version

Summary of OsREG557 (All List)

OrganismOryza sativa  
IDOsREG557  
SequenceCGCGCGAC  
Annotation  
PPDB MotifACGCGC  CGCG box, stress response?  
PLACE Motif 
Total Entry Count1217  

Entry Sequences (1217 entries)

LocusGene modelSequenceDescription
Os01g0101200006-040-D03GTCGCGCGCCCATATNONE 
006-068-A02GTCGCGCGCCCATATNONE 
AK104517GTCGCGCGCCCATATNONE 
AK104625GTCGCGCGCCCATATNONE 
AK104752GTCGCGCGCCCATATNONE 
AK119457GTCGCGCGCCCATAT2,3-diketo-5-methylthio-1-phosphopentane phosphatase domain containing protein. 
J013089L16GTCGCGCGCCCATATNONE 
J023103K24GTCGCGCGCCCATATNONE 
J075050A15GTCGCGCGCCCATATNONE 
Os01g0159600013-096-A02GTCGCGCGNONE 
AK064055GTCGCGCGSmall hydrophilic plant seed protein family protein. 
AK122153GTCGCGCGNONE 
J033073N07GTCGCGCGNONE 
J033088A13GTCGCGCGNONE 
J033143J06GTCGCGCGNONE 
J053031D05GTCGCGCGNONE 
J053037K14GTCGCGCGNONE 
J053045E08GTCGCGCGNONE 
J053062D01GTCGCGCGNONE 
J053083H22GTCGCGCGNONE 
J053089G12GTCGCGCGNONE 
J053089G24GTCGCGCGNONE 
J053099O13GTCGCGCGNONE 
J065070H11GTCGCGCGNONE 
J075013L17GTCGCGCGNONE 
J075021L24GTCGCGCGNONE 
J075033B10GTCGCGCGNONE 
J075034G01GTCGCGCGNONE 
J075035A11GTCGCGCGNONE 
J075045F22GTCGCGCGNONE 
J075046N02GTCGCGCGNONE 
J075047K11GTCGCGCGNONE 
J075058N15GTCGCGCGNONE 
J075059E22GTCGCGCGNONE 
J075061G22GTCGCGCGNONE 
J075078E12GTCGCGCGNONE 
J075079B08GTCGCGCGNONE 
J075090K12GTCGCGCGNONE 
J075096P05GTCGCGCGNONE 
J075097G05GTCGCGCGNONE 
J075097O15GTCGCGCGNONE 
J075101J04GTCGCGCGNONE 
J075104K17GTCGCGCGNONE 
J075110F15GTCGCGCGNONE 
J075118D23GTCGCGCGNONE 
J075118E10GTCGCGCGNONE 
J075137K22GTCGCGCGNONE 
J075138P08GTCGCGCGNONE 
J075142E22GTCGCGCGNONE 
J075147K12GTCGCGCGNONE 
J075149D12GTCGCGCGNONE 
J075152A15GTCGCGCGNONE 
J075152H08GTCGCGCGNONE 
J075156C11GTCGCGCGNONE 
J075156H20GTCGCGCGNONE 
J075162I01GTCGCGCGNONE 
J075166H16GTCGCGCGNONE 
J075186F11GTCGCGCGNONE 
J075189F22GTCGCGCGNONE 
J075190E16GTCGCGCGNONE 
J075193O11GTCGCGCGNONE 
Os01g0215700011-079-A08GTCGCGCGCNONE 
013-033-E05GTCGCGCGCNONE 
013-052-D07GTCGCGCGCNONE 
014-010-D04GTCGCGCGCNONE 
014-044-G08GTCGCGCGCNONE 
AK059088GTCGCGCGCLipolytic enzyme, G-D-S-L family protein. 
AK061118GTCGCGCGCNONE 
AK119598GTCGCGCGCNONE 
AK119642GTCGCGCGCNONE 
Os01g0223600AK110821GTCGCGCGSimilar to Pto kinase interactor 1-like protein. 
Os01g0224500AK109225GCAGCCCACCACGCGACGCGCGACConserved hypothetical protein. 
Os01g0295700AK070333GTCGCGCGSimilar to Protein phosphatase-2C. 
Os01g0300900AK119559CGCGCGACNONE 
Os01g0312500AK105998CGCGCGACSimilar to Pectin methylesterase isoform alpha (EC 3.1.1.11) (Fragment). 
Os01g0512200J013067C10GTCGCGCGCNONE 
Os01g0594900AK070921CGCGCGACGCCGCGACGCGConserved hypothetical protein. 
J023074J04CGCGCGACGCCGCGACGCGNONE 
J023078B04CGCGCGACGCCGCGACGCGNONE 
J023078N11CGCGCGACGCCGCGACGCGNONE 
J075143E19CGCGCGACGCCGCGACGCGNONE 
J075187L10CGCGCGACGCCGCGACGCGNONE 
J080010N23CGCGCGACGCCGCGACGCGNONE 
J080013C01CGCGCGACGCCGCGACGCGNONE 
J080013G03CGCGCGACGCCGCGACGCGNONE 
J080016I23CGCGCGACGCCGCGACGCGNONE 
J080017E01CGCGCGACGCCGCGACGCGNONE 
J080029E18CGCGCGACGCCGCGACGCGNONE 
J080034L24CGCGCGACGCCGCGACGCGNONE 
J080039N12CGCGCGACGCCGCGACGCGNONE 
J080067L11CGCGCGACGCCGCGACGCGNONE 
J080068N08CGCGCGACGCCGCGACGCGNONE 
J080069E19CGCGCGACGCCGCGACGCGNONE 
J080071E16CGCGCGACGCCGCGACGCGNONE 
J080077J09CGCGCGACGCCGCGACGCGNONE 
J080085E03CGCGCGACGCCGCGACGCGNONE 
J080301J09CGCGCGACGCCGCGACGCGNONE 
J080303L19CGCGCGACGCCGCGACGCGNONE 
J080308B12CGCGCGACGCCGCGACGCGNONE 
Os01g0654400Os01g0654400CGCGCGACConserved hypothetical protein. 
Os01g0667400016-057-F02CGCGCGACNONE 
AK064236CGCGCGACConserved hypothetical protein. 
Os01g0667900013-097-A02GCGTCGCGCGGGCCCCACCNONE 
014-011-C01GCGTCGCGCGGGCCCCACCNONE 
AK105335GCGTCGCGCGGGCCCCACCGlutaredoxin-like, plant II family protein. 
J065156F10GCGTCGCGCGGGCCCCACCNONE 
J065163D22GCGTCGCGCGGGCCCCACCNONE 
J065197J04GCGTCGCGCGGGCCCCACCNONE 
J075122C02GCGTCGCGCGGGCCCCACCNONE 
J100047L16GCGTCGCGCGGGCCCCACCNONE 
Os01g0714800AK108555GTCGCGCGCWRKY transcription factor 26. 
AY870609GTCGCGCGCNONE 
Os01g0757900AK105476CGCGCGACGCHaloacid dehalogenase/epoxide hydrolase family protein. 
Os01g0763900AK108127GTCGCGCGX8 domain containing protein. 
J075121H14GTCGCGCGNONE 
Os01g0764600AK060621CGCGCGACFosfomycin resistance kinase FomA family protein. 
J013111L18CGCGCGACNONE 
J013134N08CGCGCGACNONE 
Os01g0764800AK102809GCGCGCGACSimilar to Nt-gh3 deduced protein. 
Os01g0767700AK122168GTCGCGCGCSimilar to DEIH-box RNA/DNA helicase. 
Os01g0787400006-097-H03GCGCGCGACNONE 
AK061223GCGCGCGACConserved hypothetical protein. 
J065011G11GCGCGCGACNONE 
J065161F18GCGCGCGACNONE 
Os01g0793900009-109-G11CGCGCGACNONE 
009-125-A10CGCGCGACNONE 
AK062811CGCGCGACConserved hypothetical protein. 
Os01g0796700AK120491CGCGTCGCGCGZinc finger, RING-type domain containing protein. 
Os01g0802200009-092-E04GTCGCGCGGGGGNONE 
AK062699GTCGCGCGGGGGConserved hypothetical protein. 
J065186C19GTCGCGCGGGGGNONE 
Os01g0823600J075039G17GCGCGCGACGCConserved hypothetical protein. 
J075042I11GCGCGCGACGCNONE 
J075054M24GCGCGCGACGCNONE 
J075074C22GCGCGCGACGCNONE 
J075081G13GCGCGCGACGCNONE 
J075099I03GCGCGCGACGCNONE 
J075108D14GCGCGCGACGCNONE 
J075129O14GCGCGCGACGCNONE 
J075136P07GCGCGCGACGCNONE 
J075149P09GCGCGCGACGCNONE 
J075157K12GCGCGCGACGCNONE 
J075176K20GCGCGCGACGCNONE 
J080302C21GCGCGCGACGCNONE 
Os01g0833200AK121629CGCGTCGCGCGConserved hypothetical protein. 
