACGCGNONE 
J075100H16CGCACGCGNONE 
J075138N07CGCACGCGNONE 
Os06g0166900012-095-F08CGCACGCGNONE 
AK058497CGCACGCGProtein kinase-like domain containing protein. 
J023122G08CGCACGCGNONE 
J033039B21CGCACGCGNONE 
J090077C01CGCACGCGNONE 
Os06g0205250J065122J15CGCACGCGConserved hypothetical protein. 
Os06g0220600AK058664CGCACGCGConserved hypothetical protein. 
J075096L21CGCACGCGNONE 
Os06g0233200AK108060CGCGTGCGSimilar to RING-H2 finger protein ATL1R (RING-H2 finger protein ATL8). 
Os06g0265000AK100247CGCGTGCGSimilar to Asparagine synthetase. 
D83378CGCGTGCGNONE 
J013033O15CGCGTGCGNONE 
J013037K20CGCGTGCGNONE 
J013058I07CGCGTGCGNONE 
J033125M21CGCGTGCGNONE 
J033142B02CGCGTGCGNONE 
J043030E23CGCGTGCGNONE 
J043034K11CGCGTGCGNONE 
J053050B10CGCGTGCGNONE 
J053061I09CGCGTGCGNONE 
J053068F17CGCGTGCGNONE 
J053074G11CGCGTGCGNONE 
J053095N11CGCGTGCGNONE 
J090028M17CGCGTGCGNONE 
J090031O08CGCGTGCGNONE 
J090094C22CGCGTGCGNONE 
J100045M24CGCGTGCGNONE 
J100055P03CGCGTGCGNONE 
J100073O10CGCGTGCGNONE 
J100081K21CGCGTGCGNONE 
U55873CGCGTGCGNONE 
Os06g0294950J065167C16CGCACGCGConserved hypothetical protein. 
J065167C16CGCGTGCGConserved hypothetical protein. 
Os06g0308800AK066935CGCGTGCGProtein of unknown function DUF605 family protein. 
J013049E21CGCGTGCGNONE 
J013093K12CGCGTGCGNONE 
J023136A17CGCGTGCGNONE 
J023142F10CGCGTGCGNONE 
J100033A08CGCGTGCGNONE 
J100087G08CGCGTGCGNONE 
Os06g0506600009-119-E12CGCGTGCGNONE 
J023086A18CGCGTGCGNONE 
J033036I02CGCGTGCGNONE 
J033125C16CGCGTGCGNONE 
J065013I11CGCGTGCGNONE 
J065026O21CGCGTGCGNONE 
J065060H10CGCGTGCGNONE 
J065067A15CGCGTGCGNONE 
J065068F07CGCGTGCGNONE 
J065085N06CGCGTGCGNONE 
J065108N10CGCGTGCGNONE 
J065161O11CGCGTGCGNONE 
J065185J15CGCGTGCGNONE 
J065191H18CGCGTGCGNONE 
J065199J09CGCGTGCGNONE 
J075005G03CGCGTGCGNONE 
J075018C16CGCGTGCGNONE 
J075061K20CGCGTGCGNONE 
J075069J06CGCGTGCGNONE 
J075075H19CGCGTGCGNONE 
J075076D20CGCGTGCGNONE 
J075078D16CGCGTGCGNONE 
J075100J19CGCGTGCGNONE 
J075110M11CGCGTGCGNONE 
J075157N05CGCGTGCGNONE 
J075171F20CGCGTGCGNONE 
J075177G08CGCGTGCGNONE 
J075179G08CGCGTGCGNONE 
Os06g0542100AK111086CGCGTGCGHypothetical protein. 
J090051D03CGCGTGCGNONE 
Os06g0547500AK107081CGCACGCGConserved hypothetical protein. 
Os06g0595900AK066655CACGCCACGCGTGCGTranscription elongation factor S-II, central region domain containing protein. 
J075022F02CACGCCACGCGTGCGNONE 
J075055H13CACGCCACGCGTGCGNONE 
J075188H14CACGCCACGCGTGCGNONE 
Os06g0644800006-051-A11CGCACGCGNONE 
006-061-C06CGCACGCGNONE 
006-086-A03CGCACGCGNONE 
006-091-B11CGCACGCGNONE 
AK105643CGCACGCGNONE 
AK109442CGCACGCGMannose-6-phosphate receptor, binding domain containing protein. 
