version

Summary of OsREG559 (All List)

OrganismOryza sativa  
IDOsREG559  
SequenceCGCGTCGC  
Annotation  
PPDB Motif 
PLACE MotifCGACG  "CGACG element" found in the GC-rich regions of the rice (O.s.) Amy3D and Amy3E amylase genes, but not in Amy3E gene; May function as a coupling element for the G box element;  
Total Entry Count2206  

Entry Sequences (2206 entries)

LocusGene modelSequenceDescription
Os01g0141100012-043-A12GCGACGCGNONE 
AK062139GCGACGCGNONE 
J013110M14GCGACGCGNONE 
J013114F09GCGACGCGNONE 
J033036J01GCGACGCGNONE 
Os01g0172400AK065102CGCGACGCGACNONE 
AK100365CGCGACGCGACNONE 
AK119523CGCGACGCGACNONE 
D73411CGCGACGCGACPhospholipase D alpha 1 precursor (EC 3.1.4.4) (PLD alpha 1) (Choline phosphatase 1) (Phosphatidylcholine-hydrolyzing phospholipase D 1). 
J013001N03CGCGACGCGACNONE 
J013052B12CGCGACGCGACNONE 
J013071F15CGCGACGCGACNONE 
J013108F19CGCGACGCGACNONE 
J023025E17CGCGACGCGACNONE 
J023083O10CGCGACGCGACNONE 
J023084M17CGCGACGCGACNONE 
J023100D16CGCGACGCGACNONE 
J023107O10CGCGACGCGACNONE 
J023119F08CGCGACGCGACNONE 
J033035B07CGCGACGCGACNONE 
J033052C18CGCGACGCGACNONE 
J033092H11CGCGACGCGACNONE 
J033096D02CGCGACGCGACNONE 
J033117A16CGCGACGCGACNONE 
J043010E08CGCGACGCGACNONE 
J043013C12CGCGACGCGACNONE 
J065001M15CGCGACGCGACNONE 
J065021O11CGCGACGCGACNONE 
J065089O20CGCGACGCGACNONE 
J065117N05CGCGACGCGACNONE 
J065129L11CGCGACGCGACNONE 
J065170F18CGCGACGCGACNONE 
J090066E11CGCGACGCGACNONE 
J090076N24CGCGACGCGACNONE 
J090093G21CGCGACGCGACNONE 
J100041H17CGCGACGCGACNONE 
J100050D07CGCGACGCGACNONE 
J100063A06CGCGACGCGACNONE 
Os01g0179300AB118015CGCGACGCGNONE 
AK066179CGCGACGCGConserved hypothetical protein. 
J013027I24CGCGACGCGNONE 
J013057C04CGCGACGCGNONE 
J013114A12CGCGACGCGNONE 
J033044D13CGCGACGCGNONE 
J033088C17CGCGACGCGNONE 
J065079P13CGCGACGCGNONE 
J065097I15CGCGACGCGNONE 
J100025A19CGCGACGCGNONE 
J100027L07CGCGACGCGNONE 
J100035E12CGCGACGCGNONE 
J100076G01CGCGACGCGNONE 
Os01g0201400AK070397CGCGTCGCGRapid ALkalinization Factor family protein. 
Os01g0205900006-057-B04CGCACGCGACGCGACNONE 
AK060687CGCACGCGACGCGACNONE 
AK105932CGCACGCGACGCGACSimilar to Class III peroxidase GvPx2b (Fragment). 
J033143I12CGCACGCGACGCGACNONE 
J075013J08CGCACGCGACGCGACNONE 
J075090B11CGCACGCGACGCGACNONE 
J075143C17CGCACGCGACGCGACNONE 
J075147O13CGCACGCGACGCGACNONE 
J075161L02CGCACGCGACGCGACNONE 
Os01g0223600AK110821CGCGTCGCSimilar to Pto kinase interactor 1-like protein. 
Os01g0224500AK109225GCAGCCCACCACGCGACGCGCGACConserved hypothetical protein. 
Os01g0226400AK102301CGCGACGCGAAA ATPase domain containing protein. 
Os01g0231500AK111599CGCGTCGCSimilar to Casein kinase I (Fragment). 
J013002P18CGCGTCGCNONE 
J013021D19CGCGTCGCNONE 
J013075E24CGCGTCGCNONE 
J013095J05CGCGTCGCNONE 
J013098O18CGCGTCGCNONE 
J013126P20CGCGTCGCNONE 
J033123B12CGCGTCGCNONE 
J090048M08CGCGTCGCNONE 
Os01g0268000AK107975GTCGCGTCGCHypothetical protein. 
J065065G10GTCGCGTCGCNONE 
J065196O11GTCGCGTCGCNONE 
Os01g0279700AK067683CGCGTCGCGTCNONE 
AK100107CGCGTCGCGTCMajor facilitator superfamily protein. 
J023004N09CGCGTCGCGTCNONE 
J075019L14CGCGTCGCGTCNONE 
J075187F21CGCGTCGCGTCNONE 
Os01g0295700AK070333CCCCCGCGCGTCGCSimilar to Protein phosphatase-2C. 
Os01g0305900Os01g0305900CGCGTCGCGTCGCSimilar to A-type R2R3 Myb protein (Fragment). 
Os01g0390400AK067433ACGTGTCGCGACGCGNONE 
AK106834ACGTGTCGCGACGCGNONE 
J033069B09ACGTGTCGCGACGCGNONE 
Os01g0391100012-001-B05CGCGACGCGTGGCCGAGACGTGGCNONE 
012-053-F01CGCGACGCGTGGCCGAGACGTGGCNONE 
AK063499CGCGACGCGTGGCCGAGACGTGGCNONE 
J065021A04CGCGACGCGTGGCCGAGACGTGGCNONE 
J065076H06CGCGACGCGTGGCCGAGACGTGGCNONE 
J065181E05CGCGACGCGTGGCCGAGACGTGGCNONE 
J065187A05CGCGACGCGTGGCCGAGACGTGGCNONE 
J075036C17CGCGACGCGTGGCCGAGACGTGGCNONE 
J075051C18CGCGACGCGTGGCCGAGACGTGGCNONE 
J075063L16CGCGACGCGTGGCCGAGACGTGGCNONE 
J075079M08CGCGACGCGTGGCCGAGACGTGGCNONE 
J075112H15CGCGACGCGTGGCCGAGACGTGGCNONE 
J075135F10CGCGACGCGTGGCCGAGACGTGGCNONE 
J075164H06CGCGACGCGTGGCCGAGACGTGGCNONE 
J075195N02CGCGACGCGTGGCCGAGACGTGGCNONE 
Os01g0550300006-081-F12CCGAGCCGAGCCGCGTCGCNONE 
006-114-A02CCGAGCCGAGCCGCGTCGCNONE 
006-117-A04CCGAGCCGAGCCGCGTCGCNONE 
011-003-H03CCGAGCCGAGCCGCGTCGCNONE 
011-025-B09CCGAGCCGAGCCGCGTCGCNONE 
011-069-B06CCGAGCCGAGCCGCGTCGCNONE 
011-074-D07CCGAGCCGAGCCGCGTCGCNONE 
012-029-E03CCGAGCCGAGCCGCGTCGCNONE 
012-050-F04CCGAGCCGAGCCGCGTCGCNONE 
012-072-D11CCGAGCCGAGCCGCGTCGCNONE 
013-093-E04CCGAGCCGAGCCGCGTCGCNONE 
015-070-C10CCGAGCCGAGCCGCGTCGCNONE 
015-089-A01CCGAGCCGAGCCGCGTCGCNONE 
015-095-H06CCGAGCCGAGCCGCGTCGCNONE 
016-014-H08CCGAGCCGAGCCGCGTCGCNONE 
016-056-E07CCGAGCCGAGCCGCGTCGCNONE 
016-089-A01CCGAGCCGAGCCGCGTCGCNONE 
AK061870CCGAGCCGAGCCGCGTCGCSimilar to Gda-1 protein. 
AK067529CCGAGCCGAGCCGCGTCGCNONE 
AK106151CCGAGCCGAGCCGCGTCGCNONE 
J013039D11CCGAGCCGAGCCGCGTCGCNONE 
J013050K19CCGAGCCGAGCCGCGTCGCNONE 
J013069F08CCGAGCCGAGCCGCGTCGCNONE 
J013108E24CCGAGCCGAGCCGCGTCGCNONE 
J013132D19CCGAGCCGAGCCGCGTCGCNONE 
J023039B18CCGAGCCGAGCCGCGTCGCNONE 
J023088C10CCGAGCCGAGCCGCGTCGCNONE 
J023121M13CCGAGCCGAGCCGCGTCGCNONE 
J033034I21CCGAGCCGAGCCGCGTCGCNONE 
J033118N14CCGAGCCGAGCCGCGTCGCNONE 
J033150M22CCGAGCCGAGCCGCGTCGCNONE 
J043004F18CCGAGCCGAGCCGCGTCGCNONE 
J043005J04CCGAGCCGAGCCGCGTCGCNONE 
J043020E12CCGAGCCGAGCCGCGTCGCNONE 
J065063C02CCGAGCCGAGCCGCGTCGCNONE 
J065102D15CCGAGCCGAGCCGCGTCGCNONE 
J065200P03CCGAGCCGAGCCGCGTCGCNONE 
J065208C22CCGAGCCGAGCCGCGTCGCNONE 
J065215B03CCGAGCCGAGCCGCGTCGCNONE 
J075013N21CCGAGCCGAGCCGCGTCGCNONE 
J075024P21CCGAGCCGAGCCGCGTCGCNONE 
J075027L19CCGAGCCGAGCCGCGTCGCNONE 
J075037F12CCGAGCCGAGCCGCGTCGCNONE 
J075084P15CCGAGCCGAGCCGCGTCGCNONE 
J075086M06CCGAGCCGAGCCGCGTCGCNONE 
J075116A02CCGAGCCGAGCCGCGTCGCNONE 
J075136P18CCGAGCCGAGCCGCGTCGCNONE 
J075181A01CCGAGCCGAGCCGCGTCGCNONE 
J075198O11CCGAGCCGAGCCGCGTCGCNONE 
J080002B20CCGAGCCGAGCCGCGTCGCNONE 
J080003E05CCGAGCCGAGCCGCGTCGCNONE 
J080005A18CCGAGCCGAGCCGCGTCGCNONE 
J080005E02CCGAGCCGAGCCGCGTCGCNONE 
J080005O18CCGAGCCGAGCCGCGTCGCNONE 
J080007B04CCGAGCCGAGCCGCGTCGCNONE 
J080007L18CCGAGCCGAGCCGCGTCGCNONE 
J080008C17CCGAGCCGAGCCGCGTCGCNONE 
J080011I03CCGAGCCGAGCCGCGTCGCNONE 
J080014B07CCGAGCCGAGCCGCGTCGCNONE 
J080014B09CCGAGCCGAGCCGCGTCGCNONE 
J080015A11CCGAGCCGAGCCGCGTCGCNONE 
J080016B07CCGAGCCGAGCCGCGTCGCNONE 
J080017H23CCGAGCCGAGCCGCGTCGCNONE 
J080020G09CCGAGCCGAGCCGCGTCGCNONE 
J080020I23CCGAGCCGAGCCGCGTCGCNONE 
J080021E15CCGAGCCGAGCCGCGTCGCNONE 
J080023O13CCGAGCCGAGCCGCGTCGCNONE 