J023093N07CGCGTCGCGCGNONE 
J033050C20CGCGTCGCGCGNONE 
J080302F22CGCGTCGCGCGNONE 
J080303H06CGCGTCGCGCGNONE 
J080306J04CGCGTCGCGCGNONE 
J080309K06CGCGTCGCGCGNONE 
J080311E18CGCGTCGCGCGNONE 
J080318A20CGCGTCGCGCGNONE 
J100031F20CGCGTCGCGCGNONE 
J100034P21CGCGTCGCGCGNONE 
J100042K08CGCGTCGCGCGNONE 
J100047H24CGCGTCGCGCGNONE 
J100065C14CGCGTCGCGCGNONE 
J100074E23CGCGTCGCGCGNONE 
Os01g0844900AK066659GCGCGCGACHomeodomain-like containing protein. 
Os01g0848200AK069425CGCGCGACSimilar to Delta 1-pyrroline-5-carboxylate synthetase (P5CS) [Includes: Glutamate 5-kinase (EC 2.7.2.11) (Gamma-glutamyl kinase) (GK); Gamma-glutamyl phosphate reductase (GPR) (EC 1.2.1.41) (Glutamate-5-semialdehyde dehydrogenase) (Glutamyl-gamma-semialdehyde dehydrogenase)]. 
AK101230CGCGCGACNONE 
Os01g0872300J065128I03CTCGCGCGACConserved hypothetical protein. 
J100063A13CTCGCGCGACNONE 
Os01g0896200AK105622GCGTCGCGCGConserved hypothetical protein. 
Os01g0896800AK065268CTCGCGCGACNONE 
AK104693CTCGCGCGACEukaryotic ribosomal protein L5 family protein. 
J013126P09CTCGCGCGACNONE 
J033046N15CTCGCGCGACNONE 
J090008K02CTCGCGCGACNONE 
J090024F15CTCGCGCGACNONE 
J090074I23CTCGCGCGACNONE 
J090093F03CTCGCGCGACNONE 
J090096N02CTCGCGCGACNONE 
Os01g0921600AK071344TCGCGCGCGACSimilar to Mitochondrial import receptor subunit TOM20 (Translocase of outer membrane 20 kDa subunit). 
J013039J22TCGCGCGCGACNONE 
J013109E03TCGCGCGCGACNONE 
J023081J12TCGCGCGCGACNONE 
J023091E24TCGCGCGCGACNONE 
J033022A01TCGCGCGCGACNONE 
J033074C13TCGCGCGCGACNONE 
J065199E03TCGCGCGCGACNONE 
J075172O04TCGCGCGCGACNONE 
J090007G18TCGCGCGCGACNONE 
J090052B17TCGCGCGCGACNONE 
J090074H01TCGCGCGCGACNONE 
J100043J09TCGCGCGCGACNONE 
J100059J05TCGCGCGCGACNONE 
Os02g0121100012-035-F06GTCGCGCGNONE 
013-031-H05GTCGCGCGNONE 
013-058-E11GTCGCGCGNONE 
014-010-D01GTCGCGCGNONE 
AK070711GTCGCGCGConserved hypothetical protein. 
AK119758GTCGCGCGNONE 
J013033G12GTCGCGCGNONE 
J023007M16GTCGCGCGNONE 
J023020K20GTCGCGCGNONE 
J023061H10GTCGCGCGNONE 
J033027H20GTCGCGCGNONE 
J033051E18GTCGCGCGNONE 
J090005F12GTCGCGCGNONE 
J090017A20GTCGCGCGNONE 
J090018G11GTCGCGCGNONE 
J090062C18GTCGCGCGNONE 
J100027N10GTCGCGCGNONE 
J100032L14GTCGCGCGNONE 
J100045C14GTCGCGCGNONE 
J100061M09GTCGCGCGNONE 
J100062K11GTCGCGCGNONE 
J100064H11GTCGCGCGNONE 
J100074H16GTCGCGCGNONE 
J100082N01GTCGCGCGNONE 
Os02g0202300AK071672GTCGCGCGConserved hypothetical protein. 
Os02g0209400AK108109GTCGCGCGCCACGCCACGCCACConserved hypothetical protein. 
Os02g0437200AK065640CGCGCGACNONE 
AY900120CGCGCGACSimilar to SNAP-34. 
J013038P06CGCGCGACNONE 
J013146B13CGCGCGACNONE 
J065015L12CGCGCGACNONE 
J065089K05CGCGCGACNONE 
J065197E17CGCGCGACNONE 
J090077O07CGCGCGACNONE 
J100050L21CGCGCGACNONE 
J100074L24CGCGCGACNONE 
Os02g0445600009-183-B02CTCGCGCGCGACNONE 
AK063150CTCGCGCGCGACSimilar to Auxin-induced SAUR-like protein (Fragment). 
Os02g0506600AK107967GTCGCGCGCConserved hypothetical protein. 
J065142J01GTCGCGCGCNONE 
J100044B16GTCGCGCGCNONE 
J100079K18GTCGCGCGCNONE 
J100086M04GTCGCGCGCNONE 
Os02g0509500009-117-G07CGCGCGACNONE 
009-122-G08CGCGCGACNONE 
AK105187CGCGCGACConserved hypothetical protein. 
J065025C04CGCGCGACNONE 
J065030F10CGCGCGACNONE 
J065112P22CGCGCGACNONE 
J065116I22CGCGCGACNONE 
J065127F24CGCGCGACNONE 
J065176E11CGCGCGACNONE 
J065186F02CGCGCGACNONE 
J075041F12CGCGCGACNONE 
J075118L20CGCGCGACNONE 
J075181D20CGCGCGACNONE 
J090023P12CGCGCGACNONE 
Os02g0513100AK103266CGCGCGACSimilar to MtN3 protein precursor. 
Os02g0562300AK073250GCGCGCGACCalmodulin binding protein-like family protein. 
Os02g0630300AK108598GTCGCGCGCGCCGGCCCGGGCCNONE 
Os02g0633400AK073723CGCGTCGCGCGCSimilar to 61 kDa protein homolog. 
J100031K17CGCGTCGCGCGCNONE 
Os02g0634700AK071869CGCGCGACNONE 
J013129B13CGCGCGACNONE 
J013134D24CGCGCGACNONE 
Os02g0653900006-024-H11GCGCGCGACNONE 
006-069-F05GCGCGCGACNONE 
012-005-H01GCGCGCGACNONE 
AK064950GCGCGCGACSimilar to Avr9/Cf-9 rapidly elicited protein 14 (Fragment). 
AK098925GCGCGCGACNONE 
AK104793GCGCGCGACNONE 
AK106154GCGCGCGACNONE 
J013000P22GCGCGCGACNONE 
J013002P22GCGCGCGACNONE 
J013072L24GCGCGCGACNONE 
J013110J23GCGCGCGACNONE 
J013126I23GCGCGCGACNONE 
J013160D23GCGCGCGACNONE 
J023056H01GCGCGCGACNONE 
J033058I09GCGCGCGACNONE 
J065183H09GCGCGCGACNONE 
J065214P06GCGCGCGACNONE 
J075071L23GCGCGCGACNONE 
J090042C11GCGCGCGACNONE 
J090057H07GCGCGCGACNONE 
J090071O22GCGCGCGACNONE 
J100029M07GCGCGCGACNONE 
J100040O18GCGCGCGACNONE 
J100041P12GCGCGCGACNONE 
J100047J02GCGCGCGACNONE 
J100063L09GCGCGCGACNONE 
J100065B12GCGCGCGACNONE 
J100066N05GCGCGCGACNONE 
J100080O21GCGCGCGACNONE 
J100083F13GCGCGCGACNONE 
J100087G04GCGCGCGACNONE 
J100090J20GCGCGCGACNONE 
J100090N08GCGCGCGACNONE 
Os02g0677300006-102-D12GTCGCGCGCNONE 
AK060550GTCGCGCGCNONE 
AK106041GTCGCGCGCSimilar to CRT/DRE binding factor 1. 
Os02g0699000AK109931GCGCGCGACTGF-beta receptor, type I/II extracellular region family protein. 
AK109931GTCGCGCGCTGF-beta receptor, type I/II extracellular region family protein. 
Os02g0701600AK061746GTCGCGCGCNONE 
AK071763GTCGCGCGCSimilar to Tocopherol O-methyltransferase, chloroplast precursor (EC 2.1.1.95) (Gamma-tocopherol methyltransferase). 
J023089D05GTCGCGCGCNONE 
J023110C23GTCGCGCGCNONE 
Os02g0709200AK058999GTCGCGCGCGTGGGCCCCSimilar to Histidinol-phosphate aminotransferase, chloroplast precursor (EC 2.6.1.9) (Imidazole acetol-phosphate transaminase). 
AK099074GTCGCGCGCGTGGGCCCCNONE 
Os02g0777800AK066978CGCGCGACSimilar to Avr9/Cf-9 induced kinase 1. 