J065083E17CGCACGCGNONE 
Os06g0649900AK122015CGCACGCGPhospholipase D/Transphosphatidylase domain containing protein. 
J023121B16CGCACGCGNONE 
J033111K04CGCACGCGNONE 
Os06g0687900003-115-E01CCCATCCACGCACGCGNONE 
AB054003CCCATCCACGCACGCGGlycosyl transferase, family 43 protein. 
J065212N07CCCATCCACGCACGCGNONE 
Os06g0714000AK069538CGCACGCGProtein of unknown function UPF0183 family protein. 
J023020A02CGCACGCGNONE 
J023039H03CGCACGCGNONE 
J100042E23CGCACGCGNONE 
J100069N01CGCACGCGNONE 
J100089L13CGCACGCGNONE 
Os07g0121500J100066O17CGCACGCGNONE 
Os07g0145250J075010B04CGCACGCGNONE 
J075030M07CGCACGCGNONE 
J075039C20CGCACGCGNONE 
J075047G02CGCACGCGNONE 
J075059C09CGCACGCGNONE 
J075093A20CGCACGCGNONE 
J075122B05CGCACGCGNONE 
J075130K10CGCACGCGConserved hypothetical protein. 
J075138D05CGCACGCGNONE 
J075161C12CGCACGCGNONE 
Os07g0198300006-052-H02CGCGTGCGNONE 
009-097-B09CGCGTGCGNONE 
009-116-E02CGCGTGCGNONE 
009-186-A12CGCGTGCGNONE 
AK060951CGCGTGCGPlant lipid transfer/seed storage/trypsin-alpha amylase inhibitor domain containing protein. 
AK071830CGCGTGCGNONE 
J023117F24CGCGTGCGNONE 
J065073D24CGCGTGCGNONE 
J065116O11CGCGTGCGNONE 
J065122C11CGCGTGCGNONE 
Os07g0244400015-027-H10CGCACGCGNONE 
AK106280CGCACGCGProtein prenyltransferase domain containing protein. 
Os07g0255900J075118F23CGCGTGCGGGCCConserved hypothetical protein. 
Os07g0258400AK121534CGCACGCGNONE 
L41217CGCACGCGNONE 
S81897CGCACGCGOsNramp1 (Integral membrane protein). 
Os07g0267300AK071612CGCGTGCGHypothetical protein. 
J065115L02CGCGTGCGNONE 
J075013O04CGCGTGCGNONE 
Os07g0285200AK073171CGCGTGCGCyclin-like F-box domain containing protein. 
J033022I08CGCGTGCGNONE 
J065080B02CGCGTGCGNONE 
J100059N11CGCGTGCGNONE 
Os07g0407700006-069-D11CGCGTGCGNONE 
012-045-F02CGCGTGCGNONE 
AK061089CGCGTGCGHypothetical protein. 
AK070017CGCGTGCGNONE 
J023039B11CGCGTGCGNONE 
J023082I03CGCGTGCGNONE 
J033080H23CGCGTGCGNONE 
J053058C08CGCGTGCGNONE 
J065050G08CGCGTGCGNONE 
Os07g0421300AK121014CGCACGCGSimilar to Alpha glucosidase-like protein. 
Os07g0438800AK060412CGCGTGCGGTGNONE 
AK100065CGCGTGCGGTGSimilar to Phosphate starvation regulator protein (Regulatory protein of P- starvation acclimation response Psr1). 
AK103195CGCGTGCGGTGNONE 
AY224478CGCGTGCGGTGNONE 
J013160O05CGCGTGCGGTGNONE 
J023030C05CGCGTGCGGTGNONE 
J033025O04CGCGTGCGGTGNONE 
J033121P15CGCGTGCGGTGNONE 
J043034I23CGCGTGCGGTGNONE 
J065022N01CGCGTGCGGTGNONE 
J065022N02CGCGTGCGGTGNONE 
J065023M01CGCGTGCGGTGNONE 
J065101G13CGCGTGCGGTGNONE 
J075058P13CGCGTGCGGTGNONE 
J075186K10CGCGTGCGGTGNONE 
J075199F17CGCGTGCGGTGNONE 
Os07g0600700006-028-B10CGCACGCGNONE 
006-044-B07CGCACGCGNONE 
006-080-B12CGCACGCGNONE 
009-080-G07CGCACGCGNONE 
011-018-G09CGCACGCGNONE 
AK111913CGCACGCGNONE 
AK111970CGCACGCGX8 domain containing protein. 
