version

Summary of OsREG556 (All List)

OrganismOryza sativa  
IDOsREG556  
SequenceCGCGACGC  
Annotation  
PPDB Motif 
PLACE MotifCGACG  "CGACG element" found in the GC-rich regions of the rice (O.s.) Amy3D and Amy3E amylase genes, but not in Amy3E gene; May function as a coupling element for the G box element;  
Total Entry Count1854  

Entry Sequences (1854 entries)

LocusGene modelSequenceDescription
Os01g0104000AK072087GACGCGACGCACCGCNONE 
AK103808GACGCGACGCACCGCC-type lectin domain containing protein. 
Os01g0104100AK072797GCGGTGCGTCGCGTCZinc finger, RING-type domain containing protein. 
AK104280GCGGTGCGTCGCGTCNONE 
Os01g0139900AK121677CGCGACGCConserved hypothetical protein. 
J033069D19CGCGACGCNONE 
Os01g0171200AK107515CGCGACGCNONE 
AK109475CGCGACGCConserved hypothetical protein. 
Os01g0172400AK065102CGCGACGCGACNONE 
AK100365CGCGACGCGACNONE 
AK119523CGCGACGCGACNONE 
D73411CGCGACGCGACPhospholipase D alpha 1 precursor (EC 3.1.4.4) (PLD alpha 1) (Choline phosphatase 1) (Phosphatidylcholine-hydrolyzing phospholipase D 1). 
J013001N03CGCGACGCGACNONE 
J013052B12CGCGACGCGACNONE 
J013071F15CGCGACGCGACNONE 
J013108F19CGCGACGCGACNONE 
J023025E17CGCGACGCGACNONE 
J023083O10CGCGACGCGACNONE 
J023084M17CGCGACGCGACNONE 
J023100D16CGCGACGCGACNONE 
J023107O10CGCGACGCGACNONE 
J023119F08CGCGACGCGACNONE 
J033035B07CGCGACGCGACNONE 
J033052C18CGCGACGCGACNONE 
J033092H11CGCGACGCGACNONE 
J033096D02CGCGACGCGACNONE 
J033117A16CGCGACGCGACNONE 
J043010E08CGCGACGCGACNONE 
J043013C12CGCGACGCGACNONE 
J065001M15CGCGACGCGACNONE 
J065021O11CGCGACGCGACNONE 
J065089O20CGCGACGCGACNONE 
J065117N05CGCGACGCGACNONE 
J065129L11CGCGACGCGACNONE 
J065170F18CGCGACGCGACNONE 
J090066E11CGCGACGCGACNONE 
J090076N24CGCGACGCGACNONE 
J090093G21CGCGACGCGACNONE 
J100041H17CGCGACGCGACNONE 
J100050D07CGCGACGCGACNONE 
J100063A06CGCGACGCGACNONE 
Os01g0179300AB118015CGCGACGCGNONE 
AK066179CGCGACGCGConserved hypothetical protein. 
J013027I24CGCGACGCGNONE 
J013057C04CGCGACGCGNONE 
J013114A12CGCGACGCGNONE 
J033044D13CGCGACGCGNONE 
J033088C17CGCGACGCGNONE 
J065079P13CGCGACGCGNONE 
J065097I15CGCGACGCGNONE 
J100025A19CGCGACGCGNONE 
J100027L07CGCGACGCGNONE 
J100035E12CGCGACGCGNONE 
J100076G01CGCGACGCGNONE 
Os01g0201400AK070397CGCGTCGCGRapid ALkalinization Factor family protein. 
Os01g0205900006-057-B04CGCACGCGACGCGACNONE 
AK060687CGCACGCGACGCGACNONE 
AK105932CGCACGCGACGCGACSimilar to Class III peroxidase GvPx2b (Fragment). 
J033143I12CGCACGCGACGCGACNONE 
J075013J08CGCACGCGACGCGACNONE 
J075090B11CGCACGCGACGCGACNONE 
J075143C17CGCACGCGACGCGACNONE 
J075147O13CGCACGCGACGCGACNONE 
J075161L02CGCACGCGACGCGACNONE 
Os01g0211600AK060710GCGTCGCGCytochrome P450 family protein. 
Os01g0224500AK109225GCAGCCCACCACGCGACGCGCGACConserved hypothetical protein. 
Os01g0226400AK102301CGCGACGCGAAA ATPase domain containing protein. 
Os01g0276300AK108165CGCGACGCSimilar to Group 3 late embryogenesis abundant protein (Fragment). 
Os01g0279700AK067683CGCGTCGCGTCNONE 
AK100107CGCGTCGCGTCMajor facilitator superfamily protein. 
J023004N09CGCGTCGCGTCNONE 
J075019L14CGCGTCGCGTCNONE 
J075187F21CGCGTCGCGTCNONE 
Os01g0305900Os01g0305900CGCGTCGCGTCGCSimilar to A-type R2R3 Myb protein (Fragment). 
Os01g0390400AK067433ACGTGTCGCGACGCGNONE 
AK106834ACGTGTCGCGACGCGNONE 
J033069B09ACGTGTCGCGACGCGNONE 
Os01g0391100012-001-B05CGCGACGCGTGGCCGAGACGTGGCNONE 
012-053-F01CGCGACGCGTGGCCGAGACGTGGCNONE 
AK063499CGCGACGCGTGGCCGAGACGTGGCNONE 
J065021A04CGCGACGCGTGGCCGAGACGTGGCNONE 
J065076H06CGCGACGCGTGGCCGAGACGTGGCNONE 
J065181E05CGCGACGCGTGGCCGAGACGTGGCNONE 
J065187A05CGCGACGCGTGGCCGAGACGTGGCNONE 
J075036C17CGCGACGCGTGGCCGAGACGTGGCNONE 
J075051C18CGCGACGCGTGGCCGAGACGTGGCNONE 
J075063L16CGCGACGCGTGGCCGAGACGTGGCNONE 
J075079M08CGCGACGCGTGGCCGAGACGTGGCNONE 
J075112H15CGCGACGCGTGGCCGAGACGTGGCNONE 
J075135F10CGCGACGCGTGGCCGAGACGTGGCNONE 
J075164H06CGCGACGCGTGGCCGAGACGTGGCNONE 
J075195N02CGCGACGCGTGGCCGAGACGTGGCNONE 
Os01g0571000AK066090CGCGACGCMitochondrial substrate carrier family protein. 
AK121334CGCGACGCNONE 
Os01g0594900AK070921CGCGCGACGCCGCGACGCGConserved hypothetical protein. 
J023074J04CGCGCGACGCCGCGACGCGNONE 
J023078B04CGCGCGACGCCGCGACGCGNONE 
J023078N11CGCGCGACGCCGCGACGCGNONE 
J075143E19CGCGCGACGCCGCGACGCGNONE 
J075187L10CGCGCGACGCCGCGACGCGNONE 
J080010N23CGCGCGACGCCGCGACGCGNONE 
J080013C01CGCGCGACGCCGCGACGCGNONE 
J080013G03CGCGCGACGCCGCGACGCGNONE 
J080016I23CGCGCGACGCCGCGACGCGNONE 
J080017E01CGCGCGACGCCGCGACGCGNONE 
J080029E18CGCGCGACGCCGCGACGCGNONE 
J080034L24CGCGCGACGCCGCGACGCGNONE 
J080039N12CGCGCGACGCCGCGACGCGNONE 
J080067L11CGCGCGACGCCGCGACGCGNONE 
J080068N08CGCGCGACGCCGCGACGCGNONE 
J080069E19CGCGCGACGCCGCGACGCGNONE 
J080071E16CGCGCGACGCCGCGACGCGNONE 
J080077J09CGCGCGACGCCGCGACGCGNONE 
J080085E03CGCGCGACGCCGCGACGCGNONE 
J080301J09CGCGCGACGCCGCGACGCGNONE 
J080303L19CGCGCGACGCCGCGACGCGNONE 
J080308B12CGCGCGACGCCGCGACGCGNONE 
Os01g0598600AK104992GCGTCGCGNONE 
Os01g0606900AK065697CGCGTCGCGHeat shock protein DnaJ, N-terminal domain containing protein. 
Os01g0623500AK066142CGCGACGCGACAAA ATPase domain containing protein. 
J013055O07CGCGACGCGACNONE 
J053069D06CGCGACGCGACNONE 
J053095J11CGCGACGCGACNONE 
J065106D24CGCGACGCGACNONE 
J065134H18CGCGACGCGACNONE 
J075066D09CGCGACGCGACNONE 
J090004M17CGCGACGCGACNONE 
J100039L05CGCGACGCGACNONE 
J100042E15CGCGACGCGACNONE 
J100043B18CGCGACGCGACNONE 
J100057L11CGCGACGCGACNONE 
J100067C24CGCGACGCGACNONE 
J100073H01CGCGACGCGACNONE 
J100081J21CGCGACGCGACNONE 
Os01g0623900J090025M21CACGCCACGCCACGCGACGCGACNONE 
J090082F22CACGCCACGCCACGCGACGCGACNONE 
J090084L02CACGCCACGCCACGCGACGCGACSimilar to Splicing factor, arginine/serine-rich 2 (Splicing factor SC35) (SC-35) (Splicing component, 35 kDa) (PR264 protein). 
Os01g0662600009-056-E10GCGTCGCGTCTCNONE 
AK062234GCGTCGCGTCTCNONE 
AK098887GCGTCGCGTCTCNONE 
AK099656GCGTCGCGTCTCNONE 
AK119723GCGTCGCGTCTCSimilar to NifU-like protein. 
J013001K01GCGTCGCGTCTCNONE 
J013090F20GCGTCGCGTCTCNONE 
J013119A14GCGTCGCGTCTCNONE 
J013121P12GCGTCGCGTCTCNONE 
J033132I15GCGTCGCGTCTCNONE 
J075023F22GCGTCGCGTCTCNONE 
J075023M13GCGTCGCGTCTCNONE 
J100024D10GCGTCGCGTCTCNONE 
J100024N01GCGTCGCGTCTCNONE 
J100026H09GCGTCGCGTCTCNONE 
J100027H07GCGTCGCGTCTCNONE 
J100045K07GCGTCGCGTCTCNONE 
J100057K18GCGTCGCGTCTCNONE 
J100085C22GCGTCGCGTCTCNONE 
Os01g0663400AK072645CGCGACGCGNONE 
J090023O22CGCGACGCGNONE 
J090054G09CGCGACGCGNONE 
J090058H13CGCGACGCGNONE 
J090076G13CGCGACGCGNONE 
Os01g0667900013-097-A02CGCGTCGCGNONE 
013-097-A02GCGTCGCGCGGGCCCCACCNONE 
014-011-C01CGCGTCGCGNONE 
014-011-C01GCGTCGCGCGGGCCCCACCNONE 
AK105335CGCGTCGCGGlutaredoxin-like, plant II family protein. 
AK105335GCGTCGCGCGGGCCCCACCGlutaredoxin-like, plant II family protein. 
J065156F10CGCGTCGCGNONE 
J065156F10GCGTCGCGCGGGCCCCACCNONE 
J065163D22CGCGTCGCGNONE 
J065163D22GCGTCGCGCGGGCCCCACCNONE 
J065197J04CGCGTCGCGNONE 
J065197J04GCGTCGCGCGGGCCCCACCNONE 
J075122C02CGCGTCGCGNONE 
J075122C02GCGTCGCGCGGGCCCCACCNONE 
J100047L16CGCGTCGCGNONE 
J100047L16GCGTCGCGCGGGCCCCACCNONE 
Os01g0681900AB008845GTGTGGGGACGCGACGCGNADH dependent Glutamate Synthase precursor (EC 1.4.1.14). 
AK105755GTGTGGGGACGCGACGCGNONE 
Os01g0699600009-111-F06CGCGACGCGNONE 
AK105196CGCGACGCGProtein kinase-like domain containing protein. 
J065128A07CGCGACGCGNONE 
Os01g0701900AK066793CGCGACGCGTGGSimilar to Phosphatidylinositol transfer-like protein III. 
AK066793GCGTCGCGSimilar to Phosphatidylinositol transfer-like protein III. 
Os01g0704100AK072215CGCGACGCGSimilar to Membrane transporter. 
AK109776CGCGACGCGNONE 
J080037E03CGCGACGCGNONE 
J080041H13CGCGACGCGNONE 
J080046B15CGCGACGCGNONE 
J080058K14CGCGACGCGNONE 
J080065E14CGCGACGCGNONE 
J080079C08CGCGACGCGNONE 
J080088J12CGCGACGCGNONE 
J080088M19CGCGACGCGNONE 
J100043G11CGCGACGCGNONE 
J100059M22CGCGACGCGNONE 
Os01g0705700003-130-H06CGCGACGCNONE 
AK064946CGCGACGCSimilar to Transcription factor ICE1 (Inducer of CBF expression 1) (Basic helix- loop-helix protein 116) (bHLH116) (AtbHLH116). 
J013000P16CGCGACGCNONE 
Os01g0730900AK120751GTTGGTGGCGTCGCGTCChaperonin clpA/B family protein. 
