version

Summary of OsREG558 (All List)

OrganismOryza sativa  
IDOsREG558  
SequenceCGCGCGAG  
Annotation  
PPDB MotifACGCGC  CGCG box, stress response?  
PLACE Motif 
Total Entry Count2280  

Entry Sequences (2280 entries)

LocusGene modelSequenceDescription
Os01g0176500AK102552GCGCGCGAGConserved hypothetical protein. 
Os01g0205900006-057-B04CTCGCGCGCGCGCGCGAGNONE 
AK060687CTCGCGCGCGCGCGCGAGNONE 
AK105932CTCGCGCGCGCGCGCGAGSimilar to Class III peroxidase GvPx2b (Fragment). 
J033143I12CTCGCGCGCGCGCGCGAGNONE 
J075013J08CTCGCGCGCGCGCGCGAGNONE 
J075090B11CTCGCGCGCGCGCGCGAGNONE 
J075143C17CTCGCGCGCGCGCGCGAGNONE 
J075147O13CTCGCGCGCGCGCGCGAGNONE 
J075161L02CTCGCGCGCGCGCGCGAGNONE 
Os01g0212700AK108311CTCGCGCGCZinc finger, RING-type domain containing protein. 
Os01g0253500J100088F12CTCGCGCGCConserved hypothetical protein. 
Os01g0279800006-035-E07CTCGCGCGNONE 
AK059775CTCGCGCGNONE 
AK061114CTCGCGCGSimilar to LRR protein. 
Os01g0294700006-057-A09CTCGCGCGNONE 
AK068755CTCGCGCGHaem peroxidase, plant/fungal/bacterial family protein. 
AK104388CTCGCGCGNONE 
AK104781CTCGCGCGNONE 
J013000M08CTCGCGCGNONE 
J013067E04CTCGCGCGNONE 
J013067E05CTCGCGCGNONE 
J013159G18CTCGCGCGNONE 
J065053A05CTCGCGCGNONE 
J065065J01CTCGCGCGNONE 
J065109H12CTCGCGCGNONE 
J065131F05CTCGCGCGNONE 
J075095D14CTCGCGCGNONE 
J075156A05CTCGCGCGNONE 
Os01g0390900009-113-F05CGCGCGAGNONE 
AK103881CGCGCGAGSimilar to Dual-specificity protein phosphatase-like protein. 
J023003K08CGCGCGAGNONE 
J023092K13CGCGCGAGNONE 
J023117N02CGCGCGAGNONE 
J043038C04CGCGCGAGNONE 
Os01g0508300AK101435CGCGCGAGNONE 
AK111287CGCGCGAGConserved hypothetical protein. 
J065096N08CGCGCGAGNONE 
J075003F13CGCGCGAGNONE 
J075014I16CGCGCGAGNONE 
J075022D23CGCGCGAGNONE 
J075040N19CGCGCGAGNONE 
J075121O06CGCGCGAGNONE 
J075131E17CGCGCGAGNONE 
J075136N22CGCGCGAGNONE 
J075147D01CGCGCGAGNONE 
J075173C07CGCGCGAGNONE 
J075196L22CGCGCGAGNONE 
Os01g0513400AK069619CTCGCGCGProtein of unknown function DUF789 family protein. 
Os01g0533900AK101194CTCGCGCGSimilar to Multidrug resistance protein 1 homolog. 
Os01g0594900AK070921CGCGCGAGConserved hypothetical protein. 
AK070921CTCGCGCGCConserved hypothetical protein. 
J023074J04CGCGCGAGNONE 
J023074J04CTCGCGCGCNONE 
J023078B04CGCGCGAGNONE 
J023078B04CTCGCGCGCNONE 
J023078N11CGCGCGAGNONE 
J023078N11CTCGCGCGCNONE 
J075143E19CGCGCGAGNONE 
J075143E19CTCGCGCGCNONE 
J075187L10CGCGCGAGNONE 
J075187L10CTCGCGCGCNONE 
J080010N23CGCGCGAGNONE 
J080010N23CTCGCGCGCNONE 
J080013C01CGCGCGAGNONE 
J080013C01CTCGCGCGCNONE 
J080013G03CGCGCGAGNONE 
J080013G03CTCGCGCGCNONE 
J080016I23CGCGCGAGNONE 
J080016I23CTCGCGCGCNONE 
J080017E01CGCGCGAGNONE 
J080017E01CTCGCGCGCNONE 
J080029E18CGCGCGAGNONE 
J080029E18CTCGCGCGCNONE 
J080034L24CGCGCGAGNONE 
J080034L24CTCGCGCGCNONE 
J080039N12CGCGCGAGNONE 
J080039N12CTCGCGCGCNONE 
J080067L11CGCGCGAGNONE 
J080067L11CTCGCGCGCNONE 
J080068N08CGCGCGAGNONE 
J080068N08CTCGCGCGCNONE 
J080069E19CGCGCGAGNONE 
J080069E19CTCGCGCGCNONE 
J080071E16CGCGCGAGNONE 
J080071E16CTCGCGCGCNONE 
J080077J09CGCGCGAGNONE 
J080077J09CTCGCGCGCNONE 
J080085E03CGCGCGAGNONE 
J080085E03CTCGCGCGCNONE 
J080301J09CGCGCGAGNONE 
J080301J09CTCGCGCGCNONE 
J080303L19CGCGCGAGNONE 
J080303L19CTCGCGCGCNONE 
J080308B12CGCGCGAGNONE 
J080308B12CTCGCGCGCNONE 
Os01g0663400AK072645CTCGCGCGNONE 
J090023O22CTCGCGCGNONE 
J090054G09CTCGCGCGNONE 
J090058H13CTCGCGCGNONE 
J090076G13CTCGCGCGNONE 
Os01g0670800AK103776CTCGCGCGAGNONE 
J033143P19CTCGCGCGAGNONE 
Os01g0716200AK062106CTCGCGCGCIQ calmodulin-binding region domain containing protein. 
AK098920CTCGCGCGCNONE 
AK120664CTCGCGCGCNONE 
J013002N06CTCGCGCGCNONE 
J013050O19CTCGCGCGCNONE 
J013074N19CTCGCGCGCNONE 
J013098J01CTCGCGCGCNONE 
J013127F17CTCGCGCGCNONE 
J013155C17CTCGCGCGCNONE 
J013158K07CTCGCGCGCNONE 
J013159J10CTCGCGCGCNONE 
J053086D01CTCGCGCGCNONE 
Os01g0736000AK108695CGCGCGAGHMG-I and HMG-Y, DNA-binding domain containing protein. 
Os01g0737100AK108262CTCGCGCGCConserved hypothetical protein. 
Os01g0741900014-012-B05CTCGCGCGNONE 
AK068600CTCGCGCGSimilar to Auxin-responsive protein IAA26 (Indoleacetic acid-induced protein 26) (Phytochrome-associated protein 1). 
J013035G23CTCGCGCGNONE 
J013154A18CTCGCGCGNONE 
J033092G10CTCGCGCGNONE 
J043020A20CTCGCGCGNONE 
J100041K22CTCGCGCGNONE 
J100066E16CTCGCGCGNONE 
J100081J06CTCGCGCGNONE 
Os01g0756300014-074-B05CTCGCGCGNONE 
AK069648CTCGCGCGConserved hypothetical protein. 
Os01g0757200AB092485GCGCGCGAGNONE 
AK060666GCGCGCGAGNONE 
AK060714GCGCGCGAGNONE 
AK099350GCGCGCGAGNONE 
AK101713GCGCGCGAGSimilar to GA 2-oxidase 4. 
Os01g0764000006-021-G03ACCCGCGCGAGNONE 
006-025-C07ACCCGCGCGAGNONE 
006-029-G11ACCCGCGCGAGNONE 
006-030-C04ACCCGCGCGAGNONE 
006-035-E05ACCCGCGCGAGNONE 
006-037-G01ACCCGCGCGAGNONE 
006-038-C01ACCCGCGCGAGNONE 
006-039-G05ACCCGCGCGAGNONE 
006-042-E11ACCCGCGCGAGNONE 
006-044-H04ACCCGCGCGAGNONE 
006-045-A10ACCCGCGCGAGNONE 
006-045-C05ACCCGCGCGAGNONE 
006-047-A11ACCCGCGCGAGNONE 
006-048-H10ACCCGCGCGAGNONE 
006-050-C01ACCCGCGCGAGNONE 
006-050-H11ACCCGCGCGAGNONE 
006-051-G10ACCCGCGCGAGNONE 
006-051-G11ACCCGCGCGAGNONE 
006-056-B04ACCCGCGCGAGNONE 
006-063-F04ACCCGCGCGAGNONE 
006-063-H12ACCCGCGCGAGNONE 
006-065-G09ACCCGCGCGAGNONE 
006-067-F11ACCCGCGCGAGNONE 
006-073-D10ACCCGCGCGAGNONE 
006-074-G09ACCCGCGCGAGNONE 
006-075-D04ACCCGCGCGAGNONE 
006-077-C10ACCCGCGCGAGNONE 
006-082-A10ACCCGCGCGAGNONE 
006-084-C12ACCCGCGCGAGNONE 
006-085-F05ACCCGCGCGAGNONE 
006-087-H12ACCCGCGCGAGNONE 
006-092-E10ACCCGCGCGAGNONE 
006-094-C06ACCCGCGCGAGNONE 
006-096-G11ACCCGCGCGAGNONE 
006-097-H11ACCCGCGCGAGNONE 
006-101-A07ACCCGCGCGAGNONE 
006-101-G08ACCCGCGCGAGNONE 
006-110-E08ACCCGCGCGAGNONE 
006-111-D04ACCCGCGCGAGNONE 
006-116-H04ACCCGCGCGAGNONE 
AK058894ACCCGCGCGAGNONE 
AK059818ACCCGCGCGAGSimilar to Glutathione S-transferase I (EC 2.5.1.18) (GST-I) (GST-29) (GST class- phi). 
AK099142ACCCGCGCGAGNONE 
J013119N15ACCCGCGCGAGNONE 
J013123P15ACCCGCGCGAGNONE 
J023055F24ACCCGCGCGAGNONE 
J023125K17ACCCGCGCGAGNONE 
J053050A20ACCCGCGCGAGNONE 
J053056P10ACCCGCGCGAGNONE 
J053074D19ACCCGCGCGAGNONE 
J053078A14ACCCGCGCGAGNONE 
J053086P10ACCCGCGCGAGNONE 
J053094N23ACCCGCGCGAGNONE 
J053095M23ACCCGCGCGAGNONE 
J065006D02ACCCGCGCGAGNONE 
J065030A17ACCCGCGCGAGNONE 
J065030K04ACCCGCGCGAGNONE 
J065035L12ACCCGCGCGAGNONE 
J065046E12ACCCGCGCGAGNONE 
J065065H19ACCCGCGCGAGNONE 
J065073C01ACCCGCGCGAGNONE 
J065105F01ACCCGCGCGAGNONE 
J065131N16ACCCGCGCGAGNONE 
J065144O13ACCCGCGCGAGNONE 
J065160E12ACCCGCGCGAGNONE 
J065160K02ACCCGCGCGAGNONE 
J065163F09ACCCGCGCGAGNONE 
J065165E18ACCCGCGCGAGNONE 
J065174E04ACCCGCGCGAGNONE 
J065175O08ACCCGCGCGAGNONE 
J065191N24ACCCGCGCGAGNONE 
J065193D19ACCCGCGCGAGNONE 
J065198D04ACCCGCGCGAGNONE 
J065200G09ACCCGCGCGAGNONE 
J075016L06ACCCGCGCGAGNONE 
J075017J11ACCCGCGCGAGNONE 
J075019L08ACCCGCGCGAGNONE 
J075028M08ACCCGCGCGAGNONE 
J075029K05ACCCGCGCGAGNONE 
J075039K04ACCCGCGCGAGNONE 
J075047J22ACCCGCGCGAGNONE 
J075079H13ACCCGCGCGAGNONE 
J075095K14ACCCGCGCGAGNONE 
J075111D21ACCCGCGCGAGNONE 
J075131A19ACCCGCGCGAGNONE 
J075147G20ACCCGCGCGAGNONE 
J075158F11ACCCGCGCGAGNONE 
J075166N10ACCCGCGCGAGNONE 
J075196G09ACCCGCGCGAGNONE 
J075198I24ACCCGCGCGAGNONE 
J090001L08ACCCGCGCGAGNONE 
J090026G07ACCCGCGCGAGNONE 
J090050M15ACCCGCGCGAGNONE 
J090071A01ACCCGCGCGAGNONE 
J090072P16ACCCGCGCGAGNONE 
J090078D22ACCCGCGCGAGNONE 
J090089C18ACCCGCGCGAGNONE 
J100019B07ACCCGCGCGAGNONE 
J100019H15ACCCGCGCGAGNONE 
J100019P09ACCCGCGCGAGNONE 
J100023A16ACCCGCGCGAGNONE 
J100023B09ACCCGCGCGAGNONE 
J100026O18ACCCGCGCGAGNONE 
J100027E09ACCCGCGCGAGNONE 
J100028F22ACCCGCGCGAGNONE 
J100029P05ACCCGCGCGAGNONE 
J100031M19ACCCGCGCGAGNONE 
J100032A11ACCCGCGCGAGNONE 
J100036G19ACCCGCGCGAGNONE 
J100038E22ACCCGCGCGAGNONE 
J100040A12ACCCGCGCGAGNONE 
J100040L02ACCCGCGCGAGNONE 
J100043O13ACCCGCGCGAGNONE 
J100045E20ACCCGCGCGAGNONE 
J100046H18ACCCGCGCGAGNONE 
J100047E08ACCCGCGCGAGNONE 
J100050E08ACCCGCGCGAGNONE 
J100050P14ACCCGCGCGAGNONE 
J100051G10ACCCGCGCGAGNONE 
J100052L12ACCCGCGCGAGNONE 
J100056G24ACCCGCGCGAGNONE 
J100066B15ACCCGCGCGAGNONE 
J100068O15ACCCGCGCGAGNONE 
J100070J16ACCCGCGCGAGNONE 
J100074I22ACCCGCGCGAGNONE 
J100075M12ACCCGCGCGAGNONE 
J100077M09ACCCGCGCGAGNONE 
J100077O14ACCCGCGCGAGNONE 
J100079J08ACCCGCGCGAGNONE 
J100080I16ACCCGCGCGAGNONE 
Os01g0765000AK101905CTCGCGCGCSimilar to Deoxycytidylate deaminase (EC 3.5.4.12) (dCMP deaminase). 
Os01g0772500AK109736CACGTCTCGCGCGGlycosyl transferase, family 14 protein. 
Os01g0778700AK064933CTCGCGCGCConserved hypothetical protein. 
AK064933GCGCGCGAGConserved hypothetical protein. 
Os01g0787000006-035-E12CGCGCGAGNONE 
015-056-B07CGCGCGAGNONE 
AK101743CGCGCGAGSimilar to Peroxidase (EC 1.11.1.7). 