AK112017CGCACGCGNONE 
J023100B07CGCACGCGNONE 
J023104C24CGCACGCGNONE 
J033079E21CGCACGCGNONE 
J033126J18CGCACGCGNONE 
J065116M24CGCACGCGNONE 
J075017P07CGCACGCGNONE 
J075092N07CGCACGCGNONE 
J090017E17CGCACGCGNONE 
J090046J10CGCACGCGNONE 
J090062B18CGCACGCGNONE 
J090077H04CGCACGCGNONE 
Os07g0602000AK071832CCACCAACGCGTGCGSimilar to NADPH HC toxin reductase (Fragment). 
J023121D11CCACCAACGCGTGCGNONE 
J023138E01CCACCAACGCGTGCGNONE 
J023149O13CCACCAACGCGTGCGNONE 
J090074M19CCACCAACGCGTGCGNONE 
Os07g0611700AK109158CGCGTGCGCACGGCCCATGPeptidase C1A, papain family protein. 
Os07g0611800Os07g0611800CGCGTGCGCACGGCCCATGNONE 
Os07g0620300AK059588CGCACGCGNONE 
AK099000CGCACGCGNONE 
AK099150CGCACGCGNONE 
AK119518CGCACGCGClathrin adaptor complex, medium chain family protein. 
Os07g0620800AK063671CGCACGCGCACGCGCyclin-like domain containing protein. 
Os07g0623300AK070292CGCGTGCGSimilar to Splicing factor SC35. 
J023050C05CGCGTGCGNONE 
J090025O12CGCGTGCGNONE 
Os07g0656600006-022-H05CGCACGCGNONE 
006-022-H05CGCGTGCGNONE 
AK060061CGCACGCGRibosomal protein L14b/L23e family protein. 
AK060061CGCGTGCGRibosomal protein L14b/L23e family protein. 
Os07g0680600AK059307CGCACGCGNONE 
Os07g0681400009-117-B11CGCACGCGTCGCGNONE 
AK062850CGCACGCGTCGCGSimilar to Calcium-binding protein CAST. 
J065025F13CGCACGCGTCGCGNONE 
Os07g0695400015-036-B08GCGTCGCGTCGCGTGCGNONE 
AK100615GCGTCGCGTCGCGTGCGNONE 
AK106304GCGTCGCGTCGCGTGCGKIP1-like domain containing protein. 
J023108B01GCGTCGCGTCGCGTGCGNONE 
Os08g0110400AK100025CGCGTGCGProtein of unknown function DUF266, plant family protein. 
Os08g0143400015-006-A10CGCACGCGNONE 
AK066792CGCACGCGNONE 
AK120532CGCACGCGSWIRM domain containing protein. 
J100083F02CGCACGCGNONE 
Os08g0143500006-072-G06CGCGTGCGNONE 
016-053-H02CGCGTGCGNONE 
AK061094CGCGTGCGNONE 
AK071122CGCGTGCGGlycosyl transferase, family 14 protein. 
J023081E17CGCGTGCGNONE 
J023106O18CGCGTGCGNONE 
J043001N22CGCGTGCGNONE 
J065062D05CGCGTGCGNONE 
J065099M15CGCGTGCGNONE 
J065180K12CGCGTGCGNONE 
J090045L23CGCGTGCGNONE 
J100088K05CGCGTGCGNONE 
Os08g0416000AF145729CGCGTGCGHomeodomain leucine zipper protein. 
AK100634CGCGTGCGNONE 
AK101569CGCGTGCGNONE 
AK110561CGCGTGCGNONE 
J013074A01CGCGTGCGNONE 
J013159K22CGCGTGCGNONE 
J023028M01CGCGTGCGNONE 
J023033C15CGCGTGCGNONE 
J023107N23CGCGTGCGNONE 
J023110A12CGCGTGCGNONE 
J023122D02CGCGTGCGNONE 
J033050G15CGCGTGCGNONE 
J033107D17CGCGTGCGNONE 
J065082J21CGCGTGCGNONE 
J065165L21CGCGTGCGNONE 
J065171J17CGCGTGCGNONE 
J100026K13CGCGTGCGNONE 
J100039E16CGCGTGCGNONE 
J100056J11CGCGTGCGNONE 
J100070I19CGCGTGCGNONE 
J100073B16CGCGTGCGNONE 
J100081M19CGCGTGCGNONE 
J100088E09CGCGTGCGNONE 
Os08g0423400AK072922CGCACGCGConserved hypothetical protein. 