J080024H17CCGAGCCGAGCCGCGTCGCNONE 
J080029P12CCGAGCCGAGCCGCGTCGCNONE 
J080030A15CCGAGCCGAGCCGCGTCGCNONE 
J080032I03CCGAGCCGAGCCGCGTCGCNONE 
J080032P18CCGAGCCGAGCCGCGTCGCNONE 
J080034E10CCGAGCCGAGCCGCGTCGCNONE 
J080038I23CCGAGCCGAGCCGCGTCGCNONE 
J080040B22CCGAGCCGAGCCGCGTCGCNONE 
J080040M13CCGAGCCGAGCCGCGTCGCNONE 
J080041E07CCGAGCCGAGCCGCGTCGCNONE 
J080042C08CCGAGCCGAGCCGCGTCGCNONE 
J080042H08CCGAGCCGAGCCGCGTCGCNONE 
J080043H10CCGAGCCGAGCCGCGTCGCNONE 
J080046J02CCGAGCCGAGCCGCGTCGCNONE 
J080050D12CCGAGCCGAGCCGCGTCGCNONE 
J080052C17CCGAGCCGAGCCGCGTCGCNONE 
J080054A05CCGAGCCGAGCCGCGTCGCNONE 
J080054J23CCGAGCCGAGCCGCGTCGCNONE 
J080056A15CCGAGCCGAGCCGCGTCGCNONE 
J080056F18CCGAGCCGAGCCGCGTCGCNONE 
J080059P07CCGAGCCGAGCCGCGTCGCNONE 
J080063J18CCGAGCCGAGCCGCGTCGCNONE 
J080066F15CCGAGCCGAGCCGCGTCGCNONE 
J080067G12CCGAGCCGAGCCGCGTCGCNONE 
J080070G15CCGAGCCGAGCCGCGTCGCNONE 
J080071B08CCGAGCCGAGCCGCGTCGCNONE 
J080071M08CCGAGCCGAGCCGCGTCGCNONE 
J080071N03CCGAGCCGAGCCGCGTCGCNONE 
J080074C01CCGAGCCGAGCCGCGTCGCNONE 
J080076F22CCGAGCCGAGCCGCGTCGCNONE 
J080076N23CCGAGCCGAGCCGCGTCGCNONE 
J080077F23CCGAGCCGAGCCGCGTCGCNONE 
J080077P10CCGAGCCGAGCCGCGTCGCNONE 
J080078A19CCGAGCCGAGCCGCGTCGCNONE 
J080078H07CCGAGCCGAGCCGCGTCGCNONE 
J080079G16CCGAGCCGAGCCGCGTCGCNONE 
J080079N23CCGAGCCGAGCCGCGTCGCNONE 
J080084L04CCGAGCCGAGCCGCGTCGCNONE 
J080084N12CCGAGCCGAGCCGCGTCGCNONE 
J080084N17CCGAGCCGAGCCGCGTCGCNONE 
J080086H08CCGAGCCGAGCCGCGTCGCNONE 
J080088M01CCGAGCCGAGCCGCGTCGCNONE 
J080090M14CCGAGCCGAGCCGCGTCGCNONE 
J080092F06CCGAGCCGAGCCGCGTCGCNONE 
J080095B14CCGAGCCGAGCCGCGTCGCNONE 
J080095C09CCGAGCCGAGCCGCGTCGCNONE 
J080095F20CCGAGCCGAGCCGCGTCGCNONE 
J080095H12CCGAGCCGAGCCGCGTCGCNONE 
J080096H22CCGAGCCGAGCCGCGTCGCNONE 
J090010O21CCGAGCCGAGCCGCGTCGCNONE 
J090012K22CCGAGCCGAGCCGCGTCGCNONE 
J090051I21CCGAGCCGAGCCGCGTCGCNONE 
J090065G14CCGAGCCGAGCCGCGTCGCNONE 
J090077H03CCGAGCCGAGCCGCGTCGCNONE 
J100035M10CCGAGCCGAGCCGCGTCGCNONE 
J100049C19CCGAGCCGAGCCGCGTCGCNONE 
J100051K11CCGAGCCGAGCCGCGTCGCNONE 
J100064C12CCGAGCCGAGCCGCGTCGCNONE 
J100064F13CCGAGCCGAGCCGCGTCGCNONE 
J100084H08CCGAGCCGAGCCGCGTCGCNONE 
Os01g0594900AK070921CGCGCGACGCCGCGACGCGConserved hypothetical protein. 
J023074J04CGCGCGACGCCGCGACGCGNONE 
J023078B04CGCGCGACGCCGCGACGCGNONE 
J023078N11CGCGCGACGCCGCGACGCGNONE 
J075143E19CGCGCGACGCCGCGACGCGNONE 
J075187L10CGCGCGACGCCGCGACGCGNONE 
J080010N23CGCGCGACGCCGCGACGCGNONE 
J080013C01CGCGCGACGCCGCGACGCGNONE 
J080013G03CGCGCGACGCCGCGACGCGNONE 
J080016I23CGCGCGACGCCGCGACGCGNONE 
J080017E01CGCGCGACGCCGCGACGCGNONE 
J080029E18CGCGCGACGCCGCGACGCGNONE 
J080034L24CGCGCGACGCCGCGACGCGNONE 
J080039N12CGCGCGACGCCGCGACGCGNONE 
J080067L11CGCGCGACGCCGCGACGCGNONE 
J080068N08CGCGCGACGCCGCGACGCGNONE 
J080069E19CGCGCGACGCCGCGACGCGNONE 
J080071E16CGCGCGACGCCGCGACGCGNONE 
J080077J09CGCGCGACGCCGCGACGCGNONE 
J080085E03CGCGCGACGCCGCGACGCGNONE 
J080301J09CGCGCGACGCCGCGACGCGNONE 
J080303L19CGCGCGACGCCGCGACGCGNONE 
J080308B12CGCGCGACGCCGCGACGCGNONE 
Os01g0606900AK065697CGCGTCGCGHeat shock protein DnaJ, N-terminal domain containing protein. 
Os01g0609300AK100135CGCGTCGCNONE 
Os01g0623500AK066142CGCGACGCGACAAA ATPase domain containing protein. 
J013055O07CGCGACGCGACNONE 
J053069D06CGCGACGCGACNONE 
J053095J11CGCGACGCGACNONE 
J065106D24CGCGACGCGACNONE 
J065134H18CGCGACGCGACNONE 
J075066D09CGCGACGCGACNONE 
J090004M17CGCGACGCGACNONE 
J100039L05CGCGACGCGACNONE 
J100042E15CGCGACGCGACNONE 
J100043B18CGCGACGCGACNONE 
J100057L11CGCGACGCGACNONE 
J100067C24CGCGACGCGACNONE 
J100073H01CGCGACGCGACNONE 
J100081J21CGCGACGCGACNONE 
Os01g0623900J090025M21CACGCCACGCCACGCGACGCGACNONE 
J090082F22CACGCCACGCCACGCGACGCGACNONE 
J090084L02CACGCCACGCCACGCGACGCGACSimilar to Splicing factor, arginine/serine-rich 2 (Splicing factor SC35) (SC-35) (Splicing component, 35 kDa) (PR264 protein). 
Os01g0663400AK072645CGCGACGCGNONE 
J090023O22CGCGACGCGNONE 
J090054G09CGCGACGCGNONE 
J090058H13CGCGACGCGNONE 
J090076G13CGCGACGCGNONE 
Os01g0667900013-097-A02CGCGTCGCGNONE 
014-011-C01CGCGTCGCGNONE 
AK105335CGCGTCGCGGlutaredoxin-like, plant II family protein. 
J065156F10CGCGTCGCGNONE 
J065163D22CGCGTCGCGNONE 
J065197J04CGCGTCGCGNONE 
J075122C02CGCGTCGCGNONE 
J100047L16CGCGTCGCGNONE 
Os01g0679400AK107970CGCGTCGCConserved hypothetical protein. 
Os01g0681900AB008845GTGTGGGGACGCGACGCGNADH dependent Glutamate Synthase precursor (EC 1.4.1.14). 
AK105755GTGTGGGGACGCGACGCGNONE 
Os01g0699600009-111-F06CGCGACGCGNONE 
AK105196CGCGACGCGProtein kinase-like domain containing protein. 
J065128A07CGCGACGCGNONE 
Os01g0701900AK066793CGCGACGCGTGGSimilar to Phosphatidylinositol transfer-like protein III. 
Os01g0704100AK072215CGCGACGCGSimilar to Membrane transporter. 
AK109776CGCGACGCGNONE 
J080037E03CGCGACGCGNONE 
J080041H13CGCGACGCGNONE 
J080046B15CGCGACGCGNONE 
J080058K14CGCGACGCGNONE 
J080065E14CGCGACGCGNONE 
J080079C08CGCGACGCGNONE 
J080088J12CGCGACGCGNONE 
J080088M19CGCGACGCGNONE 
J100043G11CGCGACGCGNONE 
J100059M22CGCGACGCGNONE 
Os01g0723600AK109735GCGACGCGRibose-phosphate pyrophosphokinase 3 (EC 2.7.6.1) (Phosphoribosyl pyrophosphate synthetase 3). 
Os01g0727100AK068181CGCGTCGCGlycosyl transferase, family 8 protein. 
AK105758CGCGTCGCNONE 
J013126C21CGCGTCGCNONE 
J023049F24CGCGTCGCNONE 
J033140G15CGCGTCGCNONE 
Os01g0733200AK066316CGCGACGCGACSimilar to Heat shock transcription factor 29 (Fragment). 
AY344493CGCGACGCGACNONE 
J013066G03CGCGACGCGACNONE 
J090034J08CGCGACGCGACNONE 
Os01g0752800009-155-D12GTCGCGTCGCNONE 
AK103612GTCGCGTCGCSimilar to HASP protein-like protein (Fragment). 
J013063A16GTCGCGTCGCNONE 
J023007N11GTCGCGTCGCNONE 
J033141J21GTCGCGTCGCNONE 
Os01g0754100009-056-C10CGCGTCGCNONE 
AK067551CGCGTCGCNucleic acid-binding, OB-fold domain containing protein. 
J065144A01CGCGTCGCNONE 
J065152E22CGCGTCGCNONE 
J065203O16CGCGTCGCNONE 
J075190L18CGCGTCGCNONE 
J090084A09CGCGTCGCNONE 
Os01g0760900AK107573CGCGTCGCConserved hypothetical protein. 
J075002J19CGCGTCGCNONE 
Os01g0761100AK122112GCGACGCGTesmin/TSO1-like, CXC domain containing protein. 
Os01g0765400015-011-F09CCCATCCACGCGACGCGNONE 
AK106246CCCATCCACGCGACGCGProteinase inhibitor I4, serpin family protein. 
J100034N10CCCATCCACGCGACGCGNONE 
J100054I23CCCATCCACGCGACGCGNONE 
J100055K02CCCATCCACGCGACGCGNONE 
J100082D02CCCATCCACGCGACGCGNONE 
Os01g0774500AK069241GCGACGCGACGCGConserved hypothetical protein. 
Os01g0794100009-027-B12CGCGTCGCGNONE 
AK062404CGCGTCGCGConserved hypothetical protein. 