AK109348CGCGCGAGNONE 
J065096L02CGCGCGAGNONE 
J065185H10CGCGCGAGNONE 
J065186E06CGCGCGAGNONE 
J090081I17CGCGCGAGNONE 
Os01g0800300006-097-C12CGCGCGAGNONE 
014-070-C12CGCGCGAGNONE 
AK072549CGCGCGAGNONE 
AK100942CGCGCGAGNONE 
AK100951CGCGCGAGConserved hypothetical protein. 
AK106023CGCGCGAGNONE 
J023138D05CGCGCGAGNONE 
J075097P16CGCGCGAGNONE 
J075099F23CGCGCGAGNONE 
Os01g0800800AK108093CTCGCGCGCConserved hypothetical protein. 
Os01g0805200009-031-F03GCGCGCGAGNONE 
AK066239GCGCGCGAGConserved hypothetical protein. 
AK104864GCGCGCGAGNONE 
J013058M15GCGCGCGAGNONE 
J023013J10GCGCGCGAGNONE 
J053024C05GCGCGCGAGNONE 
J065078N15GCGCGCGAGNONE 
J065206B14GCGCGCGAGNONE 
J075016E22GCGCGCGAGNONE 
J075044O08GCGCGCGAGNONE 
J075157L16GCGCGCGAGNONE 
J080001D07GCGCGCGAGNONE 
J080001I05GCGCGCGAGNONE 
J080003N24GCGCGCGAGNONE 
J080005G15GCGCGCGAGNONE 
J080013I04GCGCGCGAGNONE 
J080018D01GCGCGCGAGNONE 
J080025E19GCGCGCGAGNONE 
J080027H24GCGCGCGAGNONE 
J080029C05GCGCGCGAGNONE 
J080033J18GCGCGCGAGNONE 
J080034N13GCGCGCGAGNONE 
J080037G21GCGCGCGAGNONE 
J080038K05GCGCGCGAGNONE 
J080039I17GCGCGCGAGNONE 
J080047F14GCGCGCGAGNONE 
J080047J22GCGCGCGAGNONE 
J080059A22GCGCGCGAGNONE 
J080062A12GCGCGCGAGNONE 
J080062K14GCGCGCGAGNONE 
J080068E09GCGCGCGAGNONE 
J080072M10GCGCGCGAGNONE 
J080079G07GCGCGCGAGNONE 
J080080F19GCGCGCGAGNONE 
J080081N09GCGCGCGAGNONE 
J080090M11GCGCGCGAGNONE 
J080096B11GCGCGCGAGNONE 
J080097D06GCGCGCGAGNONE 
J080097K16GCGCGCGAGNONE 
Os01g0816100012-082-H02CGCGCGAGNONE 
AB028183CGCGCGAGNONE 
AK073848CGCGCGAGNONE 
AY986504CGCGCGAGSimilar to NAC domain protein. 
J100061B19CGCGCGAGNONE 
Os01g0831300AK109023CTCGCGCGCSimilar to Ammonium transporter. 
Os01g0844900AK066659CTCGCGCGCHomeodomain-like containing protein. 
Os01g0856000016-095-F09CGCGCGAGNONE 
AK107439CGCGCGAGSimilar to CDC6 protein. 
AK107451CGCGCGAGNONE 
Os01g0860601011-099-B05CTCGCGCGCNONE 
013-093-G06CTCGCGCGCNONE 
AK069860CTCGCGCGCSimilar to Ferredoxin, root R-B1. 
J065017K08CTCGCGCGCNONE 
J065020D23CTCGCGCGCNONE 
J065041N15CTCGCGCGCNONE 
J065119F17CTCGCGCGCNONE 
J065169G20CTCGCGCGCNONE 
J065179F21CTCGCGCGCNONE 
J065182L09CTCGCGCGCNONE 
Os01g0872300J065128I03CTCGCGCGACConserved hypothetical protein. 
J100063A13CTCGCGCGACNONE 
Os01g0877400AK106754CTCGCGCGCSimilar to Avr9 elicitor response-like protein. 
Os01g0891400J065077E24CTCGCGCGGCCCGGGConserved hypothetical protein. 
J065206I07CTCGCGCGGCCCGGGNONE 
Os01g0896800AK065268CTCGCGCGACNONE 
AK104693CTCGCGCGACEukaryotic ribosomal protein L5 family protein. 
J013126P09CTCGCGCGACNONE 
J033046N15CTCGCGCGACNONE 
J090008K02CTCGCGCGACNONE 
J090024F15CTCGCGCGACNONE 
J090074I23CTCGCGCGACNONE 
J090093F03CTCGCGCGACNONE 
J090096N02CTCGCGCGACNONE 
Os01g0914300009-174-C06GCGCGCGAGNONE 
014-073-B09GCGCGCGAGNONE 
AK103489GCGCGCGAGNONE 
AK105463GCGCGCGAGPlant lipid transfer/seed storage/trypsin-alpha amylase inhibitor domain containing protein. 
J033076A02GCGCGCGAGNONE 
J033130M24GCGCGCGAGNONE 
Os01g0963300AK067544CTCGCGCGCSimilar to Syntaxin 61 (AtSYP61) (Osmotic stess-sensitive mutant 1). 
Os01g0965500J075073G20CGCGCGAGNuclear protein SET domain containing protein. 
Os01g0974200003-131-G05CTCGCGCGNONE 
009-056-A07CTCGCGCGNONE 
009-084-A06CTCGCGCGNONE 
009-118-C05CTCGCGCGNONE 
009-138-C12CTCGCGCGNONE 
009-163-F05CTCGCGCGNONE 
009-175-F12CTCGCGCGNONE 
009-192-F01CTCGCGCGNONE 
AB002820CTCGCGCGNONE 
AF017365CTCGCGCGNONE 
AK059392CTCGCGCGNONE 
AK062796CTCGCGCGRicMT (Metallothionein-like protein). 
AK104075CTCGCGCGNONE 
J023079A11CTCGCGCGNONE 
J023084P04CTCGCGCGNONE 
J065060A20CTCGCGCGNONE 
J065065L16CTCGCGCGNONE 
J065086F04CTCGCGCGNONE 
J065103H07CTCGCGCGNONE 
J065104O09CTCGCGCGNONE 
J065108C08CTCGCGCGNONE 
J065121B18CTCGCGCGNONE 
J065213D20CTCGCGCGNONE 
J075005A13CTCGCGCGNONE 
J075012P06CTCGCGCGNONE 
J075097C23CTCGCGCGNONE 
J075105E16CTCGCGCGNONE 
J075114O15CTCGCGCGNONE 
J075120G07CTCGCGCGNONE 
J075177K02CTCGCGCGNONE 
J080002D04CTCGCGCGNONE 
J080013A10CTCGCGCGNONE 
J080023H15CTCGCGCGNONE 
J080025I06CTCGCGCGNONE 
J080028G07CTCGCGCGNONE 
J080028P13CTCGCGCGNONE 
J080029E04CTCGCGCGNONE 
J080030B21CTCGCGCGNONE 
J080034N04CTCGCGCGNONE 
J080036A19CTCGCGCGNONE 
J080036F12CTCGCGCGNONE 
J080036P20CTCGCGCGNONE 
J080042M13CTCGCGCGNONE 
J080043N01CTCGCGCGNONE 
J080049M13CTCGCGCGNONE 
J080059A01CTCGCGCGNONE 
J080059I24CTCGCGCGNONE 
J080059J18CTCGCGCGNONE 
J080066D21CTCGCGCGNONE 
J080077B12CTCGCGCGNONE 
J080079I11CTCGCGCGNONE 
J080083M24CTCGCGCGNONE 
J080083P12CTCGCGCGNONE 
J080087D01CTCGCGCGNONE 
J080092I01CTCGCGCGNONE 
J080310J19CTCGCGCGNONE 
J080315B15CTCGCGCGNONE 
J090075D21CTCGCGCGNONE 
J100027F23CTCGCGCGNONE 
J100031B07CTCGCGCGNONE 
J100034A13CTCGCGCGNONE 
J100041O19CTCGCGCGNONE 
J100045A01CTCGCGCGNONE 
J100065I02CTCGCGCGNONE 
J100069G24CTCGCGCGNONE 
J100072E11CTCGCGCGNONE 
J100082O08CTCGCGCGNONE 
Os02g0109200AK108815GCGCGCGAGACGTGNONE 
J100030O18GCGCGCGAGACGTGNONE 
Os02g0121100012-035-F06CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
013-031-H05CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
013-058-E11CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
014-010-D01CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
AK070711CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGConserved hypothetical protein. 
AK119758CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J013033G12CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J023007M16CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J023020K20CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J023061H10CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J033027H20CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J033051E18CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J090005F12CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J090017A20CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J090018G11CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J090062C18CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100027N10CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100032L14CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100045C14CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100061M09CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100062K11CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100064H11CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100074H16CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100082N01CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
Os02g0125300006-047-E06CTCGCGCGTGCGTGGGCCCCACCNONE 
006-088-F09CTCGCGCGTGCGTGGGCCCCACCNONE 
006-106-F10CTCGCGCGTGCGTGGGCCCCACCNONE 
AB025926CTCGCGCGTGCGTGGGCCCCACCNONE 
AK061564CTCGCGCGTGCGTGGGCCCCACCNONE 
AK061953CTCGCGCGTGCGTGGGCCCCACCNONE 
AK101060CTCGCGCGTGCGTGGGCCCCACCBax inhibitor-1 (BI-1) (OsBI-1). 
J013072O21CTCGCGCGTGCGTGGGCCCCACCNONE 
J023097A08CTCGCGCGTGCGTGGGCCCCACCNONE 
J023133F03CTCGCGCGTGCGTGGGCCCCACCNONE 
J033022C21CTCGCGCGTGCGTGGGCCCCACCNONE 
J033073C21CTCGCGCGTGCGTGGGCCCCACCNONE 
J033116O09CTCGCGCGTGCGTGGGCCCCACCNONE 
J033120E01CTCGCGCGTGCGTGGGCCCCACCNONE 
J065088M19CTCGCGCGTGCGTGGGCCCCACCNONE 
J065135O04CTCGCGCGTGCGTGGGCCCCACCNONE 
J080304J03CTCGCGCGTGCGTGGGCCCCACCNONE 
J090001K14CTCGCGCGTGCGTGGGCCCCACCNONE 
J090038D04CTCGCGCGTGCGTGGGCCCCACCNONE 
J090045G09CTCGCGCGTGCGTGGGCCCCACCNONE 
J090076E12CTCGCGCGTGCGTGGGCCCCACCNONE 
J090077D21CTCGCGCGTGCGTGGGCCCCACCNONE 
J100018J19CTCGCGCGTGCGTGGGCCCCACCNONE 
J100029M12CTCGCGCGTGCGTGGGCCCCACCNONE 
J100049D07CTCGCGCGTGCGTGGGCCCCACCNONE 
J100067G21CTCGCGCGTGCGTGGGCCCCACCNONE 
J100090D05CTCGCGCGTGCGTGGGCCCCACCNONE 
Os02g0175700AK069542CTCGCGCGCEpsin, N-terminal domain containing protein. 
J023075D24CTCGCGCGCNONE 
J023105C16CTCGCGCGCNONE 
J023140A10CTCGCGCGCNONE 
J023150G13CTCGCGCGCNONE 
Os02g0189900012-074-E11CTCGCGCGCNONE 
AK063528CTCGCGCGCHepatocellular carcinoma-associated antigen 59 family protein. 
Os02g0220600AK103901CTCGCGCGNONE 
J013058O03CTCGCGCGNONE 
J013124E21CTCGCGCGNONE 
J023023L03CTCGCGCGNONE 
J023023L21CTCGCGCGNONE 
J023061N01CTCGCGCGNONE 
J023065O09CTCGCGCGNONE 
J023106J17CTCGCGCGNONE 
J023119N08CTCGCGCGNONE 
J033058A19CTCGCGCGNONE 
J033098O13CTCGCGCGNONE 
J033100M18CTCGCGCGNONE 
J033125A21CTCGCGCGNONE 
J033148C12CTCGCGCGNONE 
J043017F03CTCGCGCGNONE 
J043032J02CTCGCGCGNONE 
J053047N10CTCGCGCGNONE 
J053089P04CTCGCGCGNONE 
J065051K09CTCGCGCGNONE 
J065064H24CTCGCGCGNONE 
J090001L06CTCGCGCGNONE 
J090017C24CTCGCGCGNONE 
J090058G15CTCGCGCGNONE 
J090058H23CTCGCGCGNONE 
J090061G20CTCGCGCGNONE 
J090069N23CTCGCGCGNONE 
J090071A08CTCGCGCGNONE 
J090074A08CTCGCGCGNONE 
J090077B15CTCGCGCGNONE 
J090081K06CTCGCGCGNONE 
J090083I05CTCGCGCGNONE 
J090091O22CTCGCGCGNONE 
J090097L10CTCGCGCGNONE 
J100026B11CTCGCGCGNONE 
J100044M01CTCGCGCGNONE 
J100046F10CTCGCGCGNONE 
J100051K14CTCGCGCGNONE 
J100060D22CTCGCGCGNONE 
J100060H18CTCGCGCGNONE 
J100070I06CTCGCGCGNONE 
J100071C04CTCGCGCGNONE 
J100078M13CTCGCGCGNONE 
J100080E17CTCGCGCGNONE 
J100083I09CTCGCGCGNONE 
Os02g0317300AK071724CGCGCGAGCyclin-like F-box domain containing protein. 
J023114H08CGCGCGAGNONE 
J075025F14CGCGCGAGNONE 
J075031B10CGCGCGAGNONE 
J075094J21CGCGCGAGNONE 
J075138B09CGCGCGAGNONE 
J075145F04CGCGCGAGNONE 
J100046G09CGCGCGAGNONE 
J100056O03CGCGCGAGNONE 
Os02g0321900AK058256CTCGCGCGNONE 
AK062103CTCGCGCGSimilar to 60S ribosomal protein L10a-1. 
AK102574CTCGCGCGNONE 
J065176M06CTCGCGCGNONE 
J075112D24CTCGCGCGNONE 
Os02g0332700009-144-D04CTCGCGCGNONE 
AK062975CTCGCGCGConserved hypothetical protein. 
Os02g0445600009-183-B02CTCGCGCGCGACNONE 
AK063150CTCGCGCGCGACSimilar to Auxin-induced SAUR-like protein (Fragment). 
Os02g0462800AK110587CGCGCGAGWRKY transcription factor 42 (Transcription factor WRKY02). 
AY676923CGCGCGAGNONE 
Os02g0465400AK100199CCGATCCGCGCGAGSimilar to 7-dehydrocholesterol reductase (EC 1.3.1.21) (7-DHC reductase) (Sterol delta-7-reductase) (Dwarf5 protein). 
J090036B02CCGATCCGCGCGAGNONE 
Os02g0518000AK068281CTCGCGCGC2 calcium/lipid-binding region, CaLB domain containing protein. 