AK072922CGCGTGCGConserved hypothetical protein. 
J023146P06CGCACGCGNONE 
J023146P06CGCGTGCGNONE 
Os08g0443800AK110630CGCACGCGCD9/CD37/CD63 antigen family protein. 
Os08g0474000009-121-F01CCCCCGCGTGCGNONE 
009-124-B06CCCCCGCGTGCGNONE 
AK062882CCCCCGCGTGCGSimilar to AP2 domain containing protein RAP2.6 (Fragment). 
Os08g0476900AK101432CGCACGCGSimilar to Patatin-like protein 1. 
J033038K22CGCACGCGNONE 
J065089F13CGCACGCGNONE 
Os08g0549200AK069066CGCGTGCGGlycoside hydrolase, family 35 protein. 
J023007A22CGCGTGCGNONE 
J023030P18CGCGTGCGNONE 
J023056L18CGCGTGCGNONE 
J023090P11CGCGTGCGNONE 
J023104P10CGCGTGCGNONE 
J023115M06CGCGTGCGNONE 
Os08g0553800006-058-A04TATTGGGCCGTGTGGGCCGGCGCGTGCGNONE 
006-061-F09TATTGGGCCGTGTGGGCCGGCGCGTGCGNONE 
AK065711TATTGGGCCGTGTGGGCCGGCGCGTGCGNONE 
AK066697TATTGGGCCGTGTGGGCCGGCGCGTGCGNmrA-like family protein. 
AK073638TATTGGGCCGTGTGGGCCGGCGCGTGCGNONE 
AK104428TATTGGGCCGTGTGGGCCGGCGCGTGCGNONE 
AK105897TATTGGGCCGTGTGGGCCGGCGCGTGCGNONE 
J075001A06TATTGGGCCGTGTGGGCCGGCGCGTGCGNONE 
J075041H20TATTGGGCCGTGTGGGCCGGCGCGTGCGNONE 
J075123J24TATTGGGCCGTGTGGGCCGGCGCGTGCGNONE 
Os09g0281800AK105291CGCACGCGConserved hypothetical protein. 
Os09g0325300011-005-H08CGCACGCGNONE 
AK068435CGCACGCGConserved hypothetical protein. 
AK073998CGCACGCGNONE 
J033071H21CGCACGCGNONE 
J065214H05CGCACGCGNONE 
Os09g0369500013-023-F11CGCGTGCGNONE 
AK105322CGCGTGCGNONE 
AK105479CGCGTGCGConserved hypothetical protein. 
Os09g0453800AK119212CACGCCACGCGTGCGNONE 
J023081A04CACGCCACGCGTGCGNONE 
J065180G14CACGCCACGCGTGCGNONE 
J100024A17CACGCCACGCGTGCGNONE 
J100030A05CACGCCACGCGTGCGNONE 
J100042I11CACGCCACGCGTGCGNONE 
J100054N05CACGCCACGCGTGCGNONE 
J100075G23CACGCCACGCGTGCGNONE 
Os09g0459200AK110733CGCACGCGConserved hypothetical protein. 
J065131C07CGCACGCGNONE 
Os09g0465600AB107218CGCACGCGNONE 
AK068061CGCACGCGSimilar to Glucose-6-phosphate isomerase-like protein (Fragment). 
AY224509CGCACGCGNONE 
Os09g0466300AK102696CGCGTGCGGRAM domain containing protein. 
J033103F22CGCGTGCGNONE 
Os09g0535500AK108282CGCGTGCGSimilar to RING-H2 finger protein ATL1R (RING-H2 finger protein ATL8). 
Os09g0542900AK073400CGCACGCGConserved hypothetical protein. 
Os09g0558100009-028-D03CGCACGCGNONE 
014-011-A04CGCACGCGNONE 
AB030211CGCACGCGSimilar to Low-temperature induced protein lt101.2. 