J023004P12GTTGGTGGCGTCGCGTCNONE 
J065006G23GTTGGTGGCGTCGCGTCNONE 
Os01g0733200AK066316CGCGACGCGACSimilar to Heat shock transcription factor 29 (Fragment). 
AY344493CGCGACGCGACNONE 
J013066G03CGCGACGCGACNONE 
J090034J08CGCGACGCGACNONE 
Os01g0748100AK071261GCGTCGCGTCHypothetical protein. 
J023084C08GCGTCGCGTCNONE 
J065058A07GCGTCGCGTCNONE 
Os01g0749000AK107255GCGTCGCGProtein of unknown function DUF1264 family protein. 
AK107265GCGTCGCGNONE 
AK107290GCGTCGCGNONE 
J075001C07GCGTCGCGNONE 
Os01g0757900AK105476CGCGCGACGCHaloacid dehalogenase/epoxide hydrolase family protein. 
Os01g0765400015-011-F09CCCATCCACGCGACGCGNONE 
AK106246CCCATCCACGCGACGCGProteinase inhibitor I4, serpin family protein. 
J100034N10CCCATCCACGCGACGCGNONE 
J100054I23CCCATCCACGCGACGCGNONE 
J100055K02CCCATCCACGCGACGCGNONE 
J100082D02CCCATCCACGCGACGCGNONE 
Os01g0774500AK069241GCGACGCGACGCGConserved hypothetical protein. 
Os01g0778500J065046B15GCGTCGCGNONE 
J065167B09GCGTCGCGNONE 
J065181M19GCGTCGCGConserved hypothetical protein. 
Os01g0794100009-027-B12CGCGTCGCGNONE 
AK062404CGCGTCGCGConserved hypothetical protein. 
Os01g0796700AK120491CGCGTCGCGCGZinc finger, RING-type domain containing protein. 
Os01g0812900009-200-B11CGCGTCGCGTCNONE 
AK121582CGCGTCGCGTCConserved hypothetical protein. 
J013120B14CGCGTCGCGTCNONE 
J023049H09CGCGTCGCGTCNONE 
J023107J02CGCGTCGCGTCNONE 
J033025F24CGCGTCGCGTCNONE 
J033037D14CGCGTCGCGTCNONE 
J033084J01CGCGTCGCGTCNONE 
J033128E11CGCGTCGCGTCNONE 
J065140B08CGCGTCGCGTCNONE 
J075019M06CGCGTCGCGTCNONE 
J075023B03CGCGTCGCGTCNONE 
J075053H24CGCGTCGCGTCNONE 
J075067J23CGCGTCGCGTCNONE 
J075069E12CGCGTCGCGTCNONE 
J075122C03CGCGTCGCGTCNONE 
J075146G01CGCGTCGCGTCNONE 
J075150L21CGCGTCGCGTCNONE 
J075156M23CGCGTCGCGTCNONE 
J075161H02CGCGTCGCGTCNONE 
J075170F21CGCGTCGCGTCNONE 
Os01g0813900AK101729CGCGACGCGTCCSimilar to ZIGA1 protein (Fragment). 
Os01g0823600J075039G17GCGCGCGACGCConserved hypothetical protein. 
J075042I11GCGCGCGACGCNONE 
J075054M24GCGCGCGACGCNONE 
J075074C22GCGCGCGACGCNONE 
J075081G13GCGCGCGACGCNONE 
J075099I03GCGCGCGACGCNONE 
J075108D14GCGCGCGACGCNONE 
J075129O14GCGCGCGACGCNONE 
J075136P07GCGCGCGACGCNONE 
J075149P09GCGCGCGACGCNONE 
J075157K12GCGCGCGACGCNONE 
J075176K20GCGCGCGACGCNONE 
J080302C21GCGCGCGACGCNONE 
Os01g0833200AK121629CGCGTCGCGCGConserved hypothetical protein. 
J023093N07CGCGTCGCGCGNONE 
J033050C20CGCGTCGCGCGNONE 
J080302F22CGCGTCGCGCGNONE 
J080303H06CGCGTCGCGCGNONE 
J080306J04CGCGTCGCGCGNONE 
J080309K06CGCGTCGCGCGNONE 
J080311E18CGCGTCGCGCGNONE 
J080318A20CGCGTCGCGCGNONE 
J100031F20CGCGTCGCGCGNONE 
J100034P21CGCGTCGCGCGNONE 
J100042K08CGCGTCGCGCGNONE 
J100047H24CGCGTCGCGCGNONE 
J100065C14CGCGTCGCGCGNONE 
J100074E23CGCGTCGCGCGNONE 
Os01g0841000009-005-A12CGCGACGCNONE 
AK059601CGCGACGCENTH/VHS domain containing protein. 
AK103342CGCGACGCNONE 
J023022C02CGCGACGCNONE 
J023030C09CGCGACGCNONE 
J033075D24CGCGACGCNONE 
J033123O16CGCGACGCNONE 
J033126C16CGCGACGCNONE 
J065120M23CGCGACGCNONE 
J065190I23CGCGACGCNONE 
J090090G01CGCGACGCNONE 
Os01g0849600AK108159CGCGACGCSimilar to ENOD18 protein (Fragment). 
Os01g0851100AK071217CGCGTCGCGNONE 
Os01g0851400J065070P10GCGTCGCGMachado-Joseph disease protein MJD family protein. 
J065153F01GCGTCGCGNONE 
Os01g0869800006-029-F03CGCGTCGCGNONE 
006-067-H02CGCGTCGCGNONE 
006-084-A06CGCGTCGCGNONE 
AK058284CGCGTCGCGSimilar to Photosystem II subunit PsbS. 
AK071827CGCGTCGCGNONE 
AK104275CGCGTCGCGNONE 
J013049J07CGCGTCGCGNONE 
J033089F12CGCGTCGCGNONE 
J090094I11CGCGTCGCGNONE 
Os01g0875500012-063-E07CGCGACGCNONE 
012-063-E07CGCGTCGCGTCGCGNONE 
AK101399CGCGACGCSimilar to Beta-galactosidase (EC 3.2.1.23). 
AK101399CGCGTCGCGTCGCGSimilar to Beta-galactosidase (EC 3.2.1.23). 
AK102715CGCGACGCNONE 
AK102715CGCGTCGCGTCGCGNONE 
J023104F17CGCGACGCNONE 
J023104F17CGCGTCGCGTCGCGNONE 
J023128M07CGCGACGCNONE 
J023128M07CGCGTCGCGTCGCGNONE 
J033022B13CGCGACGCNONE 
J033022B13CGCGTCGCGTCGCGNONE 
J033034C09CGCGACGCNONE 
J033034C09CGCGTCGCGTCGCGNONE 
J033037E13CGCGACGCNONE 
J033037E13CGCGTCGCGTCGCGNONE 
J033044E15CGCGACGCNONE 
J033044E15CGCGTCGCGTCGCGNONE 
J033085M16CGCGACGCNONE 
J033085M16CGCGTCGCGTCGCGNONE 
J033087L24CGCGACGCNONE 
J033087L24CGCGTCGCGTCGCGNONE 
J033089G01CGCGACGCNONE 
J033089G01CGCGTCGCGTCGCGNONE 
J033093D16CGCGACGCNONE 
J033093D16CGCGTCGCGTCGCGNONE 
J033102B22CGCGACGCNONE 
J033102B22CGCGTCGCGTCGCGNONE 
J033108E02CGCGACGCNONE 
J033108E02CGCGTCGCGTCGCGNONE 
J033115P07CGCGACGCNONE 
J033115P07CGCGTCGCGTCGCGNONE 
J033122A10CGCGACGCNONE 
J033122A10CGCGTCGCGTCGCGNONE 
J090033B09CGCGACGCNONE 
J090033B09CGCGTCGCGTCGCGNONE 
J090038A15CGCGACGCNONE 
J090038A15CGCGTCGCGTCGCGNONE 
J090053G04CGCGACGCNONE 
J090053G04CGCGTCGCGTCGCGNONE 
J090069H01CGCGACGCNONE 
J090069H01CGCGTCGCGTCGCGNONE 
J090093F16CGCGACGCNONE 
J090093F16CGCGTCGCGTCGCGNONE 
Os01g0896200AK105622GCGTCGCGCGConserved hypothetical protein. 
Os01g0904200AK068432CGCGTCGCGProtein kinase-like domain containing protein. 
J100027C22CGCGTCGCGNONE 
J100064A19CGCGTCGCGNONE 
Os01g0913600AK071735CCTCGCCCCCCGCGACGCSimilar to Rho GDP-dissociation inhibitor 1 (Rho GDI-1) (AtRhoGDI1). 
J023003J11CCTCGCCCCCCGCGACGCNONE 
J023037O11CCTCGCCCCCCGCGACGCNONE 
J023109K10CCTCGCCCCCCGCGACGCNONE 
Os01g0962500AK073163CGCGTCGCGZinc finger, HIT-type domain containing protein. 
AK105822CGCGTCGCGNONE 
J033024I07CGCGTCGCGNONE 
Os02g0179200AK111348CGCGACGCGTCGCGlutamine amidotransferase class-I domain containing protein. 
J065218O07CGCGACGCGTCGCNONE 
Os02g0195500AK062207CGCGACGCGNONE 
Os02g0462800AK110587CGCGTCGCGTCGCGTCGCGWRKY transcription factor 42 (Transcription factor WRKY02). 
AY676923CGCGTCGCGTCGCGTCGCGNONE 
Os02g0497700011-094-A10CGCGTCGCGNONE 
012-073-H02CGCGTCGCGNONE 
016-056-G05CGCGTCGCGNONE 
AK070143CGCGTCGCGNONE 
J023041O14CGCGTCGCGNONE 
J023092H01CGCGTCGCGNONE 
J033048A17CGCGTCGCGNONE 
J033051K21CGCGTCGCGNONE 
J033122D01CGCGTCGCGNONE 
J090032E23CGCGTCGCGNONE 
J090055K13CGCGTCGCGNONE 
Os02g0509600AK111075CGCGACGCConserved hypothetical protein. 
J065033B09CGCGACGCNONE 
J065069L04CGCGACGCNONE 
J065089H14CGCGACGCNONE 
J065119J16CGCGACGCNONE 
J065142J22CGCGACGCNONE 
J065168B14CGCGACGCNONE 
J065203L03CGCGACGCNONE 
J075044C18CGCGACGCNONE 
J075068D13CGCGACGCNONE 
J075152O09CGCGACGCNONE 
Os02g0537500AK068689CGCGACGCGSimilar to E2F homolog. 
Os02g0556800AK060580CGCACGCGACGCGACNONE 
AK100187CGCACGCGACGCGACConserved hypothetical protein. 
J065162A21CGCACGCGACGCGACNONE 
J075093B20CGCACGCGACGCGACNONE 
J075097N04CGCACGCGACGCGACNONE 
Os02g0580700AK073664CTCTCCGCGACGCGConserved hypothetical protein. 
J090060F24CTCTCCGCGACGCGNONE 
Os02g0597800AK072807CGCGACGCSteroid nuclear receptor, ligand-binding domain containing protein. 
Os02g0605600016-017-B02CGCGTCGCGTCNONE 
AK066104CGCGTCGCGTCLUC7 related family protein. 
J013052G16CGCGTCGCGTCNONE 
J043022E03CGCGTCGCGTCNONE 
J065105P10CGCGTCGCGTCNONE 
Os02g0625500011-025-C06AGCTGAGCGTCGCGNONE 
AB050624AGCTGAGCGTCGCGNONE 
AK059188AGCTGAGCGTCGCGNONE 
AK059771AGCTGAGCGTCGCGNONE 
AK101791AGCTGAGCGTCGCGSimilar to Adenosine kinase-like protein (Fragment). 
AY224510AGCTGAGCGTCGCGNONE 
J013152H02AGCTGAGCGTCGCGNONE 
J023012P09AGCTGAGCGTCGCGNONE 
J023127D16AGCTGAGCGTCGCGNONE 
J033024G01AGCTGAGCGTCGCGNONE 
J033025L19AGCTGAGCGTCGCGNONE 
J033080M04AGCTGAGCGTCGCGNONE 
J033101A08AGCTGAGCGTCGCGNONE 
J033121L12AGCTGAGCGTCGCGNONE 
J043017N15AGCTGAGCGTCGCGNONE 
J065207J01AGCTGAGCGTCGCGNONE 
J090049G12AGCTGAGCGTCGCGNONE 
J100036A07AGCTGAGCGTCGCGNONE 
J100076C04AGCTGAGCGTCGCGNONE 
J100080N22AGCTGAGCGTCGCGNONE 
Os02g0626100003-107-B06CAGGTGGGCCACGCGTCGCGNONE 
AK120127CAGGTGGGCCACGCGTCGCGNONE 
Os02g0627100AK068993CGCGACGCGSimilar to Phenylalanine ammonia-lyase (EC 4.3.1.5). 
D21290CGCGACGCGNONE 
J023001A06CGCGACGCGNONE 
J065156K20CGCGACGCGNONE 
J065187O09CGCGACGCGNONE 
J100036D20CGCGACGCGNONE 
J100089I01CGCGACGCGNONE 
Os02g0633400AK073723CGCGTCGCGCGCSimilar to 61 kDa protein homolog. 