Os01g0796700AK120491CGCGTCGCGCGZinc finger, RING-type domain containing protein. 
Os01g0812900009-200-B11CGCGTCGCGTCNONE 
AK121582CGCGTCGCGTCConserved hypothetical protein. 
J013120B14CGCGTCGCGTCNONE 
J023049H09CGCGTCGCGTCNONE 
J023107J02CGCGTCGCGTCNONE 
J033025F24CGCGTCGCGTCNONE 
J033037D14CGCGTCGCGTCNONE 
J033084J01CGCGTCGCGTCNONE 
J033128E11CGCGTCGCGTCNONE 
J065140B08CGCGTCGCGTCNONE 
J075019M06CGCGTCGCGTCNONE 
J075023B03CGCGTCGCGTCNONE 
J075053H24CGCGTCGCGTCNONE 
J075067J23CGCGTCGCGTCNONE 
J075069E12CGCGTCGCGTCNONE 
J075122C03CGCGTCGCGTCNONE 
J075146G01CGCGTCGCGTCNONE 
J075150L21CGCGTCGCGTCNONE 
J075156M23CGCGTCGCGTCNONE 
J075161H02CGCGTCGCGTCNONE 
J075170F21CGCGTCGCGTCNONE 
Os01g0813900AK101729CGCGACGCGTCCSimilar to ZIGA1 protein (Fragment). 
Os01g0833200AK121629CGCGTCGCGCGConserved hypothetical protein. 
J023093N07CGCGTCGCGCGNONE 
J033050C20CGCGTCGCGCGNONE 
J080302F22CGCGTCGCGCGNONE 
J080303H06CGCGTCGCGCGNONE 
J080306J04CGCGTCGCGCGNONE 
J080309K06CGCGTCGCGCGNONE 
J080311E18CGCGTCGCGCGNONE 
J080318A20CGCGTCGCGCGNONE 
J100031F20CGCGTCGCGCGNONE 
J100034P21CGCGTCGCGCGNONE 
J100042K08CGCGTCGCGCGNONE 
J100047H24CGCGTCGCGCGNONE 
J100065C14CGCGTCGCGCGNONE 
J100074E23CGCGTCGCGCGNONE 
Os01g0833500AK073320CGCGTCGCSimilar to Serine carboxypeptidase II-1 precursor (EC 3.4.16.6) (CP-MII.1) (Fragment). 
Os01g0847200AK061976CGCGTCGCNONE 
AK064779CGCGTCGCNONE 
AK122126CGCGTCGCSimilar to Mannose-1-phosphate guanyltransferase (EC 2.7.7.13) (ATP-mannose-1- phosphate guanylyltransferase) (GDP-mannose pyrophosphorylase) (NDP- hexose pyrophosphorylase). 
J033050F01CGCGTCGCNONE 
J033132D02CGCGTCGCNONE 
Os01g0851100AK071217CGCGTCGCGNONE 
Os01g0859600011-041-F12GCGACGCGTGCGNONE 
AK072151GCGACGCGTGCGCyclin-like F-box domain containing protein. 
J013031O08GCGACGCGTGCGNONE 
J013049K06GCGACGCGTGCGNONE 
J013095P13GCGACGCGTGCGNONE 
J013108J06GCGACGCGTGCGNONE 
J013109C18GCGACGCGTGCGNONE 
J013111E15GCGACGCGTGCGNONE 
J013132O07GCGACGCGTGCGNONE 
J023086B20GCGACGCGTGCGNONE 
J023101N16GCGACGCGTGCGNONE 
J033025C17GCGACGCGTGCGNONE 
J033103E23GCGACGCGTGCGNONE 
J033105C11GCGACGCGTGCGNONE 
J033126A20GCGACGCGTGCGNONE 
J090018G15GCGACGCGTGCGNONE 
J090031F06GCGACGCGTGCGNONE 
J090056E09GCGACGCGTGCGNONE 
J090075M18GCGACGCGTGCGNONE 
J100024M05GCGACGCGTGCGNONE 
J100032F09GCGACGCGTGCGNONE 
Os01g0867900AK061366CGCGTCGCAGGTGGGTCCCACCTGProtein of unknown function DUF502 family protein. 
Os01g0869800006-029-F03CGCGTCGCGNONE 
006-067-H02CGCGTCGCGNONE 
006-084-A06CGCGTCGCGNONE 
AK058284CGCGTCGCGSimilar to Photosystem II subunit PsbS. 
AK071827CGCGTCGCGNONE 
AK104275CGCGTCGCGNONE 
J013049J07CGCGTCGCGNONE 
J033089F12CGCGTCGCGNONE 
J090094I11CGCGTCGCGNONE 
Os01g0875500012-063-E07CGCGTCGCGTCGCGNONE 
AK101399CGCGTCGCGTCGCGSimilar to Beta-galactosidase (EC 3.2.1.23). 
AK102715CGCGTCGCGTCGCGNONE 
J023104F17CGCGTCGCGTCGCGNONE 
J023128M07CGCGTCGCGTCGCGNONE 
J033022B13CGCGTCGCGTCGCGNONE 
J033034C09CGCGTCGCGTCGCGNONE 
J033037E13CGCGTCGCGTCGCGNONE 
J033044E15CGCGTCGCGTCGCGNONE 
J033085M16CGCGTCGCGTCGCGNONE 
J033087L24CGCGTCGCGTCGCGNONE 
J033089G01CGCGTCGCGTCGCGNONE 
J033093D16CGCGTCGCGTCGCGNONE 
J033102B22CGCGTCGCGTCGCGNONE 
J033108E02CGCGTCGCGTCGCGNONE 
J033115P07CGCGTCGCGTCGCGNONE 
J033122A10CGCGTCGCGTCGCGNONE 
J090033B09CGCGTCGCGTCGCGNONE 
J090038A15CGCGTCGCGTCGCGNONE 
J090053G04CGCGTCGCGTCGCGNONE 
J090069H01CGCGTCGCGTCGCGNONE 
J090093F16CGCGTCGCGTCGCGNONE 
Os01g0904200AK068432CGCGTCGCGProtein kinase-like domain containing protein. 
J100027C22CGCGTCGCGNONE 
J100064A19CGCGTCGCGNONE 
Os01g0926400AK063916GTCGCGTCGCNONE 
AK073976GTCGCGTCGCSimilar to Pectin-glucuronyltransferase. 
Os01g0937100AK105806CGCGTCGCSimilar to Xylanase inhibitor precursor (Xylanase inhibitor TAXI-I). 
J033069E12CGCGTCGCNONE 
Os01g0950900AK101121CCGAGCCGCGTCGCProtein of unknown function DUF221 domain containing protein. 
J023036H24CCGAGCCGCGTCGCNONE 
J023084G23CCGAGCCGCGTCGCNONE 
J033025J04CCGAGCCGCGTCGCNONE 
J033139J18CCGAGCCGCGTCGCNONE 
J090006A09CCGAGCCGCGTCGCNONE 
J090036D02CCGAGCCGCGTCGCNONE 
Os01g0962500AK073163CGCGTCGCGZinc finger, HIT-type domain containing protein. 
AK105822CGCGTCGCGNONE 
J033024I07CGCGTCGCGNONE 
Os02g0160900J075127G12GCGACGCGConserved hypothetical protein. 
Os02g0169300006-023-D12GCGACGCGNONE 
006-062-B01GCGACGCGNONE 
015-049-F11GCGACGCGNONE 
015-057-G02GCGACGCGNONE 
015-092-F04GCGACGCGNONE 
015-095-H02GCGACGCGNONE 
015-097-B07GCGACGCGNONE 
AK070041GCGACGCGSimilar to Phosphoglycerate kinase, cytosolic (EC 2.7.2.3). 
J013042K07GCGACGCGNONE 
J013134H23GCGACGCGNONE 
J013134J23GCGACGCGNONE 
J023036N24GCGACGCGNONE 
J023049C06GCGACGCGNONE 
J023077E10GCGACGCGNONE 
J023077F10GCGACGCGNONE 
J023105N12GCGACGCGNONE 
J033036O12GCGACGCGNONE 
J033064P11GCGACGCGNONE 
J033079F01GCGACGCGNONE 
J033123M22GCGACGCGNONE 
J033143E10GCGACGCGNONE 
J075013D12GCGACGCGNONE 
Os02g0173100AK066680CGCGTCGCNONE 
AK100596CGCGTCGCSimilar to Cytochrome P450 97B3 (EC 1.14.-.-). 
J023106P10CGCGTCGCNONE 
Os02g0179200AK111348CGCGACGCGTCGCGlutamine amidotransferase class-I domain containing protein. 
J065218O07CGCGACGCGTCGCNONE 
Os02g0195500AK062207CGCGACGCGNONE 
Os02g0302200Os02g0302200GCGACGCGConserved hypothetical protein. 
Os02g0462800AK110587CGCGTCGCGTCGCGTCGCGWRKY transcription factor 42 (Transcription factor WRKY02). 
AY676923CGCGTCGCGTCGCGTCGCGNONE 
Os02g0471500AK120615GTCGCGTCGCNONE 
AK120927GTCGCGTCGCProtein phosphatase 2C-like domain containing protein. 
Os02g0497700011-094-A10CGCGTCGCNONE 
011-094-A10CGCGTCGCGNONE 
012-073-H02CGCGTCGCNONE 
012-073-H02CGCGTCGCGNONE 
016-056-G05CGCGTCGCNONE 
016-056-G05CGCGTCGCGNONE 
AK070143CGCGTCGCNONE 
AK070143CGCGTCGCGNONE 
J023041O14CGCGTCGCNONE 
J023041O14CGCGTCGCGNONE 
J023092H01CGCGTCGCNONE 
J023092H01CGCGTCGCGNONE 
J033048A17CGCGTCGCNONE 
J033048A17CGCGTCGCGNONE 
J033051K21CGCGTCGCNONE 
J033051K21CGCGTCGCGNONE 
J033122D01CGCGTCGCNONE 
J033122D01CGCGTCGCGNONE 
J090032E23CGCGTCGCNONE 
J090032E23CGCGTCGCGNONE 
J090055K13CGCGTCGCNONE 
J090055K13CGCGTCGCGNONE 
Os02g0522000AK101294GCTGGGCCGGTGGACGCGTCGCRetrotransposon gag protein family protein. 
Os02g0531450J065097O14CGCGTCGCHypothetical protein. 
J075155C16CGCGTCGCNONE 
Os02g0537500AK068689CGCGACGCGSimilar to E2F homolog. 
Os02g0556800AK060580CGCACGCGACGCGACNONE 
AK100187CGCACGCGACGCGACConserved hypothetical protein. 
J065162A21CGCACGCGACGCGACNONE 
J075093B20CGCACGCGACGCGACNONE 
J075097N04CGCACGCGACGCGACNONE 
Os02g0580700AK073664CTCTCCGCGACGCGConserved hypothetical protein. 
J090060F24CTCTCCGCGACGCGNONE 
Os02g0605600016-017-B02CGCGTCGCGTCNONE 
AK066104CGCGTCGCGTCLUC7 related family protein. 
J013052G16CGCGTCGCGTCNONE 
J043022E03CGCGTCGCGTCNONE 
J065105P10CGCGTCGCGTCNONE 
Os02g0626100003-107-B06CAGGTGGGCCACGCGTCGCGNONE 
AK120127CAGGTGGGCCACGCGTCGCGNONE 
Os02g0627100AK068993CGCGACGCGSimilar to Phenylalanine ammonia-lyase (EC 4.3.1.5). 