Os02g0782500013-043-A07CGCGCGACNONE 
013-068-B10CGCGCGACNONE 
013-093-A08CGCGCGACNONE 
014-083-C12CGCGCGACNONE 
AK063602CGCGCGACNONE 
AK119261CGCGCGACSimilar to Small heat stress protein class CIII. 
J065013N12CGCGCGACNONE 
J075136E01CGCGCGACNONE 
J075149G04CGCGCGACNONE 
Os02g0817900AK068163GTCGCGCGCCytochrome P450 family protein. 
Os03g0128300AK064718GCGTCGCGCGCConserved hypothetical protein. 
Os03g0140700AK070000GTCCGTCCCCCGCGCGACGCGACTetratricopeptide-like helical domain containing protein. 
Os03g0141200AK068968GCCCCACCGCGCGCGACGTGGCSimilar to Beta-amylase PCT-BMYI (EC 3.2.1.2). 
AK100092GCCCCACCGCGCGCGACGTGGCNONE 
J023003L18GCCCCACCGCGCGCGACGTGGCNONE 
J023022K18GCCCCACCGCGCGCGACGTGGCNONE 
J023107H13GCCCCACCGCGCGCGACGTGGCNONE 
J023107K02GCCCCACCGCGCGCGACGTGGCNONE 
Os03g0157700015-011-D01CGCGCGACGCGGGCCGAGNONE 
AK102075CGCGCGACGCGGGCCGAGProtein of unknown function DUF639 family protein. 
AK106245CGCGCGACGCGGGCCGAGNONE 
J075144I02CGCGCGACGCGGGCCGAGNONE 
Os03g0159600AK106743TCGCGCGCGACSimilar to Rab28 protein. 
J075041K15TCGCGCGCGACNONE 
J075051E03TCGCGCGCGACNONE 
J075055P19TCGCGCGCGACNONE 
J075096D01TCGCGCGCGACNONE 
Os03g0168100012-058-G09GTCGCGCGNONE 
014-008-F07GTCGCGCGNONE 
015-084-D03GTCGCGCGNONE 
AK121575GTCGCGCGLate embryogenesis abundant protein repeat containing protein. 
J033024H14GTCGCGCGNONE 
J033036H02GTCGCGCGNONE 
J033044I19GTCGCGCGNONE 
J033098F11GTCGCGCGNONE 
J033125I22GTCGCGCGNONE 
J033128N18GTCGCGCGNONE 
J033132L19GTCGCGCGNONE 
J033149G13GTCGCGCGNONE 
J075052I19GTCGCGCGNONE 
J075099H16GTCGCGCGNONE 
J075099P11GTCGCGCGNONE 
J075122I20GTCGCGCGNONE 
J075172K14GTCGCGCGNONE 
J075188H01GTCGCGCGNONE 
Os03g0197300AK102651CACGCCACGCCACCCCCACGTCGCGCGCCupin, RmlC-type domain containing protein. 
Os03g0214200AK100623CGACACGTGTCGCGCGCProtein of unknown function DUF1675 family protein. 
J075053B18CGACACGTGTCGCGCGCNONE 
Os03g0241600AK120688GTCGCGCGNONE 
Os03g0275500AK065232CCCCCGCGCGACEpsin, N-terminal domain containing protein. 
J013002H14CCCCCGCGCGACNONE 
J013047G17CCCCCGCGCGACNONE 
J013050M23CCCCCGCGCGACNONE 
J013066D16CCCCCGCGCGACNONE 
J013088C16CCCCCGCGCGACNONE 
J023026P14CCCCCGCGCGACNONE 
J023031E04CCCCCGCGCGACNONE 
J023045C06CCCCCGCGCGACNONE 
J023086K13CCCCCGCGCGACNONE 
J023119G16CCCCCGCGCGACNONE 
J033079G11CCCCCGCGCGACNONE 
J033090O21CCCCCGCGCGACNONE 
J033103H08CCCCCGCGCGACNONE 
J033103M23CCCCCGCGCGACNONE 
J033106J17CCCCCGCGCGACNONE 
J033141M15CCCCCGCGCGACNONE 
J090029G22CCCCCGCGCGACNONE 
J090032O20CCCCCGCGCGACNONE 
J090034P11CCCCCGCGCGACNONE 
J090087D18CCCCCGCGCGACNONE 
J100078E18CCCCCGCGCGACNONE 
J100081C12CCCCCGCGCGACNONE 
Os03g0277000AK100522CCACGCGTCGCGCGCSimilar to GDP dissociation inhibitor protein OsGDI1. 
Os03g0310800009-126-C10GTCGCGCGNONE 
009-156-D02GTCGCGCGNONE 
AK058663GTCGCGCGNONE 
AK099476GTCGCGCGSimilar to Hypersensitive reaction associated Ca2+-binding protein. 
J065084G15GTCGCGCGNONE 
J075046C12GTCGCGCGNONE 
J075058D24GTCGCGCGNONE 
J075151M03GTCGCGCGNONE 
J075151M04GTCGCGCGNONE 
J075153I20GTCGCGCGNONE 
J075167J05GTCGCGCGNONE 
J075179G06GTCGCGCGNONE 
J100025I19GTCGCGCGNONE 
J100025L21GTCGCGCGNONE 
J100029C06GTCGCGCGNONE 
J100068E24GTCGCGCGNONE 
J100070F10GTCGCGCGNONE 
J100083H23GTCGCGCGNONE 
J100089H10GTCGCGCGNONE 
Os03g0339400AK065305GTCGCGCGHaem peroxidase, plant/fungal/bacterial family protein. 
J013002O02GTCGCGCGNONE 
Os03g0387100AB026559ATCGGACGGCGCGCGACNONE 
AF022735ATCGGACGGCGCGCGACNONE 
AK058567ATCGGACGGCGCGCGACProteasome subunit alpha type 2 (EC 3.4.25.1) (20S proteasome alpha subunit B) (20S proteasome subunit alpha-2). 
AK101195ATCGGACGGCGCGCGACNONE 
J033030J15ATCGGACGGCGCGCGACNONE 
J033102N16ATCGGACGGCGCGCGACNONE 
J065056E08ATCGGACGGCGCGCGACNONE 
J065112M11ATCGGACGGCGCGCGACNONE 
J065170H07ATCGGACGGCGCGCGACNONE 
J075003P17ATCGGACGGCGCGCGACNONE 
J075074D06ATCGGACGGCGCGCGACNONE 
J075127F20ATCGGACGGCGCGCGACNONE 
J075129I01ATCGGACGGCGCGCGACNONE 
J075178A10ATCGGACGGCGCGCGACNONE 
J090071P12ATCGGACGGCGCGCGACNONE 
J100090D18ATCGGACGGCGCGCGACNONE 
Os03g0695400AK070048CGCGCGACAnkyrin repeat containing protein. 
Os03g0699400AK069110GTCGCGCGAGSilencing group B protein. 
J023009F11GTCGCGCGAGNONE 
J065010K14GTCGCGCGAGNONE 
J065013G22GTCGCGCGAGNONE 
J065041E22GTCGCGCGAGNONE 
J065045P04GTCGCGCGAGNONE 
J065060N03GTCGCGCGAGNONE 
J065077K12GTCGCGCGAGNONE 
J090024D16GTCGCGCGAGNONE 
J100031M08GTCGCGCGAGNONE 
J100075I05GTCGCGCGAGNONE 
Os03g0704100003-129-D05CGCGCGACNONE 
AK070474CGCGCGACPAP fibrillin family protein. 
Os03g0738600AK073529GCGCGCGACCCACACGSimilar to Lipoxygenase L-2 (EC 1.13.11.12). 
X64396GCGCGCGACCCACACGNONE 
Os03g0748500AK110695GTCGCGCGAGNONE 
Os03g0751600006-043-F03GCGCGCGACNONE 
006-050-G05GCGCGCGACNONE 
006-059-F10GCGCGCGACNONE 
AK061520GCGCGCGACHeavy metal transport/detoxification protein domain containing protein. 
AK104665GCGCGCGACNONE 
Os03g0764200Os03g0764200GTCGCGCGCNONE 
Os03g0801900015-081-G06CGCGCGACNONE 
AK106415CGCGCGACProtein of unknown function DUF569 family protein. 
J090099L17CGCGCGACNONE 
J100024B03CGCGCGACNONE 
J100088I08CGCGCGACNONE 
Os03g0802200009-047-D08CGCGCGACNONE 
013-057-D02CGCGCGACNONE 
013-089-F02CGCGCGACNONE 
014-079-D02CGCGCGACNONE 
016-004-A11CGCGCGACNONE 
AK111769CGCGCGACConserved hypothetical protein. 
J075006H18CGCGCGACNONE 
J075060G07CGCGCGACNONE 
Os03g0819900006-058-B05CGCACGCGCGCGACNONE 
AK111912CGCACGCGCGCGACNONE 
AK112029CGCACGCGCGCGACSimilar to RAB8C. 