J100031K17CGCGTCGCGCGCNONE 
Os02g0640000AK120841CGCGACGCGC2 calcium/lipid-binding region, CaLB domain containing protein. 
J023022G19CGCGACGCGNONE 
J023081F22CGCGACGCGNONE 
Os02g0669100012-068-E10CGCGTCGCGNONE 
016-075-F09CGCGTCGCGNONE 
AB011367CGCGTCGCGNONE 
AK070197CGCGTCGCGNONE 
AY587109CGCGTCGCGDehydrin family protein. 
AY786415CGCGTCGCGNONE 
J023042N13CGCGTCGCGNONE 
J023128F01CGCGTCGCGNONE 
J065002K05CGCGTCGCGNONE 
J090057I09CGCGTCGCGNONE 
J090067J23CGCGTCGCGNONE 
J090071B04CGCGTCGCGNONE 
J100018L23CGCGTCGCGNONE 
J100036A11CGCGTCGCGNONE 
J100063L18CGCGTCGCGNONE 
J100071G02CGCGTCGCGNONE 
J100084P19CGCGTCGCGNONE 
Os02g0671200J065152N20GCCCACCCCGCGACGCNONE 
J075053E22GCCCACCCCGCGACGCConserved hypothetical protein. 
Os02g0672500AK109266GCGTCGCGNONE 
Os02g0675000AK109532CGCGACGCConserved hypothetical protein. 
Os02g0693700AK103774CGCGACGCGSimilar to P-glycoprotein ABCB5. 
AK106518CGCGACGCGNONE 
Os02g0708100AK059630CGCGACGCGACNONE 
AK102055CGCGACGCGACSimilar to Carbamoyl phosphate synthetase small subunit (EC 6.3.5.5). 
Os02g0717600J090003H19CCCCCGCGACGCGGATCGGACGGCTNONE 
J100090A12CCCCCGCGACGCGGATCGGACGGCTConserved hypothetical protein. 
Os02g0726000AK072936CGCGACGCGNONE 
AK099178CGCGACGCGBeta-Ig-H3/fasciclin domain containing protein. 
J090014C14CGCGACGCGNONE 
J090014G22CGCGACGCGNONE 
J090031H04CGCGACGCGNONE 
J090054D18CGCGACGCGNONE 
J090054I05CGCGACGCGNONE 
J090064M02CGCGACGCGNONE 
J090073C19CGCGACGCGNONE 
Os02g0728600AK063054GCGTCGCGSimilar to H/ACA ribonucleoprotein complex subunit 2 (H/ACA snoRNP protein NHP2) (High mobility group-like nuclear protein 2). 
J065121P04GCGTCGCGNONE 
Os02g0752300AK072544CGCGACGCGConserved hypothetical protein. 
J023132N16CGCGACGCGNONE 
J033069F17CGCGACGCGNONE 
Os02g0753800AK101787CGCGACGCGACGCGACGCSimilar to Annexin p35. 
Os02g0762400AK103084GCGACGCGACGCGCyclin-dependent kinase inhibitor family protein. 
Os02g0770100AK111651CGCGTCGCGConserved hypothetical protein. 
AK111651GACGCGACGCGACConserved hypothetical protein. 
J023029P14CGCGTCGCGNONE 
J023029P14GACGCGACGCGACNONE 
J065119C17CGCGTCGCGNONE 
J065119C17GACGCGACGCGACNONE 
Os02g0775300AK111093CGCGACGCConserved hypothetical protein. 
J100039N18CGCGACGCNONE 
Os02g0788800AK066747CGCGACGCGAmino acid/polyamine transporter II family protein. 
Os02g0789600AK101046CGCGTCGCGTCNONE 
AK112100CGCGTCGCGTCSimilar to DEM2. 
Os03g0116800012-097-D10CCCACGCGACGCGACNONE 
016-024-H10CCCACGCGACGCGACNONE 
AK066955CCCACGCGACGCGACConserved hypothetical protein. 
AK068678CCCACGCGACGCGACNONE 
AK104839CCCACGCGACGCGACNONE 
J013033G16CCCACGCGACGCGACNONE 
J013091C10CCCACGCGACGCGACNONE 
J013158H22CCCACGCGACGCGACNONE 
J023106K11CCCACGCGACGCGACNONE 
J065051O15CCCACGCGACGCGACNONE 
J065129G22CCCACGCGACGCGACNONE 
J075001K02CCCACGCGACGCGACNONE 
J075011O03CCCACGCGACGCGACNONE 
J075024K04CCCACGCGACGCGACNONE 
J075026E07CCCACGCGACGCGACNONE 
J075037O14CCCACGCGACGCGACNONE 
J075071D17CCCACGCGACGCGACNONE 
J075084M05CCCACGCGACGCGACNONE 
J075114B06CCCACGCGACGCGACNONE 
J075128C23CCCACGCGACGCGACNONE 
J075153A13CCCACGCGACGCGACNONE 
J075158A15CCCACGCGACGCGACNONE 
J075165P09CCCACGCGACGCGACNONE 
J075167M21CCCACGCGACGCGACNONE 
J075170F11CCCACGCGACGCGACNONE 
J075186F12CCCACGCGACGCGACNONE 
J075186L13CCCACGCGACGCGACNONE 
J075189A01CCCACGCGACGCGACNONE 
J075192D19CCCACGCGACGCGACNONE 
Os03g0124300AK069148CGCACGCGACGCGConserved hypothetical protein. 
AK106076CGCACGCGACGCGNONE 
J023003G19CGCACGCGACGCGNONE 
Os03g0126800J075039C05CGCGTCGCGNONE 
J075172P07CGCGTCGCGNONE 
J075176L13CGCGTCGCGNONE 
J075180L10CGCGTCGCGNONE 
J090019H18CGCGTCGCGNONE 
J090024P22CGCGTCGCGNONE 
Os03g0126900AK109217GTCGCGTCGCGTCConserved hypothetical protein. 
J065085G16GTCGCGTCGCGTCNONE 
J100086C03GTCGCGTCGCGTCNONE 
Os03g0128300AK064718GCGTCGCGCGCConserved hypothetical protein. 
Os03g0140700AK070000GTCCGTCCCCCGCGCGACGCGACTetratricopeptide-like helical domain containing protein. 
Os03g0141200AK068968AGCCCACGCGTCGCGSimilar to Beta-amylase PCT-BMYI (EC 3.2.1.2). 
AK100092AGCCCACGCGTCGCGNONE 
J023003L18AGCCCACGCGTCGCGNONE 
J023022K18AGCCCACGCGTCGCGNONE 
J023107H13AGCCCACGCGTCGCGNONE 
J023107K02AGCCCACGCGTCGCGNONE 
Os03g0143700AK066360CGCGACGCGACGCGACConserved hypothetical protein. 
J013066M09CGCGACGCGACGCGACNONE 
J023087N24CGCGACGCGACGCGACNONE 
Os03g0146000006-105-H06GTCGCGTCGCGTCGCGTCGAGTCGAGTCNONE 
AK061250GTCGCGTCGCGTCGCGTCGAGTCGAGTCSimilar to RAB1X. 
AK099130GTCGCGTCGCGTCGCGTCGAGTCGAGTCNONE 
J023043D11GTCGCGTCGCGTCGCGTCGAGTCGAGTCNONE 
J043009O17GTCGCGTCGCGTCGCGTCGAGTCGAGTCNONE 
Os03g0157700015-011-D01CGCGCGACGCGGGCCGAGNONE 
AK102075CGCGCGACGCGGGCCGAGProtein of unknown function DUF639 family protein. 
AK106245CGCGCGACGCGGGCCGAGNONE 
J075144I02CGCGCGACGCGGGCCGAGNONE 
Os03g0177000AK071368CGCGACGCGCN5-related N-acetyltransferase domain containing protein. 
Os03g0210600AK070125CGCGTCGCGConserved hypothetical protein. 
Os03g0214400AK067931GACGCGACGCSimilar to Digalactosyldiacylglycerol synthase 2. 
Os03g0245200003-116-E09CGCGACGCNONE 
AK062288CGCGACGCProtein of unknown function DUF1210 family protein. 
J075022G03CGCGACGCNONE 
J075088C24CGCGACGCNONE 
J075110L07CGCGACGCNONE 
J075112K01CGCGACGCNONE 
J075131F24CGCGACGCNONE 
J075149D10CGCGACGCNONE 
Os03g0246800AK070145CGCACGCGACGCGNONE 
AK102770CGCACGCGACGCGNONE 
Os03g0273800AK059223CGCGACGCCATGGGCTTCNONE 
AK067356CGCGACGCCATGGGCTTCNONE 
AK100173CGCGACGCCATGGGCTTCPyrimidine 5-nucleotidase family protein. 
Os03g0277000AK100522CCACGCGTCGCGCGCSimilar to GDP dissociation inhibitor protein OsGDI1. 
Os03g0302800AK061293GCGACGCGACGCGConserved hypothetical protein. 
Os03g0319300006-021-E05GTCGCGTCGCGNONE 
006-022-H12GTCGCGTCGCGNONE 
009-187-E02GTCGCGTCGCGNONE 
AF042840GTCGCGTCGCGNONE 
AK059756GTCGCGTCGCGCalmodulin (CaM). 
AK070090GTCGCGTCGCGNONE 
J065017J02GTCGCGTCGCGNONE 
J065028G17GTCGCGTCGCGNONE 
J065045N09GTCGCGTCGCGNONE 
J065078F21GTCGCGTCGCGNONE 
J065091H01GTCGCGTCGCGNONE 
J065112B19GTCGCGTCGCGNONE 
J065186E08GTCGCGTCGCGNONE 
J065199G12GTCGCGTCGCGNONE 
J075030K07GTCGCGTCGCGNONE 
J075050B02GTCGCGTCGCGNONE 
J075057G07GTCGCGTCGCGNONE 
J075070F01GTCGCGTCGCGNONE 
J075093N12GTCGCGTCGCGNONE 
J075095K13GTCGCGTCGCGNONE 
J075102D14GTCGCGTCGCGNONE 
J075103B17GTCGCGTCGCGNONE 
J075114K05GTCGCGTCGCGNONE 
J075142F18GTCGCGTCGCGNONE 
J075154L11GTCGCGTCGCGNONE 
J075185F08GTCGCGTCGCGNONE 
J090012A14GTCGCGTCGCGNONE 
J090044L10GTCGCGTCGCGNONE 
J100044C12GTCGCGTCGCGNONE 
J100088J19GTCGCGTCGCGNONE 
Os03g0330300AK060756CGCGTCGCGViral attachment protein, fibre shaft repeat containing protein. 
AK072405CGCGTCGCGNONE 
J013043H13CGCGTCGCGNONE 
J013097M19CGCGTCGCGNONE 
J023080M15CGCGTCGCGNONE 
Os03g0374400016-027-B12GCGTCGCGCCCACCTNONE 
AK069719GCGTCGCGCCCACCTConserved hypothetical protein. 
J023020L05GCGTCGCGCCCACCTNONE 
J023026H16GCGTCGCGCCCACCTNONE 
J033025P22GCGTCGCGCCCACCTNONE 
J075016I21GCGTCGCGCCCACCTNONE 
J090015G21GCGTCGCGCCCACCTNONE 
Os03g0374500Os03g0374500GCGTCGCGCCCACCTHypothetical protein. 
Os03g0437200006-066-E02GCGTCGCGTCGCNONE 
AK059839GCGTCGCGTCGCZinc finger, C2H2-type domain containing protein. 
AY295345GCGTCGCGTCGCNONE 
Os03g0561249J065016H04CGCGACGCGTGGConserved hypothetical protein. 
Os03g0634000014-034-A03CGCGTCGCGTCGCNONE 
AK063673CGCGTCGCGTCGCSimilar to THA4. 
Os03g0669300006-050-A06CGCGTCGCGNONE 
AK061572CGCGTCGCGGlycoside hydrolase, family 17 protein. 
AK120399CGCGTCGCGNONE 
AK120903CGCGTCGCGNONE 
J075023N09CGCGTCGCGNONE 
J075083N02CGCGTCGCGNONE 
J075097I22CGCGTCGCGNONE 
J100070D08CGCGTCGCGNONE 
J100086L13CGCGTCGCGNONE 
Os03g0675300015-081-H08CGCGACGCNONE 
AK106417CGCGACGCAntihaemostatic protein domain containing protein. 
Os03g0703000011-082-B01CGCGACGCNONE 
014-041-E03CGCGACGCNONE 
AK100165CGCGACGCNONE 
AK103027CGCGACGCNONE 
AK105026CGCGACGCNONE 
J013146C10CGCGACGCNONE 
J023050B03CGCGACGCNONE 
J033117C01CGCGACGCNONE 
J080039D22CGCGACGCNONE 
J090013G10CGCGACGCNONE 
J090025K21CGCGACGCNONE 
J090052K21CGCGACGCNONE 
J090074F22CGCGACGCNONE 
J100063C18CGCGACGCNONE 
J100083C15CGCGACGCNONE 
U28047CGCGACGCSimilar to Beta-glucosidase. 