AK068281GCGCGCGAGC2 calcium/lipid-binding region, CaLB domain containing protein. 
J013146J12CTCGCGCGNONE 
J013146J12GCGCGCGAGNONE 
J013155G12CTCGCGCGNONE 
J013155G12GCGCGCGAGNONE 
J065141K03CTCGCGCGNONE 
J065141K03GCGCGCGAGNONE 
J065162I12CTCGCGCGNONE 
J065162I12GCGCGCGAGNONE 
J065166C16CTCGCGCGNONE 
J065166C16GCGCGCGAGNONE 
J065171I12CTCGCGCGNONE 
J065171I12GCGCGCGAGNONE 
Os02g0595800Os02g0595800CGCGCGAGSimilar to Eukaryotic initiation factor 4B (Fragment). 
Os02g0610500AK058536CGCGCGAGACGCGSimilar to CONSTANS-like protein CO9 (Fragment). 
AK058536CTCGCGCGCGCGTCTCSimilar to CONSTANS-like protein CO9 (Fragment). 
AK100097CGCGCGAGACGCGNONE 
AK100097CTCGCGCGCGCGTCTCNONE 
J090016D17CGCGCGAGACGCGNONE 
J090016D17CTCGCGCGCGCGTCTCNONE 
J090077O10CGCGCGAGACGCGNONE 
J090077O10CTCGCGCGCGCGTCTCNONE 
J090097J09CGCGCGAGACGCGNONE 
J090097J09CTCGCGCGCGCGTCTCNONE 
J100054K15CGCGCGAGACGCGNONE 
J100054K15CTCGCGCGCGCGTCTCNONE 
J100066N13CGCGCGAGACGCGNONE 
J100066N13CTCGCGCGCGCGTCTCNONE 
J100072H14CGCGCGAGACGCGNONE 
J100072H14CTCGCGCGCGCGTCTCNONE 
Os02g0640000AK120841GCGCGCGAGC2 calcium/lipid-binding region, CaLB domain containing protein. 
J023022G19GCGCGCGAGNONE 
J023081F22GCGCGCGAGNONE 
Os02g0643200AK106784CTCGCGCGCYABBY protein family protein. 
J075048L13CTCGCGCGCNONE 
Os02g0643500AK068423TCGCGCGCGAGPentapeptide repeat containing protein. 
Os02g0670000AK073148CTCGCGCGProtein of unknown function DUF300 family protein. 
Os02g0679700AK108178GCGCGCGAGProtein of unknown function DUF623, plant domain containing protein. 
J075112F23GCGCGCGAGNONE 
Os02g0686300AK066567CGCGCGAGTGACACConserved hypothetical protein. 
Os02g0694100J090034G11CTCGCGCGCyclin-like F-box domain containing protein. 
Os02g0709200AK058999GCGCGCGAGSimilar to Histidinol-phosphate aminotransferase, chloroplast precursor (EC 2.6.1.9) (Imidazole acetol-phosphate transaminase). 
AK099074GCGCGCGAGNONE 
Os02g0711300AK107963CTCGCGCGCHSP20-like chaperone domain containing protein. 
Os02g0723200AK108140CGCGCGAGSimilar to Alpha galactosyltransferase (Fragment). 
J090087D22CGCGCGAGNONE 
Os02g0744900AK061968CTCGCGCGSimilar to Geranylgeranyl reductase (Fragment). 
AK098873CTCGCGCGNONE 
J013001C18CTCGCGCGNONE 
J080003D07CTCGCGCGNONE 
J080003H24CTCGCGCGNONE 
J080010C23CTCGCGCGNONE 
J080011I04CTCGCGCGNONE 
J080011O03CTCGCGCGNONE 
J080012F13CTCGCGCGNONE 
J080020E06CTCGCGCGNONE 
J080025H22CTCGCGCGNONE 
J080026D15CTCGCGCGNONE 
J080028D20CTCGCGCGNONE 
J080029P20CTCGCGCGNONE 
J080031K22CTCGCGCGNONE 
J080034I05CTCGCGCGNONE 
J080036E11CTCGCGCGNONE 
J080036H13CTCGCGCGNONE 
J080037E17CTCGCGCGNONE 
J080043N05CTCGCGCGNONE 
J080044L23CTCGCGCGNONE 
J080047N11CTCGCGCGNONE 
J080048O04CTCGCGCGNONE 
J080049M01CTCGCGCGNONE 
J080050F21CTCGCGCGNONE 
J080054F09CTCGCGCGNONE 
J080055N20CTCGCGCGNONE 
J080058C02CTCGCGCGNONE 
J080058K15CTCGCGCGNONE 
J080062G02CTCGCGCGNONE 
J080066H16CTCGCGCGNONE 
J080066O05CTCGCGCGNONE 
J080067O16CTCGCGCGNONE 
J080068E13CTCGCGCGNONE 
J080069P16CTCGCGCGNONE 
J080072M11CTCGCGCGNONE 
J080076H09CTCGCGCGNONE 
J080081G24CTCGCGCGNONE 
J080082J05CTCGCGCGNONE 
J080084I10CTCGCGCGNONE 
J080087L24CTCGCGCGNONE 
J080089H07CTCGCGCGNONE 
J080089M05CTCGCGCGNONE 
J080092G18CTCGCGCGNONE 
J080095N08CTCGCGCGNONE 
Os02g0753000AK121015CTCGCGCGGGTSimilar to Trehalose-6-phosphate phosphatase. 
Os02g0756200AK063454CTCGCGCGCNONE 
AK101655CTCGCGCGCSimilar to Phi-1 protein. 
J065104L21CTCGCGCGCNONE 
J065141A07CTCGCGCGCNONE 
Os02g0758200AK111266GCGCGCGAGCCCAACCConserved hypothetical protein. 
Os02g0771100AB040053GCGCGCGAGNONE 
AK102740GCGCGCGAGSimilar to COP1 (Fragment). 
AK111614GCGCGCGAGNONE 
AK112098GCGCGCGAGNONE 
J033106E23GCGCGCGAGNONE 
Os02g0816100AK058331CGCGCGAGHAD-superfamily hydrolase, subfamily IA, variant 2 protein. 
AK060021CGCGCGAGNONE 
J065132K03CGCGCGAGNONE 
Os03g0132900006-025-D05CTCGCGCGNONE 
006-080-C01CTCGCGCGNONE 
AF001501CTCGCGCGNONE 
AK059871CTCGCGCGNONE 
AK099355CTCGCGCGSimilar to Chitinase (EC 3.2.1.14) (Fragment). 
J033022O03CTCGCGCGNONE 
J033044P19CTCGCGCGNONE 
J033119B12CTCGCGCGNONE 
J075009H20CTCGCGCGNONE 
J075122E04CTCGCGCGNONE 
J075161D07CTCGCGCGNONE 
Os03g0133100013-080-E12CTCGCGCGCNONE 
AK063608CTCGCGCGCHypothetical protein. 
AK119680CTCGCGCGCNONE 
J075192B05CTCGCGCGCNONE 
Os03g0135700AK060029CTCGCGCGGCCCACCNONE 
AK103779CTCGCGCGGCCCACCSimilar to Transcriptional activator Rb homolog (Fragment). 
J033145C17CTCGCGCGGCCCACCNONE 
J043021B17CTCGCGCGGCCCACCNONE 
Os03g0157400AK066035CTCGCGCGGGTABC transporter related domain containing protein. 
Os03g0180800AK070649CTCGCGCGCZIM domain containing protein. 
AK070649CTCGCGCGCZIM domain containing protein. 
J065121B15CTCGCGCGCNONE 
J065121B15CTCGCGCGCNONE 
J075067G15CTCGCGCGCNONE 
J075067G15CTCGCGCGCNONE 
Os03g0184100AK067400GCGCGCGAGHypothetical protein. 
J013030J24GCGCGCGAGNONE 
J013037M23GCGCGCGAGNONE 
J013106B15GCGCGCGAGNONE 
J013130H10GCGCGCGAGNONE 
J013152B03GCGCGCGAGNONE 
J013157J24GCGCGCGAGNONE 
J013157K04GCGCGCGAGNONE 
J033093A19GCGCGCGAGNONE 
J033106E24GCGCGCGAGNONE 
J090043G12GCGCGCGAGNONE 
Os03g0188400AK107555CCTCGCCCCTCGCGCGBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
AK107555TCTCGGCCACACACCTCGCGCGBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
Os03g0194900006-038-B11CGCGCGAGNONE 
006-048-H09CGCGCGAGNONE 
009-141-E07CGCGCGAGNONE 
013-006-A05CGCGCGAGNONE 
013-073-G09CGCGCGAGNONE 
013-093-E05CGCGCGAGNONE 
AK061389CGCGCGAGNONE 
AK070149CGCGCGAGDOMON related domain containing protein. 
AK104041CGCGCGAGNONE 
AK104413CGCGCGAGNONE 
J013134O16CGCGCGAGNONE 
J023042P18CGCGCGAGNONE 
J023077M08CGCGCGAGNONE 
J033068I01CGCGCGAGNONE 
J053023E18CGCGCGAGNONE 
J053026N22CGCGCGAGNONE 
J053043H12CGCGCGAGNONE 
J053064P12CGCGCGAGNONE 
J053068B02CGCGCGAGNONE 
J053069A07CGCGCGAGNONE 
J053070F13CGCGCGAGNONE 
J053094H07CGCGCGAGNONE 
J065061I03CGCGCGAGNONE 
J065115D02CGCGCGAGNONE 
J065163K24CGCGCGAGNONE 
J065195M16CGCGCGAGNONE 
J065219A21CGCGCGAGNONE 
J075046I11CGCGCGAGNONE 
J075097H16CGCGCGAGNONE 
J075128N20CGCGCGAGNONE 
J075139O20CGCGCGAGNONE 
J075168H20CGCGCGAGNONE 
J075170E15CGCGCGAGNONE 
J075191C04CGCGCGAGNONE 
J075192P06CGCGCGAGNONE 
J100027K07CGCGCGAGNONE 
J100027P03CGCGCGAGNONE 
J100033P16CGCGCGAGNONE 
J100050M24CGCGCGAGNONE 
J100072D05CGCGCGAGNONE 
Os03g0210600AK070125CTCGCGCGConserved hypothetical protein. 
Os03g0214200AK100623GCGCGCGAGProtein of unknown function DUF1675 family protein. 
J075053B18GCGCGCGAGNONE 
Os03g0215700AK099772CTCGCGCGCMyosin II heavy chain-like family protein. 
Os03g0227800J013091I04CTCGCGCGNONE 
J080305J16CTCGCGCGNONE 
Os03g0249800009-063-F07CGCGCGAGNONE 
009-063-F07GCGCGCGAGNONE 
009-135-C05CGCGCGAGNONE 
009-135-C05GCGCGCGAGNONE 
AK120462CGCGCGAGHypothetical protein. 
AK120462GCGCGCGAGHypothetical protein. 
AK121219CGCGCGAGNONE 
AK121219GCGCGCGAGNONE 
J023090G01CGCGCGAGNONE 
J023090G01GCGCGCGAGNONE 
J100045O11CGCGCGAGNONE 
J100045O11GCGCGCGAGNONE 
Os03g0252100J065002C04CGCGCGAGNONE 
J065061I07CGCGCGAGNONE 
J065065G09CGCGCGAGNONE 
J065073F02CGCGCGAGNONE 
J065073H04CGCGCGAGEsterase/lipase/thioesterase domain containing protein. 
J065122K22CGCGCGAGNONE 
J065132J11CGCGCGAGNONE 
J065162B03CGCGCGAGNONE 
J065187P08CGCGCGAGNONE 
J075023G18CGCGCGAGNONE 
J075173H13CGCGCGAGNONE 
J090025K19CGCGCGAGNONE 
Os03g0259700015-018-F05CTCGCGCGProtein of unknown function DUF1630 family protein. 
J065023N06CTCGCGCGNONE 
J065121K01CTCGCGCGNONE 
J075142D15CTCGCGCGNONE 
J100029H23CTCGCGCGNONE 
Os03g0277000AK100522GCGCGCGAGSimilar to GDP dissociation inhibitor protein OsGDI1. 
Os03g0284500012-066-D02CCCCCGCGCGAGNONE 
012-066-D02CGGGCCCCTCGCGCGNONE 
AK105295CCCCCGCGCGAGNONE 
AK105295CGGGCCCCTCGCGCGNONE 
AK121300CCCCCGCGCGAGHAD-superfamily subfamily IIA hydrolase, CECR5 protein. 
AK121300CGGGCCCCTCGCGCGHAD-superfamily subfamily IIA hydrolase, CECR5 protein. 
Os03g0284600AK110712CTCGCGCGGGGGThioredoxin fold domain containing protein. 
Os03g0300200AK102070CTCGCGCGCSimilar to Ubiquitin-specific protease 16. 
Os03g0308100AB116073GCGCGCGAGPeptidase S14, ClpP family protein. 
AK060518GCGCGCGAGNONE 
AK099107GCGCGCGAGNONE 
AK105977GCGCGCGAGNONE 
J065005O19GCGCGCGAGNONE 
J065007L02GCGCGCGAGNONE 
J065128G15GCGCGCGAGNONE 
J065128N14GCGCGCGAGNONE 
J075010E21GCGCGCGAGNONE 
J075101J24GCGCGCGAGNONE 
J075124O14GCGCGCGAGNONE 
J075126O07GCGCGCGAGNONE 
Os03g0318400015-094-B06GCGCGCGAGNONE 
AK106440GCGCGCGAGPeptidase A1, pepsin family protein. 
J100029O07GCGCGCGAGNONE 
Os03g0336100AK105307CTCGCGCG11-S plant seed storage protein family protein. 
Os03g0567100AK109220CTCGCGCGCCGCGTGGGCTGTATGGGCCAGConserved hypothetical protein. 
Os03g0576900AK064861CCCCCGCGCGCGAGNONE 
J013000I01CCCCCGCGCGCGAGNONE 
J013169P21CCCCCGCGCGCGAGNONE 
J023001P03CCCCCGCGCGCGAGNONE 
J023009M10CCCCCGCGCGCGAGNONE 
J023025G11CCCCCGCGCGCGAGNONE 
J033046B19CCCCCGCGCGCGAGNONE 
J033149I10CCCCCGCGCGCGAGNONE 
J090081C04CCCCCGCGCGCGAGNONE 
Os03g0646300AK069229CTCGCGCGCSimilar to Cyclic nucleotide-gated channel A (Fragment). 
Os03g0668000AK111705CGCGCGAGNONE 
AK111783CGCGCGAGCyclin-like F-box domain containing protein. 