D21290CGCGACGCGNONE 
J023001A06CGCGACGCGNONE 
J065156K20CGCGACGCGNONE 
J065187O09CGCGACGCGNONE 
J100036D20CGCGACGCGNONE 
J100089I01CGCGACGCGNONE 
Os02g0633400AK073723CGCGTCGCGCGCSimilar to 61 kDa protein homolog. 
J100031K17CGCGTCGCGCGCNONE 
Os02g0638200J065176A11GCGACGCGConserved hypothetical protein. 
Os02g0640000AK120841CGCGACGCGC2 calcium/lipid-binding region, CaLB domain containing protein. 
AK120841GCGACGCGGCGACGCGC2 calcium/lipid-binding region, CaLB domain containing protein. 
J023022G19CGCGACGCGNONE 
J023022G19GCGACGCGGCGACGCGNONE 
J023081F22CGCGACGCGNONE 
J023081F22GCGACGCGGCGACGCGNONE 
Os02g0641800AK066504GCGACGCGSimilar to RNA helicase (Fragment). 
AK072124GCGACGCGNONE 
Os02g0643000009-051-D01GCGACGCGNONE 
AK073818GCGACGCGSimilar to VAP27. 
J023068D06GCGACGCGNONE 
J033068O06GCGACGCGNONE 
J075019O08GCGACGCGNONE 
J075140B16GCGACGCGNONE 
J100036D07GCGACGCGNONE 
J100067I05GCGACGCGNONE 
J100070D07GCGACGCGNONE 
Os02g0651900AK101633GCGACGCGNONE 
AK102949GCGACGCGConserved hypothetical protein. 
J080018N20GCGACGCGNONE 
J080062I19GCGACGCGNONE 
J100064N12GCGACGCGNONE 
J100083B11GCGACGCGNONE 
J100089D08GCGACGCGNONE 
Os02g0669100012-068-E10CGCGTCGCNONE 
012-068-E10CGCGTCGCGNONE 
016-075-F09CGCGTCGCNONE 
016-075-F09CGCGTCGCGNONE 
AB011367CGCGTCGCNONE 
AB011367CGCGTCGCGNONE 
AK070197CGCGTCGCNONE 
AK070197CGCGTCGCGNONE 
AY587109CGCGTCGCDehydrin family protein. 
AY587109CGCGTCGCGDehydrin family protein. 
AY786415CGCGTCGCNONE 
AY786415CGCGTCGCGNONE 
J023042N13CGCGTCGCNONE 
J023042N13CGCGTCGCGNONE 
J023128F01CGCGTCGCNONE 
J023128F01CGCGTCGCGNONE 
J065002K05CGCGTCGCNONE 
J065002K05CGCGTCGCGNONE 
J090057I09CGCGTCGCNONE 
J090057I09CGCGTCGCGNONE 
J090067J23CGCGTCGCNONE 
J090067J23CGCGTCGCGNONE 
J090071B04CGCGTCGCNONE 
J090071B04CGCGTCGCGNONE 
J100018L23CGCGTCGCNONE 
J100018L23CGCGTCGCGNONE 
J100036A11CGCGTCGCNONE 
J100036A11CGCGTCGCGNONE 
J100063L18CGCGTCGCNONE 
J100063L18CGCGTCGCGNONE 
J100071G02CGCGTCGCNONE 
J100071G02CGCGTCGCGNONE 
J100084P19CGCGTCGCNONE 
J100084P19CGCGTCGCGNONE 
Os02g0670400009-189-H11CCCACGCGTCGCNONE 
AB079636CCCACGCGTCGCSimilar to HMGc1 protein. 
J090001B08CCCACGCGTCGCNONE 
Os02g0671100012-049-H09GCGACGCGNONE 
015-077-A04GCGACGCGNONE 
AK100120GCGACGCGNONE 
AK109758GCGACGCGProtein of unknown function DUF295 family protein. 
J023007K16GCGACGCGNONE 
J065139P07GCGACGCGNONE 
J065181I06GCGACGCGNONE 
J065186I20GCGACGCGNONE 
J075052H09GCGACGCGNONE 
J075065J01GCGACGCGNONE 
J075069J15GCGACGCGNONE 
J100036N09GCGACGCGNONE 
J100054J19GCGACGCGNONE 
J100055A12GCGACGCGNONE 
J100065P09GCGACGCGNONE 
J100074E08GCGACGCGNONE 
J100074N13GCGACGCGNONE 
J100087G18GCGACGCGNONE 
Os02g0693700AK103774CGCGACGCGSimilar to P-glycoprotein ABCB5. 
AK106518CGCGACGCGNONE 
Os02g0708100AK059630CGCGACGCGACNONE 
AK102055CGCGACGCGACSimilar to Carbamoyl phosphate synthetase small subunit (EC 6.3.5.5). 
Os02g0715400013-046-F07CGCGTCGCConserved hypothetical protein. 
J053064L02CGCGTCGCNONE 
J053089K10CGCGTCGCNONE 
J075030C14CGCGTCGCNONE 
J075033J20CGCGTCGCNONE 
J075122H10CGCGTCGCNONE 
Os02g0717600J090003H19CCCCCGCGACGCGGATCGGACGGCTNONE 
J100090A12CCCCCGCGACGCGGATCGGACGGCTConserved hypothetical protein. 
Os02g0726000AK072936CGCGACGCGNONE 
AK099178CGCGACGCGBeta-Ig-H3/fasciclin domain containing protein. 
J090014C14CGCGACGCGNONE 
J090014G22CGCGACGCGNONE 
J090031H04CGCGACGCGNONE 
J090054D18CGCGACGCGNONE 
J090054I05CGCGACGCGNONE 
J090064M02CGCGACGCGNONE 
J090073C19CGCGACGCGNONE 
Os02g0752300AK072544CGCGACGCGConserved hypothetical protein. 
J023132N16CGCGACGCGNONE 
J033069F17CGCGACGCGNONE 
Os02g0753800AK101787CGCGACGCGACGCGACGCSimilar to Annexin p35. 
Os02g0762400AK103084GCGACGCGACGCGCyclin-dependent kinase inhibitor family protein. 
Os02g0770100AK111651CGCGTCGCGConserved hypothetical protein. 
AK111651GACGCGACGCGACConserved hypothetical protein. 
J023029P14CGCGTCGCGNONE 
J023029P14GACGCGACGCGACNONE 
J065119C17CGCGTCGCGNONE 
J065119C17GACGCGACGCGACNONE 
Os02g0775300AK111093CGCGTCGCConserved hypothetical protein. 
J100039N18CGCGTCGCNONE 
Os02g0788800AK066747CGCGACGCGAmino acid/polyamine transporter II family protein. 
Os02g0789600AK101046CGCGTCGCGTCNONE 
AK112100CGCGTCGCGTCSimilar to DEM2. 
Os02g0816200AK060243GCGACGCGLipolytic enzyme, G-D-S-L family protein. 
AK099251GCGACGCGNONE 
AK106084GCGACGCGNONE 
J065039F12GCGACGCGNONE 
J065099G01GCGACGCGNONE 
J090005E15GCGACGCGNONE 
Os02g0816300009-030-G05GCGACGCGNONE 
Os02g0820600AK066549GCGACGCGConserved hypothetical protein. 
J013070F02GCGACGCGNONE 
Os03g0116800012-097-D10CCCACGCGACGCGACNONE 
016-024-H10CCCACGCGACGCGACNONE 
AK066955CCCACGCGACGCGACConserved hypothetical protein. 
AK068678CCCACGCGACGCGACNONE 
AK104839CCCACGCGACGCGACNONE 
J013033G16CCCACGCGACGCGACNONE 
J013091C10CCCACGCGACGCGACNONE 
J013158H22CCCACGCGACGCGACNONE 
J023106K11CCCACGCGACGCGACNONE 
J065051O15CCCACGCGACGCGACNONE 
J065129G22CCCACGCGACGCGACNONE 
J075001K02CCCACGCGACGCGACNONE 
J075011O03CCCACGCGACGCGACNONE 
J075024K04CCCACGCGACGCGACNONE 
J075026E07CCCACGCGACGCGACNONE 
J075037O14CCCACGCGACGCGACNONE 
J075071D17CCCACGCGACGCGACNONE 
J075084M05CCCACGCGACGCGACNONE 
J075114B06CCCACGCGACGCGACNONE 
J075128C23CCCACGCGACGCGACNONE 
J075153A13CCCACGCGACGCGACNONE 
J075158A15CCCACGCGACGCGACNONE 
J075165P09CCCACGCGACGCGACNONE 
J075167M21CCCACGCGACGCGACNONE 
J075170F11CCCACGCGACGCGACNONE 
J075186F12CCCACGCGACGCGACNONE 
J075186L13CCCACGCGACGCGACNONE 
J075189A01CCCACGCGACGCGACNONE 
J075192D19CCCACGCGACGCGACNONE 
Os03g0124300AK069148CGCACGCGACGCGConserved hypothetical protein. 
AK106076CGCACGCGACGCGNONE 
J023003G19CGCACGCGACGCGNONE 
Os03g0126800J075039C05CGCGTCGCGNONE 
J075172P07CGCGTCGCGNONE 
J075176L13CGCGTCGCGNONE 
J075180L10CGCGTCGCGNONE 
J090019H18CGCGTCGCGNONE 
J090024P22CGCGTCGCGNONE 
Os03g0126900AK109217GTCGCGTCGCGTCConserved hypothetical protein. 
J065085G16GTCGCGTCGCGTCNONE 
J100086C03GTCGCGTCGCGTCNONE 
Os03g0133100013-080-E12CGCGTCGCNONE 
AK063608CGCGTCGCHypothetical protein. 
AK119680CGCGTCGCNONE 
J075192B05CGCGTCGCNONE 
Os03g0140700AK070000GTCCGTCCCCCGCGCGACGCGACTetratricopeptide-like helical domain containing protein. 
Os03g0141200AK068968AGCCCACGCGTCGCGSimilar to Beta-amylase PCT-BMYI (EC 3.2.1.2). 
AK100092AGCCCACGCGTCGCGNONE 
J023003L18AGCCCACGCGTCGCGNONE 
J023022K18AGCCCACGCGTCGCGNONE 
J023107H13AGCCCACGCGTCGCGNONE 
J023107K02AGCCCACGCGTCGCGNONE 
Os03g0143700AK066360CGCGACGCGACGCGACConserved hypothetical protein. 
J013066M09CGCGACGCGACGCGACNONE 
J023087N24CGCGACGCGACGCGACNONE 
Os03g0146000006-105-H06GTCGCGTCGCGTCGCGTCGAGTCGAGTCNONE 
AK061250GTCGCGTCGCGTCGCGTCGAGTCGAGTCSimilar to RAB1X. 
AK099130GTCGCGTCGCGTCGCGTCGAGTCGAGTCNONE 
J023043D11GTCGCGTCGCGTCGCGTCGAGTCGAGTCNONE 
J043009O17GTCGCGTCGCGTCGCGTCGAGTCGAGTCNONE 
Os03g0157700015-011-D01CGCGCGACGCGGGCCGAGNONE 
AK102075CGCGCGACGCGGGCCGAGProtein of unknown function DUF639 family protein. 