Os03g0711300AK060694CGCGACGCNONE 
Os03g0711600X88799CGCGTCGCGSimilar to DNA binding protein (Fragment). 
Os03g0749900006-112-A05CGCGACGCNONE 
AK061252CGCGACGCConserved hypothetical protein. 
J023020I01CGCGACGCNONE 
J033060N21CGCGACGCNONE 
Os03g0761500AK101646GCGTCGCGNONE 
AK103255GCGTCGCGSimilar to Subtilisin-like protease (Fragment). 
J023001N03GCGTCGCGNONE 
J023019D14GCGTCGCGNONE 
J023022B15GCGTCGCGNONE 
J023132H08GCGTCGCGNONE 
J033024J07GCGTCGCGNONE 
J033028J10GCGTCGCGNONE 
J033034N16GCGTCGCGNONE 
J033058G12GCGTCGCGNONE 
J033068F19GCGTCGCGNONE 
J033090C13GCGTCGCGNONE 
J033112H13GCGTCGCGNONE 
J033123P12GCGTCGCGNONE 
J033131E23GCGTCGCGNONE 
J033131P18GCGTCGCGNONE 
J033132E16GCGTCGCGNONE 
J065047J15GCGTCGCGNONE 
J065059O05GCGTCGCGNONE 
J065061N22GCGTCGCGNONE 
J065086O08GCGTCGCGNONE 
J065117P15GCGTCGCGNONE 
J065217N21GCGTCGCGNONE 
J075017I08GCGTCGCGNONE 
J075025D11GCGTCGCGNONE 
J075026P19GCGTCGCGNONE 
J075027G19GCGTCGCGNONE 
J075060K14GCGTCGCGNONE 
J075069G18GCGTCGCGNONE 
J075088H13GCGTCGCGNONE 
J075094E18GCGTCGCGNONE 
J075095K22GCGTCGCGNONE 
J075097O06GCGTCGCGNONE 
J075116H10GCGTCGCGNONE 
J075140M17GCGTCGCGNONE 
J075172N22GCGTCGCGNONE 
J075178C01GCGTCGCGNONE 
J075179M02GCGTCGCGNONE 
J075180E18GCGTCGCGNONE 
J075181N01GCGTCGCGNONE 
J075191C02GCGTCGCGNONE 
J090003N22GCGTCGCGNONE 
J090040H23GCGTCGCGNONE 
J090051D11GCGTCGCGNONE 
J090060E01GCGTCGCGNONE 
J090073O06GCGTCGCGNONE 
J090095G24GCGTCGCGNONE 
J100027P22GCGTCGCGNONE 
J100055A18GCGTCGCGNONE 
J100088C12GCGTCGCGNONE 
Os03g0772600AK120949GAGACGCGACGCGACGCGACGCGSimilar to Lectin-like receptor kinase 7;2. 
Os03g0784400AK103474GCGTCGCGTCProtein of unknown function DUF1692 domain containing protein. 
J023135I15GCGTCGCGTCNONE 
J033130D12GCGTCGCGTCNONE 
J043035E20GCGTCGCGTCNONE 
J065206K15GCGTCGCGTCNONE 
J075053J20GCGTCGCGTCNONE 
J075129B11GCGTCGCGTCNONE 
J090003E22GCGTCGCGTCNONE 
J100023E23GCGTCGCGTCNONE 
Os03g0784500AK109744CATCCACCCGCGTCGCGTCTCNONE 
Os03g0785500AK067718CGCGACGCGProtein of unknown function DUF284, transmembrane eukaryotic family protein. 
Os03g0793700AK121667CGCGACGCCupin 1 domain containing protein. 
AY098743CGCGACGCNONE 
Os03g0818100015-098-A09CGCGACGCNONE 
AK064366CGCGACGCNONE 
AK121701CGCGACGCHistidine acid phosphatase family protein. 
Os03g0822000AF247164CGCGACGCGNONE 
AK101784CGCGACGCGNONE 
AK119215CGCGACGCGAlpha-expansin OsEXPA7. 
J033065B20CGCGACGCGNONE 
J065038A10CGCGACGCGNONE 
J065049A16CGCGACGCGNONE 
J065085B11CGCGACGCGNONE 
J065205I19CGCGACGCGNONE 
J065210L24CGCGACGCGNONE 
Os03g0829600AK071298CGCGACGCGNONE 
AK119707CGCGACGCGConserved hypothetical protein. 
J023084A07CGCGACGCGNONE 
Os03g0855700AK070400CGCGACGCGNucleic acid-binding, OB-fold domain containing protein. 
Os04g0253000005-012-H08CGCGACGCNONE 
009-095-D01CGCGACGCNONE 
016-090-D11CGCGACGCNONE 
AK073668CGCGACGCSimilar to Histone H1. 
J013088G23CGCGACGCNONE 
J013162C07CGCGACGCNONE 
J023031N06CGCGACGCNONE 
J023039N07CGCGACGCNONE 
J023083I01CGCGACGCNONE 
J023083O14CGCGACGCNONE 
J023122B19CGCGACGCNONE 
J023133L08CGCGACGCNONE 
J033052L06CGCGACGCNONE 
J033080E10CGCGACGCNONE 
J090032L14CGCGACGCNONE 
J100022N05CGCGACGCNONE 
J100029A08CGCGACGCNONE 
J100029H18CGCGACGCNONE 
J100066D09CGCGACGCNONE 
J100077M22CGCGACGCNONE 
Os04g0405500011-007-D12CGCGTCGCGTCCCTCANONE 
AK063263CGCGTCGCGTCCCTCAConserved hypothetical protein. 
J065166G19CGCGTCGCGTCCCTCANONE 
J075180M09CGCGTCGCGTCCCTCANONE 
Os04g0406600AK103609CGCGACGCGPrephenate dehydratase domain containing protein. 
J033133I10CGCGACGCGNONE 
J075092D11CGCGACGCGNONE 
J100031M09CGCGACGCGNONE 
Os04g0407900AK064758GCGTCGCGSimilar to Cytochrom P450-like protein. 
Os04g0412300AK110902CGCGCGACGCGNONE 
AK121151CGCGCGACGCGGlycoside hydrolase, family 17 protein. 
J013126I01CGCGCGACGCGNONE 
J023078I08CGCGCGACGCGNONE 
J090006M17CGCGCGACGCGNONE 
J090060D03CGCGCGACGCGNONE 
J090063F12CGCGCGACGCGNONE 
J100040E06CGCGCGACGCGNONE 
J100057F18CGCGCGACGCGNONE 
J100058B19CGCGCGACGCGNONE 
J100058C20CGCGCGACGCGNONE 
J100067G08CGCGCGACGCGNONE 
J100082C09CGCGCGACGCGNONE 
J100086D14CGCGCGACGCGNONE 
Os04g0414500AK121479CGCGTCGCGConserved hypothetical protein. 
J023149I19CGCGTCGCGNONE 
J090084C07CGCGTCGCGNONE 
Os04g0430600009-014-G12CGCGTCGCGTCNONE 
015-019-A08CGCGTCGCGTCNONE 
015-048-C08CGCGTCGCGTCNONE 
015-085-E11CGCGTCGCGTCNONE 
AK072050CGCGTCGCGTCNONE 
AK106337CGCGTCGCGTCConserved hypothetical protein. 
J065037C09CGCGTCGCGTCNONE 
J075125G18CGCGTCGCGTCNONE 
Os04g0434400014-079-B10CGCGCGACGCGNONE 
AK063725CGCGCGACGCGConserved hypothetical protein. 
Os04g0464200AK103582GCGTCGCGBetaine-aldehyde dehydrogenase (EC 1.2.1.8) (BADH). 
J033133A13GCGTCGCGNONE 
J090026I06GCGTCGCGNONE 
J090096B12GCGTCGCGNONE 
Os04g0481100AK099817CGCGTCGCGSimilar to Seed imbibition protein (Fragment). 
AK100197CGCGTCGCGNONE 
AK111421CGCGTCGCGNONE 
Os04g0494600AK110895CGCGTCGCGCGProtein of unknown function DUF642 family protein. 
Os04g0529100AK107680CGCACGCGTCGCGPathogenesis-related transcriptional factor and ERF domain containing protein. 
Os04g0545100AK071451GCGTCGCGEngulfment and cell motility, ELM domain containing protein. 
Os04g0556300009-065-A04CGCGACGCNONE 
009-124-C05CGCGACGCNONE 
AK062772CGCGACGCGlutathione peroxidase. 
AY100689CGCGACGCNONE 
J065008N06CGCGACGCNONE 
J065012C13CGCGACGCNONE 
J065017J06CGCGACGCNONE 
J065033M15CGCGACGCNONE 
J065086O21CGCGACGCNONE 
J065102K04CGCGACGCNONE 
J065141D21CGCGACGCNONE 
J065159K20CGCGACGCNONE 
J065164C12CGCGACGCNONE 
J065170F10CGCGACGCNONE 
J065181F20CGCGACGCNONE 
J065205N07CGCGACGCNONE 
J065209N21CGCGACGCNONE 
J075001M12CGCGACGCNONE 
J075007D22CGCGACGCNONE 
J075026H04CGCGACGCNONE 
J075042O08CGCGACGCNONE 
J075044G20CGCGACGCNONE 
J075057D10CGCGACGCNONE 
J075096L23CGCGACGCNONE 
J075104K12CGCGACGCNONE 
J075119H14CGCGACGCNONE 
J075136C14CGCGACGCNONE 
J075172D01CGCGACGCNONE 
J075184M01CGCGACGCNONE 
J075186E06CGCGACGCNONE 
J075192M08CGCGACGCNONE 
J080006D18CGCGACGCNONE 
J080044G16CGCGACGCNONE 
J080087G15CGCGACGCNONE 
J100021I05CGCGACGCNONE 
J100039D10CGCGACGCNONE 
J100073B05CGCGACGCNONE 
J100074M12CGCGACGCNONE 
Os04g0576800AK073542CGCGACGC3-oxo-5-alpha-steroid 4-dehydrogenase, C-terminal domain containing protein. 
AK104042CGCGACGCNONE 
Os04g0579200AK100603CGCGACGCZinc finger, RING-type domain containing protein. 
Os04g0586100009-190-F11CGCGACGCGACGCCCCACCNONE 
AK063206CGCGACGCGACGCCCCACCProtein of unknown function DUF581 family protein. 
Os04g0623800AK059270CGCGTCGCGCGCNONE 
AK099234CGCGTCGCGCGCSimilar to Aminomethyltransferase, mitochondrial precursor (EC 2.1.2.10) (Glycine cleavage system T protein) (GCVT). 
Os04g0642100011-074-F06CGCGACGCGNONE 
J043006J10CGCGACGCGSimilar to Microtubule-associated protein EB1. 
J043006P09CGCGACGCGNONE 
Os04g0650700006-037-H03CGCGACGCGNONE 
AK061502CGCGACGCGNONE 
AK068693CGCGACGCGNONE 
AK121820CGCGACGCGSimilar to L-asparaginase (L-asparagine amidohydrolase). 
J043030P10CGCGACGCGNONE 
J065084D09CGCGACGCGNONE 
Os04g0658600AK064729CGCGACGCGNONE 
AK119253CGCGACGCGNucleolar, Nop52 family protein. 
J075132J07CGCGACGCGNONE 
J075157N21CGCGACGCGNONE 
Os04g0674000006-093-C01CCCCCGCGACGCNONE 
009-040-F06CCCCCGCGACGCNONE 
AK071276CCCCCGCGACGCNONE 
AK109377CCCCCGCGACGCConserved hypothetical protein. 
AK119671CCCCCGCGACGCNONE 
J023084J11CCCCCGCGACGCNONE 
J023088F18CCCCCGCGACGCNONE 
J065099M12CCCCCGCGACGCNONE 
J065136J08CCCCCGCGACGCNONE 
J065167H22CCCCCGCGACGCNONE 
J075046L21CCCCCGCGACGCNONE 
J080029F17CCCCCGCGACGCNONE 
J080053C16CCCCCGCGACGCNONE 
J080053E24CCCCCGCGACGCNONE 
J080074D14CCCCCGCGACGCNONE 
J100029C12CCCCCGCGACGCNONE 
J100030D01CCCCCGCGACGCNONE 
J100044E16CCCCCGCGACGCNONE 
J100065N18CCCCCGCGACGCNONE 
J100077D18CCCCCGCGACGCNONE 
J100090P13CCCCCGCGACGCNONE 
Os04g0686700AK105746CGCGACGCKelch repeat containing protein. 
J065021K04CGCGACGCNONE 
J065097E18CGCGACGCNONE 
J075004C12CGCGACGCNONE 
J080301H10CGCGACGCNONE 
J090087N02CGCGACGCNONE 
J100060E19CGCGACGCNONE 
Os05g0116500AK102231CGCGTCGCGConserved hypothetical protein. 
J033088A05CGCGTCGCGNONE 
Os05g0119200AK067943CGCGTCGCGConserved hypothetical protein. 