J023087J12CGCGCGAGNONE 
Os03g0670700009-028-B03CTCGCGCGNONE 
009-036-H12CTCGCGCGNONE 
009-053-H05CTCGCGCGNONE 
009-126-B02CTCGCGCGNONE 
009-135-D07CTCGCGCGNONE 
009-148-A03CTCGCGCGNONE 
009-148-A12CTCGCGCGNONE 
009-152-B02CTCGCGCGNONE 
009-153-B06CTCGCGCGNONE 
009-166-G05CTCGCGCGNONE 
009-181-A09CTCGCGCGNONE 
011-061-D07CTCGCGCGNONE 
012-043-C04CTCGCGCGNONE 
013-001-A02CTCGCGCGNONE 
013-004-F05CTCGCGCGNONE 
013-008-C08CTCGCGCGNONE 
013-015-B09CTCGCGCGNONE 
013-016-G05CTCGCGCGNONE 
013-023-A06CTCGCGCGNONE 
013-023-B06CTCGCGCGNONE 
013-032-F09CTCGCGCGNONE 
013-059-C07CTCGCGCGNONE 
013-071-E09CTCGCGCGNONE 
013-073-D06CTCGCGCGNONE 
013-077-C02CTCGCGCGNONE 
013-078-B12CTCGCGCGNONE 
013-093-A01CTCGCGCGNONE 
014-002-B12CTCGCGCGNONE 
014-003-E08CTCGCGCGNONE 
014-004-D06CTCGCGCGNONE 
014-007-C11CTCGCGCGNONE 
014-007-G10CTCGCGCGNONE 
014-019-C04CTCGCGCGNONE 
014-021-F05CTCGCGCGNONE 
014-024-G06CTCGCGCGNONE 
014-027-C07CTCGCGCGNONE 
014-027-D03CTCGCGCGNONE 
014-029-E07CTCGCGCGNONE 
014-031-B04CTCGCGCGNONE 
014-033-B05CTCGCGCGNONE 
014-033-C03CTCGCGCGNONE 
014-033-C12CTCGCGCGNONE 
014-036-F01CTCGCGCGNONE 
014-037-C04CTCGCGCGNONE 
014-040-H02CTCGCGCGNONE 
014-045-H04CTCGCGCGNONE 
014-045-H06CTCGCGCGNONE 
014-052-A08CTCGCGCGNONE 
014-076-G01CTCGCGCGNONE 
014-083-F04CTCGCGCGNONE 
014-086-E01CTCGCGCGNONE 
014-091-D02CTCGCGCGNONE 
014-091-F05CTCGCGCGNONE 
014-093-E10CTCGCGCGNONE 
014-100-C10CTCGCGCGNONE 
015-011-H02CTCGCGCGNONE 
015-073-B03CTCGCGCGNONE 
AF010579CTCGCGCGNONE 
AK059164CTCGCGCGSimilar to Glycine-rich RNA-binding, abscisic acid-inducible protein. 
AK070016CTCGCGCGNONE 
AK119238CTCGCGCGNONE 
AK119242CTCGCGCGNONE 
J023037K17CTCGCGCGNONE 
J033136F11CTCGCGCGNONE 
J065008C13CTCGCGCGNONE 
J065032K18CTCGCGCGNONE 
J065043N10CTCGCGCGNONE 
J065045E06CTCGCGCGNONE 
J065046P21CTCGCGCGNONE 
J065048J17CTCGCGCGNONE 
J065053I23CTCGCGCGNONE 
J065053P03CTCGCGCGNONE 
J065054C13CTCGCGCGNONE 
J065058I17CTCGCGCGNONE 
J065061I12CTCGCGCGNONE 
J065062E09CTCGCGCGNONE 
J065063P04CTCGCGCGNONE 
J065068J07CTCGCGCGNONE 
J065076D02CTCGCGCGNONE 
J065083O07CTCGCGCGNONE 
J065090J02CTCGCGCGNONE 
J065093N08CTCGCGCGNONE 
J065097F02CTCGCGCGNONE 
J065112H17CTCGCGCGNONE 
J065121B01CTCGCGCGNONE 
J065124F12CTCGCGCGNONE 
J065130L03CTCGCGCGNONE 
J065131K05CTCGCGCGNONE 
J065132C06CTCGCGCGNONE 
J065135J18CTCGCGCGNONE 
J065138J22CTCGCGCGNONE 
J065140G21CTCGCGCGNONE 
J065161B19CTCGCGCGNONE 
J065162F22CTCGCGCGNONE 
J065162M09CTCGCGCGNONE 
J065163D03CTCGCGCGNONE 
J065163O21CTCGCGCGNONE 
J065165H11CTCGCGCGNONE 
J065165O16CTCGCGCGNONE 
J065167N06CTCGCGCGNONE 
J065168I08CTCGCGCGNONE 
J065170A14CTCGCGCGNONE 
J065170L03CTCGCGCGNONE 
J065171C08CTCGCGCGNONE 
J065173G11CTCGCGCGNONE 
J065173M09CTCGCGCGNONE 
J065176P07CTCGCGCGNONE 
J065178K24CTCGCGCGNONE 
J065185O12CTCGCGCGNONE 
J065191E02CTCGCGCGNONE 
J065204H10CTCGCGCGNONE 
J075033C23CTCGCGCGNONE 
J075041M21CTCGCGCGNONE 
J075043F13CTCGCGCGNONE 
J075044D02CTCGCGCGNONE 
J075044J15CTCGCGCGNONE 
J075048L07CTCGCGCGNONE 
J075054G12CTCGCGCGNONE 
J075055J10CTCGCGCGNONE 
J075059F09CTCGCGCGNONE 
J075066M23CTCGCGCGNONE 
J075071O09CTCGCGCGNONE 
J075085G23CTCGCGCGNONE 
J075086B21CTCGCGCGNONE 
J075087L18CTCGCGCGNONE 
J075087L21CTCGCGCGNONE 
J075087N14CTCGCGCGNONE 
J075088O13CTCGCGCGNONE 
J075089B06CTCGCGCGNONE 
J075089E20CTCGCGCGNONE 
J075090J01CTCGCGCGNONE 
J075090L05CTCGCGCGNONE 
J075091G05CTCGCGCGNONE 
J075091N06CTCGCGCGNONE 
J075093G08CTCGCGCGNONE 
J075094C13CTCGCGCGNONE 
J075095K01CTCGCGCGNONE 
J075096C02CTCGCGCGNONE 
J075097L16CTCGCGCGNONE 
J075097O10CTCGCGCGNONE 
J075098H24CTCGCGCGNONE 
J075099H02CTCGCGCGNONE 
J075099J11CTCGCGCGNONE 
J075099L08CTCGCGCGNONE 
J075109I11CTCGCGCGNONE 
J075114F03CTCGCGCGNONE 
J075121G07CTCGCGCGNONE 
J075122D23CTCGCGCGNONE 
J075132O07CTCGCGCGNONE 
J075141L21CTCGCGCGNONE 
J075142I08CTCGCGCGNONE 
J075145A06CTCGCGCGNONE 
J075147J15CTCGCGCGNONE 
J075150B09CTCGCGCGNONE 
J075151E07CTCGCGCGNONE 
J075161M16CTCGCGCGNONE 
J075190I16CTCGCGCGNONE 
J075192L05CTCGCGCGNONE 
J075192O03CTCGCGCGNONE 
J075192O08CTCGCGCGNONE 
J075193L12CTCGCGCGNONE 
J080001M24CTCGCGCGNONE 
J080004E20CTCGCGCGNONE 
J080005K15CTCGCGCGNONE 
J080005L05CTCGCGCGNONE 
J080014P20CTCGCGCGNONE 
J080029D12CTCGCGCGNONE 
J080030H09CTCGCGCGNONE 
J080039G05CTCGCGCGNONE 
J080040E18CTCGCGCGNONE 
J080041B02CTCGCGCGNONE 
J080041E06CTCGCGCGNONE 
J080041G05CTCGCGCGNONE 
J080041G24CTCGCGCGNONE 
J080041H07CTCGCGCGNONE 
J080041K03CTCGCGCGNONE 
J080047G01CTCGCGCGNONE 
J080052E07CTCGCGCGNONE 
J080053B15CTCGCGCGNONE 
J080053N01CTCGCGCGNONE 
J080054I01CTCGCGCGNONE 
J080054N02CTCGCGCGNONE 
J080063P03CTCGCGCGNONE 
J080064E13CTCGCGCGNONE 
J080064G13CTCGCGCGNONE 
J080065F02CTCGCGCGNONE 
J080065G03CTCGCGCGNONE 
J080065K17CTCGCGCGNONE 
J080067D06CTCGCGCGNONE 
J080067H23CTCGCGCGNONE 
J080067M15CTCGCGCGNONE 
J080068B20CTCGCGCGNONE 
J080068G24CTCGCGCGNONE 
J080072K19CTCGCGCGNONE 
J080076I24CTCGCGCGNONE 
J080092F05CTCGCGCGNONE 
J080092K14CTCGCGCGNONE 
J080092N22CTCGCGCGNONE 
J080093K02CTCGCGCGNONE 
J080094C08CTCGCGCGNONE 
J080094E09CTCGCGCGNONE 
J080094E20CTCGCGCGNONE 
J080094G08CTCGCGCGNONE 
J080094H18CTCGCGCGNONE 
J080094P22CTCGCGCGNONE 
J080095J23CTCGCGCGNONE 
J080096F14CTCGCGCGNONE 
J080097A21CTCGCGCGNONE 
J080097I07CTCGCGCGNONE 
J080097J02CTCGCGCGNONE 
J080097K01CTCGCGCGNONE 
J080097K03CTCGCGCGNONE 
J080305H18CTCGCGCGNONE 
J080306G01CTCGCGCGNONE 
J080306O08CTCGCGCGNONE 
J080311I01CTCGCGCGNONE 
J080315N24CTCGCGCGNONE 
J090003K21CTCGCGCGNONE 
J090008C20CTCGCGCGNONE 
J090008K19CTCGCGCGNONE 
J090008P13CTCGCGCGNONE 
J090015H22CTCGCGCGNONE 
J090016M01CTCGCGCGNONE 
J090018E13CTCGCGCGNONE 
J090018G03CTCGCGCGNONE 
J090018L17CTCGCGCGNONE 
J090019H11CTCGCGCGNONE 
J090021B19CTCGCGCGNONE 
J090021K02CTCGCGCGNONE 
J090023H15CTCGCGCGNONE 
J090034E03CTCGCGCGNONE 
J090045D16CTCGCGCGNONE 
J090045I06CTCGCGCGNONE 
J090047L09CTCGCGCGNONE 
J090048B05CTCGCGCGNONE 
J090048D11CTCGCGCGNONE 
J090048N11CTCGCGCGNONE 
J090050F20CTCGCGCGNONE 
J090052M20CTCGCGCGNONE 
J090083H03CTCGCGCGNONE 
J090084C12CTCGCGCGNONE 
J090095B05CTCGCGCGNONE 
J090095M18CTCGCGCGNONE 
J100024I22CTCGCGCGNONE 
J100024J12CTCGCGCGNONE 
J100024J22CTCGCGCGNONE 
J100025F07CTCGCGCGNONE 
J100026B13CTCGCGCGNONE 
J100027N03CTCGCGCGNONE 
J100029F14CTCGCGCGNONE 
J100029L20CTCGCGCGNONE 
J100032C22CTCGCGCGNONE 
J100032I08CTCGCGCGNONE 
J100032O05CTCGCGCGNONE 
J100033J24CTCGCGCGNONE 
J100033L12CTCGCGCGNONE 
J100034K06CTCGCGCGNONE 
J100037D09CTCGCGCGNONE 
J100038H02CTCGCGCGNONE 
J100039A12CTCGCGCGNONE 
J100039N12CTCGCGCGNONE 
J100039O21CTCGCGCGNONE 
J100040K05CTCGCGCGNONE 
J100042A02CTCGCGCGNONE 
J100042A17CTCGCGCGNONE 
J100043C15CTCGCGCGNONE 
J100044A17CTCGCGCGNONE 
J100044E18CTCGCGCGNONE 
J100044I11CTCGCGCGNONE 
J100044J15CTCGCGCGNONE 
J100045E23CTCGCGCGNONE 
J100049B18CTCGCGCGNONE 
J100050G04CTCGCGCGNONE 
J100051D06CTCGCGCGNONE 
J100051H20CTCGCGCGNONE 
J100052J01CTCGCGCGNONE 
J100052K07CTCGCGCGNONE 
J100055I01CTCGCGCGNONE 
J100057D02CTCGCGCGNONE 
J100059G14CTCGCGCGNONE 
J100059G21CTCGCGCGNONE 
J100059H03CTCGCGCGNONE 
J100059H15CTCGCGCGNONE 
J100063E13CTCGCGCGNONE 
J100063M02CTCGCGCGNONE 
J100064B17CTCGCGCGNONE 
J100064F11CTCGCGCGNONE 
J100066G12CTCGCGCGNONE 
J100066H09CTCGCGCGNONE 
J100068B12CTCGCGCGNONE 
J100068L16CTCGCGCGNONE 
J100068M23CTCGCGCGNONE 
J100069A02CTCGCGCGNONE 
J100069D07CTCGCGCGNONE 
J100069M13CTCGCGCGNONE 
J100070C07CTCGCGCGNONE 
J100070J11CTCGCGCGNONE 
J100070L20CTCGCGCGNONE 
J100071H10CTCGCGCGNONE 
J100072L14CTCGCGCGNONE 
J100072N12CTCGCGCGNONE 
J100073A21CTCGCGCGNONE 
J100074K17CTCGCGCGNONE 
J100074M04CTCGCGCGNONE 
J100075F11CTCGCGCGNONE 
J100076E23CTCGCGCGNONE 
J100076G03CTCGCGCGNONE 
J100077K01CTCGCGCGNONE 
J100077N23CTCGCGCGNONE 
J100079H17CTCGCGCGNONE 
J100081N01CTCGCGCGNONE 
J100082E04CTCGCGCGNONE 
J100082K11CTCGCGCGNONE 
J100085H23CTCGCGCGNONE 
J100086O18CTCGCGCGNONE 
J100087F21CTCGCGCGNONE 
J100088E02CTCGCGCGNONE 
J100088F08CTCGCGCGNONE 
J100088G24CTCGCGCGNONE 
J100088K20CTCGCGCGNONE 
J100089B19CTCGCGCGNONE 
J100089K22CTCGCGCGNONE 
J100089N22CTCGCGCGNONE 
J100089O17CTCGCGCGNONE 
J100090N05CTCGCGCGNONE 
Os03g0684400AK100086CGCGCGAGMg2+ transporter protein, CorA-like family protein. 
Os03g0685000009-031-F08CTCGCGCGCNONE 
AK059896CTCGCGCGCSimilar to Ferredoxin. 
AK098989CTCGCGCGCNONE 
AK099303CTCGCGCGCNONE 
J065041E14CTCGCGCGCNONE 
J065085G22CTCGCGCGCNONE 
Os03g0699400AK069110GTCGCGCGAGSilencing group B protein. 