AK106245CGCGCGACGCGGGCCGAGNONE 
J075144I02CGCGCGACGCGGGCCGAGNONE 
Os03g0171900006-070-A01GTCGCGTCGCNONE 
AK061079GTCGCGTCGCNONE 
AK105642GTCGCGTCGCSimilar to Alanine:glyoxylate aminotransferase-like protein (Fragment). 
Os03g0186800AK100356CGCGTCGCModifier of rudimentary, Modr family protein. 
Os03g0210600AK070125CGCGTCGCGConserved hypothetical protein. 
Os03g0212700009-144-B11CGCGTCGCNONE 
AK060718CGCGTCGCNONE 
Os03g0227800016-033-F09CGCGTCGCNONE 
AK063571CGCGTCGCNONE 
AK103846CGCGTCGCNONE 
J013028J20CGCGTCGCNONE 
J013091I04CGCGTCGCNONE 
J013100P18CGCGTCGCNONE 
J013128L15CGCGTCGCNONE 
J013153M09CGCGTCGCNONE 
J033072J03CGCGTCGCNONE 
J033074L07CGCGTCGCNONE 
J033106H15CGCGTCGCNONE 
J033148J22CGCGTCGCNONE 
J065005B02CGCGTCGCNONE 
J065009M20CGCGTCGCNONE 
J065035E23CGCGTCGCNONE 
J065039E24CGCGTCGCNONE 
J065057P20CGCGTCGCNONE 
J065066E10CGCGTCGCNONE 
J065072G21CGCGTCGCNONE 
J065076N07CGCGTCGCNONE 
J065093G14CGCGTCGCNONE 
J065127K10CGCGTCGCNONE 
J065142O20CGCGTCGCNONE 
J065165O18CGCGTCGCNONE 
J065179O07CGCGTCGCNONE 
J065203E15CGCGTCGCNONE 
J080305J16CGCGTCGCNONE 
J090008C14CGCGTCGCNONE 
J090083E01CGCGTCGCNONE 
J090092B02CGCGTCGCNONE 
J090098O14CGCGTCGCNONE 
J100042A12CGCGTCGCNONE 
J100090K14CGCGTCGCNONE 
Os03g0246800AK070145CGCACGCGACGCGNONE 
AK102770CGCACGCGACGCGNONE 
Os03g0277000AK100522CCACGCGTCGCGCGCSimilar to GDP dissociation inhibitor protein OsGDI1. 
Os03g0285800AF216315CCCCCGCGTCGCNONE 
AF332873CCCCCGCGTCGCNONE 
AF479883CCCCCGCGTCGCNONE 
AF479884CCCCCGCGTCGCNONE 
AJ250311CCCCCGCGTCGCNONE 
AJ486975CCCCCGCGTCGCNONE 
AK067339CCCCCGCGTCGCMAP Kinase. 
AK104834CCCCCGCGTCGCNONE 
J013102O17CCCCCGCGTCGCNONE 
J023055N19CCCCCGCGTCGCNONE 
J023099F06CCCCCGCGTCGCNONE 
J065144H06CCCCCGCGTCGCNONE 
J065153A14CCCCCGCGTCGCNONE 
J065212K01CCCCCGCGTCGCNONE 
Os03g0297400AK060653GCCACGTCGCGTCGCNONE 
AK061403GCCACGTCGCGTCGCNONE 
AK101597GCCACGTCGCGTCGCMalonyl CoA-acyl carrier protein transacylase family protein. 
Os03g0302800AK061293GCGACGCGACGCGConserved hypothetical protein. 
Os03g0312500AK106657GCGACGCGSimilar to Inhibitor of apoptosis-like protein. 
AK109328GCGACGCGNONE 
Os03g0319300006-021-E05GTCGCGTCGCGNONE 
006-022-H12GTCGCGTCGCGNONE 
009-187-E02GTCGCGTCGCGNONE 
AF042840GTCGCGTCGCGNONE 
AK059756GTCGCGTCGCGCalmodulin (CaM). 
AK070090GTCGCGTCGCGNONE 
J065017J02GTCGCGTCGCGNONE 
J065028G17GTCGCGTCGCGNONE 
J065045N09GTCGCGTCGCGNONE 
J065078F21GTCGCGTCGCGNONE 
J065091H01GTCGCGTCGCGNONE 
J065112B19GTCGCGTCGCGNONE 
J065186E08GTCGCGTCGCGNONE 
J065199G12GTCGCGTCGCGNONE 
J075030K07GTCGCGTCGCGNONE 
J075050B02GTCGCGTCGCGNONE 
J075057G07GTCGCGTCGCGNONE 
J075070F01GTCGCGTCGCGNONE 
J075093N12GTCGCGTCGCGNONE 
J075095K13GTCGCGTCGCGNONE 
J075102D14GTCGCGTCGCGNONE 
J075103B17GTCGCGTCGCGNONE 
J075114K05GTCGCGTCGCGNONE 
J075142F18GTCGCGTCGCGNONE 
J075154L11GTCGCGTCGCGNONE 
J075185F08GTCGCGTCGCGNONE 
J090012A14GTCGCGTCGCGNONE 
J090044L10GTCGCGTCGCGNONE 
J100044C12GTCGCGTCGCGNONE 
J100088J19GTCGCGTCGCGNONE 
Os03g0330300AK060756CGCGTCGCGViral attachment protein, fibre shaft repeat containing protein. 
AK072405CGCGTCGCGNONE 
J013043H13CGCGTCGCGNONE 
J013097M19CGCGTCGCGNONE 
J023080M15CGCGTCGCGNONE 
Os03g0342900006-032-D01CGCGTCGCNONE 
006-033-E10CGCGTCGCNONE 
006-051-G06CGCGTCGCNONE 
006-053-E05CGCGTCGCNONE 
006-056-B05CGCGTCGCNONE 
006-058-F04CGCGTCGCNONE 
006-059-E05CGCGTCGCNONE 
006-060-F10CGCGTCGCNONE 
006-104-D12CGCGTCGCNONE 
009-129-C12CGCGTCGCNONE 
AK060136CGCGTCGCNONE 
AK060980CGCGTCGCNONE 
AK064815CGCGTCGCDormancyauxin associated family protein. 
AK104244CGCGTCGCNONE 
AK104391CGCGTCGCNONE 
AK104590CGCGTCGCNONE 
AK104744CGCGTCGCNONE 
AK106100CGCGTCGCNONE 
J013000E10CGCGTCGCNONE 
J075027O22CGCGTCGCNONE 
J075052J03CGCGTCGCNONE 
J075066E15CGCGTCGCNONE 
J075095C17CGCGTCGCNONE 
J075118N05CGCGTCGCNONE 
J075187K22CGCGTCGCNONE 
J090026L04CGCGTCGCNONE 
J090059G16CGCGTCGCNONE 
J100055P20CGCGTCGCNONE 
J100062A10CGCGTCGCNONE 
J100068G20CGCGTCGCNONE 
Os03g0437200006-066-E02GCGTCGCGTCGCNONE 
AK059839GCGTCGCGTCGCZinc finger, C2H2-type domain containing protein. 
AY295345GCGTCGCGTCGCNONE 
Os03g0561249J065016H04CGCGACGCGTGGConserved hypothetical protein. 
Os03g0611200AK065587CGCGTCGCAldo/keto reductase family protein. 
Os03g0633800AK073044CGCGTCGCSimilar to IAA6 (Fragment). 
J065038L22CGCGTCGCNONE 
J065185C13CGCGTCGCNONE 
Os03g0634000014-034-A03CGCGTCGCGTCGCNONE 
AK063673CGCGTCGCGTCGCSimilar to THA4. 
Os03g0669300006-050-A06CGCGTCGCGNONE 
AK061572CGCGTCGCGGlycoside hydrolase, family 17 protein. 
AK120399CGCGTCGCGNONE 
AK120903CGCGTCGCGNONE 
J075023N09CGCGTCGCGNONE 
J075083N02CGCGTCGCGNONE 
J075097I22CGCGTCGCGNONE 
J100070D08CGCGTCGCGNONE 
J100086L13CGCGTCGCGNONE 
Os03g0696000AK109661CGCGTCGCHarpin-induced 1 domain containing protein. 
Os03g0709300AK100153CGCGTCGCSimilar to Chemocyanin precursor (Basic blue protein) (Plantacyanin). 
J065192M19CGCGTCGCNONE 
Os03g0711600X88799CGCGTCGCGSimilar to DNA binding protein (Fragment). 
Os03g0716200Os03g0716200GCGACGCGCACCGCACCGCConserved hypothetical protein. 
Os03g0752800AB041020CGCACGCGTCGCNONE 
AF058697CGCACGCGTCGCMADS14 protein. 
AF139664CGCACGCGTCGCNONE 
AK121171CGCACGCGTCGCNONE 
AY332478CGCACGCGTCGCNONE 
AY551916CGCACGCGTCGCNONE 
J023081C04CGCACGCGTCGCNONE 
Os03g0762400AK071181GCGACGCGSimilar to Peroxidase2 precursor (EC 1.11.1.7). 
J023084I20GCGACGCGNONE 
J033039C18GCGACGCGNONE 
J033108N03GCGACGCGNONE 
J043017N16GCGACGCGNONE 
J065026C13GCGACGCGNONE 
J065045C01GCGACGCGNONE 
J065045D11GCGACGCGNONE 
J065050N09GCGACGCGNONE 
J065058P21GCGACGCGNONE 
J065075I20GCGACGCGNONE 
J065077I17GCGACGCGNONE 
J065081I20GCGACGCGNONE 
J065085B14GCGACGCGNONE 
J065101K21GCGACGCGNONE 
J065112A17GCGACGCGNONE 
J065112N13GCGACGCGNONE 
J065118J02GCGACGCGNONE 
J065123E01GCGACGCGNONE 
J065134N12GCGACGCGNONE 
J065139L04GCGACGCGNONE 
J065141I11GCGACGCGNONE 
J065161J24GCGACGCGNONE 
J065164I10GCGACGCGNONE 
J065171L01GCGACGCGNONE 
J065178P21GCGACGCGNONE 
J065185L24GCGACGCGNONE 
J065219C04GCGACGCGNONE 
J075029B07GCGACGCGNONE 
J075033G20GCGACGCGNONE 
J075054N01GCGACGCGNONE 
J075068B22GCGACGCGNONE 
J075096N11GCGACGCGNONE 
J075098C11GCGACGCGNONE 
J075115J22GCGACGCGNONE 
J075127D11GCGACGCGNONE 
J075156J21GCGACGCGNONE 
J075166G08GCGACGCGNONE 
J075166P17GCGACGCGNONE 
J075170O18GCGACGCGNONE 
J075181A16GCGACGCGNONE 
J075195J11GCGACGCGNONE 
Os03g0772600AK120949GAGACGCGACGCGACGCGACGCGSimilar to Lectin-like receptor kinase 7;2. 
Os03g0784500AK109744CATCCACCCGCGTCGCGTCTCNONE 
Os03g0785500AK067718CGCGACGCGProtein of unknown function DUF284, transmembrane eukaryotic family protein. 
AK067718CGCGTCGCProtein of unknown function DUF284, transmembrane eukaryotic family protein. 
Os03g0786500016-056-D08CGCGTCGCACGCCACNONE 
AK106487CGCGTCGCACGCCACSimilar to Glycine-rich protein 2. 