J013122C02CGCGTCGCGNONE 
J065077M14CGCGTCGCGNONE 
J065108P21CGCGTCGCGNONE 
J065138G20CGCGTCGCGNONE 
J065148H07CGCGTCGCGNONE 
J065205P09CGCGTCGCGNONE 
J075061H16CGCGTCGCGNONE 
J075140H13CGCGTCGCGNONE 
J075153H02CGCGTCGCGNONE 
J075170B14CGCGTCGCGNONE 
Os05g0127300AK106429CGCGACGCGNONE 
AK121766CGCGACGCGRegulator of chromosome condensation/beta-lactamase-inhibitor protein II domain containing protein. 
J065021F23CGCGACGCGNONE 
J100041J04CGCGACGCGNONE 
Os05g0171200009-093-B06CGCGACGCCCCCACNONE 
009-157-F06CGCGACGCCCCCACNONE 
009-197-H10CGCGACGCCCCCACNONE 
AK062702CGCGACGCCCCCACEmbryo-specific 3 family protein. 
Os05g0187100012-066-F01GACGCGACGCNONE 
AK067988GACGCGACGCSimilar to Hexokinase. 
Os05g0195200015-031-H09GCGTCGCGNONE 
015-070-C11GCGTCGCGNONE 
016-063-C11GCGTCGCGNONE 
AK106392GCGTCGCGZinc finger, CCCH-type domain containing protein. 
J033051N05GCGTCGCGNONE 
J065118P05GCGTCGCGNONE 
J100071H15GCGTCGCGNONE 
J100078J22GCGTCGCGNONE 
Os05g0267800006-099-A08ACGTGTCGCGACGCNONE 
AK061207ACGTGTCGCGACGCCellular retinaldehyde-binding/triple function, N-terminal domain containing protein. 
Os05g0323900006-105-F01CGCGACGCNONE 
009-161-D06CGCGACGCNONE 
AK070528CGCGACGCManganese-superoxide dismutase precursor (EC 1.15.1.1). 
AK104030CGCGACGCNONE 
AK104160CGCGACGCNONE 
AK119904CGCGACGCNONE 
J023060D13CGCGACGCNONE 
J033057E10CGCGACGCNONE 
J043034F19CGCGACGCNONE 
J053099K12CGCGACGCNONE 
J065022N03CGCGACGCNONE 
J065035G13CGCGACGCNONE 
J065059M24CGCGACGCNONE 
J065059N23CGCGACGCNONE 
J065073I02CGCGACGCNONE 
J065095L15CGCGACGCNONE 
J065104I24CGCGACGCNONE 
J065104J24CGCGACGCNONE 
J065112L13CGCGACGCNONE 
J065114J24CGCGACGCNONE 
J065120J16CGCGACGCNONE 
J065141I09CGCGACGCNONE 
J065165E17CGCGACGCNONE 
J065170C14CGCGACGCNONE 
J065182I05CGCGACGCNONE 
J065191K20CGCGACGCNONE 
J065205L14CGCGACGCNONE 
J075017M10CGCGACGCNONE 
J075019O04CGCGACGCNONE 
J075019O15CGCGACGCNONE 
J075032E07CGCGACGCNONE 
J075042D13CGCGACGCNONE 
J075054J07CGCGACGCNONE 
J075089O11CGCGACGCNONE 
J075104G09CGCGACGCNONE 
J075150N03CGCGACGCNONE 
J075187A09CGCGACGCNONE 
J075187D04CGCGACGCNONE 
J090006G06CGCGACGCNONE 
J090045C09CGCGACGCNONE 
J090083D13CGCGACGCNONE 
J090084B13CGCGACGCNONE 
J100021H22CGCGACGCNONE 
J100034A15CGCGACGCNONE 
J100041N15CGCGACGCNONE 
J100042D05CGCGACGCNONE 
J100042D08CGCGACGCNONE 
J100059P21CGCGACGCNONE 
L19436CGCGACGCNONE 
L34038CGCGACGCNONE 
Os05g0348100006-028-F04CGCGACGCCCCAGCCCAAGNONE 
009-036-C03CGCGACGCCCCAGCCCAAGNONE 
009-040-H02CGCGACGCCCCAGCCCAAGNONE 
009-173-H12CGCGACGCCCCAGCCCAAGNONE 
AK061434CGCGACGCCCCAGCCCAAGConserved hypothetical protein. 
J065137N04CGCGACGCCCCAGCCCAAGNONE 
J065164C10CGCGACGCCCCAGCCCAAGNONE 
J065210H22CGCGACGCCCCAGCCCAAGNONE 
Os05g0358500AK060575CGCACCGCGACGCACGCCACNONE 
AK100777CGCACCGCGACGCACGCCACProtein phosphatase 2C-like domain containing protein. 
Os05g0361700AJ575218GAGACGCGCGACGCGNONE 
AK100184GAGACGCGCGACGCGSimilar to EREBP-2 protein (Fragment). 
AK111676GAGACGCGCGACGCGNONE 
J013155B14GAGACGCGCGACGCGNONE 
J065073N01GAGACGCGCGACGCGNONE 
J065161J12GAGACGCGCGACGCGNONE 
J075074A07GAGACGCGCGACGCGNONE 
J100029H13GAGACGCGCGACGCGNONE 
Os05g0381400014-036-H12CGCGTCGCGNONE 
014-085-H12CGCGTCGCGNONE 
AK102039CGCGTCGCGSimilar to ABA induced plasma membrane protein PM 19. 
J075011E17CGCGTCGCGNONE 
J075057P04CGCGTCGCGNONE 
J075066K19CGCGTCGCGNONE 
J075068L13CGCGTCGCGNONE 
J075074J21CGCGTCGCGNONE 
J075076N10CGCGTCGCGNONE 
J075078L14CGCGTCGCGNONE 
J075099O16CGCGTCGCGNONE 
J075120C05CGCGTCGCGNONE 
J075140I24CGCGTCGCGNONE 
J075148F21CGCGTCGCGNONE 
J075151F01CGCGTCGCGNONE 
J075151I10CGCGTCGCGNONE 
J075156M15CGCGTCGCGNONE 
J075191F07CGCGTCGCGNONE 
J075192K20CGCGTCGCGNONE 
J075195M22CGCGTCGCGNONE 
Os05g0382600AK068231CGCGACGCGAnnexin family protein. 
J013147O19CGCGACGCGNONE 
Os05g0388500AK065313CCCCCGCGACGCGCGAGSimilar to 50S ribosomal protein L1. 
AK098990CCCCCGCGACGCGCGAGNONE 
AK104689CCCCCGCGACGCGCGAGNONE 
J013094L23CCCCCGCGACGCGCGAGNONE 
J065118O04CCCCCGCGACGCGCGAGNONE 
Os05g0407100AK063349CGCGTCGCGCGCFour F5 protein family protein. 
Os05g0408200AK100057GCGGGCCCCACGCGCGACGCSBP domain containing protein. 
J065182F20GCGGGCCCCACGCGCGACGCNONE 
Os05g0424800AK121054CTCGCGCGTCGCGTCSimilar to AER274Wp. 
J023055P22CTCGCGCGTCGCGTCNONE 
J023102M21CTCGCGCGTCGCGTCNONE 
J033088E13CTCGCGCGTCGCGTCNONE 
J033123K17CTCGCGCGTCGCGTCNONE 
J065176L18CTCGCGCGTCGCGTCNONE 
J075002F14CTCGCGCGTCGCGTCNONE 
J075005E10CTCGCGCGTCGCGTCNONE 
J075005K21CTCGCGCGTCGCGTCNONE 
J075007A18CTCGCGCGTCGCGTCNONE 
J075021J16CTCGCGCGTCGCGTCNONE 
J075040K11CTCGCGCGTCGCGTCNONE 
J075061A14CTCGCGCGTCGCGTCNONE 
J075106H07CTCGCGCGTCGCGTCNONE 
J075109M22CTCGCGCGTCGCGTCNONE 
J075121O13CTCGCGCGTCGCGTCNONE 
J075132M08CTCGCGCGTCGCGTCNONE 
J075153B19CTCGCGCGTCGCGTCNONE 
J075158L15CTCGCGCGTCGCGTCNONE 
J075187G20CTCGCGCGTCGCGTCNONE 
J100079N17CTCGCGCGTCGCGTCNONE 
Os05g0444200AK102658CGCGCGACGCSimilar to T6J4.5 protein (WIP6 protein). 
Os05g0450300AK071191GACGCGACGCGConserved hypothetical protein. 
J023084G11GACGCGACGCGNONE 
Os05g0451300AK108341CGCGTCGCGConserved hypothetical protein. 
Os05g0458000AK060188CGCGACGCNONE 
AK068989CGCGACGCZinc finger, DHHC-type domain containing protein. 
Os05g0459900AK058918CGCGACGCGSimilar to 60S ribosomal protein L36-1. 
AK111268CGCGACGCGNONE 
J013129N08CGCGACGCGNONE 
J065191E01CGCGACGCGNONE 
J065216P03CGCGACGCGNONE 
J075089K21CGCGACGCGNONE 
Os05g0462400AK099608CGCGTCGCGLipin, N-terminal conserved region domain containing protein. 
J033138E12CGCGTCGCGNONE 
Os05g0478000AK111029CGCGTCGCGZinc finger, RING-type domain containing protein. 
Os05g0494700Os05g0494700CGCGACGCNONE 
Os05g0519800AK069435CGCGTCGCGTCProtein of unknown function DUF28 family protein. 
J023024L22CGCGTCGCGTCNONE 
Os05g0540900006-038-F02CGCGACGCNONE 
AK060489CGCGACGCNONE 
AK072284CGCGACGCConserved hypothetical protein. 
Os05g0551700AK071216GTCGCGTCGCGtRNA isopentenyltransferase family protein. 
Os05g0568600009-024-B09CGCGACGCGNONE 
AK063781CGCGACGCGProtein of unknown function DUF1645 family protein. 
J080049H14CGCGACGCGNONE 
J080062M08CGCGACGCGNONE 
J080064I07CGCGACGCGNONE 
J080068A12CGCGACGCGNONE 
J080086J10CGCGACGCGNONE 
Os05g0576600AK107732GACGCGACGCGACConserved hypothetical protein. 
Os05g0577700AK107217GCTGGGCTGGGCCCCTCGCGCGCGACGCGACSimilar to Protein kinase. 
AY224453GCTGGGCTGGGCCCCTCGCGCGCGACGCGACNONE 
Os05g0579600Os05g0579600CGCGACGCGACHomeodomain-like containing protein. 
Os05g0593000013-075-E08CGCGTCGCGNONE 
014-081-D06CGCGTCGCGNONE 
015-061-D11CGCGTCGCGNONE 
016-061-B10CGCGTCGCGNONE 
016-066-C11CGCGTCGCGNONE 
AK064253CGCGTCGCGConserved hypothetical protein. 
Os06g0130400AK065212GCGTCGCGTCSimilar to 1-aminocyclopropane-1-carboxylate synthase (EC 4.4.1.14) (Fragment). 
Os06g0153200AK072625CGCGTCGCGNONE 
AK106752CGCGTCGCGProtein of unknown function DUF250 domain containing protein. 
Os06g0166000009-023-G02CGCGTCGCGTCGCGTCNONE 
AK060317CGCGTCGCGTCGCGTCCyclin-like F-box domain containing protein. 
J075052L22CGCGTCGCGTCGCGTCNONE 
J075078E03CGCGTCGCGTCGCGTCNONE 
J075115M08CGCGTCGCGTCGCGTCNONE 
J075192G08CGCGTCGCGTCGCGTCNONE 
J100036C01CGCGTCGCGTCGCGTCNONE 
J100070J02CGCGTCGCGTCGCGTCNONE 
J100088C24CGCGTCGCGTCGCGTCNONE 
Os06g0206100AK099498CGCGTCGCGNONE 
AK121282CGCGTCGCGSimilar to Gb protein. 
Os06g0223300AK111776GCGTCGCGTCGCGTCSimilar to TDR8 protein. 
J023075K19GCGTCGCGTCGCGTCNONE 
Os06g0225300AK065224CGCGACGCGACNONE 
AK100258CGCGACGCGACSimilar to SERK1 (Fragment). 
J013002G23CGCGACGCGACNONE 
Os06g0500000J065064K10CGCGACGCGACConserved hypothetical protein. 
J065148C10CGCGACGCGACNONE 
J065183N06CGCGACGCGACNONE 
J065203F05CGCGACGCGACNONE 
Os06g0567000009-166-G12CGCGACGCNONE 
AK121337CGCGACGCProtein of unknown function UPF0197 family protein. 