J023009F11GTCGCGCGAGNONE 
J065010K14GTCGCGCGAGNONE 
J065013G22GTCGCGCGAGNONE 
J065041E22GTCGCGCGAGNONE 
J065045P04GTCGCGCGAGNONE 
J065060N03GTCGCGCGAGNONE 
J065077K12GTCGCGCGAGNONE 
J090024D16GTCGCGCGAGNONE 
J100031M08GTCGCGCGAGNONE 
J100075I05GTCGCGCGAGNONE 
Os03g0701100014-015-E11CGCGCGAGNONE 
AK109455CGCGCGAGNONE 
AK110740CGCGCGAGNONE 
Os03g0725000AK059294GCGCGCGAGNONE 
J043026H11GCGCGCGAGNONE 
J065187O06GCGCGCGAGNONE 
J090066M23GCGCGCGAGNONE 
Os03g0727800014-002-D07CTCGCGCGNONE 
014-002-D07GCGCGCGAGNONE 
AK109453CTCGCGCGCyclin-like F-box domain containing protein. 
AK109453GCGCGCGAGCyclin-like F-box domain containing protein. 
Os03g0744800AK059983CTCGCGCGCemp24/gp25L/p24 family protein. 
J065067D01CTCGCGCGCNONE 
J065122L19CTCGCGCGCNONE 
J090041I03CTCGCGCGCNONE 
J100039H03CTCGCGCGCNONE 
Os03g0748500AK110695CGCACGCGCGAGNONE 
AK110695GTCGCGCGAGNONE 
Os03g0764600AK105625GCGCGCGAGHomeodomain-like containing protein. 
Os03g0802200009-047-D08CTCGCGCGCNONE 
013-057-D02CTCGCGCGCNONE 
013-089-F02CTCGCGCGCNONE 
014-079-D02CTCGCGCGCNONE 
016-004-A11CTCGCGCGCNONE 
AK111769CTCGCGCGCConserved hypothetical protein. 
J075006H18CTCGCGCGCNONE 
J075060G07CTCGCGCGCNONE 
Os03g0851100AF303468CTCGCGCGCNONE 
AK102069CTCGCGCGCSimilar to Translational elongation factor EF-TuM. 
J033082G06CTCGCGCGCNONE 
J043036M21CTCGCGCGCNONE 
J065158H05CTCGCGCGCNONE 
J065192A04CTCGCGCGCNONE 
Os04g0406600AK103609GCGCGCGAGPrephenate dehydratase domain containing protein. 
J033133I10GCGCGCGAGNONE 
J075092D11GCGCGCGAGNONE 
J100031M09GCGCGCGAGNONE 
Os04g0410400AK108077CGCGCGAGRoot cap family protein. 
Os04g0417000AK063428GCGCGCGAGSimilar to Aluminum-activated malate transporter. 
Os04g0434400014-079-B10CGCACGCGCGCGAGNONE 
AK063725CGCACGCGCGCGAGConserved hypothetical protein. 
Os04g0457700J075145N15TTTGGGCCTCGCGCGCConserved hypothetical protein. 
Os04g0461000Os04g0461000CGCGCGAGSimilar to Myb-related transcription factor LBM1. 
Os04g0505200004-004-B07CTCGCGCGCNONE 
006-025-D10CTCGCGCGCNONE 
006-038-D07CTCGCGCGCNONE 
006-044-H11CTCGCGCGCNONE 
006-061-A09CTCGCGCGCNONE 
006-083-C02CTCGCGCGCNONE 
009-167-F06CTCGCGCGCNONE 
013-093-B02CTCGCGCGCNONE 
AK061301CTCGCGCGCLeucine-rich repeat, plant specific containing protein. 
AK066703CTCGCGCGCNONE 
AK104903CTCGCGCGCNONE 
J013027H24CTCGCGCGCNONE 
J013075O17CTCGCGCGCNONE 
J013130D11CTCGCGCGCNONE 
J033069B22CTCGCGCGCNONE 
J033102K15CTCGCGCGCNONE 
J090004A17CTCGCGCGCNONE 
J090008L22CTCGCGCGCNONE 
J090063C05CTCGCGCGCNONE 
Os04g0535200012-036-D08CGCGCGAGNONE 
AK060585CGCGCGAGNONE 
AK101505CGCGCGAGNONE 
AK119767CGCGCGAGPeptidase A1, pepsin family protein. 
J033044F04CGCGCGAGNONE 
J065167K19CGCGCGAGNONE 
J075017H22CGCGCGAGNONE 
J075180E03CGCGCGAGNONE 
J080025H04CGCGCGAGNONE 
J080026P04CGCGCGAGNONE 
J080029A01CGCGCGAGNONE 
J080034L18CGCGCGAGNONE 
J080038J07CGCGCGAGNONE 
J080053L24CGCGCGAGNONE 
J080071P08CGCGCGAGNONE 
J080093F09CGCGCGAGNONE 
Os04g0542000J090086F02CTCGCGCGNONE 
Os04g0562100AK060598CGCGCGAGAmino acid/polyamine transporter II family protein. 
Os04g0593200J100032B06CTCGCGCGSimilar to Transcription repressor MYB4 (Myb-related protein 4) (AtMYB4). 
J100049K04CTCGCGCGNONE 
Os04g0602800AK100925GCGCGCGAGSimilar to Yarrowia lipolytica chromosome D of strain CLIB99 of Yarrowia lipolytica. 
Os04g0612100AK060663CGCGCGAGSimilar to Beta-1,3-glucanase-like protein. 
Os04g0635000009-031-A05GCGCGCGAGNONE 
009-031-A05GTCGCGCGAGNONE 
009-074-F05GCGCGCGAGNONE 
009-074-F05GTCGCGCGAGNONE 
009-163-H03GCGCGCGAGNONE 
009-163-H03GTCGCGCGAGNONE 
AK062619GCGCGCGAGConserved hypothetical protein. 
AK062619GTCGCGCGAGConserved hypothetical protein. 
Os04g0661200AK102842GCGCGCGAGProtein of unknown function DUF941 family protein. 
J033075E19GCGCGCGAGNONE 
J033109O19GCGCGCGAGNONE 
J065002J12GCGCGCGAGNONE 
J065026E22GCGCGCGAGNONE 
J065061F05GCGCGCGAGNONE 
J065068D22GCGCGCGAGNONE 
J065072N14GCGCGCGAGNONE 
J065085F02GCGCGCGAGNONE 
J075055G19GCGCGCGAGNONE 
J075105B14GCGCGCGAGNONE 
J075118M17GCGCGCGAGNONE 
J075193H02GCGCGCGAGNONE 
J100040O05GCGCGCGAGNONE 
J100064I04GCGCGCGAGNONE 
Os04g0679400004-018-E07GCGCGCGAGNONE 
006-039-G08GCGCGCGAGNONE 
006-045-D06GCGCGCGAGNONE 
006-048-B12GCGCGCGAGNONE 
006-061-C05GCGCGCGAGNONE 
006-062-A03GCGCGCGAGNONE 
006-063-A06GCGCGCGAGNONE 
006-066-B04GCGCGCGAGNONE 
006-068-H12GCGCGCGAGNONE 
006-075-C08GCGCGCGAGNONE 
006-076-A02GCGCGCGAGNONE 
006-083-B04GCGCGCGAGNONE 
006-090-F04GCGCGCGAGNONE 
006-099-H12GCGCGCGAGNONE 
006-105-F10GCGCGCGAGNONE 
006-106-G03GCGCGCGAGNONE 
006-107-B05GCGCGCGAGNONE 
006-108-F06GCGCGCGAGNONE 
006-109-E09GCGCGCGAGNONE 
006-111-B02GCGCGCGAGNONE 
006-113-C10GCGCGCGAGNONE 
009-128-G11GCGCGCGAGNONE 
009-150-B02GCGCGCGAGNONE 
009-156-E08GCGCGCGAGNONE 
012-015-E07GCGCGCGAGNONE 
012-027-B04GCGCGCGAGNONE 
012-030-A03GCGCGCGAGNONE 
012-066-E06GCGCGCGAGNONE 
012-083-A09GCGCGCGAGNONE 
012-088-E07GCGCGCGAGNONE 
012-097-F08GCGCGCGAGNONE 
013-010-D04GCGCGCGAGNONE 
013-012-A01GCGCGCGAGNONE 
013-016-D04GCGCGCGAGNONE 
013-041-B01GCGCGCGAGNONE 
013-043-F10GCGCGCGAGNONE 
013-047-C12GCGCGCGAGNONE 
013-058-E10GCGCGCGAGNONE 
013-063-B07GCGCGCGAGNONE 
013-076-A01GCGCGCGAGNONE 
013-081-D04GCGCGCGAGNONE 
013-090-D05GCGCGCGAGNONE 
013-091-B07GCGCGCGAGNONE 
014-030-A04GCGCGCGAGNONE 
014-055-A04GCGCGCGAGNONE 
014-070-A04GCGCGCGAGNONE 
015-033-C10GCGCGCGAGNONE 
015-040-H10GCGCGCGAGNONE 
016-006-F03GCGCGCGAGNONE 
016-090-B03GCGCGCGAGNONE 
AK065314GCGCGCGAGNONE 
AK068608GCGCGCGAGNONE 
AK099009GCGCGCGAGNONE 
AK099087GCGCGCGAGNONE 
AK099368GCGCGCGAGNONE 
AK099653GCGCGCGAGNONE 
AK099975GCGCGCGAGNONE 
AK104249GCGCGCGAGNONE 
AK104376GCGCGCGAGNONE 
AK106133GCGCGCGAGNONE 
AK119666GCGCGCGAGNONE 
AK120508GCGCGCGAGNONE 
AK121152GCGCGCGAGSimilar to Ripening-associated protein (Fragment). 
J013002O24GCGCGCGAGNONE 
J013023H15GCGCGCGAGNONE 
J013036E15GCGCGCGAGNONE 
J013042D22GCGCGCGAGNONE 
J013045A07GCGCGCGAGNONE 
J013056D24GCGCGCGAGNONE 
J013057D10GCGCGCGAGNONE 
J013059B08GCGCGCGAGNONE 
J013059D01GCGCGCGAGNONE 
J013060C02GCGCGCGAGNONE 
J013070N22GCGCGCGAGNONE 
J013071K02GCGCGCGAGNONE 
J013073G04GCGCGCGAGNONE 
J013096J17GCGCGCGAGNONE 
J013098G08GCGCGCGAGNONE 
J013123H02GCGCGCGAGNONE 
J013135I23GCGCGCGAGNONE 
J013149G08GCGCGCGAGNONE 
J013155N04GCGCGCGAGNONE 
J013156C23GCGCGCGAGNONE 
J013157C07GCGCGCGAGNONE 
J013157D23GCGCGCGAGNONE 
J023001K19GCGCGCGAGNONE 
J023002H21GCGCGCGAGNONE 
J023003H14GCGCGCGAGNONE 
J023006D09GCGCGCGAGNONE 
J023010E07GCGCGCGAGNONE 
J023014E18GCGCGCGAGNONE 
J023024G16GCGCGCGAGNONE 
J023034F13GCGCGCGAGNONE 
J023034F17GCGCGCGAGNONE 
J023045C18GCGCGCGAGNONE 
J023058P17GCGCGCGAGNONE 
J023061H18GCGCGCGAGNONE 
J023064H05GCGCGCGAGNONE 
J023078J16GCGCGCGAGNONE 
J023079L03GCGCGCGAGNONE 
J023085N10GCGCGCGAGNONE 
J023087G10GCGCGCGAGNONE 
J023088I02GCGCGCGAGNONE 
J023093K24GCGCGCGAGNONE 
J023095H05GCGCGCGAGNONE 
J023097C02GCGCGCGAGNONE 
J023101P15GCGCGCGAGNONE 
J023106C22GCGCGCGAGNONE 
J023121B08GCGCGCGAGNONE 
J023121N13GCGCGCGAGNONE 
J023123F01GCGCGCGAGNONE 
J023128E14GCGCGCGAGNONE 
J023128M11GCGCGCGAGNONE 
J023135L14GCGCGCGAGNONE 
J023141H20GCGCGCGAGNONE 
J023150A12GCGCGCGAGNONE 
J033035G16GCGCGCGAGNONE 
J033037N04GCGCGCGAGNONE 
J033041D20GCGCGCGAGNONE 
J033052O07GCGCGCGAGNONE 
J033061D19GCGCGCGAGNONE 
J033068M01GCGCGCGAGNONE 
J033090I15GCGCGCGAGNONE 
J033103G06GCGCGCGAGNONE 
J033117F16GCGCGCGAGNONE 
J033120H02GCGCGCGAGNONE 
J033126N05GCGCGCGAGNONE 
J033136C13GCGCGCGAGNONE 
J033139H08GCGCGCGAGNONE 
J043024N03GCGCGCGAGNONE 
J043027G07GCGCGCGAGNONE 
J065103L02GCGCGCGAGNONE 
J065108G02GCGCGCGAGNONE 
J065175N11GCGCGCGAGNONE 
J080003B03GCGCGCGAGNONE 
J080007J02GCGCGCGAGNONE 
J080008D02GCGCGCGAGNONE 
J080008E04GCGCGCGAGNONE 
J080015H20GCGCGCGAGNONE 
J080017J09GCGCGCGAGNONE 
J080020O09GCGCGCGAGNONE 
J080021F06GCGCGCGAGNONE 
J080027L11GCGCGCGAGNONE 
J080028J11GCGCGCGAGNONE 
J080030G17GCGCGCGAGNONE 
J080035E09GCGCGCGAGNONE 
J080035F20GCGCGCGAGNONE 
J080036H18GCGCGCGAGNONE 
J080039M19GCGCGCGAGNONE 
J080042A21GCGCGCGAGNONE 
J080043A07GCGCGCGAGNONE 
J080052A16GCGCGCGAGNONE 
J080055G22GCGCGCGAGNONE 
J080061O12GCGCGCGAGNONE 
J080062I05GCGCGCGAGNONE 
J080068K18GCGCGCGAGNONE 
J080070G01GCGCGCGAGNONE 
J080077F11GCGCGCGAGNONE 
J080079N14GCGCGCGAGNONE 
J080084G11GCGCGCGAGNONE 
J080093C04GCGCGCGAGNONE 
J090056G10GCGCGCGAGNONE 
J090091H01GCGCGCGAGNONE 
J100025J03GCGCGCGAGNONE 
J100027L16GCGCGCGAGNONE 
J100030B22GCGCGCGAGNONE 
J100048H23GCGCGCGAGNONE 
J100050C24GCGCGCGAGNONE 
J100055F22GCGCGCGAGNONE 
J100057L08GCGCGCGAGNONE 
J100065E17GCGCGCGAGNONE 
J100072C03GCGCGCGAGNONE 
Os04g0686700AK105746CGCGCGAGKelch repeat containing protein. 
J065021K04CGCGCGAGNONE 
J065097E18CGCGCGAGNONE 
J075004C12CGCGCGAGNONE 
J080301H10CGCGCGAGNONE 
J090087N02CGCGCGAGNONE 
J100060E19CGCGCGAGNONE 
Os05g0119300004-011-B09CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
006-063-A03CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
006-077-E12CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
006-079-E12CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
006-100-B11CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
009-109-A12CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
009-123-C07CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
009-163-D09CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
009-170-D11CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
009-173-C01CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
009-192-E01CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
011-048-G01CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
AK060883CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
AK068289CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
AK071554CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
AK099495CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGXYPPX repeat containing protein. 