J080001C23CGCGTCGCACGCCACNONE 
J080005A02CGCGTCGCACGCCACNONE 
J080009A14CGCGTCGCACGCCACNONE 
J080009B11CGCGTCGCACGCCACNONE 
J080011L03CGCGTCGCACGCCACNONE 
J080017E21CGCGTCGCACGCCACNONE 
J080018H08CGCGTCGCACGCCACNONE 
J080021E11CGCGTCGCACGCCACNONE 
J080025O20CGCGTCGCACGCCACNONE 
J080026H21CGCGTCGCACGCCACNONE 
J080029I10CGCGTCGCACGCCACNONE 
J080036L01CGCGTCGCACGCCACNONE 
J080038M15CGCGTCGCACGCCACNONE 
J080051H09CGCGTCGCACGCCACNONE 
J080053E18CGCGTCGCACGCCACNONE 
J080054I12CGCGTCGCACGCCACNONE 
J080055B14CGCGTCGCACGCCACNONE 
J080060L16CGCGTCGCACGCCACNONE 
J080067G06CGCGTCGCACGCCACNONE 
J080069K14CGCGTCGCACGCCACNONE 
J080070N14CGCGTCGCACGCCACNONE 
J080071G10CGCGTCGCACGCCACNONE 
J080076D08CGCGTCGCACGCCACNONE 
J080076O11CGCGTCGCACGCCACNONE 
J080078E10CGCGTCGCACGCCACNONE 
J080079B15CGCGTCGCACGCCACNONE 
J080079K03CGCGTCGCACGCCACNONE 
J080079O15CGCGTCGCACGCCACNONE 
J080087B18CGCGTCGCACGCCACNONE 
Os03g0789800AK106804GCGACGCGNONE 
J065068E17GCGACGCGNONE 
J090016H22GCGACGCGNONE 
Os03g0790900AK059698GCGACGCGNONE 
Os03g0794800AK070933GCGACGCGACSimilar to XRN3. 
Os03g0800400AK071430CGCGTCGCProtein of unknown function DUF1618 domain containing protein. 
J023019H20CGCGTCGCNONE 
J023097A10CGCGTCGCNONE 
J023100K15CGCGTCGCNONE 
J075095I09CGCGTCGCNONE 
J090014B19CGCGTCGCNONE 
J090072D02CGCGTCGCNONE 
J100029E17CGCGTCGCNONE 
J100047F04CGCGTCGCNONE 
Os03g0801900015-081-G06GCGACGCGNONE 
AK106415GCGACGCGProtein of unknown function DUF569 family protein. 
J090099L17GCGACGCGNONE 
J100024B03GCGACGCGNONE 
J100088I08GCGACGCGNONE 
Os03g0822000AF247164CGCGACGCGNONE 
AK101784CGCGACGCGNONE 
AK119215CGCGACGCGAlpha-expansin OsEXPA7. 
J033065B20CGCGACGCGNONE 
J065038A10CGCGACGCGNONE 
J065049A16CGCGACGCGNONE 
J065085B11CGCGACGCGNONE 
J065205I19CGCGACGCGNONE 
J065210L24CGCGACGCGNONE 
Os03g0829600AK071298CGCGACGCGNONE 
AK119707CGCGACGCGConserved hypothetical protein. 
J023084A07CGCGACGCGNONE 
Os03g0832200AK070712CGCGTCGCSimilar to Calcium-binding protein precursor (Calreticulin). 
Os03g0855700AK070400CGCGACGCGNucleic acid-binding, OB-fold domain containing protein. 
Os04g0293600AK063003GCGACGCGHypothetical protein. 
Os04g0370600AK103855GCGACGCG4Fe-4S ferredoxin, iron-sulfur binding domain containing protein. 
J023115N20GCGACGCGNONE 
J033148N10GCGACGCGNONE 
J090031L24GCGACGCGNONE 
J090089F12GCGACGCGNONE 
Os04g0382100AK108218CGCGTCGCSWIB/MDM2 domain containing protein. 
J065059M07CGCGTCGCNONE 
J065104M04CGCGTCGCNONE 
Os04g0405500011-007-D12CGCGTCGCGTCCCTCANONE 
AK063263CGCGTCGCGTCCCTCAConserved hypothetical protein. 
J065166G19CGCGTCGCGTCCCTCANONE 
J075180M09CGCGTCGCGTCCCTCANONE 
Os04g0406600AK103609CGCGACGCGPrephenate dehydratase domain containing protein. 
J033133I10CGCGACGCGNONE 
J075092D11CGCGACGCGNONE 
J100031M09CGCGACGCGNONE 
Os04g0412300AK110902CGCGCGACGCGNONE 
AK121151CGCGCGACGCGGlycoside hydrolase, family 17 protein. 
J013126I01CGCGCGACGCGNONE 
J023078I08CGCGCGACGCGNONE 
J090006M17CGCGCGACGCGNONE 
J090060D03CGCGCGACGCGNONE 
J090063F12CGCGCGACGCGNONE 
J100040E06CGCGCGACGCGNONE 
J100057F18CGCGCGACGCGNONE 
J100058B19CGCGCGACGCGNONE 
J100058C20CGCGCGACGCGNONE 
J100067G08CGCGCGACGCGNONE 
J100082C09CGCGCGACGCGNONE 
J100086D14CGCGCGACGCGNONE 
Os04g0414500AK121479CGCGTCGCGConserved hypothetical protein. 
J023149I19CGCGTCGCGNONE 
J090084C07CGCGTCGCGNONE 
Os04g0430600009-014-G12CGCGTCGCGTCNONE 
015-019-A08CGCGTCGCGTCNONE 
015-048-C08CGCGTCGCGTCNONE 
015-085-E11CGCGTCGCGTCNONE 
AK072050CGCGTCGCGTCNONE 
AK106337CGCGTCGCGTCConserved hypothetical protein. 
J065037C09CGCGTCGCGTCNONE 
J075125G18CGCGTCGCGTCNONE 
Os04g0434400014-079-B10CGCGCGACGCGNONE 
AK063725CGCGCGACGCGConserved hypothetical protein. 
Os04g0481100AK099817CGCGTCGCGSimilar to Seed imbibition protein (Fragment). 
AK100197CGCGTCGCGNONE 
AK111421CGCGTCGCGNONE 
Os04g0494600AK110895CGCGTCGCGCGProtein of unknown function DUF642 family protein. 
Os04g0505200004-004-B07GCGACGCGNONE 
006-025-D10GCGACGCGNONE 
006-038-D07GCGACGCGNONE 
006-044-H11GCGACGCGNONE 
006-061-A09GCGACGCGNONE 
006-083-C02GCGACGCGNONE 
009-167-F06GCGACGCGNONE 
013-093-B02GCGACGCGNONE 
AK061301GCGACGCGLeucine-rich repeat, plant specific containing protein. 
AK066703GCGACGCGNONE 
AK104903GCGACGCGNONE 
J013027H24GCGACGCGNONE 
J013075O17GCGACGCGNONE 
J013130D11GCGACGCGNONE 
J033069B22GCGACGCGNONE 
J033102K15GCGACGCGNONE 
J090004A17GCGACGCGNONE 
J090008L22GCGACGCGNONE 
J090063C05GCGACGCGNONE 
Os04g0529100AK107680CGCACGCGTCGCGPathogenesis-related transcriptional factor and ERF domain containing protein. 
Os04g0560100006-090-B07GCGACGCGNONE 
AK071033GCGACGCGNONE 
AK106001GCGACGCGCytochrome P450 family protein. 
J023063N21GCGACGCGNONE 
J023078O09GCGACGCGNONE 
J090062K20GCGACGCGNONE 
Os04g0563700015-005-B06CGCGTCGCCCATCCANONE 
AB024987CGCGTCGCCCATCCANONE 
AK070211CGCGTCGCCCATCCACyclin. 
Os04g0574100006-087-B01GCGACGCGNONE 
006-087-B01GGATGGGCCCCGCGTCGCNONE 
AK061150GCGACGCGNONE 
AK061150GGATGGGCCCCGCGTCGCNONE 
AK069178GCGACGCGExostosin-like family protein. 
AK069178GGATGGGCCCCGCGTCGCExostosin-like family protein. 
AK121041GCGACGCGNONE 
AK121041GGATGGGCCCCGCGTCGCNONE 
J023008D04GCGACGCGNONE 
J023008D04GGATGGGCCCCGCGTCGCNONE 
J023052A13GCGACGCGNONE 
J023052A13GGATGGGCCCCGCGTCGCNONE 
J065046P18GCGACGCGNONE 
J065046P18GGATGGGCCCCGCGTCGCNONE 
J065105D10GCGACGCGNONE 
J065105D10GGATGGGCCCCGCGTCGCNONE 
Os04g0586100009-190-F11CGCGACGCGACGCCCCACCNONE 
AK063206CGCGACGCGACGCCCCACCProtein of unknown function DUF581 family protein. 
Os04g0594100014-046-H12GCGACGCGNONE 
014-049-F01GCGACGCGNONE 
AK111960GCGACGCGSimilar to P-type R2R3 Myb protein (Fragment). 
Os04g0623800AK059270CGCGTCGCGCGCNONE 
AK099234CGCGTCGCGCGCSimilar to Aminomethyltransferase, mitochondrial precursor (EC 2.1.2.10) (Glycine cleavage system T protein) (GCVT). 
Os04g0634800AK107772GCGACGCGConserved hypothetical protein. 
J065046O17GCGACGCGNONE 
J065121F10GCGACGCGNONE 
J075173G21GCGACGCGNONE 
J090081F22GCGACGCGNONE 
J100037A09GCGACGCGNONE 
J100056M24GCGACGCGNONE 
Os04g0639100009-158-D03CGCGTCGCCCAACCNONE 
AK063036CGCGTCGCCCAACCConserved hypothetical protein. 
J075045D14CGCGTCGCCCAACCNONE 
J075047L16CGCGTCGCCCAACCNONE 
J075048D20CGCGTCGCCCAACCNONE 
J075056E20CGCGTCGCCCAACCNONE 
J075074E14CGCGTCGCCCAACCNONE 
J075108F16CGCGTCGCCCAACCNONE 
J075143L19CGCGTCGCCCAACCNONE 
J075146L07CGCGTCGCCCAACCNONE 
J075158I04CGCGTCGCCCAACCNONE 
J075172B20CGCGTCGCCCAACCNONE 
J090061M08CGCGTCGCCCAACCNONE 
Os04g0642100011-074-F06CGCGACGCGNONE 
J043006J10CGCGACGCGSimilar to Microtubule-associated protein EB1. 
J043006P09CGCGACGCGNONE 
Os04g0650700006-037-H03CGCGACGCGNONE 
AK061502CGCGACGCGNONE 
AK068693CGCGACGCGNONE 
AK121820CGCGACGCGSimilar to L-asparaginase (L-asparagine amidohydrolase). 
J043030P10CGCGACGCGNONE 
J065084D09CGCGACGCGNONE 
Os04g0658600AK064729CGCGACGCGNONE 
AK119253CGCGACGCGNucleolar, Nop52 family protein. 
J075132J07CGCGACGCGNONE 
J075157N21CGCGACGCGNONE 
Os04g0661200AK102842GCGACGCGProtein of unknown function DUF941 family protein. 