J013122F01CGCGACGCNONE 
J023080N12CGCGACGCNONE 
J023120F03CGCGACGCNONE 
J065013B18CGCGACGCNONE 
J065039P21CGCGACGCNONE 
J065089E06CGCGACGCNONE 
J065095N19CGCGACGCNONE 
J065119H03CGCGACGCNONE 
J065121D18CGCGACGCNONE 
J065149G04CGCGACGCNONE 
J075012J04CGCGACGCNONE 
J075021G13CGCGACGCNONE 
J075106I23CGCGACGCNONE 
J075107F19CGCGACGCNONE 
J075152J22CGCGACGCNONE 
J075186J20CGCGACGCNONE 
J075188F16CGCGACGCNONE 
J080001G06CGCGACGCNONE 
J080002O09CGCGACGCNONE 
J080006E10CGCGACGCNONE 
J080006F24CGCGACGCNONE 
J080012L07CGCGACGCNONE 
J080016A10CGCGACGCNONE 
J080017D11CGCGACGCNONE 
J080017I04CGCGACGCNONE 
J080017I10CGCGACGCNONE 
J080020P06CGCGACGCNONE 
J080024A20CGCGACGCNONE 
J080027B10CGCGACGCNONE 
J080027E03CGCGACGCNONE 
J080027I01CGCGACGCNONE 
J080027K20CGCGACGCNONE 
J080041L12CGCGACGCNONE 
J080043D21CGCGACGCNONE 
J080044K11CGCGACGCNONE 
J080048I08CGCGACGCNONE 
J080049M12CGCGACGCNONE 
J080050C14CGCGACGCNONE 
J080050N21CGCGACGCNONE 
J080053F04CGCGACGCNONE 
J080054O16CGCGACGCNONE 
J080058O21CGCGACGCNONE 
J080059M11CGCGACGCNONE 
J080061A11CGCGACGCNONE 
J080063B15CGCGACGCNONE 
J080063F22CGCGACGCNONE 
J080066M18CGCGACGCNONE 
J080068D12CGCGACGCNONE 
J080070D22CGCGACGCNONE 
J080071B06CGCGACGCNONE 
J080072B17CGCGACGCNONE 
J080081O04CGCGACGCNONE 
J080089H05CGCGACGCNONE 
J080093K13CGCGACGCNONE 
J080095I05CGCGACGCNONE 
J080097F19CGCGACGCNONE 
J080304C03CGCGACGCNONE 
J080304H11CGCGACGCNONE 
J080308M21CGCGACGCNONE 
J080313O15CGCGACGCNONE 
J090020N23CGCGACGCNONE 
J100023C12CGCGACGCNONE 
Os06g0597600AK120804GCGACGCGACGCGAromatic-ring hydroxylase family protein. 
Os06g0613500AK070970GTCGCGTCGCGCGCSimilar to Helix-loop-helix protein homolog. 
J023066J03GTCGCGTCGCGCGCNONE 
Os06g0633100AK107791GCGCGCGACGCGConserved hypothetical protein. 
AK107791GTCGCGTCGCGTCGCGCCCACAAConserved hypothetical protein. 
J065001N11GCGCGCGACGCGNONE 
J065001N11GTCGCGTCGCGTCGCGCCCACAANONE 
Os06g0644800006-051-A11CGCGTCGCGTCGCGTCGCNONE 
006-061-C06CGCGTCGCGTCGCGTCGCNONE 
006-086-A03CGCGTCGCGTCGCGTCGCNONE 
006-091-B11CGCGTCGCGTCGCGTCGCNONE 
AK105643CGCGTCGCGTCGCGTCGCNONE 
AK109442CGCGTCGCGTCGCGTCGCMannose-6-phosphate receptor, binding domain containing protein. 
J065083E17CGCGTCGCGTCGCGTCGCNONE 
Os06g0673500J100018J12GACGCGACGCNONE 
J100072F13GACGCGACGCSimilar to Ubiquitin. 
Os06g0687800AK072593GCGTCGCGSimilar to Pincher (EH-domain containing 4). 
Os06g0696400011-019-C01CGCGACGCGNONE 
011-027-D04CGCGACGCGNONE 
013-051-H10CGCGACGCGNONE 
013-054-A06CGCGACGCGNONE 
013-061-D06CGCGACGCGNONE 
013-088-F04CGCGACGCGNONE 
014-018-C07CGCGACGCGNONE 
014-026-E10CGCGACGCGNONE 
AK058291CGCGACGCGNONE 
AK066125CGCGACGCGNONE 
AK104912CGCGACGCGNONE 
BT014685CGCGACGCGSimilar to Xyloglucan endotransglucosylase/hydrolase protein 24 precursor (EC 2.4.1.207) (At-XTH24) (XTH-24) (Meristem protein 5) (MERI-5 protein) (MERI5 protein) (Endo-xyloglucan transferase) (Xyloglucan endo-1,4-beta-D-glucanase). 
J013059H08CGCGACGCGNONE 
J065065L22CGCGACGCGNONE 
J065084O06CGCGACGCGNONE 
J075006O13CGCGACGCGNONE 
J075013J18CGCGACGCGNONE 
J075018L23CGCGACGCGNONE 
J075036E14CGCGACGCGNONE 
J075039K21CGCGACGCGNONE 
J075075H13CGCGACGCGNONE 
J075091A14CGCGACGCGNONE 
J075093I09CGCGACGCGNONE 
J075136L17CGCGACGCGNONE 
J075156M24CGCGACGCGNONE 
J075174J01CGCGACGCGNONE 
J075179P15CGCGACGCGNONE 
J075181F02CGCGACGCGNONE 
J075194L24CGCGACGCGNONE 
J080302J02CGCGACGCGNONE 
J080304J11CGCGACGCGNONE 
J080308A15CGCGACGCGNONE 
J100041B09CGCGACGCGNONE 
Os06g0707200006-022-G09GACGCGACGCNONE 
AK059411GACGCGACGCNONE 
AK071568GACGCGACGCProtein of unknown function DUF563 family protein. 
J065101E21GACGCGACGCNONE 
Os07g0142900003-001-H01CGCGACGCNONE 
AK060737CGCGACGCAldo/keto reductase family protein. 
AK064848CGCGACGCNONE 
Os07g0240300AK072205CGCGCGACGCConserved hypothetical protein. 
AK098977CGCGCGACGCNONE 
Os07g0262950J033120B02CGCGCGACGCGTGGConserved hypothetical protein. 
J075040G05CGCGCGACGCGTGGNONE 
J075160F23CGCGCGACGCGTGGNONE 
Os07g0456700AK100891CGCGACGCSimilar to (1,4)-beta-xylan endohydrolase (EC 3.2.1.8). 
Os07g0490400AK067941CGCGACGCPeptidylprolyl isomerase, FKBP-type domain containing protein. 
J013121F22CGCGACGCNONE 
Os07g0496200AK064866CGCGTCGCGNONE 
AK065801CGCGTCGCGSimilar to NAD-dependent malic enzyme 62 kDa isoform, mitochondrial precursor (EC 1.1.1.39) (NAD-ME). 
Os07g0530700AK060014GACGCGACGCNONE 
Os07g0553700006-039-A02CGCGACGCNONE 
AK061510CGCGACGCSimilar to Light induced protein like. 
J013170D04CGCGACGCNONE 
J053024G19CGCGACGCNONE 
J053032K14CGCGACGCNONE 
J053048O04CGCGACGCNONE 
J053050C13CGCGACGCNONE 
J053054B17CGCGACGCNONE 
J053066M01CGCGACGCNONE 
J100044H05CGCGACGCNONE 
Os07g0565800009-114-F12CGCGCGACGCNONE 
AK062834CGCGCGACGCConserved hypothetical protein. 
J065026L16CGCGCGACGCNONE 
Os07g0568300AK067784CGCGACGCGNONE 
AK067895CGCGACGCGSimilar to ZF protein (Fragment). 
J013119M01CGCGACGCGNONE 
J013120B09CGCGACGCGNONE 
J013123G12CGCGACGCGNONE 
J023012C12CGCGACGCGNONE 
J023020G17CGCGACGCGNONE 
J023037E23CGCGACGCGNONE 
J033076I01CGCGACGCGNONE 
J033108A07CGCGACGCGNONE 
J033138J02CGCGACGCGNONE 
J075033L09CGCGACGCGNONE 
J075049E02CGCGACGCGNONE 
J075060N23CGCGACGCGNONE 
J075094H13CGCGACGCGNONE 
J075179L18CGCGACGCGNONE 
J080005P09CGCGACGCGNONE 
J080044J03CGCGACGCGNONE 
J080062G20CGCGACGCGNONE 
J080063L23CGCGACGCGNONE 
J080065B16CGCGACGCGNONE 
J080071K09CGCGACGCGNONE 
J080089C23CGCGACGCGNONE 
J090008P21CGCGACGCGNONE 
J090046B22CGCGACGCGNONE 
J090094C19CGCGACGCGNONE 
J090096B19CGCGACGCGNONE 
J100060G03CGCGACGCGNONE 
J100082D16CGCGACGCGNONE 
Os07g0577600006-021-H11CGCGACGCGNONE 
006-022-B11CGCGACGCGNONE 
006-022-D10CGCGACGCGNONE 
006-022-E02CGCGACGCGNONE 
006-022-F03CGCGACGCGNONE 
006-023-C11CGCGACGCGNONE 
006-024-C10CGCGACGCGNONE 
006-024-C12CGCGACGCGNONE 
006-024-G12CGCGACGCGNONE 
006-026-C04CGCGACGCGNONE 
006-026-E05CGCGACGCGNONE 
006-026-E11CGCGACGCGNONE 
006-026-F09CGCGACGCGNONE 
006-026-H05CGCGACGCGNONE 
006-027-D03CGCGACGCGNONE 
006-028-C04CGCGACGCGNONE 
006-029-G10CGCGACGCGNONE 
006-030-A11CGCGACGCGNONE 
006-030-D12CGCGACGCGNONE 
006-031-G05CGCGACGCGNONE 
006-032-H06CGCGACGCGNONE 
006-033-A02CGCGACGCGNONE 
006-033-A06CGCGACGCGNONE 
006-034-B10CGCGACGCGNONE 
006-034-F07CGCGACGCGNONE 
006-035-A08CGCGACGCGNONE 
006-035-F07CGCGACGCGNONE 
006-036-A04CGCGACGCGNONE 
006-036-B04CGCGACGCGNONE 
006-037-D02CGCGACGCGNONE 
006-037-F12CGCGACGCGNONE 
006-037-H12CGCGACGCGNONE 
006-040-G12CGCGACGCGNONE 
006-040-H03CGCGACGCGNONE 
006-040-H06CGCGACGCGNONE 
006-042-B12CGCGACGCGNONE 
006-042-H10CGCGACGCGNONE 
006-044-G09CGCGACGCGNONE 
006-045-C04CGCGACGCGNONE 
006-046-B10CGCGACGCGNONE 
006-047-A05CGCGACGCGNONE 
006-048-D05CGCGACGCGNONE 
006-049-A08CGCGACGCGNONE 
006-050-C07CGCGACGCGNONE 
006-050-H10CGCGACGCGNONE 
006-051-G03CGCGACGCGNONE 
006-052-A01CGCGACGCGNONE 
006-052-A05CGCGACGCGNONE 
006-052-B03CGCGACGCGNONE 
006-052-D10CGCGACGCGNONE 
006-054-D03CGCGACGCGNONE 
006-055-A12CGCGACGCGNONE 
006-055-C05CGCGACGCGNONE 
006-055-F05CGCGACGCGNONE 
006-055-H10CGCGACGCGNONE 
006-056-A02CGCGACGCGNONE 
006-056-D07CGCGACGCGNONE 
006-057-A03CGCGACGCGNONE 
006-057-B06CGCGACGCGNONE 
006-057-H08CGCGACGCGNONE 
006-058-C04CGCGACGCGNONE 
006-058-F06CGCGACGCGNONE 
006-059-C10CGCGACGCGNONE 
006-059-G08CGCGACGCGNONE 
006-060-E10CGCGACGCGNONE 
006-061-B10CGCGACGCGNONE 
006-062-A05CGCGACGCGNONE 
006-062-B04CGCGACGCGNONE 
006-063-A04CGCGACGCGNONE 
006-063-D01CGCGACGCGNONE 
006-063-G12CGCGACGCGNONE 
006-064-D12CGCGACGCGNONE 
006-066-A03CGCGACGCGNONE 
006-066-C03CGCGACGCGNONE 
006-067-A03CGCGACGCGNONE 
006-067-G07CGCGACGCGNONE 
006-068-A06CGCGACGCGNONE 
006-069-D04CGCGACGCGNONE 
006-069-G05CGCGACGCGNONE 
006-070-H08CGCGACGCGNONE 
006-071-A05CGCGACGCGNONE 
006-071-H11CGCGACGCGNONE 
006-072-A07CGCGACGCGNONE 
006-072-B02CGCGACGCGNONE 
006-072-D11CGCGACGCGNONE 
006-072-H12CGCGACGCGNONE 
006-075-G06CGCGACGCGNONE 
006-077-B09CGCGACGCGNONE 
006-078-D01CGCGACGCGNONE 
006-078-D02CGCGACGCGNONE 
006-078-E05CGCGACGCGNONE 
006-078-G07CGCGACGCGNONE 
006-079-C03CGCGACGCGNONE 
006-079-F12CGCGACGCGNONE 
006-079-H01CGCGACGCGNONE 
006-080-D04CGCGACGCGNONE 