AY576526CGCACGCGCGCGACNONE 
AY579410CGCACGCGCGCGACNONE 
J075041G24CGCACGCGCGCGACNONE 
J100070N08CGCACGCGCGCGACNONE 
Os03g0829600AK071298CGCGCGACNONE 
AK119707CGCGCGACConserved hypothetical protein. 
J023084A07CGCGCGACNONE 
Os04g0412300AK110902CGCGCGACGCGNONE 
AK121151CGCGCGACGCGGlycoside hydrolase, family 17 protein. 
J013126I01CGCGCGACGCGNONE 
J023078I08CGCGCGACGCGNONE 
J090006M17CGCGCGACGCGNONE 
J090060D03CGCGCGACGCGNONE 
J090063F12CGCGCGACGCGNONE 
J100040E06CGCGCGACGCGNONE 
J100057F18CGCGCGACGCGNONE 
J100058B19CGCGCGACGCGNONE 
J100058C20CGCGCGACGCGNONE 
J100067G08CGCGCGACGCGNONE 
J100082C09CGCGCGACGCGNONE 
J100086D14CGCGCGACGCGNONE 
Os04g0434400014-079-B10CGCGCGACGCGNONE 
AK063725CGCGCGACGCGConserved hypothetical protein. 
Os04g0435700AK100857GTCGCGCGCSimilar to UVB-resistance protein UVR8. 
Os04g0447400AK070858GCCCCCACCACGTCGCGCGCSimilar to Glutamate decarboxylase 2 (EC 4.1.1.15) (GAD 2). 
J023002M09GCCCCCACCACGTCGCGCGCNONE 
J023003G16GCCCCCACCACGTCGCGCGCNONE 
J023006F16GCCCCCACCACGTCGCGCGCNONE 
J023008D10GCCCCCACCACGTCGCGCGCNONE 
J023010A01GCCCCCACCACGTCGCGCGCNONE 
J023012M16GCCCCCACCACGTCGCGCGCNONE 
J023023H17GCCCCCACCACGTCGCGCGCNONE 
J023029B12GCCCCCACCACGTCGCGCGCNONE 
J023030F09GCCCCCACCACGTCGCGCGCNONE 
J023034K03GCCCCCACCACGTCGCGCGCNONE 
J023045A16GCCCCCACCACGTCGCGCGCNONE 
J023048I04GCCCCCACCACGTCGCGCGCNONE 
J023056C09GCCCCCACCACGTCGCGCGCNONE 
J023056F05GCCCCCACCACGTCGCGCGCNONE 
J023058B21GCCCCCACCACGTCGCGCGCNONE 
J023058N06GCCCCCACCACGTCGCGCGCNONE 
J023059F03GCCCCCACCACGTCGCGCGCNONE 
J023059M19GCCCCCACCACGTCGCGCGCNONE 
J023060P05GCCCCCACCACGTCGCGCGCNONE 
J023062D07GCCCCCACCACGTCGCGCGCNONE 
J023063F16GCCCCCACCACGTCGCGCGCNONE 
J023068K15GCCCCCACCACGTCGCGCGCNONE 
J023069L04GCCCCCACCACGTCGCGCGCNONE 
J023075I24GCCCCCACCACGTCGCGCGCNONE 
J023086H01GCCCCCACCACGTCGCGCGCNONE 
J023086I24GCCCCCACCACGTCGCGCGCNONE 
J023091M08GCCCCCACCACGTCGCGCGCNONE 
J023095A07GCCCCCACCACGTCGCGCGCNONE 
J023110K06GCCCCCACCACGTCGCGCGCNONE 
J023113D07GCCCCCACCACGTCGCGCGCNONE 
J023126J05GCCCCCACCACGTCGCGCGCNONE 
J023140F04GCCCCCACCACGTCGCGCGCNONE 
J023141N19GCCCCCACCACGTCGCGCGCNONE 
Os04g0447500AK064090GCGCGCGACGTGGTGGGGGCSimilar to NADPH-dependent codeinone reductase (EC 1.1.1.247). 
Os04g0489600003-130-E01GTCGCGCGCNONE 
AK062301GTCGCGCGCNONE 
AK068039GTCGCGCGCBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
Os04g0494600AK110895CGCGTCGCGCGProtein of unknown function DUF642 family protein. 
Os04g0505200004-004-B07GTCGCGCGCGCGACNONE 
006-025-D10GTCGCGCGCGCGACNONE 
006-038-D07GTCGCGCGCGCGACNONE 
006-044-H11GTCGCGCGCGCGACNONE 
006-061-A09GTCGCGCGCGCGACNONE 
006-083-C02GTCGCGCGCGCGACNONE 
009-167-F06GTCGCGCGCGCGACNONE 
013-093-B02GTCGCGCGCGCGACNONE 
AK061301GTCGCGCGCGCGACLeucine-rich repeat, plant specific containing protein. 
AK066703GTCGCGCGCGCGACNONE 
AK104903GTCGCGCGCGCGACNONE 
J013027H24GTCGCGCGCGCGACNONE 
J013075O17GTCGCGCGCGCGACNONE 
J013130D11GTCGCGCGCGCGACNONE 
J033069B22GTCGCGCGCGCGACNONE 
J033102K15GTCGCGCGCGCGACNONE 
J090004A17GTCGCGCGCGCGACNONE 
J090008L22GTCGCGCGCGCGACNONE 
J090063C05GTCGCGCGCGCGACNONE 
Os04g0510900012-083-A10CGCGCGACNONE 
014-002-F04CGCGCGACNONE 
AK063625CGCGCGACSimilar to Embryo-specific protein 1 (ATS1). 
J065136I20CGCGCGACNONE 
J065144F23CGCGCGACNONE 
J065153D08CGCGCGACNONE 
J065178A02CGCGCGACNONE 
J065178B01CGCGCGACNONE 
J065195M21CGCGCGACNONE 
Os04g0587300AK119483GCGCGCGACSimilar to Purine permease-like protein. 
Os04g0589600011-100-F04GCGCGCGACNONE 
AK061833GCGCGCGACGlycosyl transferase, group 1 domain containing protein. 
AK098964GCGCGCGACNONE 
AK100053GCGCGCGACNONE 
Os04g0594100014-046-H12CACCTGTCGCGCGCNONE 
014-049-F01CACCTGTCGCGCGCNONE 
AK111960CACCTGTCGCGCGCSimilar to P-type R2R3 Myb protein (Fragment). 
Os04g0612100AK060663CGCGCGACSimilar to Beta-1,3-glucanase-like protein. 
Os04g0612500003-117-H11GCGCGCGACNONE 
AK062295GCGCGCGACSimilar to Prolin rich protein. 
Os04g0612800016-010-G05CGCGCGACNONE 
AK071230CGCGCGACProtein prenyltransferase domain containing protein. 
Os04g0623800AK059270CGCGTCGCGCGCNONE 
AK099234CGCGTCGCGCGCSimilar to Aminomethyltransferase, mitochondrial precursor (EC 2.1.2.10) (Glycine cleavage system T protein) (GCVT). 
Os04g0635000009-031-A05GTCGCGCGAGNONE 
009-074-F05GTCGCGCGAGNONE 
009-163-H03GTCGCGCGAGNONE 
AK062619GTCGCGCGAGConserved hypothetical protein. 
Os04g0639100009-158-D03GTCGCGCGNONE 
AK063036GTCGCGCGConserved hypothetical protein. 
J075045D14GTCGCGCGNONE 
J075047L16GTCGCGCGNONE 
J075048D20GTCGCGCGNONE 
J075056E20GTCGCGCGNONE 
J075074E14GTCGCGCGNONE 
J075108F16GTCGCGCGNONE 
J075143L19GTCGCGCGNONE 
J075146L07GTCGCGCGNONE 
J075158I04GTCGCGCGNONE 
J075172B20GTCGCGCGNONE 
J090061M08GTCGCGCGNONE 
Os04g0667600009-131-H09CGCGCGACNONE 
009-200-A04CGCGCGACNONE 
AK068657CGCGCGACHeavy metal transport/detoxification protein domain containing protein. 