AY348312CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J013037L16CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J013088P04CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J013099D14CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J013146E19CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J013147E18CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J023104E19CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J023128O20CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J023132D16CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J023143E13CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J033028F15CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J033133D24CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J053091M07CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J075029L15CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J075097M12CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J075103J11CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J075138J10CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J075172K18CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080001C15CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080002M13CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080009K01CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080010N01CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080011D23CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080013C13CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080013M16CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080018J02CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080020F03CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080020G05CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080021D05CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080030A19CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080031A16CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080033J23CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080035H07CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080039M24CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080042B16CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080043B03CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080045G01CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080045K17CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080047A09CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080047I22CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080048M14CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080049J02CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080052C15CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080052E11CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080052M22CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080056O21CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080059J04CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080059O17CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080064N04CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080066A03CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080066I22CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080069C13CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080069J03CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080069N04CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080071A01CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080071C03CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080071J02CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080080D17CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080084O06CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080085O20CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080086H15CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080094K06CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080095C05CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080095G04CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080096F03CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080096F20CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J090004H05CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J090012P10CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J090021B09CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J090034M08CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J090046G21CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J090055K24CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J090055L05CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J090057H17CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J090082K21CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J100022A07CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J100022M02CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J100069K11CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J100086C24CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
Os05g0151200J065041L18CGCGCGAGTspO/MBR-related protein family protein. 
J065168L08CGCGCGAGNONE 
Os05g0195200015-031-H09CGCGCGAGNONE 
015-070-C11CGCGCGAGNONE 
016-063-C11CGCGCGAGNONE 
AK106392CGCGCGAGZinc finger, CCCH-type domain containing protein. 
J033051N05CGCGCGAGNONE 
J065118P05CGCGCGAGNONE 
J100071H15CGCGCGAGNONE 
J100078J22CGCGCGAGNONE 
Os05g0388500AK065313CCCCCGCGACGCGCGAGSimilar to 50S ribosomal protein L1. 
AK098990CCCCCGCGACGCGCGAGNONE 
AK104689CCCCCGCGACGCGCGAGNONE 
J013094L23CCCCCGCGACGCGCGAGNONE 
J065118O04CCCCCGCGACGCGCGAGNONE 
Os05g0388600AK105904CTCGCGCGConserved hypothetical protein. 
AK105904GTCGCGCGAGConserved hypothetical protein. 
Os05g0406800AK062566CGCGCGAGNONE 
AK099640CGCGCGAGLeucine rich repeat, N-terminal domain containing protein. 
J013060B14CGCGCGAGNONE 
J090013F14CGCGCGAGNONE 
J090062E13CGCGCGAGNONE 
J090063D09CGCGCGAGNONE 
J090075H10CGCGCGAGNONE 
J090096E22CGCGCGAGNONE 
Os05g0424800AK121054CTCGCGCGSimilar to AER274Wp. 
AK121054CTCGCGCGTCGCGTCSimilar to AER274Wp. 
J023055P22CTCGCGCGNONE 
J023055P22CTCGCGCGTCGCGTCNONE 
J023102M21CTCGCGCGNONE 
J023102M21CTCGCGCGTCGCGTCNONE 
J033088E13CTCGCGCGNONE 
J033088E13CTCGCGCGTCGCGTCNONE 
J033123K17CTCGCGCGNONE 
J033123K17CTCGCGCGTCGCGTCNONE 
J065176L18CTCGCGCGNONE 
J065176L18CTCGCGCGTCGCGTCNONE 
J075002F14CTCGCGCGNONE 
J075002F14CTCGCGCGTCGCGTCNONE 
J075005E10CTCGCGCGNONE 
J075005E10CTCGCGCGTCGCGTCNONE 
J075005K21CTCGCGCGNONE 
J075005K21CTCGCGCGTCGCGTCNONE 
J075007A18CTCGCGCGNONE 
J075007A18CTCGCGCGTCGCGTCNONE 
J075021J16CTCGCGCGNONE 
J075021J16CTCGCGCGTCGCGTCNONE 
J075040K11CTCGCGCGNONE 
J075040K11CTCGCGCGTCGCGTCNONE 
J075061A14CTCGCGCGNONE 
J075061A14CTCGCGCGTCGCGTCNONE 
J075106H07CTCGCGCGNONE 
J075106H07CTCGCGCGTCGCGTCNONE 
J075109M22CTCGCGCGNONE 
J075109M22CTCGCGCGTCGCGTCNONE 
J075121O13CTCGCGCGNONE 
J075121O13CTCGCGCGTCGCGTCNONE 
J075132M08CTCGCGCGNONE 
J075132M08CTCGCGCGTCGCGTCNONE 
J075153B19CTCGCGCGNONE 
J075153B19CTCGCGCGTCGCGTCNONE 
J075158L15CTCGCGCGNONE 
J075158L15CTCGCGCGTCGCGTCNONE 
J075187G20CTCGCGCGNONE 
J075187G20CTCGCGCGTCGCGTCNONE 
J100079N17CTCGCGCGNONE 
J100079N17CTCGCGCGTCGCGTCNONE 
Os05g0429900AK066834CTCGCGCGCNONE 
AK099108CTCGCGCGCNONE 
AK104053CTCGCGCGCNONE 
D88617CTCGCGCGCSimilar to MybHv5 (Fragment). 
J090031E22CTCGCGCGCNONE 
Os05g0444200AK102658CTCGCGCGCACGCGSimilar to T6J4.5 protein (WIP6 protein). 
Os05g0455500AK101985CTCGCGCGNONE 
AK102633CTCGCGCGDelta 1-pyrroline-5-carboxylate synthetase (P5CS) [Includes: Glutamate 5-kinase (EC 2.7.2.11) (Gamma-glutamyl kinase) (GK); Gamma-glutamyl phosphate reductase (GPR) (EC 1.2.1.41) (Glutamate-5-semialdehyde dehydrogenase) (Glutamyl-gamma-semialdehyde dehydrogenase)]. 
AY574031CTCGCGCGNONE 
D49714CTCGCGCGNONE 
J013002F07CTCGCGCGNONE 
J033085C02CTCGCGCGNONE 
Os05g0478000AK111029CTCGCGCGCZinc finger, RING-type domain containing protein. 
Os05g0510100Os05g0510100CGCGCGAGProtein of unknown function DUF567 family protein. 
Os05g0510700AK070308CTCGCGCGCBSD domain containing protein. 
Os05g0534400AK101368CTCGCGCGSimilar to Calcineurin B-like protein 4 (SALT OVERLY SENSITIVE 3 protein). 
J033035L13CTCGCGCGNONE 
J065045H07CTCGCGCGNONE 
Os05g0555300009-032-C03CGTGTGGCGCGCGAGNONE 
009-125-E08CGTGTGGCGCGCGAGNONE 
009-149-C12CGTGTGGCGCGCGAGNONE 
009-172-C01CGTGTGGCGCGCGAGNONE 
AK062890CGTGTGGCGCGCGAGFerredoxin domain containing protein. 
AK062997CGTGTGGCGCGCGAGNONE 
Os05g0569400AK100553CTCGCGCGAldose 1-epimerase family protein. 
Os05g0577700AK107217GCTGGGCTGGGCCCCTCGCGCGCGACGCGACSimilar to Protein kinase. 
AY224453GCTGGGCTGGGCCCCTCGCGCGCGACGCGACNONE 
Os06g0163200AK068888CTCGCGCGCEsterase/lipase/thioesterase domain containing protein. 
J023001E15CTCGCGCGCNONE 
J075100H16CTCGCGCGCNONE 
J075138N07CTCGCGCGCNONE 
Os06g0166500016-094-H06CTCGCGCGCNONE 
AK102541CTCGCGCGCSimilar to Auxin-responsive protein IAA20 (Indoleacetic acid-induced protein 20). 
Os06g0168800AK111753GCGCGCGAGSimilar to Protein kinase. 
Os06g0184300AK102933CGCGCGAGPeptidase C19, ubiquitin carboxyl-terminal hydrolase 2 family protein. 
Os06g0199100AK120323GAGACGCGCGAGProtein prenyltransferase domain containing protein. 
Os06g0215500AK108079CGCGCGAGSimilar to Oxo-phytodienoic acid reductase. 
Os06g0220600AK058664CTCGCGCGConserved hypothetical protein. 
J075096L21CTCGCGCGNONE 
Os06g0268800AK120796GCGCGCGAGProtein of unknown function UPF0005 family protein. 
Os06g0274500AK066417TCGCGCGCGAGSimilar to SERK1 (Fragment). 
Os06g0320000009-030-C04CTCGCGCGNONE 
009-135-F08CTCGCGCGNONE 
J075103B05CTCGCGCGProtein of unknown function DUF953, thioredoxin-like family protein. 
J075187J24CTCGCGCGNONE 
Os06g0574200Os06g0574200CTCGCGCGCGAUspA domain containing protein. 
Os06g0698300AK071637CGCGCGAGProtein phosphatase 2C family protein. 
J023098M15CGCGCGAGNONE 
J023101G03CGCGCGAGNONE 
J023139A04CGCGCGAGNONE 
Os06g0713300J065143C11CTCGCGCGNONE 
Os07g0133500015-010-H05CTCGCGCGNONE 
AB110179CTCGCGCGNONE 
AK106244CTCGCGCGProtein of unknown function DUF1005 family protein. 
J090075I21CTCGCGCGNONE 
Os07g0414800AK108552CTCGCGCGCF-actin capping protein, alpha subunit family protein. 
Os07g0456900AK101301CTCGCGCGNo apical meristem (NAM) protein domain containing protein. 
J033033K06CTCGCGCGNONE 
Os07g0529000011-012-E06GCGCGCGAGNONE 
011-054-G04GCGCGCGAGNONE 
016-094-D08GCGCGCGAGNONE 
AK063353GCGCGCGAGSimilar to Isocitrate lyase (Fragment). 
AK103744GCGCGCGAGNONE 
J065022H24GCGCGCGAGNONE 
J065040B11GCGCGCGAGNONE 
J065053J07GCGCGCGAGNONE 
J065057K21GCGCGCGAGNONE 
J065063M16GCGCGCGAGNONE 
J065073G06GCGCGCGAGNONE 
J065158H07GCGCGCGAGNONE 
J065159C23GCGCGCGAGNONE 
J065184F18GCGCGCGAGNONE 
J065184K08GCGCGCGAGNONE 
J065192A11GCGCGCGAGNONE 
J065199L23GCGCGCGAGNONE 
J065212K16GCGCGCGAGNONE 
J075002I18GCGCGCGAGNONE 
J075055G16GCGCGCGAGNONE 
J075112H09GCGCGCGAGNONE 
J075199I10GCGCGCGAGNONE 
Os07g0543750J013059L18CGCGCGAGNONE 
J013060O22CGCGCGAGNONE 
J013067A13CGCGCGAGNONE 
J023135I04CGCGCGAGNONE 
J033091F24CGCGCGAGNONE 
J033094G15CGCGCGAGConserved hypothetical protein. 
Os07g0549600J080302I11GCGCGCGAGGGCGAGGBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
J080304E08GCGCGCGAGGGCGAGGNONE 
J080306P15GCGCGCGAGGGCGAGGNONE 
J080312F02GCGCGCGAGGGCGAGGNONE 
J080316C13GCGCGCGAGGGCGAGGNONE 
J080316K21GCGCGCGAGGGCGAGGNONE 
J080319K19GCGCGCGAGGGCGAGGNONE 
Os07g0595800011-069-G09CTCGCGCGACNONE 
AK066349CTCGCGCGACPrefoldin related, ubiquitously expressed transcript family protein. 
J013062C05CTCGCGCGACNONE 
Os07g0637300AF323611GCGCGCGAGNONE 
AK069157GCGCGCGAGNONE 
J023007C01GCGCGCGAGNONE 
Os07g0656600006-022-H05CTCGCGCGNONE 
AK060061CTCGCGCGRibosomal protein L14b/L23e family protein. 
Os07g0659300AK069789CTCGCGCGCConserved hypothetical protein. 
Os07g0673400009-130-B03CGCGCGAGNONE 
014-016-A11CGCGCGAGNONE 
AF491815CGCGCGAGNONE 
AK064061CGCGCGAGUniversal stress protein (Usp) family protein. 
AK073356CGCGCGAGNONE 
AY224503CGCGCGAGNONE 
J033028K22CGCGCGAGNONE 
J065010E10CGCGCGAGNONE 
Os08g0101100AK069900GCGCGCGAGHigh mobility group box domain containing protein. 
Os08g0163400AB005290GCGCGCGAGAGAGTGGGSigma-70 factor family protein. 
AK065997GCGCGCGAGAGAGTGGGNONE 
AK071725GCGCGCGAGAGAGTGGGNONE 
Os08g0327200AK069803GCGCGCGAGVirulence factor, pectin lyase fold family protein. 
Os08g0405700AK108256GCGCGCGAGSimilar to Copper chaperone homolog CCH. 
J100052M11GCGCGCGAGNONE 
Os08g0459600AK071203CTCGCGCGSimilar to 12-oxophytodienoate reductase 3 (EC 1.3.1.42) (12-oxophytodienoate- 10,11-reductase 3) (OPDA-reductase 3) (LeOPR3). 
AK104843CTCGCGCGNONE 
Os08g0473600011-035-H09CTCGCGCGCNONE 
011-052-E06CTCGCGCGCNONE 
012-004-D02CTCGCGCGCNONE 
012-006-G11CTCGCGCGCNONE 
012-025-G01CTCGCGCGCNONE 
012-026-E10CTCGCGCGCNONE 
012-034-F07CTCGCGCGCNONE 
012-038-A04CTCGCGCGCNONE 
012-043-A07CTCGCGCGCNONE 
012-050-C12CTCGCGCGCNONE 
012-060-A06CTCGCGCGCNONE 
012-062-A07CTCGCGCGCNONE 
012-066-G07CTCGCGCGCNONE 
012-067-G12CTCGCGCGCNONE 
012-075-F02CTCGCGCGCNONE 
012-082-H06CTCGCGCGCNONE 
012-088-C08CTCGCGCGCNONE 
012-088-D06CTCGCGCGCNONE 
012-089-D12CTCGCGCGCNONE 
012-091-H05CTCGCGCGCNONE 
012-092-C06CTCGCGCGCNONE 
012-093-H01CTCGCGCGCNONE 
012-100-C09CTCGCGCGCNONE 
013-033-C02CTCGCGCGCNONE 
014-042-F10CTCGCGCGCNONE 
014-050-E03CTCGCGCGCNONE 
014-075-F10CTCGCGCGCNONE 
015-004-G11CTCGCGCGCNONE 
015-005-E07CTCGCGCGCNONE 
015-005-G08CTCGCGCGCNONE 
015-013-D03CTCGCGCGCNONE 
015-013-F04CTCGCGCGCNONE 
015-017-D03CTCGCGCGCNONE 
015-048-D02CTCGCGCGCNONE 
015-049-D02CTCGCGCGCNONE 
015-092-F03CTCGCGCGCNONE 
016-019-H02CTCGCGCGCNONE 
016-027-F03CTCGCGCGCNONE 
016-096-D06CTCGCGCGCNONE 
AK064071CTCGCGCGCNONE 
AK064300CTCGCGCGCAlpha-amylase isozyme 3E precursor (EC 3.2.1.1) (1,4-alpha-D-glucan glucanohydrolase). 