006-080-H04CGCGACGCGNONE 
006-081-A10CGCGACGCGNONE 
006-082-G02CGCGACGCGNONE 
006-082-H07CGCGACGCGNONE 
006-083-B03CGCGACGCGNONE 
006-085-A09CGCGACGCGNONE 
006-085-A12CGCGACGCGNONE 
006-085-F07CGCGACGCGNONE 
006-086-B11CGCGACGCGNONE 
006-086-D01CGCGACGCGNONE 
006-086-G04CGCGACGCGNONE 
006-087-E04CGCGACGCGNONE 
006-087-G09CGCGACGCGNONE 
006-088-E11CGCGACGCGNONE 
006-088-G10CGCGACGCGNONE 
006-088-H01CGCGACGCGNONE 
006-089-B04CGCGACGCGNONE 
006-089-D05CGCGACGCGNONE 
006-089-F07CGCGACGCGNONE 
006-089-H07CGCGACGCGNONE 
006-090-B06CGCGACGCGNONE 
006-090-H05CGCGACGCGNONE 
006-091-E11CGCGACGCGNONE 
006-092-H01CGCGACGCGNONE 
006-093-B08CGCGACGCGNONE 
006-093-C07CGCGACGCGNONE 
006-093-F02CGCGACGCGNONE 
006-093-G05CGCGACGCGNONE 
006-093-G06CGCGACGCGNONE 
006-094-D10CGCGACGCGNONE 
006-094-H07CGCGACGCGNONE 
006-095-G03CGCGACGCGNONE 
006-096-A06CGCGACGCGNONE 
006-096-E03CGCGACGCGNONE 
006-097-B03CGCGACGCGNONE 
006-097-D03CGCGACGCGNONE 
006-098-B07CGCGACGCGNONE 
006-098-G05CGCGACGCGNONE 
006-099-F05CGCGACGCGNONE 
006-100-H10CGCGACGCGNONE 
006-100-H12CGCGACGCGNONE 
006-101-A06CGCGACGCGNONE 
006-101-A08CGCGACGCGNONE 
006-101-A12CGCGACGCGNONE 
006-101-D04CGCGACGCGNONE 
006-101-G07CGCGACGCGNONE 
006-102-B12CGCGACGCGNONE 
006-102-E09CGCGACGCGNONE 
006-102-F02CGCGACGCGNONE 
006-103-D09CGCGACGCGNONE 
006-105-D05CGCGACGCGNONE 
006-105-D08CGCGACGCGNONE 
006-106-C07CGCGACGCGNONE 
006-106-F12CGCGACGCGNONE 
006-107-D01CGCGACGCGNONE 
006-109-C05CGCGACGCGNONE 
006-109-C08CGCGACGCGNONE 
006-109-D02CGCGACGCGNONE 
006-111-F03CGCGACGCGNONE 
006-112-C12CGCGACGCGNONE 
006-112-D08CGCGACGCGNONE 
006-113-A01CGCGACGCGNONE 
006-113-B03CGCGACGCGNONE 
006-113-C11CGCGACGCGNONE 
006-113-E07CGCGACGCGNONE 
006-113-F08CGCGACGCGNONE 
006-114-D08CGCGACGCGNONE 
006-114-H08CGCGACGCGNONE 
006-115-A08CGCGACGCGNONE 
006-115-A09CGCGACGCGNONE 
006-115-G05CGCGACGCGNONE 
006-117-B06CGCGACGCGNONE 
006-117-B09CGCGACGCGNONE 
006-117-F11CGCGACGCGNONE 
006-117-G10CGCGACGCGNONE 
006-117-H08CGCGACGCGNONE 
006-118-C06CGCGACGCGNONE 
006-118-G11CGCGACGCGNONE 
006-119-H03CGCGACGCGNONE 
006-120-D01CGCGACGCGNONE 
006-120-D12CGCGACGCGNONE 
006-120-H04CGCGACGCGNONE 
009-022-E12CGCGACGCGNONE 
009-044-H02CGCGACGCGNONE 
009-074-B08CGCGACGCGNONE 
009-145-B08CGCGACGCGNONE 
009-156-D09CGCGACGCGNONE 
009-163-F03CGCGACGCGNONE 
009-193-G03CGCGACGCGNONE 
AF010321CGCGACGCGNONE 
AK060987CGCGACGCGNONE 
AK070051CGCGACGCGNONE 
AK103966CGCGACGCGNONE 
AK104016CGCGACGCGNONE 
AK104127CGCGACGCGNONE 
AK104177CGCGACGCGNONE 
AK104283CGCGACGCGNONE 
AK104608CGCGACGCGNONE 
AK104651CGCGACGCGNONE 
AK119176CGCGACGCGSimilar to Type II chlorophyll a/b binding protein from photosystem I precursor. 
J065013J05CGCGACGCGNONE 
J065129D23CGCGACGCGNONE 
J065138E06CGCGACGCGNONE 
J065179N22CGCGACGCGNONE 
J065192A07CGCGACGCGNONE 
J065208G16CGCGACGCGNONE 
J075013K01CGCGACGCGNONE 
J075017B12CGCGACGCGNONE 
J075018O17CGCGACGCGNONE 
J075023H05CGCGACGCGNONE 
J075053L02CGCGACGCGNONE 
J075067I01CGCGACGCGNONE 
J075083D19CGCGACGCGNONE 
J075083G03CGCGACGCGNONE 
J075084F12CGCGACGCGNONE 
J075088K18CGCGACGCGNONE 
J075094A18CGCGACGCGNONE 
J075094I22CGCGACGCGNONE 
J075097E17CGCGACGCGNONE 
J075098I24CGCGACGCGNONE 
J075110K19CGCGACGCGNONE 
J075118G21CGCGACGCGNONE 
J075118J20CGCGACGCGNONE 
J075120G14CGCGACGCGNONE 
J075120H20CGCGACGCGNONE 
J075127H23CGCGACGCGNONE 
J075139M03CGCGACGCGNONE 
J075142E17CGCGACGCGNONE 
J075149N17CGCGACGCGNONE 
J075152A20CGCGACGCGNONE 
J075157N22CGCGACGCGNONE 
J075159K21CGCGACGCGNONE 
J075173B20CGCGACGCGNONE 
J075192N20CGCGACGCGNONE 
J075196A07CGCGACGCGNONE 
J075199N04CGCGACGCGNONE 
J080005P10CGCGACGCGNONE 
J080025I24CGCGACGCGNONE 
J080064D09CGCGACGCGNONE 
J080064N24CGCGACGCGNONE 
J080068B02CGCGACGCGNONE 
J080097K04CGCGACGCGNONE 
J080097K19CGCGACGCGNONE 
J080097N20CGCGACGCGNONE 
J100055P07CGCGACGCGNONE 
Os07g0584500003-129-F05GTCGCGTCGCGTCNONE 
006-119-H08GTCGCGTCGCGTCNONE 
011-022-G03GTCGCGTCGCGTCNONE 
AK067725GTCGCGTCGCGTCRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
AK121109GTCGCGTCGCGTCNONE 
J013055C05GTCGCGTCGCGTCNONE 
J013062F12GTCGCGTCGCGTCNONE 
J013069J22GTCGCGTCGCGTCNONE 
J013114I11GTCGCGTCGCGTCNONE 
J023072P12GTCGCGTCGCGTCNONE 
Os07g0600000006-021-B09CGCGACGCCCAACCNONE 
006-028-D09CGCGACGCCCAACCNONE 
013-065-H09CGCGACGCCCAACCNONE 
AK105907CGCGACGCCCAACCConserved hypothetical protein. 
Os07g0657100AK108253CGCGACGCGACGCGGlyoxalase/extradiol ring-cleavage dioxygenase domain containing protein. 
AK108253CGCGACGCGACGCGGlyoxalase/extradiol ring-cleavage dioxygenase domain containing protein. 
J075072F01CGCGACGCGACGCGNONE 
J075072F01CGCGACGCGACGCGNONE 
J075078C21CGCGACGCGACGCGNONE 
J075078C21CGCGACGCGACGCGNONE 
J075147E12CGCGACGCGACGCGNONE 
J075147E12CGCGACGCGACGCGNONE 
J075180N10CGCGACGCGACGCGNONE 
J075180N10CGCGACGCGACGCGNONE 
J075197D01CGCGACGCGACGCGNONE 
J075197D01CGCGACGCGACGCGNONE 
Os07g0659300AK069789CGCGACGCGConserved hypothetical protein. 
Os07g0681400009-117-B11CGCACGCGTCGCGNONE 
AK062850CGCACGCGTCGCGSimilar to Calcium-binding protein CAST. 
J065025F13CGCACGCGTCGCGNONE 
Os07g0691300009-078-C12CGCGACGCGNONE 
009-132-H04CGCGACGCGNONE 
AK069499CGCGACGCGWound-induced WI12 family protein. 
Os07g0695400015-036-B08CGCGTCGCGTCGCNONE 
015-036-B08GCGTCGCGTCGCGTGCGNONE 
AK100615CGCGTCGCGTCGCNONE 
AK100615GCGTCGCGTCGCGTGCGNONE 
AK106304CGCGTCGCGTCGCKIP1-like domain containing protein. 
AK106304GCGTCGCGTCGCGTGCGKIP1-like domain containing protein. 
J023108B01CGCGTCGCGTCGCNONE 
J023108B01GCGTCGCGTCGCGTGCGNONE 
Os08g0119800AJ437536GCGTCGCGNONE 
AK060602GCGTCGCGSimilar to Photosystem II core complex proteins psbY, chloroplast precursor (L- arginine metabolising enzyme) (L-AME) [Contains: Photosystem II protein psbY-1 (psbY-A1); Photosystem II protein psbY-2 (psbY-A2)]. 
AK067636GCGTCGCGNONE 
AK068273GCGTCGCGNONE 
J100075K05GCGTCGCGNONE 
Os08g0127600AK058365CGCGACGCGHeat shock protein DnaJ, N-terminal domain containing protein. 
AK068373CGCGACGCGNONE 
J013149L10CGCGACGCGNONE 
J075027H17CGCGACGCGNONE 
J075060F10CGCGACGCGNONE 
Os08g0127700012-086-F03GACGCGACGCNONE 
AK059350GACGCGACGCNONE 
AK099242GACGCGACGCNONE 
AK121348GACGCGACGCConserved hypothetical protein. 
J033027J18GACGCGACGCNONE 
J065012F22GACGCGACGCNONE 
J065046N17GACGCGACGCNONE 
J065197B02GACGCGACGCNONE 
J100018P04GACGCGACGCNONE 
J100052C14GACGCGACGCNONE 
J100083A12GACGCGACGCNONE 
Os08g0136500006-092-G03CGCGACGCNONE 
AK061187CGCGACGCProtein of unknown function DUF26 domain containing protein. 
J065057C18CGCGACGCNONE 
Os08g0144100AK071435TCGCGCGCGCGACGCGSimilar to Avr9/Cf-9 rapidly elicited protein 31. 
Os08g0163400AB005290CGCGTCGCGSigma-70 factor family protein. 
AK065997CGCGTCGCGNONE 
AK071725CGCGTCGCGNONE 
Os08g0243500AK068915CGCGTCGCGCGCCCAATTSimilar to NADPH-cytochrome P450 oxydoreductase isoform 2. 
AK099083CGCGTCGCGCGCCCAATTNONE 
Os08g0346400003-103-D08CGCGACGCGNONE 
009-135-G12CGCGACGCGNONE 
AK059644CGCGACGCGNONE 
AK062928CGCGACGCGNONE 
AK103873CGCGACGCGSimilar to Phosphate starvation regulator protein (Regulatory protein of P- starvation acclimation response Psr1). 
J033149L11CGCGACGCGNONE 
J065137E08CGCGACGCGNONE 
J065194M22CGCGACGCGNONE 
J075083O16CGCGACGCGNONE 
Os08g0402500AK108881GCGCGCGACGCGACGCGConserved hypothetical protein. 
Os08g0442900AK110520CGCGACGCEggshell protein family protein. 
Os08g0465800AY428025GCGTCGCGNONE 
J013029M24GCGTCGCGNONE 
J013030K15GCGTCGCGNONE 
J013048G12GCGTCGCGNONE 
J023041H10GCGTCGCGNONE 
J023065G12GCGTCGCGNONE 
J023074A02GCGTCGCGNONE 
J023092B20GCGTCGCGNONE 
J023147A01GCGTCGCGNONE 
J023150L07GCGTCGCGNONE 
J043007P21GCGTCGCGNONE 
J090004P19GCGTCGCGNONE 
J100030K13GCGTCGCGNONE 
J100060N03GCGTCGCGNONE 
Os08g0471800AK105281GCGTCGCGRemorin, C-terminal region domain containing protein. 
Os08g0484700J065041E01CGCGACGCGACHomeodomain-like containing protein. 
Os08g0485700AK068131GCGCGCGACGCGNONE 
AK069097GCGCGCGACGCGMethyl-CpG binding domain containing protein. 
J013130L03GCGCGCGACGCGNONE 
Os08g0521800006-099-A01CGCGACGCNONE 
009-031-C06CGCGACGCNONE 
AK067267CGCGACGCConserved hypothetical protein. 