J065013M12CGCGCGACNONE 
J065024H17CGCGCGACNONE 
J065025P10CGCGCGACNONE 
J065028I11CGCGCGACNONE 
J065044K11CGCGCGACNONE 
J065045B14CGCGCGACNONE 
J065052B02CGCGCGACNONE 
J065061F20CGCGCGACNONE 
J065061K16CGCGCGACNONE 
J065063E12CGCGCGACNONE 
J065065E16CGCGCGACNONE 
J065082M02CGCGCGACNONE 
J065084O10CGCGCGACNONE 
J065096H18CGCGCGACNONE 
J065122F02CGCGCGACNONE 
J065131F09CGCGCGACNONE 
J065139P06CGCGCGACNONE 
J065148L17CGCGCGACNONE 
J065164D23CGCGCGACNONE 
J065167M17CGCGCGACNONE 
J065174B15CGCGCGACNONE 
J065176G01CGCGCGACNONE 
J065186K17CGCGCGACNONE 
J065186N05CGCGCGACNONE 
J065213N24CGCGCGACNONE 
J075001P17CGCGCGACNONE 
J075004A15CGCGCGACNONE 
J075007B03CGCGCGACNONE 
J075026D23CGCGCGACNONE 
J075032D17CGCGCGACNONE 
J075058C22CGCGCGACNONE 
J075080L14CGCGCGACNONE 
J075094K18CGCGCGACNONE 
J075097K15CGCGCGACNONE 
J075098E02CGCGCGACNONE 
J075104D11CGCGCGACNONE 
J075120L16CGCGCGACNONE 
J075126A18CGCGCGACNONE 
J075129M08CGCGCGACNONE 
J075143N14CGCGCGACNONE 
J075146D07CGCGCGACNONE 
J075149L10CGCGCGACNONE 
J075171F22CGCGCGACNONE 
J090058C05CGCGCGACNONE 
J100018N19CGCGCGACNONE 
J100024K09CGCGCGACNONE 
J100036F15CGCGCGACNONE 
J100042A15CGCGCGACNONE 
J100042P14CGCGCGACNONE 
J100051N18CGCGCGACNONE 
J100055K14CGCGCGACNONE 
J100056F05CGCGCGACNONE 
J100058L10CGCGCGACNONE 
J100083J17CGCGCGACNONE 
J100086N07CGCGCGACNONE 
Os04g0688200011-046-G12CGCGCGACNONE 
AK103558CGCGCGACSimilar to Peroxidase (EC 1.11.1.7). 
J033023B21CGCGCGACNONE 
J033060E20CGCGCGACNONE 
J033079N12CGCGCGACNONE 
J033132H20CGCGCGACNONE 
J100018D11CGCGCGACNONE 
J100028D18CGCGCGACNONE 
Os05g0186300AK070360ACCCGCGCGACSimilar to NADP-malic enzyme. 
AK099249ACCCGCGCGACNONE 
AY435404ACCCGCGCGACNONE 
J023006D11ACCCGCGCGACNONE 
J023059P07ACCCGCGCGACNONE 
Os05g0190300004-005-C08GCGCGCGACNONE 
006-025-C01GCGCGCGACNONE 
006-027-F06GCGCGCGACNONE 
006-028-B04GCGCGCGACNONE 
006-035-C02GCGCGCGACNONE 
006-036-C11GCGCGCGACNONE 
006-041-A01GCGCGCGACNONE 
006-045-D03GCGCGCGACNONE 
006-054-D06GCGCGCGACNONE 
006-059-H03GCGCGCGACNONE 
006-064-A07GCGCGCGACNONE 
006-064-D09GCGCGCGACNONE 
006-066-C11GCGCGCGACNONE 
006-074-H09GCGCGCGACNONE 
006-079-D01GCGCGCGACNONE 
006-084-A12GCGCGCGACNONE 
006-089-A10GCGCGCGACNONE 
006-090-A09GCGCGCGACNONE 
006-096-C06GCGCGCGACNONE 
006-102-E03GCGCGCGACNONE 
006-109-B09GCGCGCGACNONE 
006-115-D12GCGCGCGACNONE 
AK061507GCGCGCGACNONE 
AK104180GCGCGCGACNONE 
AK104252GCGCGCGACNONE 
AK104267GCGCGCGACNONE 
AK104355GCGCGCGACNONE 
AK106112GCGCGCGACNONE 
AK119190GCGCGCGACAcid phosphatase (Class B) family protein. 
J013088K07GCGCGCGACNONE 
J013110D12GCGCGCGACNONE 
J013118F19GCGCGCGACNONE 
J013124A02GCGCGCGACNONE 
J013135I19GCGCGCGACNONE 
J023027C12GCGCGCGACNONE 
J023063O08GCGCGCGACNONE 
J023122E16GCGCGCGACNONE 
J023150C11GCGCGCGACNONE 
J065035F03GCGCGCGACNONE 
J065057B06GCGCGCGACNONE 
Os05g0194900AK071798GTCGCGCGSimilar to Pyrophosphate-fructose-6-phosphate 1-phosphotransferase-like protein (Pyrophosphate-dependent phosphofructo-1-kinase-like protein). 
J023112B14GTCGCGCGNONE 
Os05g0349800011-076-D06CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
014-037-D12CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
AK063677CCGAGCCGTCCGCGTCGCCGCGCGACACGTEmbryonic abundant protein 1. 
AK119674CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J053027D20CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J053039D11CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J053047P16CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J053048F05CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J053058E11CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J053060C03CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J053082N12CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J065017B15CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J065117G02CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J065212K21CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J075001H18CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J075003F20CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J075026F11CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J075035F13CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J075055C12CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J075067L20CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J075067O13CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J075070A12CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J075089E05CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J075128J17CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J075134M19CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J075192L11CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J075199D14CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
Os05g0361700AJ575218GAGACGCGCGACGCGNONE 
AK100184GAGACGCGCGACGCGSimilar to EREBP-2 protein (Fragment). 
AK111676GAGACGCGCGACGCGNONE 
J013155B14GAGACGCGCGACGCGNONE 
J065073N01GAGACGCGCGACGCGNONE 
J065161J12GAGACGCGCGACGCGNONE 
J075074A07GAGACGCGCGACGCGNONE 
J100029H13GAGACGCGCGACGCGNONE 
Os05g0388600AK105904GTCGCGCGAGConserved hypothetical protein. 
Os05g0392200013-072-B10GTCGCGCGCNONE 
AK063603GTCGCGCGCGeneric methyltransferase domain containing protein. 
J065116F18GTCGCGCGCNONE 
J075112N20GTCGCGCGCNONE 
J075136D16GTCGCGCGCNONE 
J090090O10GTCGCGCGCNONE 
J090091G05GTCGCGCGCNONE 
Os05g0397700AK067298GCGCGCGACACGTGSecY protein family protein. 
Os05g0407100AK063349CGCGTCGCGCGCFour F5 protein family protein. 
Os05g0408200AK100057GCGGGCCCCACGCGCGACGCSBP domain containing protein. 
J065182F20GCGGGCCCCACGCGCGACGCNONE 
Os05g0444200AK102658CGCGCGACGCSimilar to T6J4.5 protein (WIP6 protein). 
Os05g0465100AK065821CGCACCGCGCGCGACRabGAP/TBC domain containing protein. 
Os05g0467300006-113-H02CGCGCGACNONE 
AK061873CGCGCGACSelT/selW/selH selenoprotein family protein. 
AK098945CGCGCGACNONE 
J013050H09CGCGCGACNONE 
J023108B17CGCGCGACNONE 
J065189J01CGCGCGACNONE 
J075011H05CGCGCGACNONE 
J075019G20CGCGCGACNONE 
Os05g0499800016-065-G04GTCGCGCGCCACGTCNONE 
AK064392GTCGCGCGCCACGTCNONE 
AK103146GTCGCGCGCCACGTCUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
J023075J11GTCGCGCGCCACGTCNONE 
J033120I02GTCGCGCGCCACGTCNONE 
Os05g0533500Os05g0533500GTCGCGCGCSimilar to Serine acetyltransferase. 
Os05g0577700AK107217GCTGGGCTGGGCCCCTCGCGCGCGACGCGACSimilar to Protein kinase. 
AY224453GCTGGGCTGGGCCCCTCGCGCGCGACGCGACNONE 
Os06g0101600AF093636GCGCGCGACNONE 
AK070447GCGCGCGACPlastocyanin, chloroplast precursor. 