AK103413CTCGCGCGCNONE 
AK106526CTCGCGCGCNONE 
J033030A15CTCGCGCGCNONE 
J033040E10CTCGCGCGCNONE 
J033057P15CTCGCGCGCNONE 
J033127G12CTCGCGCGCNONE 
J033128G11CTCGCGCGCNONE 
J053054F05CTCGCGCGCNONE 
J065006J19CTCGCGCGCNONE 
J065007M11CTCGCGCGCNONE 
J065013H10CTCGCGCGCNONE 
J065015G17CTCGCGCGCNONE 
J065019C10CTCGCGCGCNONE 
J065020H22CTCGCGCGCNONE 
J065022H12CTCGCGCGCNONE 
J065024C08CTCGCGCGCNONE 
J065029F11CTCGCGCGCNONE 
J065036D04CTCGCGCGCNONE 
J065039F22CTCGCGCGCNONE 
J065042G09CTCGCGCGCNONE 
J065045L16CTCGCGCGCNONE 
J065046M13CTCGCGCGCNONE 
J065049E18CTCGCGCGCNONE 
J065052H21CTCGCGCGCNONE 
J065053G17CTCGCGCGCNONE 
J065066H10CTCGCGCGCNONE 
J065069M24CTCGCGCGCNONE 
J065070P07CTCGCGCGCNONE 
J065073O06CTCGCGCGCNONE 
J065078G19CTCGCGCGCNONE 
J065082P16CTCGCGCGCNONE 
J065086P15CTCGCGCGCNONE 
J065093H11CTCGCGCGCNONE 
J065097A14CTCGCGCGCNONE 
J065103D19CTCGCGCGCNONE 
J065105A18CTCGCGCGCNONE 
J065108N23CTCGCGCGCNONE 
J065109N14CTCGCGCGCNONE 
J065121K22CTCGCGCGCNONE 
J065122C18CTCGCGCGCNONE 
J065129L03CTCGCGCGCNONE 
J065130B11CTCGCGCGCNONE 
J065135P07CTCGCGCGCNONE 
J065139B03CTCGCGCGCNONE 
J065144O11CTCGCGCGCNONE 
J065163I17CTCGCGCGCNONE 
J065163J15CTCGCGCGCNONE 
J065177G16CTCGCGCGCNONE 
J065186D17CTCGCGCGCNONE 
J065187D02CTCGCGCGCNONE 
J065188L03CTCGCGCGCNONE 
J065191L02CTCGCGCGCNONE 
J065193F09CTCGCGCGCNONE 
J065197J03CTCGCGCGCNONE 
J065200F07CTCGCGCGCNONE 
J065208K11CTCGCGCGCNONE 
J065211I22CTCGCGCGCNONE 
J065213O22CTCGCGCGCNONE 
J065213P22CTCGCGCGCNONE 
Os08g0482100AK065903CGCGCGAGLETM1-like domain containing protein. 
J013049J03CGCGCGAGNONE 
Os08g0495300Os08g0495300GCGCGCGAGConserved hypothetical protein. 
Os08g0535400004-001-H10GAGACGTGGGCCCCACCCTCGCGCGCNONE 
AK071527GAGACGTGGGCCCCACCCTCGCGCGCZinc finger, DHHC-type domain containing protein. 
J023107B02GAGACGTGGGCCCCACCCTCGCGCGCNONE 
Os09g0101800AK102345CTCGCGCGCWD40-like domain containing protein. 
J090030C23CTCGCGCGCNONE 
Os09g0133700011-038-F10CTCGCGCGAGNONE 
015-095-D09CTCGCGCGAGNONE 
AK101816CTCGCGCGAGATPase, BadF/BadG/BcrA/BcrD type domain containing protein. 
J065001B01CTCGCGCGAGNONE 
Os09g0346500004-015-F05GCCCCACGCGCGAGNONE 
005-018-A05GCCCCACGCGCGAGNONE 
006-021-B03GCCCCACGCGCGAGNONE 
006-021-D10GCCCCACGCGCGAGNONE 
006-021-E07GCCCCACGCGCGAGNONE 
006-021-F03GCCCCACGCGCGAGNONE 
006-022-A06GCCCCACGCGCGAGNONE 
006-022-B07GCCCCACGCGCGAGNONE 
006-022-C02GCCCCACGCGCGAGNONE 
006-023-E02GCCCCACGCGCGAGNONE 
006-023-G08GCCCCACGCGCGAGNONE 
006-023-H05GCCCCACGCGCGAGNONE 
006-024-B09GCCCCACGCGCGAGNONE 
006-024-E02GCCCCACGCGCGAGNONE 
006-025-F01GCCCCACGCGCGAGNONE 
006-025-G12GCCCCACGCGCGAGNONE 
006-026-D02GCCCCACGCGCGAGNONE 
006-026-D05GCCCCACGCGCGAGNONE 
006-028-C05GCCCCACGCGCGAGNONE 
006-028-E07GCCCCACGCGCGAGNONE 
006-028-F05GCCCCACGCGCGAGNONE 
006-028-F07GCCCCACGCGCGAGNONE 
006-028-F08GCCCCACGCGCGAGNONE 
006-028-G09GCCCCACGCGCGAGNONE 
006-029-B04GCCCCACGCGCGAGNONE 
006-029-C10GCCCCACGCGCGAGNONE 
006-030-H03GCCCCACGCGCGAGNONE 
006-031-F04GCCCCACGCGCGAGNONE 
006-031-G11GCCCCACGCGCGAGNONE 
006-032-D07GCCCCACGCGCGAGNONE 
006-032-G02GCCCCACGCGCGAGNONE 
006-032-H02GCCCCACGCGCGAGNONE 
006-032-H10GCCCCACGCGCGAGNONE 
006-033-A05GCCCCACGCGCGAGNONE 
006-033-C04GCCCCACGCGCGAGNONE 
006-033-D02GCCCCACGCGCGAGNONE 
006-034-C05GCCCCACGCGCGAGNONE 
006-034-D01GCCCCACGCGCGAGNONE 
006-034-H10GCCCCACGCGCGAGNONE 
006-035-A10GCCCCACGCGCGAGNONE 
006-035-B10GCCCCACGCGCGAGNONE 
006-035-D05GCCCCACGCGCGAGNONE 
006-036-B07GCCCCACGCGCGAGNONE 
006-036-F04GCCCCACGCGCGAGNONE 
006-036-H02GCCCCACGCGCGAGNONE 
006-036-H05GCCCCACGCGCGAGNONE 
006-036-H06GCCCCACGCGCGAGNONE 
006-037-C10GCCCCACGCGCGAGNONE 
006-037-F03GCCCCACGCGCGAGNONE 
006-038-B05GCCCCACGCGCGAGNONE 
006-038-E03GCCCCACGCGCGAGNONE 
006-038-E06GCCCCACGCGCGAGNONE 
006-039-B07GCCCCACGCGCGAGNONE 
006-039-D03GCCCCACGCGCGAGNONE 
006-039-F05GCCCCACGCGCGAGNONE 
006-041-A10GCCCCACGCGCGAGNONE 
006-041-B07GCCCCACGCGCGAGNONE 
006-042-B05GCCCCACGCGCGAGNONE 
006-042-C04GCCCCACGCGCGAGNONE 
006-042-D12GCCCCACGCGCGAGNONE 
006-043-C11GCCCCACGCGCGAGNONE 
006-043-E04GCCCCACGCGCGAGNONE 
006-044-E09GCCCCACGCGCGAGNONE 
006-045-B01GCCCCACGCGCGAGNONE 
006-045-G02GCCCCACGCGCGAGNONE 
006-046-A01GCCCCACGCGCGAGNONE 
006-046-C07GCCCCACGCGCGAGNONE 
006-046-G02GCCCCACGCGCGAGNONE 
006-047-B02GCCCCACGCGCGAGNONE 
006-047-C01GCCCCACGCGCGAGNONE 
006-047-D05GCCCCACGCGCGAGNONE 
006-047-F09GCCCCACGCGCGAGNONE 
006-049-E05GCCCCACGCGCGAGNONE 
006-049-E09GCCCCACGCGCGAGNONE 
006-050-A01GCCCCACGCGCGAGNONE 
006-050-A12GCCCCACGCGCGAGNONE 
006-050-C05GCCCCACGCGCGAGNONE 
006-050-C06GCCCCACGCGCGAGNONE 
006-050-G06GCCCCACGCGCGAGNONE 
006-050-G10GCCCCACGCGCGAGNONE 
006-050-H02GCCCCACGCGCGAGNONE 
006-051-A02GCCCCACGCGCGAGNONE 
006-051-B09GCCCCACGCGCGAGNONE 
006-051-C02GCCCCACGCGCGAGNONE 
006-051-H01GCCCCACGCGCGAGNONE 
006-052-B12GCCCCACGCGCGAGNONE 
006-052-D08GCCCCACGCGCGAGNONE 
006-052-E08GCCCCACGCGCGAGNONE 
006-052-F05GCCCCACGCGCGAGNONE 
006-052-F11GCCCCACGCGCGAGNONE 
006-052-G08GCCCCACGCGCGAGNONE 
006-052-G11GCCCCACGCGCGAGNONE 
006-052-H07GCCCCACGCGCGAGNONE 
006-053-A08GCCCCACGCGCGAGNONE 
006-053-B06GCCCCACGCGCGAGNONE 
006-054-H08GCCCCACGCGCGAGNONE 
006-055-B08GCCCCACGCGCGAGNONE 
006-055-E03GCCCCACGCGCGAGNONE 
006-055-H08GCCCCACGCGCGAGNONE 
006-056-A10GCCCCACGCGCGAGNONE 
006-056-C10GCCCCACGCGCGAGNONE 
006-056-E04GCCCCACGCGCGAGNONE 
006-057-A10GCCCCACGCGCGAGNONE 
006-058-A02GCCCCACGCGCGAGNONE 
006-058-D11GCCCCACGCGCGAGNONE 
006-058-F01GCCCCACGCGCGAGNONE 
006-058-H03GCCCCACGCGCGAGNONE 
006-058-H10GCCCCACGCGCGAGNONE 
006-059-B04GCCCCACGCGCGAGNONE 
006-059-F04GCCCCACGCGCGAGNONE 
006-060-A06GCCCCACGCGCGAGNONE 
006-060-B07GCCCCACGCGCGAGNONE 
006-060-D03GCCCCACGCGCGAGNONE 
006-062-B09GCCCCACGCGCGAGNONE 
006-062-C02GCCCCACGCGCGAGNONE 
006-062-D01GCCCCACGCGCGAGNONE 
006-062-E01GCCCCACGCGCGAGNONE 
006-062-F03GCCCCACGCGCGAGNONE 
006-062-H02GCCCCACGCGCGAGNONE 
006-063-C03GCCCCACGCGCGAGNONE 
006-063-G02GCCCCACGCGCGAGNONE 
006-063-H10GCCCCACGCGCGAGNONE 
006-064-H01GCCCCACGCGCGAGNONE 
006-067-F08GCCCCACGCGCGAGNONE 
006-068-G11GCCCCACGCGCGAGNONE 
006-071-B06GCCCCACGCGCGAGNONE 
006-071-G08GCCCCACGCGCGAGNONE 
006-071-H10GCCCCACGCGCGAGNONE 
006-072-H11GCCCCACGCGCGAGNONE 
006-073-C12GCCCCACGCGCGAGNONE 
006-073-E07GCCCCACGCGCGAGNONE 
006-073-H09GCCCCACGCGCGAGNONE 
006-074-C03GCCCCACGCGCGAGNONE 
006-074-F03GCCCCACGCGCGAGNONE 
006-074-G02GCCCCACGCGCGAGNONE 
006-074-H12GCCCCACGCGCGAGNONE 
006-075-C06GCCCCACGCGCGAGNONE 
006-075-G07GCCCCACGCGCGAGNONE 
006-075-G08GCCCCACGCGCGAGNONE 
006-075-G09GCCCCACGCGCGAGNONE 
006-075-H09GCCCCACGCGCGAGNONE 
006-076-C02GCCCCACGCGCGAGNONE 
006-076-E12GCCCCACGCGCGAGNONE 
006-076-G04GCCCCACGCGCGAGNONE 
006-076-G06GCCCCACGCGCGAGNONE 
006-076-G11GCCCCACGCGCGAGNONE 
006-077-D09GCCCCACGCGCGAGNONE 
006-077-E08GCCCCACGCGCGAGNONE 
006-079-B10GCCCCACGCGCGAGNONE 
006-079-F11GCCCCACGCGCGAGNONE 
006-079-H04GCCCCACGCGCGAGNONE 
006-079-H11GCCCCACGCGCGAGNONE 
006-080-D06GCCCCACGCGCGAGNONE 
006-080-E10GCCCCACGCGCGAGNONE 
006-080-F09GCCCCACGCGCGAGNONE 
006-080-G04GCCCCACGCGCGAGNONE 
006-081-C05GCCCCACGCGCGAGNONE 
006-081-D08GCCCCACGCGCGAGNONE 
006-081-E09GCCCCACGCGCGAGNONE 
006-081-F07GCCCCACGCGCGAGNONE 
006-081-H11GCCCCACGCGCGAGNONE 
006-082-E05GCCCCACGCGCGAGNONE 
006-083-E12GCCCCACGCGCGAGNONE 
006-083-F12GCCCCACGCGCGAGNONE 
006-084-A10GCCCCACGCGCGAGNONE 
006-084-B07GCCCCACGCGCGAGNONE 
006-084-E05GCCCCACGCGCGAGNONE 
006-084-F07GCCCCACGCGCGAGNONE 
006-085-C01GCCCCACGCGCGAGNONE 
006-085-D08GCCCCACGCGCGAGNONE 
006-085-G07GCCCCACGCGCGAGNONE 
006-085-G11GCCCCACGCGCGAGNONE 
006-086-A01GCCCCACGCGCGAGNONE 
006-086-B09GCCCCACGCGCGAGNONE 
006-086-E05GCCCCACGCGCGAGNONE 
006-086-F11GCCCCACGCGCGAGNONE 
006-086-F12GCCCCACGCGCGAGNONE 
006-086-G03GCCCCACGCGCGAGNONE 
006-087-C01GCCCCACGCGCGAGNONE 
006-087-D09GCCCCACGCGCGAGNONE 
006-087-E02GCCCCACGCGCGAGNONE 
006-087-F07GCCCCACGCGCGAGNONE 
006-088-A05GCCCCACGCGCGAGNONE 
006-088-F02GCCCCACGCGCGAGNONE 
006-089-F08GCCCCACGCGCGAGNONE 
006-090-G11GCCCCACGCGCGAGNONE 
006-091-H10GCCCCACGCGCGAGNONE 
006-092-B09GCCCCACGCGCGAGNONE 
006-092-E09GCCCCACGCGCGAGNONE 
006-093-B01GCCCCACGCGCGAGNONE 
006-093-C09GCCCCACGCGCGAGNONE 
006-093-G08GCCCCACGCGCGAGNONE 
006-094-G06GCCCCACGCGCGAGNONE 