AK104809CGCGACGCNONE 
J013098C23CGCGACGCNONE 
J065043L13CGCGACGCNONE 
Os09g0113000009-104-D11GCGTCGCGNONE 
AK062770GCGTCGCGHypothetical protein. 
Os09g0251800006-100-E12CGCGACGCGACGCNONE 
AK061218CGCGACGCGACGCC2 calcium/lipid-binding region, CaLB domain containing protein. 
AK104010CGCGACGCGACGCNONE 
J065048A02CGCGACGCGACGCNONE 
J065073P10CGCGACGCGACGCNONE 
J065075B09CGCGACGCGACGCNONE 
J065112B05CGCGACGCGACGCNONE 
J090014H10CGCGACGCGACGCNONE 
Os09g0265050J065112H09CGCGCGACGCGTGGConserved hypothetical protein. 
Os09g0325700011-041-G03CGCGACGCGNONE 
AK063334CGCGACGCGSimilar to Protein phpsphatase 2C (PP2C) (EC 3.1.3.16). 
J080317M24CGCGACGCGNONE 
Os09g0370300AK108199CGCGTCGCGSimilar to Iron sulfur subunit of succinate dehydrogenase (Truncated) and ribosomal protein S14 precursor. 
AK108199GCCACACGTGTCCGCGACGCSimilar to Iron sulfur subunit of succinate dehydrogenase (Truncated) and ribosomal protein S14 precursor. 
Os09g0445600AK107839GAGACGCGACGCConserved hypothetical protein. 
Os09g0453800AK119212CGCGACGCNONE 
J023081A04CGCGACGCNONE 
J065180G14CGCGACGCNONE 
J100024A17CGCGACGCNONE 
J100030A05CGCGACGCNONE 
J100042I11CGCGACGCNONE 
J100054N05CGCGACGCNONE 
J100075G23CGCGACGCNONE 
Os09g0456200015-025-E01CCACGCGTCGCGCGCNONE 
AK065873CCACGCGTCGCGCGCSimilar to BZIP transcription factor ABI5. 
J013049N23CCACGCGTCGCGCGCNONE 
J033128E10CCACGCGTCGCGCGCNONE 
Os09g0486500006-062-H11CGCGCGACGCNONE 
009-049-A11CGCGCGACGCNONE 
009-070-D06CGCGCGACGCNONE 
009-089-A10CGCGCGACGCNONE 
009-107-D06CGCGCGACGCNONE 
009-133-F02CGCGCGACGCNONE 
009-142-A05CGCGCGACGCNONE 
009-175-G07CGCGCGACGCNONE 
013-044-C05CGCGCGACGCNONE 
014-044-D10CGCGCGACGCNONE 
AF140722CGCGCGACGCNONE 
AK061067CGCGCGACGCNONE 
AK070140CGCGCGACGCNONE 
AK106128CGCGCGACGCMultiple stress-responsive zinc-finger protein ISAP1 (Stress- associated protein 1) (OsISAP1). 
AK119793CGCGCGACGCNONE 
J023042G11CGCGCGACGCNONE 
J053043H07CGCGCGACGCNONE 
J053046N13CGCGCGACGCNONE 
J053091K15CGCGCGACGCNONE 
J053094I21CGCGCGACGCNONE 
J053094N04CGCGCGACGCNONE 
J053100D12CGCGCGACGCNONE 
J053101K11CGCGCGACGCNONE 
J065079H06CGCGCGACGCNONE 
J100028D11CGCGCGACGCNONE 
J100033A20CGCGCGACGCNONE 
J100033F15CGCGCGACGCNONE 
Os09g0497400009-087-E03CGCGTCGCGTCNONE 
AK058354CGCGTCGCGTCNONE 
J013159B19CGCGTCGCGTCNONE 
J023011D22CGCGTCGCGTCNONE 
J023081K05CGCGTCGCGTCNONE 
J033060O14CGCGTCGCGTCNONE 
J075020I08CGCGTCGCGTCNONE 
J075034J03CGCGTCGCGTCNONE 
J075049M15CGCGTCGCGTCNONE 
J075065K02CGCGTCGCGTCNONE 
J075099L06CGCGTCGCGTCNONE 
Os09g0525500AK107918CGCGACGCGYY1 protein precursor. 
D50575CGCGACGCGNONE 
Os09g0525900006-115-E04CGCGTCGCGNONE 
AK059988CGCGTCGCGRhomboid-like protein family protein. 
AK071290CGCGTCGCGNONE 
J013153K05CGCGTCGCGNONE 
J023087M04CGCGTCGCGNONE 
J065165B13CGCGTCGCGNONE 
J075013G15CGCGTCGCGNONE 
J075028A09CGCGTCGCGNONE 
J075031I06CGCGTCGCGNONE 
J075051C21CGCGTCGCGNONE 
J075114H22CGCGTCGCGNONE 
J075129A19CGCGTCGCGNONE 
J075129M12CGCGTCGCGNONE 
J075166N24CGCGTCGCGNONE 
J075167M23CGCGTCGCGNONE 
J075168D10CGCGTCGCGNONE 
Os09g0534800009-128-G09CGCGACGCGACCGAGCCGNONE 
AF464908CGCGACGCGACCGAGCCGNONE 
AK068941CGCGACGCGACCGAGCCGTranscription initiation factor IIB (General transcription factor TFIIB). 
J013170A08CGCGACGCGACCGAGCCGNONE 
J023123L05CGCGACGCGACCGAGCCGNONE 
J043020O05CGCGACGCGACCGAGCCGNONE 
Os09g0551600005-020-H08CGCGTCGCGCGCNONE 
006-043-E02CGCGTCGCGCGCNONE 
013-043-F03CGCGTCGCGCGCNONE 
AK066658CGCGTCGCGCGCSimilar to HMGd1 protein (Nucleasome/chromatin assembly factor D protein NFD101). 
J013071N11CGCGTCGCGCGCNONE 
J065177J20CGCGTCGCGCGCNONE 
J075041D06CGCGTCGCGCGCNONE 
J075199H24CGCGTCGCGCGCNONE 
J080001G07CGCGTCGCGCGCNONE 
J080024A12CGCGTCGCGCGCNONE 
J080025B15CGCGTCGCGCGCNONE 
J090017G07CGCGTCGCGCGCNONE 
J090050G23CGCGTCGCGCGCNONE 
J090083G11CGCGTCGCGCGCNONE 
Os09g0558100009-028-D03CGCGACGCCACGCCACNONE 
014-011-A04CGCGACGCCACGCCACNONE 
AB030211CGCGACGCCACGCCACSimilar to Low-temperature induced protein lt101.2. 
AK062410CGCGACGCCACGCCACNONE 
J065006B17CGCGACGCCACGCCACNONE 
J065067M15CGCGACGCCACGCCACNONE 
J065075E19CGCGACGCCACGCCACNONE 
J075011G16CGCGACGCCACGCCACNONE 
J075015L22CGCGACGCCACGCCACNONE 
J075035O11CGCGACGCCACGCCACNONE 
J075072E15CGCGACGCCACGCCACNONE 
J075100O22CGCGACGCCACGCCACNONE 
Os11g0111200AK109277GCGTCGCGConserved hypothetical protein. 
Os11g0244800AK103215GCGACGCGACGCGSimilar to Alfin-1. 
J065009E13GCGACGCGACGCGNONE 
J065027D16GCGACGCGACGCGNONE 
J065085B06GCGACGCGACGCGNONE 
J065180O17GCGACGCGACGCGNONE 
J090010C16GCGACGCGACGCGNONE 
J090039K20GCGACGCGACGCGNONE 
Os11g0582400AF049348GCGTCGCGConserved hypothetical protein. 
AF516927GCGTCGCGNONE 
AK073083GCGTCGCGNONE 
AK108352GCGTCGCGNONE 
J075005O16GCGTCGCGNONE 
J075007D15GCGTCGCGNONE 
J075007L04GCGTCGCGNONE 
J075009C11GCGTCGCGNONE 
J075012L11GCGTCGCGNONE 
J075013A14GCGTCGCGNONE 
J075015K01GCGTCGCGNONE 
J075019O21GCGTCGCGNONE 
J075020G20GCGTCGCGNONE 
J075020H06GCGTCGCGNONE 
J075022D07GCGTCGCGNONE 
J075024M12GCGTCGCGNONE 
J075025G04GCGTCGCGNONE 
J075026F09GCGTCGCGNONE 
J075027D19GCGTCGCGNONE 
J075030A12GCGTCGCGNONE 
J075030C16GCGTCGCGNONE 
J075030D15GCGTCGCGNONE 
J075034M20GCGTCGCGNONE 
J075041H12GCGTCGCGNONE 
J075052D12GCGTCGCGNONE 
J075052G11GCGTCGCGNONE 
J075053L09GCGTCGCGNONE 
J075064G05GCGTCGCGNONE 
J075067J01GCGTCGCGNONE 
J075071O03GCGTCGCGNONE 
J075072G12GCGTCGCGNONE 
J075078H06GCGTCGCGNONE 
J075081D06GCGTCGCGNONE 
J075084G23GCGTCGCGNONE 
J075085M10GCGTCGCGNONE 
J075087N20GCGTCGCGNONE 
J075088E11GCGTCGCGNONE 
J075088O22GCGTCGCGNONE 
J075091E10GCGTCGCGNONE 
J075092B12GCGTCGCGNONE 
J075093E08GCGTCGCGNONE 
J075095D04GCGTCGCGNONE 
J075095J10GCGTCGCGNONE 
J075095O19GCGTCGCGNONE 
J075096H20GCGTCGCGNONE 
J075098F10GCGTCGCGNONE 
J075100H10GCGTCGCGNONE 
J075104C23GCGTCGCGNONE 
J075105B10GCGTCGCGNONE 
J075106I24GCGTCGCGNONE 
J075109H23GCGTCGCGNONE 
J075115A03GCGTCGCGNONE 
J075118M06GCGTCGCGNONE 
J075121G08GCGTCGCGNONE 
J075122C09GCGTCGCGNONE 
J075122J12GCGTCGCGNONE 
J075123E06GCGTCGCGNONE 
J075123E16GCGTCGCGNONE 
J075124N09GCGTCGCGNONE 
J075127F23GCGTCGCGNONE 
J075128H17GCGTCGCGNONE 
J075129C02GCGTCGCGNONE 
J075139P18GCGTCGCGNONE 
J075140H17GCGTCGCGNONE 
J075146E12GCGTCGCGNONE 
J075146I07GCGTCGCGNONE 
J075150A08GCGTCGCGNONE 
J075150I22GCGTCGCGNONE 
J075155D01GCGTCGCGNONE 
J075155N10GCGTCGCGNONE 
J075155O09GCGTCGCGNONE 
J075156K11GCGTCGCGNONE 
J075157N01GCGTCGCGNONE 
J075164L09GCGTCGCGNONE 
J075166F14GCGTCGCGNONE 
J075169E20GCGTCGCGNONE 
J075170B13GCGTCGCGNONE 
J075170F24GCGTCGCGNONE 
J075170N16GCGTCGCGNONE 
J075172H22GCGTCGCGNONE 
J075172I02GCGTCGCGNONE 
J075176E08GCGTCGCGNONE 
J075177H17GCGTCGCGNONE 
J075179C18GCGTCGCGNONE 
J075182H23GCGTCGCGNONE 
J075187B10GCGTCGCGNONE 
J075192L10GCGTCGCGNONE 
J075195C04GCGTCGCGNONE 
U25969GCGTCGCGNONE 
Os11g0705200AK102199GCGTCGCGTCSimilar to Scarecrow-like 9 (Fragment). 
J033087D22GCGTCGCGTCNONE 
Os12g0141000J065041B13GACGCGACGCConserved hypothetical protein. 
J065110D03GACGCGACGCNONE 
J065183O10GACGCGACGCNONE 
Os12g0149300AK110842CGCGTCGCGCGCSimilar to Xyloglucan 6-xylosyltransferase (EC 2.4.2.39) (AtXT1). 
Os12g0255866J075127N18CGCGCGACGCGTGGConserved hypothetical protein. 
Os12g0297400005-006-D01CGCGACGCNONE 
AK061658CGCGACGCHypothetical protein. 
Os12g0509300AK108497CGCGTCGCGConserved hypothetical protein. 
AK108497GCGTCGCGConserved hypothetical protein. 
Os12g0592900AK064058CGCGACGCGNONE 
AK120039CGCGACGCGHypothetical protein. 
J065081M07CGCGACGCGNONE 
J065105G17CGCGACGCGNONE 
J075017E06CGCGACGCGNONE 
J075040M14CGCGACGCGNONE 
J075052I18CGCGACGCGNONE 
J075055J23CGCGACGCGNONE 
J075057L03CGCGACGCGNONE 
J075099C10CGCGACGCGNONE 
J075104C21CGCGACGCGNONE 
J075172L12CGCGACGCGNONE 
J075179D22CGCGACGCGNONE 
J075182G07CGCGACGCGNONE 
J075194N11CGCGACGCGNONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.