J065001A20GCGCGCGACNONE 
J065019M17GCGCGCGACNONE 
J065021H18GCGCGCGACNONE 
J065061A17GCGCGCGACNONE 
J065073L02GCGCGCGACNONE 
J065099F17GCGCGCGACNONE 
J065101C23GCGCGCGACNONE 
J065121E23GCGCGCGACNONE 
J065122N04GCGCGCGACNONE 
J065141N05GCGCGCGACNONE 
J065143N21GCGCGCGACNONE 
J065161H09GCGCGCGACNONE 
J065161J04GCGCGCGACNONE 
J065162P20GCGCGCGACNONE 
J065182K10GCGCGCGACNONE 
J065184M05GCGCGCGACNONE 
J065186H24GCGCGCGACNONE 
J065189G21GCGCGCGACNONE 
J065190N14GCGCGCGACNONE 
J065191H08GCGCGCGACNONE 
J065205H17GCGCGCGACNONE 
J075001E03GCGCGCGACNONE 
J075001H21GCGCGCGACNONE 
J075003J23GCGCGCGACNONE 
J075003K01GCGCGCGACNONE 
J075005I11GCGCGCGACNONE 
J075007F16GCGCGCGACNONE 
J075017I11GCGCGCGACNONE 
J075018O05GCGCGCGACNONE 
J075019G24GCGCGCGACNONE 
J075032D04GCGCGCGACNONE 
J075032N13GCGCGCGACNONE 
J075033C09GCGCGCGACNONE 
J075033D11GCGCGCGACNONE 
J075039A20GCGCGCGACNONE 
J075058P12GCGCGCGACNONE 
J075062E10GCGCGCGACNONE 
J075062P16GCGCGCGACNONE 
J075063C17GCGCGCGACNONE 
J075066E07GCGCGCGACNONE 
J075066I20GCGCGCGACNONE 
J075075K21GCGCGCGACNONE 
J075078F03GCGCGCGACNONE 
J075082F10GCGCGCGACNONE 
J075086G16GCGCGCGACNONE 
J075087E07GCGCGCGACNONE 
J075087K06GCGCGCGACNONE 
J075087L04GCGCGCGACNONE 
J075088B16GCGCGCGACNONE 
J075088D02GCGCGCGACNONE 
J075094H21GCGCGCGACNONE 
J075094I24GCGCGCGACNONE 
J075094K10GCGCGCGACNONE 
J075095C18GCGCGCGACNONE 
J075097B05GCGCGCGACNONE 
J075099C13GCGCGCGACNONE 
J075099H22GCGCGCGACNONE 
J075099L16GCGCGCGACNONE 
J075104K08GCGCGCGACNONE 
J075118O06GCGCGCGACNONE 
J075119E15GCGCGCGACNONE 
J075124N06GCGCGCGACNONE 
J075126G02GCGCGCGACNONE 
J075127L24GCGCGCGACNONE 
J075131E23GCGCGCGACNONE 
J075140H06GCGCGCGACNONE 
J075146I20GCGCGCGACNONE 
J075146N24GCGCGCGACNONE 
J075147I19GCGCGCGACNONE 
J075155K07GCGCGCGACNONE 
J075156C05GCGCGCGACNONE 
J075161G07GCGCGCGACNONE 
J075164G01GCGCGCGACNONE 
J075170J18GCGCGCGACNONE 
J075172G17GCGCGCGACNONE 
J075176G10GCGCGCGACNONE 
J075178C05GCGCGCGACNONE 
J075179G01GCGCGCGACNONE 
J075181E24GCGCGCGACNONE 
J080029D19GCGCGCGACNONE 
J080034L11GCGCGCGACNONE 
J080039G07GCGCGCGACNONE 
J080062M23GCGCGCGACNONE 
J080302A01GCGCGCGACNONE 
J100042I15GCGCGCGACNONE 
J100043G22GCGCGCGACNONE 
J100056L12GCGCGCGACNONE 
J100061A12GCGCGCGACNONE 
J100073O20GCGCGCGACNONE 
J100082I08GCGCGCGACNONE 
Os06g0211200011-063-B02GCGCGCGACNONE 
AK103188GCGCGCGACSimilar to Abscisic acid responsive elements-binding factor (ABA-responsive element binding protein 1) (AREB1). 
AK105312GCGCGCGACNONE 
J065214N03GCGCGCGACNONE 
J090046C13GCGCGCGACNONE 
J090049L03GCGCGCGACNONE 
J100074P03GCGCGCGACNONE 
Os06g0219900AK058704GTCGCGCGCSimilar to Phi-1 protein. 
Os06g0220500011-038-H05GCGCGCGACNONE 
011-086-F05GCGCGCGACNONE 
AK063324GCGCGCGACUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
J100040M16GCGCGCGACNONE 
Os06g0348800AF318581GCGCGCGACCGGCCCNONE 
AK061946GCGCGCGACCGGCCCNONE 
AK065184GCGCGCGACCGGCCCNONE 
AK098909GCGCGCGACCGGCCCNONE 
AK098915GCGCGCGACCGGCCCHomeodomain-like containing protein. 
AK122161GCGCGCGACCGGCCCNONE 
J013002D22GCGCGCGACCGGCCCNONE 
J013002F22GCGCGCGACCGGCCCNONE 
J013002I19GCGCGCGACCGGCCCNONE 
J013022A07GCGCGCGACCGGCCCNONE 
J013135J08GCGCGCGACCGGCCCNONE 
J033147G01GCGCGCGACCGGCCCNONE 
J075012G19GCGCGCGACCGGCCCNONE 
J075049L03GCGCGCGACCGGCCCNONE 
J075068G02GCGCGCGACCGGCCCNONE 
J075145E15GCGCGCGACCGGCCCNONE 
J075145J09GCGCGCGACCGGCCCNONE 
J075155B11GCGCGCGACCGGCCCNONE 
J075173E22GCGCGCGACCGGCCCNONE 
J075180B11GCGCGCGACCGGCCCNONE 
J075195D12GCGCGCGACCGGCCCNONE 
Os06g0553100J065130H10CGCGCGACACGTNONE 
J075102G23CGCGCGACACGTNONE 
J075147H23CGCGCGACACGTHeat shock factor (HSF)-type, DNA-binding domain containing protein. 
Os06g0556600AK072511GTCGCGCGCSimilar to Pollen allergen Phl p 11. 
J023077F02GTCGCGCGCNONE 
J023132A12GTCGCGCGCNONE 
Os06g0593100AK060274GCGCGCGACSimilar to UDP-galactose/UDP-glucose transporter. 
AK071175GCGCGCGACNONE 
Os06g0613500AK070970GTCGCGTCGCGCGCSimilar to Helix-loop-helix protein homolog. 
J023066J03GTCGCGTCGCGCGCNONE 
Os06g0633100AK107791GCGCGCGACGCGConserved hypothetical protein. 
J065001N11GCGCGCGACGCGNONE 
Os06g0656800AK109762GCGCGCGACBeta-Ig-H3/fasciclin domain containing protein. 
Os06g0678800AK071465CGCGCGACSimilar to Pollen-specific protein NTP303 precursor. 
Os07g0136300AK064609GTCGCGCGTGGGCCGAGAConserved hypothetical protein. 
Os07g0141400003-129-D08GCGCGCGACNONE 
006-021-E02GCGCGCGACNONE 
006-025-C06GCGCGCGACNONE 
006-027-H11GCGCGCGACNONE 
006-036-C05GCGCGCGACNONE 
006-046-D07GCGCGCGACNONE 
006-047-A02GCGCGCGACNONE 
006-050-F02GCGCGCGACNONE 
006-053-D07GCGCGCGACNONE 
006-054-E06GCGCGCGACNONE 
006-055-E01GCGCGCGACNONE 
006-055-F01GCGCGCGACNONE 
006-056-H12GCGCGCGACNONE 
006-057-D07GCGCGCGACNONE 
006-074-G10GCGCGCGACNONE 
006-077-C02GCGCGCGACNONE 
006-081-E01GCGCGCGACNONE 
006-089-B08GCGCGCGACNONE 
006-089-C10GCGCGCGACNONE 
006-092-E07GCGCGCGACNONE 
006-096-C11GCGCGCGACNONE 
006-096-H06GCGCGCGACNONE 
006-097-E07GCGCGCGACNONE 
006-098-D03GCGCGCGACNONE 
006-102-C05GCGCGCGACNONE 
006-107-E09GCGCGCGACNONE 
006-110-C09GCGCGCGACNONE 
006-113-C01GCGCGCGACNONE 
006-114-D09GCGCGCGACNONE 
006-115-H06GCGCGCGACNONE 
009-016-G06GCGCGCGACNONE 
009-031-C05GCGCGCGACNONE 
009-060-B05GCGCGCGACNONE 
009-123-H12GCGCGCGACNONE 
009-154-B09GCGCGCGACNONE 
009-172-F07GCGCGCGACNONE 
009-193-A04GCGCGCGACNONE 
AF022732GCGCGCGACNONE 
AF052203GCGCGCGACNONE 
AK065248GCGCGCGACSimilar to 23 kDa polypeptide of photosystem II. 
AK104722GCGCGCGACNONE 
D49713GCGCGCGACNONE 
J013002J02GCGCGCGACNONE 
J065051O13GCGCGCGACNONE 
J065066J18GCGCGCGACNONE 
J065077G23GCGCGCGACNONE 
J065162C22GCGCGCGACNONE 
J065162G22GCGCGCGACNONE 
J075091B13GCGCGCGACNONE 
J075099J22GCGCGCGACNONE 
J100056O22GCGCGCGACNONE 
J100059E01GCGCGCGACNONE 
J100079F20GCGCGCGACNONE 
Os07g0191600AK071418GTCGCGCGCNONE 
AK071418GTCGCGCGCNONE 
AK102563GTCGCGCGCNONE 
AK102563GTCGCGCGCNONE 
Os07g0191700AK066389ACCCGCGCGACGTGGGGCCCACGCSimilar to AT.I.24-9 protein (Fragment). 