006-095-A11GCCCCACGCGCGAGNONE 
006-095-D06GCCCCACGCGCGAGNONE 
006-095-F06GCCCCACGCGCGAGNONE 
006-096-E05GCCCCACGCGCGAGNONE 
006-096-H05GCCCCACGCGCGAGNONE 
006-097-A04GCCCCACGCGCGAGNONE 
006-097-H01GCCCCACGCGCGAGNONE 
006-098-B10GCCCCACGCGCGAGNONE 
006-098-F01GCCCCACGCGCGAGNONE 
006-098-G08GCCCCACGCGCGAGNONE 
006-098-H08GCCCCACGCGCGAGNONE 
006-099-E01GCCCCACGCGCGAGNONE 
006-100-C11GCCCCACGCGCGAGNONE 
006-100-F03GCCCCACGCGCGAGNONE 
006-101-B03GCCCCACGCGCGAGNONE 
006-101-B06GCCCCACGCGCGAGNONE 
006-101-B09GCCCCACGCGCGAGNONE 
006-101-G02GCCCCACGCGCGAGNONE 
006-101-H03GCCCCACGCGCGAGNONE 
006-102-A03GCCCCACGCGCGAGNONE 
006-102-E11GCCCCACGCGCGAGNONE 
006-102-H01GCCCCACGCGCGAGNONE 
006-102-H03GCCCCACGCGCGAGNONE 
006-103-C04GCCCCACGCGCGAGNONE 
006-103-H06GCCCCACGCGCGAGNONE 
006-104-A03GCCCCACGCGCGAGNONE 
006-104-F11GCCCCACGCGCGAGNONE 
006-105-H05GCCCCACGCGCGAGNONE 
006-105-H07GCCCCACGCGCGAGNONE 
006-106-B12GCCCCACGCGCGAGNONE 
006-106-D04GCCCCACGCGCGAGNONE 
006-107-A08GCCCCACGCGCGAGNONE 
006-107-C03GCCCCACGCGCGAGNONE 
006-107-G02GCCCCACGCGCGAGNONE 
006-108-B06GCCCCACGCGCGAGNONE 
006-109-B02GCCCCACGCGCGAGNONE 
006-109-D08GCCCCACGCGCGAGNONE 
006-109-F11GCCCCACGCGCGAGNONE 
006-109-G08GCCCCACGCGCGAGNONE 
006-110-G12GCCCCACGCGCGAGNONE 
006-110-H07GCCCCACGCGCGAGNONE 
006-111-A01GCCCCACGCGCGAGNONE 
006-111-A11GCCCCACGCGCGAGNONE 
006-111-D01GCCCCACGCGCGAGNONE 
006-111-H10GCCCCACGCGCGAGNONE 
006-111-H11GCCCCACGCGCGAGNONE 
006-112-A03GCCCCACGCGCGAGNONE 
006-112-B02GCCCCACGCGCGAGNONE 
006-112-B10GCCCCACGCGCGAGNONE 
006-112-E12GCCCCACGCGCGAGNONE 
006-112-F06GCCCCACGCGCGAGNONE 
006-112-H10GCCCCACGCGCGAGNONE 
006-113-A10GCCCCACGCGCGAGNONE 
006-113-C07GCCCCACGCGCGAGNONE 
006-114-A04GCCCCACGCGCGAGNONE 
006-114-B10GCCCCACGCGCGAGNONE 
006-114-C04GCCCCACGCGCGAGNONE 
006-114-D03GCCCCACGCGCGAGNONE 
006-114-D07GCCCCACGCGCGAGNONE 
006-114-G11GCCCCACGCGCGAGNONE 
006-115-C01GCCCCACGCGCGAGNONE 
006-116-A12GCCCCACGCGCGAGNONE 
006-116-F09GCCCCACGCGCGAGNONE 
006-116-H01GCCCCACGCGCGAGNONE 
006-117-B04GCCCCACGCGCGAGNONE 
006-117-B08GCCCCACGCGCGAGNONE 
006-117-E07GCCCCACGCGCGAGNONE 
006-117-E11GCCCCACGCGCGAGNONE 
006-117-H04GCCCCACGCGCGAGNONE 
006-117-H11GCCCCACGCGCGAGNONE 
006-118-A12GCCCCACGCGCGAGNONE 
006-118-C01GCCCCACGCGCGAGNONE 
006-119-A12GCCCCACGCGCGAGNONE 
006-119-C11GCCCCACGCGCGAGNONE 
006-119-F06GCCCCACGCGCGAGNONE 
009-038-E07GCCCCACGCGCGAGNONE 
009-053-G07GCCCCACGCGCGAGNONE 
009-088-D05GCCCCACGCGCGAGNONE 
009-109-G12GCCCCACGCGCGAGNONE 
009-124-H09GCCCCACGCGCGAGNONE 
009-134-F04GCCCCACGCGCGAGNONE 
009-149-G07GCCCCACGCGCGAGNONE 
009-181-D07GCCCCACGCGCGAGNONE 
009-191-D03GCCCCACGCGCGAGNONE 
AK058305GCCCCACGCGCGAGNONE 
AK060851GCCCCACGCGCGAGSimilar to Chlorophyll a-b binding protein, chloroplast precursor (LHCII type I CAB) (LHCP). 
AK104281GCCCCACGCGCGAGNONE 
AK104288GCCCCACGCGCGAGNONE 
AK104350GCCCCACGCGCGAGNONE 
D00641GCCCCACGCGCGAGNONE 
J013091G20GCCCCACGCGCGAGNONE 
J013129G18GCCCCACGCGCGAGNONE 
J013158J17GCCCCACGCGCGAGNONE 
J023013M23GCCCCACGCGCGAGNONE 
J023062B14GCCCCACGCGCGAGNONE 
J023105C20GCCCCACGCGCGAGNONE 
J023113G18GCCCCACGCGCGAGNONE 
J065060F20GCCCCACGCGCGAGNONE 
J065132G17GCCCCACGCGCGAGNONE 
J065163A19GCCCCACGCGCGAGNONE 
J075001K18GCCCCACGCGCGAGNONE 
J075047E10GCCCCACGCGCGAGNONE 
J075050E09GCCCCACGCGCGAGNONE 
J075058J15GCCCCACGCGCGAGNONE 
J075086B22GCCCCACGCGCGAGNONE 
J075086E16GCCCCACGCGCGAGNONE 
J075092C16GCCCCACGCGCGAGNONE 
J075130A10GCCCCACGCGCGAGNONE 
J075140F10GCCCCACGCGCGAGNONE 
J075161K06GCCCCACGCGCGAGNONE 
J075176J22GCCCCACGCGCGAGNONE 
J075177I20GCCCCACGCGCGAGNONE 
J075179H01GCCCCACGCGCGAGNONE 
J080003C15GCCCCACGCGCGAGNONE 
J080005N03GCCCCACGCGCGAGNONE 
J080011I16GCCCCACGCGCGAGNONE 
J080014C08GCCCCACGCGCGAGNONE 
J080017L17GCCCCACGCGCGAGNONE 
J080018K10GCCCCACGCGCGAGNONE 
J080022J03GCCCCACGCGCGAGNONE 
J080024I10GCCCCACGCGCGAGNONE 
J080026F17GCCCCACGCGCGAGNONE 
J080029G15GCCCCACGCGCGAGNONE 
J080032H11GCCCCACGCGCGAGNONE 
J080034C09GCCCCACGCGCGAGNONE 
J080035B22GCCCCACGCGCGAGNONE 
J080037H20GCCCCACGCGCGAGNONE 
J080039J16GCCCCACGCGCGAGNONE 
J080042J20GCCCCACGCGCGAGNONE 
J080044F03GCCCCACGCGCGAGNONE 
J080044F23GCCCCACGCGCGAGNONE 
J080045H08GCCCCACGCGCGAGNONE 
J080048H13GCCCCACGCGCGAGNONE 
J080062K23GCCCCACGCGCGAGNONE 
J080063G19GCCCCACGCGCGAGNONE 
J080068M05GCCCCACGCGCGAGNONE 
J080069L18GCCCCACGCGCGAGNONE 
J080071P09GCCCCACGCGCGAGNONE 
J080074E21GCCCCACGCGCGAGNONE 
J080075A14GCCCCACGCGCGAGNONE 
J080075C06GCCCCACGCGCGAGNONE 
J080085D10GCCCCACGCGCGAGNONE 
J080085E07GCCCCACGCGCGAGNONE 
J080086E17GCCCCACGCGCGAGNONE 
J080089F09GCCCCACGCGCGAGNONE 
J080089O19GCCCCACGCGCGAGNONE 
J080096A04GCCCCACGCGCGAGNONE 
J080301D10GCCCCACGCGCGAGNONE 
J080301E15GCCCCACGCGCGAGNONE 
J080306C23GCCCCACGCGCGAGNONE 
J080307L24GCCCCACGCGCGAGNONE 
J080308G21GCCCCACGCGCGAGNONE 
J080315H03GCCCCACGCGCGAGNONE 
J090014I10GCCCCACGCGCGAGNONE 
J090018H12GCCCCACGCGCGAGNONE 
J090031J20GCCCCACGCGCGAGNONE 
J090055A05GCCCCACGCGCGAGNONE 
J090062H23GCCCCACGCGCGAGNONE 
J090071K20GCCCCACGCGCGAGNONE 
J090099G11GCCCCACGCGCGAGNONE 
J100045E10GCCCCACGCGCGAGNONE 
J100046E18GCCCCACGCGCGAGNONE 
J100052B19GCCCCACGCGCGAGNONE 
J100053A01GCCCCACGCGCGAGNONE 
J100079P18GCCCCACGCGCGAGNONE 
Os09g0417600006-110-A01CTCGCGCGCNONE 
AF467736CTCGCGCGCNONE 
AK059966CTCGCGCGCNONE 
AK068337CTCGCGCGCWRKY transcription factor 76. 
AY323479CTCGCGCGCNONE 
J013151N12CTCGCGCGCNONE 
J065064C11CTCGCGCGCNONE 
J065152D10CTCGCGCGCNONE 
J065162J10CTCGCGCGCNONE 
J075033B01CTCGCGCGCNONE 
Os09g0418000006-022-F01CTCGCGCGCNONE 
006-038-G10CTCGCGCGCNONE 
006-089-G04CTCGCGCGCNONE 
006-098-F07CTCGCGCGCNONE 
AK061220CTCGCGCGCNONE 
AK061493CTCGCGCGCNONE 
AK100881CTCGCGCGCNONE 
AK119760CTCGCGCGCProtein kinase-like domain containing protein. 
J023127H10CTCGCGCGCNONE 
J033122J01CTCGCGCGCNONE 
J065162D08CTCGCGCGCNONE 
J065214P03CTCGCGCGCNONE 
J090009B17CTCGCGCGCNONE 
J090093C21CTCGCGCGCNONE 
J100067C01CTCGCGCGCNONE 
J100067P06CTCGCGCGCNONE 
Os09g0433000009-198-H02CTCGCGCGCNONE 
AK063243CTCGCGCGCNONE 
Os09g0445600AK107839CTCGCGCGConserved hypothetical protein. 
Os09g0456200015-025-E01CTCGCGCGCCACGTNONE 
AK065873CTCGCGCGCCACGTSimilar to BZIP transcription factor ABI5. 
J013049N23CTCGCGCGCCACGTNONE 
J033128E10CTCGCGCGCCACGTNONE 
Os09g0459900009-190-G09CTCGCGCGCNONE 
AK063208CTCGCGCGCCyclin-dependent kinase inhibitor family protein. 
AK111010CTCGCGCGCNONE 
Os09g0476100AK099938CTCGCGCGTGGGGCCCACCCGRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os09g0480600AK107853GTCGCGCGCGCGAGHypothetical protein. 
Os09g0511600015-078-A09CTCGCGCGAGNONE 
015-078-A09CTCGCGCGCNONE 
AK102869CTCGCGCGAGNONE 
AK102869CTCGCGCGCNONE 
AK121679CTCGCGCGAGNONE 
AK121679CTCGCGCGCNONE 
AK121935CTCGCGCGAGGlycoside hydrolase, family 1 protein. 
AK121935CTCGCGCGCGlycoside hydrolase, family 1 protein. 
Os09g0526700011-075-B12CTCGCGCGCNONE 
AB097460CTCGCGCGCNONE 
AK073610CTCGCGCGCSimilar to UDP-glucose 4-epimerase (EC 5.1.3.2) (Galactowaldenase) (UDP-galactose 4-epimerase). 
AK104977CTCGCGCGCNONE 
Os11g0146700AK065900CTCGCGCGNONE 
AK072412CTCGCGCGRED-like, C-terminal family protein. 
Os11g0216900AK060326CTCGCGCGCGTGGGCCTTGSimilar to IDI2. 
AK060549CTCGCGCGCGTGGGCCTTGNONE 
AK100869CTCGCGCGCGTGGGCCTTGNONE 
Os11g0223000J065060C21AGATGGGCGCGCGAGNONE 
Os11g0586300AK072257CTCGCGCGCConserved hypothetical protein. 
Os11g0619800016-094-C06CTCGCGCGCNONE 
AK107437CTCGCGCGCTRAF-like domain containing protein. 
Os12g0149300AK110842CTCGCGCGCSimilar to Xyloglucan 6-xylosyltransferase (EC 2.4.2.39) (AtXT1). 
Os12g0149900004-010-G09CTCGCGCGNONE 
AK060888CTCGCGCGNONE 
AK072203CTCGCGCGIQ calmodulin-binding region domain containing protein. 
AK102297CTCGCGCGNONE 
J013050I08CTCGCGCGNONE 
J013096D15CTCGCGCGNONE 
J033025C09CTCGCGCGNONE 
J033061C16CTCGCGCGNONE 
J033079M05CTCGCGCGNONE 
J033089L12CTCGCGCGNONE 
J033147F22CTCGCGCGNONE 
J043036P05CTCGCGCGNONE 
J090022O19CTCGCGCGNONE 
J100063L21CTCGCGCGNONE 
J100084K12CTCGCGCGNONE 
J100089F24CTCGCGCGNONE 
Os12g0535400004-008-H02CGCGCGAGNONE 
004-008-H02CTCGCGCGGCTCGGNONE 
AK065318CGCGCGAGHypothetical protein. 
AK065318CTCGCGCGGCTCGGHypothetical protein. 
J013002P10CGCGCGAGNONE 
J013002P10CTCGCGCGGCTCGGNONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.