J033075E19GCGACGCGNONE 
J033109O19GCGACGCGNONE 
J065002J12GCGACGCGNONE 
J065026E22GCGACGCGNONE 
J065061F05GCGACGCGNONE 
J065068D22GCGACGCGNONE 
J065072N14GCGACGCGNONE 
J065085F02GCGACGCGNONE 
J075055G19GCGACGCGNONE 
J075105B14GCGACGCGNONE 
J075118M17GCGACGCGNONE 
J075193H02GCGACGCGNONE 
J100040O05GCGACGCGNONE 
J100064I04GCGACGCGNONE 
Os04g0663800013-021-G09GCGACGCGNONE 
AK105321GCGACGCGSimilar to Peptidyl-prolyl cis-trans isomerase 1 (EC 5.2.1.8) (Rotamase Pin1) (PPIase Pin1) (PIN1At). 
Os04g0667600009-131-H09CGCGTCGCNONE 
009-200-A04CGCGTCGCNONE 
AK068657CGCGTCGCHeavy metal transport/detoxification protein domain containing protein. 
J065013M12CGCGTCGCNONE 
J065024H17CGCGTCGCNONE 
J065025P10CGCGTCGCNONE 
J065028I11CGCGTCGCNONE 
J065044K11CGCGTCGCNONE 
J065045B14CGCGTCGCNONE 
J065052B02CGCGTCGCNONE 
J065061F20CGCGTCGCNONE 
J065061K16CGCGTCGCNONE 
J065063E12CGCGTCGCNONE 
J065065E16CGCGTCGCNONE 
J065082M02CGCGTCGCNONE 
J065084O10CGCGTCGCNONE 
J065096H18CGCGTCGCNONE 
J065122F02CGCGTCGCNONE 
J065131F09CGCGTCGCNONE 
J065139P06CGCGTCGCNONE 
J065148L17CGCGTCGCNONE 
J065164D23CGCGTCGCNONE 
J065167M17CGCGTCGCNONE 
J065174B15CGCGTCGCNONE 
J065176G01CGCGTCGCNONE 
J065186K17CGCGTCGCNONE 
J065186N05CGCGTCGCNONE 
J065213N24CGCGTCGCNONE 
J075001P17CGCGTCGCNONE 
J075004A15CGCGTCGCNONE 
J075007B03CGCGTCGCNONE 
J075026D23CGCGTCGCNONE 
J075032D17CGCGTCGCNONE 
J075058C22CGCGTCGCNONE 
J075080L14CGCGTCGCNONE 
J075094K18CGCGTCGCNONE 
J075097K15CGCGTCGCNONE 
J075098E02CGCGTCGCNONE 
J075104D11CGCGTCGCNONE 
J075120L16CGCGTCGCNONE 
J075126A18CGCGTCGCNONE 
J075129M08CGCGTCGCNONE 
J075143N14CGCGTCGCNONE 
J075146D07CGCGTCGCNONE 
J075149L10CGCGTCGCNONE 
J075171F22CGCGTCGCNONE 
J090058C05CGCGTCGCNONE 
J100018N19CGCGTCGCNONE 
J100024K09CGCGTCGCNONE 
J100036F15CGCGTCGCNONE 
J100042A15CGCGTCGCNONE 
J100042P14CGCGTCGCNONE 
J100051N18CGCGTCGCNONE 
J100055K14CGCGTCGCNONE 
J100056F05CGCGTCGCNONE 
J100058L10CGCGTCGCNONE 
J100083J17CGCGTCGCNONE 
J100086N07CGCGTCGCNONE 
Os04g0669300AK071148CGCGTCGCDynamin family protein. 
AK071148GCGACGCGDynamin family protein. 
Os04g0674350J065104O14GCGACGCGNONE 
J065118J19GCGACGCGNONE 
J065167I12GCGACGCGHypothetical protein. 
Os04g0674400015-042-B08CGCGTCGCNONE 
AK102124CGCGTCGCSimilar to Anamorsin (Cytokine induced apoptosis inhibitor 1) (CUA001). Splice isoform 2. 
J013129O22CGCGTCGCNONE 
J023022I24CGCGTCGCNONE 
J023120A15CGCGTCGCNONE 
J023123P20CGCGTCGCNONE 
J033068P09CGCGTCGCNONE 
J033107G22CGCGTCGCNONE 
J033116G12CGCGTCGCNONE 
J033133F03CGCGTCGCNONE 
J033143B20CGCGTCGCNONE 
J043006G12CGCGTCGCNONE 
J043027M18CGCGTCGCNONE 
J043034H17CGCGTCGCNONE 
J090091E20CGCGTCGCNONE 
J100035H09CGCGTCGCNONE 
J100037J04CGCGTCGCNONE 
J100047J24CGCGTCGCNONE 
J100059G06CGCGTCGCNONE 
J100066O12CGCGTCGCNONE 
J100074G23CGCGTCGCNONE 
J100077M12CGCGTCGCNONE 
Os04g0692600006-056-F05CGCGTCGCNONE 
006-074-F09CGCGTCGCNONE 
006-078-B07CGCGTCGCNONE 
006-081-H09CGCGTCGCNONE 
006-111-A10CGCGTCGCNONE 
AK070001CGCGTCGCNONE 
AK105888CGCGTCGCNONE 
AK105982CGCGTCGCConserved hypothetical protein. 
Os05g0116500AK102231CGCGTCGCGConserved hypothetical protein. 
J033088A05CGCGTCGCGNONE 
Os05g0119200AK067943CGCGTCGCGConserved hypothetical protein. 
J013122C02CGCGTCGCGNONE 
J065077M14CGCGTCGCGNONE 
J065108P21CGCGTCGCGNONE 
J065138G20CGCGTCGCGNONE 
J065148H07CGCGTCGCGNONE 
J065205P09CGCGTCGCGNONE 
J075061H16CGCGTCGCGNONE 
J075140H13CGCGTCGCGNONE 
J075153H02CGCGTCGCGNONE 
J075170B14CGCGTCGCGNONE 
Os05g0127300AK106429CGCGACGCGNONE 
AK121766CGCGACGCGRegulator of chromosome condensation/beta-lactamase-inhibitor protein II domain containing protein. 
J065021F23CGCGACGCGNONE 
J100041J04CGCGACGCGNONE 
Os05g0164100AF456329CGCGTCGCNONE 
AK065086CGCGTCGCNONE 
AK072243CGCGTCGCSimilar to Fructose-6-phosphate 2-kinase/fructose-2,6-bisphosphatase (EC 2.7.1.105) (EC 3.1.3.46) (Fragment). 
J013001L18CGCGTCGCNONE 
J013132O12CGCGTCGCNONE 
J023003N09CGCGTCGCNONE 
Os05g0316200AK060608GCGACGCGCCCATCTNONE 
AK101705GCGACGCGCCCATCTConserved hypothetical protein. 
AK111481GCGACGCGCCCATCTNONE 
Os05g0332600AK098926GCGACGCGNONE 
Os05g0335800AK108393GCGACGCGTGF-beta receptor, type I/II extracellular region family protein. 
Os05g0349800011-076-D06CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
014-037-D12CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
AK063677CCGAGCCGTCCGCGTCGCCGCGCGACACGTEmbryonic abundant protein 1. 
AK119674CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J053027D20CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J053039D11CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J053047P16CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J053048F05CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J053058E11CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J053060C03CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J053082N12CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J065017B15CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J065117G02CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J065212K21CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J075001H18CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J075003F20CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J075026F11CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J075035F13CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J075055C12CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J075067L20CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J075067O13CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J075070A12CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J075089E05CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J075128J17CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J075134M19CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J075192L11CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J075199D14CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
Os05g0361700AJ575218GAGACGCGCGACGCGNONE 
AK100184GAGACGCGCGACGCGSimilar to EREBP-2 protein (Fragment). 
AK111676GAGACGCGCGACGCGNONE 
J013155B14GAGACGCGCGACGCGNONE 
J065073N01GAGACGCGCGACGCGNONE 
J065161J12GAGACGCGCGACGCGNONE 
J075074A07GAGACGCGCGACGCGNONE 
J100029H13GAGACGCGCGACGCGNONE 
Os05g0381400014-036-H12CGCGTCGCNONE 
014-036-H12CGCGTCGCGNONE 
014-085-H12CGCGTCGCNONE 
014-085-H12CGCGTCGCGNONE 
AK102039CGCGTCGCSimilar to ABA induced plasma membrane protein PM 19. 
AK102039CGCGTCGCGSimilar to ABA induced plasma membrane protein PM 19. 
J075011E17CGCGTCGCNONE 
J075011E17CGCGTCGCGNONE 
J075057P04CGCGTCGCNONE 
J075057P04CGCGTCGCGNONE 
J075066K19CGCGTCGCNONE 
J075066K19CGCGTCGCGNONE 
J075068L13CGCGTCGCNONE 
J075068L13CGCGTCGCGNONE 
J075074J21CGCGTCGCNONE 
J075074J21CGCGTCGCGNONE 
J075076N10CGCGTCGCNONE 
J075076N10CGCGTCGCGNONE 
J075078L14CGCGTCGCNONE 
J075078L14CGCGTCGCGNONE 
J075099O16CGCGTCGCNONE 
J075099O16CGCGTCGCGNONE 
J075120C05CGCGTCGCNONE 
J075120C05CGCGTCGCGNONE 
J075140I24CGCGTCGCNONE 
J075140I24CGCGTCGCGNONE 
J075148F21CGCGTCGCNONE 
J075148F21CGCGTCGCGNONE 
J075151F01CGCGTCGCNONE 
J075151F01CGCGTCGCGNONE 
J075151I10CGCGTCGCNONE 
J075151I10CGCGTCGCGNONE 
J075156M15CGCGTCGCNONE 
J075156M15CGCGTCGCGNONE 
J075191F07CGCGTCGCNONE 
J075191F07CGCGTCGCGNONE 
J075192K20CGCGTCGCNONE 
J075192K20CGCGTCGCGNONE 
J075195M22CGCGTCGCNONE 
J075195M22CGCGTCGCGNONE 
Os05g0382600AK068231CGCGACGCGAnnexin family protein. 
J013147O19CGCGACGCGNONE 
Os05g0386800AK060897CGCGTCGCNONE 
AK070472CGCGTCGCSimilar to Phytochelatin synthetase-like protein 2. 
Os05g0388500AK065313CCCCCGCGACGCGCGAGSimilar to 50S ribosomal protein L1. 
AK098990CCCCCGCGACGCGCGAGNONE 
AK104689CCCCCGCGACGCGCGAGNONE 
J013094L23CCCCCGCGACGCGCGAGNONE 
J065118O04CCCCCGCGACGCGCGAGNONE 
Os05g0407100AK063349CGCGTCGCGCGCFour F5 protein family protein. 
Os05g0424800AK121054CTCGCGCGTCGCGTCSimilar to AER274Wp. 