AK103768ACCCGCGCGACGTGGGGCCCACGCNONE 
Os07g0240300AK072205CGCGCGACGCConserved hypothetical protein. 
AK098977CGCGCGACGCNONE 
Os07g0262950J033120B02CGCGCGACGCGTGGConserved hypothetical protein. 
J075040G05CGCGCGACGCGTGGNONE 
J075160F23CGCGCGACGCGTGGNONE 
Os07g0501900AK067791CGCGCGACNONE 
Os07g0502200006-027-C06CCCCCGCGCGCGACNONE 
012-007-C05CCCCCGCGCGCGACNONE 
AK120682CCCCCGCGCGCGACMulti antimicrobial extrusion protein MatE family protein. 
J053045G13CCCCCGCGCGCGACNONE 
J053064I18CCCCCGCGCGCGACNONE 
J053091G24CCCCCGCGCGCGACNONE 
J065016E10CCCCCGCGCGCGACNONE 
J065021B18CCCCCGCGCGCGACNONE 
J065022A17CCCCCGCGCGCGACNONE 
J065059D18CCCCCGCGCGCGACNONE 
J065063N19CCCCCGCGCGCGACNONE 
J065065O10CCCCCGCGCGCGACNONE 
J065196F12CCCCCGCGCGCGACNONE 
J065208I01CCCCCGCGCGCGACNONE 
J065218G15CCCCCGCGCGCGACNONE 
J100040G01CCCCCGCGCGCGACNONE 
J100060M03CCCCCGCGCGCGACNONE 
J100061P09CCCCCGCGCGCGACNONE 
J100065P05CCCCCGCGCGCGACNONE 
Os07g0558000AK069272GTCGCGCGCNONE 
AK101867GTCGCGCGCABC-1 domain containing protein. 
Os07g0565800009-114-F12CGCGCGACGCNONE 
009-114-F12GTCGCGCGCNONE 
AK062834CGCGCGACGCConserved hypothetical protein. 
AK062834GTCGCGCGCConserved hypothetical protein. 
J065026L16CGCGCGACGCNONE 
J065026L16GTCGCGCGCNONE 
Os07g0595800011-069-G09CTCGCGCGACNONE 
AK066349CTCGCGCGACPrefoldin related, ubiquitously expressed transcript family protein. 
J013062C05CTCGCGCGACNONE 
Os07g0657100AK108253CGCGCGACGlyoxalase/extradiol ring-cleavage dioxygenase domain containing protein. 
J075072F01CGCGCGACNONE 
J075078C21CGCGCGACNONE 
J075147E12CGCGCGACNONE 
J075180N10CGCGCGACNONE 
J075197D01CGCGCGACNONE 
Os07g0686600AK108527GTCGCGCGVQ domain containing protein. 
Os08g0126700AK111805GTCGCGCGCNONE 
AK111902GTCGCGCGCZinc finger, CCCH-type domain containing protein. 
Os08g0144100AK071435TCGCGCGCGCGACGCGSimilar to Avr9/Cf-9 rapidly elicited protein 31. 
Os08g0243500AK068915CGCGTCGCGCGCCCAATTSimilar to NADPH-cytochrome P450 oxydoreductase isoform 2. 
AK099083CGCGTCGCGCGCCCAATTNONE 
Os08g0244100012-067-B02GTCGCGCGNONE 
AK064015GTCGCGCGNONE 
AK101898GTCGCGCGNONE 
AK102977GTCGCGCGt-snare domain containing protein. 
J033071B08GTCGCGCGNONE 
J033115N03GTCGCGCGNONE 
J065031I08GTCGCGCGNONE 
J065091O05GTCGCGCGNONE 
J065116E21GTCGCGCGNONE 
J065131F08GTCGCGCGNONE 
J065196N04GTCGCGCGNONE 
J075064N17GTCGCGCGNONE 
J075078P10GTCGCGCGNONE 
J075108N23GTCGCGCGNONE 
J075142C18GTCGCGCGNONE 
J075163I12GTCGCGCGNONE 
J075177B18GTCGCGCGNONE 
J075178A18GTCGCGCGNONE 
J075191N04GTCGCGCGNONE 
Os08g0402500AK108881GCGCGCGACGCGACGCGConserved hypothetical protein. 
Os08g0425700AK059408CGCGCGACSimilar to Annexin-like protein. 
AK104119CGCGCGACNONE 
J065063J06CGCGCGACNONE 
Os08g0443800AK110630GTCGCGCGCCD9/CD37/CD63 antigen family protein. 
Os08g0476300014-029-G10GTCGCGCGCNONE 
AK071937GTCGCGCGCNONE 
AK105359GTCGCGCGCGlucose/ribitol dehydrogenase family protein. 
J065099P11GTCGCGCGCNONE 
J075083H04GTCGCGCGCNONE 
J075130H04GTCGCGCGCNONE 
Os08g0485700AK068131GCGCGCGACGCGNONE 
AK069097GCGCGCGACGCGMethyl-CpG binding domain containing protein. 
J013130L03GCGCGCGACGCGNONE 
Os08g0517700AK071151GCGCGCGACOxysterol-binding protein family protein. 
Os08g0565200AK108143GTCGCGCGCPathogenesis-related transcriptional factor and ERF domain containing protein. 
Os09g0265050J065112H09CGCGCGACGCGTGGConserved hypothetical protein. 
Os09g0363700AK103667GTCGCGCGCConserved hypothetical protein. 
J075001L14GTCGCGCGCNONE 
J075049M23GTCGCGCGCNONE 
J075051I04GTCGCGCGCNONE 
J075073L04GTCGCGCGCNONE 
J075077E03GTCGCGCGCNONE 
J075083J11GTCGCGCGCNONE 
J075094J22GTCGCGCGCNONE 
J075112E08GTCGCGCGCNONE 
J075137J23GTCGCGCGCNONE 
J075192E02GTCGCGCGCNONE 
J100039K04GTCGCGCGCNONE 
Os09g0403000AK111051GCGCGCGACConserved hypothetical protein. 
Os09g0456200015-025-E01CCACGCGTCGCGCGCNONE 
AK065873CCACGCGTCGCGCGCSimilar to BZIP transcription factor ABI5. 
J013049N23CCACGCGTCGCGCGCNONE 
J033128E10CCACGCGTCGCGCGCNONE 
Os09g0480600AK107853GTCGCGCGCGCGAGHypothetical protein. 
Os09g0486500006-062-H11CGCGCGACGCNONE 
009-049-A11CGCGCGACGCNONE 
009-070-D06CGCGCGACGCNONE 
009-089-A10CGCGCGACGCNONE 
009-107-D06CGCGCGACGCNONE 
009-133-F02CGCGCGACGCNONE 
009-142-A05CGCGCGACGCNONE 
009-175-G07CGCGCGACGCNONE 
013-044-C05CGCGCGACGCNONE 
014-044-D10CGCGCGACGCNONE 
AF140722CGCGCGACGCNONE 
AK061067CGCGCGACGCNONE 
AK070140CGCGCGACGCNONE 
AK106128CGCGCGACGCMultiple stress-responsive zinc-finger protein ISAP1 (Stress- associated protein 1) (OsISAP1). 
AK119793CGCGCGACGCNONE 
J023042G11CGCGCGACGCNONE 
J053043H07CGCGCGACGCNONE 
J053046N13CGCGCGACGCNONE 
J053091K15CGCGCGACGCNONE 
J053094I21CGCGCGACGCNONE 
J053094N04CGCGCGACGCNONE 
J053100D12CGCGCGACGCNONE 
J053101K11CGCGCGACGCNONE 
J065079H06CGCGCGACGCNONE 
J100028D11CGCGCGACGCNONE 
J100033A20CGCGCGACGCNONE 
J100033F15CGCGCGACGCNONE 
Os09g0493700015-091-G11GCGGGTCGCGCGNONE 
AK068501GCGGGTCGCGCGSimilar to CUC2. 
AK099237GCGGGTCGCGCGNONE 
J013155B08GCGGGTCGCGCGNONE 
J023006E01GCGGGTCGCGCGNONE 
J023060K23GCGGGTCGCGCGNONE 
J023100B11GCGGGTCGCGCGNONE 
J033026L19GCGGGTCGCGCGNONE 
J033129J12GCGGGTCGCGCGNONE 
J033149K09GCGGGTCGCGCGNONE 
J065045I06GCGGGTCGCGCGNONE 
J065061A10GCGGGTCGCGCGNONE 
J065101H05GCGGGTCGCGCGNONE 
J065135A03GCGGGTCGCGCGNONE 
J065169C16GCGGGTCGCGCGNONE 
J100047C11GCGGGTCGCGCGNONE 
J100047K07GCGGGTCGCGCGNONE 
Os09g0551600005-020-H08CGCGTCGCGCGCNONE 
006-043-E02CGCGTCGCGCGCNONE 
013-043-F03CGCGTCGCGCGCNONE 
AK066658CGCGTCGCGCGCSimilar to HMGd1 protein (Nucleasome/chromatin assembly factor D protein NFD101). 