AK062410CGCACGCGNONE 
J065006B17CGCACGCGNONE 
J065067M15CGCACGCGNONE 
J065075E19CGCACGCGNONE 
J075011G16CGCACGCGNONE 
J075015L22CGCACGCGNONE 
J075035O11CGCACGCGNONE 
J075072E15CGCACGCGNONE 
J075100O22CGCACGCGNONE 
Os09g0568000AK068829CGCGTGCGNONE 
Os11g0152900AK109321CGCACGCGConserved hypothetical protein. 
AK109321CGCGTGCGConserved hypothetical protein. 
Os11g0166800AK070928CGCACGCGRNA polymerase II transcription factor SIII subunit A family protein. 
Os11g0180300AK072438CGCACGCGConserved hypothetical protein. 
J013092P11CGCACGCGNONE 
J013092P13CGCACGCGNONE 
J023107D15CGCACGCGNONE 
J065191C20CGCACGCGNONE 
J090082F02CGCACGCGNONE 
Os11g0181500006-025-C02CGCGTGCGGTGNONE 
AK060074CGCGTGCGGTGNONE 
AK067601CGCGTGCGGTGSimilar to Nitrogen fixation like protein. 
Os11g0231600AK121872CGCACGCGCyclin-like F-box domain containing protein. 
Os11g0237700J100060P16CGCACGCGConserved hypothetical protein. 
J100065I12CGCACGCGNONE 
Os11g0472500AK061749CGCACGCGNONE 
AK073686CGCACGCGProtein of unknown function UPF0016 family protein. 
AK104618CGCACGCGNONE 
Os11g0475600J023003B03CGCGTGCGNONE 
J023099M13CGCGTGCGSimilar to Hexose transporter. 
Os11g0602300AK103473CGCGTGCGSimilar to HVA22-like protein a (AtHVA22a). 
J033075N24CGCGTGCGNONE 
Os11g0602900006-069-F01CGCACCGCGCACGCGNONE 
006-088-E03CGCACCGCGCACGCGNONE 
AK059904CGCACCGCGCACGCGNONE 
AK068821CGCACCGCGCACGCGPeptidyl-prolyl cis-trans isomerase, cyclophilin type domain containing protein. 
AK104231CGCACCGCGCACGCGNONE 
J053052O17CGCACCGCGCACGCGNONE 
J065060I12CGCACCGCGCACGCGNONE 
J065063E04CGCACCGCGCACGCGNONE 
J065065K12CGCACCGCGCACGCGNONE 
J065097O13CGCACCGCGCACGCGNONE 
J065149K01CGCACCGCGCACGCGNONE 
J065176B15CGCACCGCGCACGCGNONE 
J090051M01CGCACCGCGCACGCGNONE 
Os11g0604600006-022-C01CGCACGCGNONE 
AK061397CGCACGCGNONE 
AK102376CGCACGCGRINGv domain containing protein. 
J033091P05CGCACGCGNONE 
J065062C12CGCACGCGNONE 
J065062H09CGCACGCGNONE 
J065064A02CGCACGCGNONE 
J065101I16CGCACGCGNONE 
J065123F23CGCACGCGNONE 
J065155N12CGCACGCGNONE 
J065164F22CGCACGCGNONE 
J065181G08CGCACGCGNONE 
J075055H05CGCACGCGNONE 
J075058A22CGCACGCGNONE 
J075082H23CGCACGCGNONE 
J075111A14CGCACGCGNONE 
J075176I06CGCACGCGNONE 
Os12g0145700AK071391CGCGTGCGPyruvate kinase family protein. 
J023013N02CGCGTGCGNONE 
J033085D15CGCGTGCGNONE 
J043021I09CGCGTGCGNONE 
J100055L05CGCGTGCGNONE 
Os12g0244400AK070297CGCGTGCGSimilar to Lysine and histidine specific transporter. 
J023028K05CGCGTGCGNONE 
J023052C04CGCGTGCGNONE 
J023086N07CGCGTGCGNONE 
J023138D01CGCGTGCGNONE 
J090033L20CGCGTGCGNONE 
J090039M09CGCGTGCGNONE 
J090055E20CGCGTGCGNONE 
J090099N22CGCGTGCGNONE 
Os12g0297500AK072331CGCACGCGGlycoside hydrolase, starch-binding domain containing protein. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.