J013071N11CGCGTCGCGCGCNONE 
J065177J20CGCGTCGCGCGCNONE 
J075041D06CGCGTCGCGCGCNONE 
J075199H24CGCGTCGCGCGCNONE 
J080001G07CGCGTCGCGCGCNONE 
J080024A12CGCGTCGCGCGCNONE 
J080025B15CGCGTCGCGCGCNONE 
J090017G07CGCGTCGCGCGCNONE 
J090050G23CGCGTCGCGCGCNONE 
J090083G11CGCGTCGCGCGCNONE 
Os11g0131900AK065240CGCGCGACSimilar to Arabinoxylan arabinofuranohydrolase isoenzyme AXAH-II. 
Os11g0276000AK072319GTCGCGCGCSimilar to Roothairless 1. 
Os11g0582400AF049348CCCCCGCGCGCGACGTGGGCTConserved hypothetical protein. 
AF516927CCCCCGCGCGCGACGTGGGCTNONE 
AK073083CCCCCGCGCGCGACGTGGGCTNONE 
AK108352CCCCCGCGCGCGACGTGGGCTNONE 
J075005O16CCCCCGCGCGCGACGTGGGCTNONE 
J075007D15CCCCCGCGCGCGACGTGGGCTNONE 
J075007L04CCCCCGCGCGCGACGTGGGCTNONE 
J075009C11CCCCCGCGCGCGACGTGGGCTNONE 
J075012L11CCCCCGCGCGCGACGTGGGCTNONE 
J075013A14CCCCCGCGCGCGACGTGGGCTNONE 
J075015K01CCCCCGCGCGCGACGTGGGCTNONE 
J075019O21CCCCCGCGCGCGACGTGGGCTNONE 
J075020G20CCCCCGCGCGCGACGTGGGCTNONE 
J075020H06CCCCCGCGCGCGACGTGGGCTNONE 
J075022D07CCCCCGCGCGCGACGTGGGCTNONE 
J075024M12CCCCCGCGCGCGACGTGGGCTNONE 
J075025G04CCCCCGCGCGCGACGTGGGCTNONE 
J075026F09CCCCCGCGCGCGACGTGGGCTNONE 
J075027D19CCCCCGCGCGCGACGTGGGCTNONE 
J075030A12CCCCCGCGCGCGACGTGGGCTNONE 
J075030C16CCCCCGCGCGCGACGTGGGCTNONE 
J075030D15CCCCCGCGCGCGACGTGGGCTNONE 
J075034M20CCCCCGCGCGCGACGTGGGCTNONE 
J075041H12CCCCCGCGCGCGACGTGGGCTNONE 
J075052D12CCCCCGCGCGCGACGTGGGCTNONE 
J075052G11CCCCCGCGCGCGACGTGGGCTNONE 
J075053L09CCCCCGCGCGCGACGTGGGCTNONE 
J075064G05CCCCCGCGCGCGACGTGGGCTNONE 
J075067J01CCCCCGCGCGCGACGTGGGCTNONE 
J075071O03CCCCCGCGCGCGACGTGGGCTNONE 
J075072G12CCCCCGCGCGCGACGTGGGCTNONE 
J075078H06CCCCCGCGCGCGACGTGGGCTNONE 
J075081D06CCCCCGCGCGCGACGTGGGCTNONE 
J075084G23CCCCCGCGCGCGACGTGGGCTNONE 
J075085M10CCCCCGCGCGCGACGTGGGCTNONE 
J075087N20CCCCCGCGCGCGACGTGGGCTNONE 
J075088E11CCCCCGCGCGCGACGTGGGCTNONE 
J075088O22CCCCCGCGCGCGACGTGGGCTNONE 
J075091E10CCCCCGCGCGCGACGTGGGCTNONE 
J075092B12CCCCCGCGCGCGACGTGGGCTNONE 
J075093E08CCCCCGCGCGCGACGTGGGCTNONE 
J075095D04CCCCCGCGCGCGACGTGGGCTNONE 
J075095J10CCCCCGCGCGCGACGTGGGCTNONE 
J075095O19CCCCCGCGCGCGACGTGGGCTNONE 
J075096H20CCCCCGCGCGCGACGTGGGCTNONE 
J075098F10CCCCCGCGCGCGACGTGGGCTNONE 
J075100H10CCCCCGCGCGCGACGTGGGCTNONE 
J075104C23CCCCCGCGCGCGACGTGGGCTNONE 
J075105B10CCCCCGCGCGCGACGTGGGCTNONE 
J075106I24CCCCCGCGCGCGACGTGGGCTNONE 
J075109H23CCCCCGCGCGCGACGTGGGCTNONE 
J075115A03CCCCCGCGCGCGACGTGGGCTNONE 
J075118M06CCCCCGCGCGCGACGTGGGCTNONE 
J075121G08CCCCCGCGCGCGACGTGGGCTNONE 
J075122C09CCCCCGCGCGCGACGTGGGCTNONE 
J075122J12CCCCCGCGCGCGACGTGGGCTNONE 
J075123E06CCCCCGCGCGCGACGTGGGCTNONE 
J075123E16CCCCCGCGCGCGACGTGGGCTNONE 
J075124N09CCCCCGCGCGCGACGTGGGCTNONE 
J075127F23CCCCCGCGCGCGACGTGGGCTNONE 
J075128H17CCCCCGCGCGCGACGTGGGCTNONE 
J075129C02CCCCCGCGCGCGACGTGGGCTNONE 
J075139P18CCCCCGCGCGCGACGTGGGCTNONE 
J075140H17CCCCCGCGCGCGACGTGGGCTNONE 
J075146E12CCCCCGCGCGCGACGTGGGCTNONE 
J075146I07CCCCCGCGCGCGACGTGGGCTNONE 
J075150A08CCCCCGCGCGCGACGTGGGCTNONE 
J075150I22CCCCCGCGCGCGACGTGGGCTNONE 
J075155D01CCCCCGCGCGCGACGTGGGCTNONE 
J075155N10CCCCCGCGCGCGACGTGGGCTNONE 
J075155O09CCCCCGCGCGCGACGTGGGCTNONE 
J075156K11CCCCCGCGCGCGACGTGGGCTNONE 
J075157N01CCCCCGCGCGCGACGTGGGCTNONE 
J075164L09CCCCCGCGCGCGACGTGGGCTNONE 
J075166F14CCCCCGCGCGCGACGTGGGCTNONE 
J075169E20CCCCCGCGCGCGACGTGGGCTNONE 
J075170B13CCCCCGCGCGCGACGTGGGCTNONE 
J075170F24CCCCCGCGCGCGACGTGGGCTNONE 
J075170N16CCCCCGCGCGCGACGTGGGCTNONE 
J075172H22CCCCCGCGCGCGACGTGGGCTNONE 
J075172I02CCCCCGCGCGCGACGTGGGCTNONE 
J075176E08CCCCCGCGCGCGACGTGGGCTNONE 
J075177H17CCCCCGCGCGCGACGTGGGCTNONE 
J075179C18CCCCCGCGCGCGACGTGGGCTNONE 
J075182H23CCCCCGCGCGCGACGTGGGCTNONE 
J075187B10CCCCCGCGCGCGACGTGGGCTNONE 
J075192L10CCCCCGCGCGCGACGTGGGCTNONE 
J075195C04CCCCCGCGCGCGACGTGGGCTNONE 
U25969CCCCCGCGCGCGACGTGGGCTNONE 
Os12g0128700AK072576CGCGCGACSimilar to Arabinoxylan arabinofuranohydrolase isoenzyme AXAH-II. 
J013047N12CGCGCGACNONE 
Os12g0134000AK066940GGTCCACGCGCGACSimilar to Hydroxymethylglutaryl-CoA lyase. 
Os12g0149300AK110842CGCGTCGCGCGCSimilar to Xyloglucan 6-xylosyltransferase (EC 2.4.2.39) (AtXT1). 
Os12g0255866J075127N18CGCGCGACGCGTGGConserved hypothetical protein. 
Os12g0407100J075130F11GCGCGCGACACGTGTCNONE 
J075150G14GCGCGCGACACGTGTCConserved hypothetical protein. 
J090089B20GCGCGCGACACGTGTCNONE 
J100042D22GCGCGCGACACGTGTCNONE 
Os12g0541900AK069047GTCGCGCGRapid ALkalinization Factor family protein. 
AK071210GTCGCGCGNONE 
Os12g0550800006-091-A05TCGCGCGCGACNONE 
AK061828TCGCGCGCGACNONE 
AK098944TCGCGCGCGACNONE 
AK102550TCGCGCGCGACHypothetical protein. 
J013045G24TCGCGCGCGACNONE 
J065156K11TCGCGCGCGACNONE 
J065201E21TCGCGCGCGACNONE 
Os12g0640700AK108649CGCGCGACN/apple PAN domain containing protein. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.