J023055P22CTCGCGCGTCGCGTCNONE 
J023102M21CTCGCGCGTCGCGTCNONE 
J033088E13CTCGCGCGTCGCGTCNONE 
J033123K17CTCGCGCGTCGCGTCNONE 
J065176L18CTCGCGCGTCGCGTCNONE 
J075002F14CTCGCGCGTCGCGTCNONE 
J075005E10CTCGCGCGTCGCGTCNONE 
J075005K21CTCGCGCGTCGCGTCNONE 
J075007A18CTCGCGCGTCGCGTCNONE 
J075021J16CTCGCGCGTCGCGTCNONE 
J075040K11CTCGCGCGTCGCGTCNONE 
J075061A14CTCGCGCGTCGCGTCNONE 
J075106H07CTCGCGCGTCGCGTCNONE 
J075109M22CTCGCGCGTCGCGTCNONE 
J075121O13CTCGCGCGTCGCGTCNONE 
J075132M08CTCGCGCGTCGCGTCNONE 
J075153B19CTCGCGCGTCGCGTCNONE 
J075158L15CTCGCGCGTCGCGTCNONE 
J075187G20CTCGCGCGTCGCGTCNONE 
J100079N17CTCGCGCGTCGCGTCNONE 
Os05g0450300AK071191GACGCGACGCGConserved hypothetical protein. 
J023084G11GACGCGACGCGNONE 
Os05g0451300AK108341CGCGTCGCGConserved hypothetical protein. 
Os05g0459900AK058918CGCGACGCGSimilar to 60S ribosomal protein L36-1. 
AK111268CGCGACGCGNONE 
J013129N08CGCGACGCGNONE 
J065191E01CGCGACGCGNONE 
J065216P03CGCGACGCGNONE 
J075089K21CGCGACGCGNONE 
Os05g0462400AK099608CGCGTCGCGLipin, N-terminal conserved region domain containing protein. 
J033138E12CGCGTCGCGNONE 
Os05g0478000AK111029CGCGTCGCGZinc finger, RING-type domain containing protein. 
Os05g0506000AF031609CCGTCGGATCAGGCCCCGCGTCGCNONE 
AK062012CCGTCGGATCAGGCCCCGCGTCGCNONE 
AK098900CCGTCGGATCAGGCCCCGCGTCGCNONE 
AK122090CCGTCGGATCAGGCCCCGCGTCGCSimilar to MS5-like protein (Fragment). 
J013002B13CCGTCGGATCAGGCCCCGCGTCGCNONE 
J023149G13CCGTCGGATCAGGCCCCGCGTCGCNONE 
J033123O20CCGTCGGATCAGGCCCCGCGTCGCNONE 
J080315O17CCGTCGGATCAGGCCCCGCGTCGCNONE 
Os05g0508300Os05g0508300GTCGCGTCGCSimilar to Papain-like cysteine peptidase XBCP3. 
Os05g0510100Os05g0510100GCGACGCGProtein of unknown function DUF567 family protein. 
Os05g0512000AK102433CGCGTCGCZinc finger, RING-type domain containing protein. 
Os05g0519700014-100-B04CGCGTCGCCCATCGNONE 
AF332981CGCGTCGCCCATCGNONE 
AK100903CGCGTCGCCCATCGNONE 
AK105433CGCGTCGCCCATCGHeat shock protein 101. 
Os05g0519800AK069435CGCGTCGCGTCProtein of unknown function DUF28 family protein. 
J023024L22CGCGTCGCGTCNONE 
Os05g0521600013-027-G05CGCGTCGCNONE 
AK063238CGCGTCGCVirulence factor, pectin lyase fold family protein. 
Os05g0524500AK073571GCGACGCGProtein kinase-like domain containing protein. 
Os05g0539400AK068572GCGACGCGGlycoside hydrolase, family 35 protein. 
J013063P08GCGACGCGNONE 
J013110N24GCGACGCGNONE 
J013156K22GCGACGCGNONE 
J043038A08GCGACGCGNONE 
J090004K18GCGACGCGNONE 
J090085F03GCGACGCGNONE 
Os05g0551700AK071216GTCGCGTCGCGtRNA isopentenyltransferase family protein. 
Os05g0562200AK061766GCGACGCGDrought induced 19 family protein. 
AK109438GCGACGCGNONE 
Os05g0568600009-024-B09CGCGACGCGNONE 
AK063781CGCGACGCGProtein of unknown function DUF1645 family protein. 
J080049H14CGCGACGCGNONE 
J080062M08CGCGACGCGNONE 
J080064I07CGCGACGCGNONE 
J080068A12CGCGACGCGNONE 
J080086J10CGCGACGCGNONE 
Os05g0576600AK107732GACGCGACGCGACConserved hypothetical protein. 
Os05g0577700AK107217GCTGGGCTGGGCCCCTCGCGCGCGACGCGACSimilar to Protein kinase. 
AY224453GCTGGGCTGGGCCCCTCGCGCGCGACGCGACNONE 
Os05g0579600Os05g0579600CGCGACGCGACHomeodomain-like containing protein. 
Os05g0592800AK067627CGCGTCGCCACGTGTCCACGCCSimilar to Protein phosphatase 2C ABI2 (EC 3.1.3.16) (PP2C) (Abscisic acid- insensitive 2). 
AK070388CGCGTCGCCACGTGTCCACGCCNONE 
AK104323CGCGTCGCCACGTGTCCACGCCNONE 
Os05g0593000013-075-E08CGCGTCGCGNONE 
014-081-D06CGCGTCGCGNONE 
015-061-D11CGCGTCGCGNONE 
016-061-B10CGCGTCGCGNONE 
016-066-C11CGCGTCGCGNONE 
AK064253CGCGTCGCGConserved hypothetical protein. 
Os06g0140700009-041-G05CGCGTCGCNONE 
AF145726CGCGTCGCNONE 
AK105150CGCGTCGCNONE 
AY206864CGCGTCGCSimilar to Homeodomain leucine zipper protein (Fragment). 
Os06g0153200AK072625CGCGTCGCGNONE 
AK106752CGCGTCGCGProtein of unknown function DUF250 domain containing protein. 
Os06g0166000009-023-G02CGCGTCGCGTCGCGTCNONE 
AK060317CGCGTCGCGTCGCGTCCyclin-like F-box domain containing protein. 
J075052L22CGCGTCGCGTCGCGTCNONE 
J075078E03CGCGTCGCGTCGCGTCNONE 
J075115M08CGCGTCGCGTCGCGTCNONE 
J075192G08CGCGTCGCGTCGCGTCNONE 
J100036C01CGCGTCGCGTCGCGTCNONE 
J100070J02CGCGTCGCGTCGCGTCNONE 
J100088C24CGCGTCGCGTCGCGTCNONE 
Os06g0206100AK099498CGCGTCGCGNONE 
AK121282CGCGTCGCGSimilar to Gb protein. 
Os06g0223300AK111776GCGTCGCGTCGCGTCSimilar to TDR8 protein. 
J023075K19GCGTCGCGTCGCGTCNONE 
Os06g0225300AK065224CGCGACGCGACNONE 
AK065224CGCGTCGCCTCGCCCNONE 
AK100258CGCGACGCGACSimilar to SERK1 (Fragment). 
AK100258CGCGTCGCCTCGCCCSimilar to SERK1 (Fragment). 
J013002G23CGCGACGCGACNONE 
J013002G23CGCGTCGCCTCGCCCNONE 
Os06g0247800AK102187GCCCCCACCGCGTCGCSimilar to Dynamin-like protein (Fragment). 
AY224491GCCCCCACCGCGTCGCNONE 
Os06g0304500AK119441GCGACGCGCRS1/YhbY domain containing protein. 
J075143M24GCGACGCGNONE 
J075194D03GCGACGCGNONE 
Os06g0307900AK119309GCGACGCGTGGProtein of unknown function DUF1618 domain containing protein. 
AK120750GCGACGCGTGGNONE 
J023004O19GCGACGCGTGGNONE 
J033022G01GCGACGCGTGGNONE 
Os06g0335900J065112L04CGCGTCGCNONE 
J065216L13CGCGTCGCNONE 
Os06g0500000J065064K10CGCGACGCGACConserved hypothetical protein. 
J065148C10CGCGACGCGACNONE 
J065183N06CGCGACGCGACNONE 
J065203F05CGCGACGCGACNONE 
Os06g0552400015-046-G05CGCGTCGCNONE 
AK106524CGCGTCGCNONE 
AK121387CGCGTCGCProtein of unknown function DUF500 family protein. 
J023127P05CGCGTCGCNONE 
Os06g0597600AK120804GCGACGCGACGCGAromatic-ring hydroxylase family protein. 
Os06g0613500AK070970GTCGCGTCGCGCGCSimilar to Helix-loop-helix protein homolog. 
J023066J03GTCGCGTCGCGCGCNONE 
Os06g0633100AK107791GCGCGCGACGCGConserved hypothetical protein. 
AK107791GTCGCGTCGCGTCGCGCCCACAAConserved hypothetical protein. 
J065001N11GCGCGCGACGCGNONE 
J065001N11GTCGCGTCGCGTCGCGCCCACAANONE 
Os06g0644800006-051-A11CGCGTCGCGTCGCGTCGCNONE 
006-061-C06CGCGTCGCGTCGCGTCGCNONE 
006-086-A03CGCGTCGCGTCGCGTCGCNONE 
006-091-B11CGCGTCGCGTCGCGTCGCNONE 
AK105643CGCGTCGCGTCGCGTCGCNONE 
AK109442CGCGTCGCGTCGCGTCGCMannose-6-phosphate receptor, binding domain containing protein. 
J065083E17CGCGTCGCGTCGCGTCGCNONE 
Os06g0660400AK111110GCGACGCGConserved hypothetical protein. 
Os06g0696400011-019-C01CGCGACGCGNONE 
011-019-C01GCGACGCGNONE 
011-027-D04CGCGACGCGNONE 
011-027-D04GCGACGCGNONE 
013-051-H10CGCGACGCGNONE 
013-051-H10GCGACGCGNONE 
013-054-A06CGCGACGCGNONE 
013-054-A06GCGACGCGNONE 
013-061-D06CGCGACGCGNONE 
013-061-D06GCGACGCGNONE 
013-088-F04CGCGACGCGNONE 
013-088-F04GCGACGCGNONE 
014-018-C07CGCGACGCGNONE 
014-018-C07GCGACGCGNONE 
014-026-E10CGCGACGCGNONE 
014-026-E10GCGACGCGNONE 
AK058291CGCGACGCGNONE 
AK058291GCGACGCGNONE 
AK066125CGCGACGCGNONE 
AK066125GCGACGCGNONE 
AK104912CGCGACGCGNONE 
AK104912GCGACGCGNONE 
BT014685CGCGACGCGSimilar to Xyloglucan endotransglucosylase/hydrolase protein 24 precursor (EC 2.4.1.207) (At-XTH24) (XTH-24) (Meristem protein 5) (MERI-5 protein) (MERI5 protein) (Endo-xyloglucan transferase) (Xyloglucan endo-1,4-beta-D-glucanase). 
BT014685GCGACGCGSimilar to Xyloglucan endotransglucosylase/hydrolase protein 24 precursor (EC 2.4.1.207) (At-XTH24) (XTH-24) (Meristem protein 5) (MERI-5 protein) (MERI5 protein) (Endo-xyloglucan transferase) (Xyloglucan endo-1,4-beta-D-glucanase). 
J013059H08CGCGACGCGNONE 
J013059H08GCGACGCGNONE 
J065065L22CGCGACGCGNONE 
J065065L22GCGACGCGNONE 
J065084O06CGCGACGCGNONE 
J065084O06GCGACGCGNONE 
J075006O13CGCGACGCGNONE 
J075006O13GCGACGCGNONE 
J075013J18CGCGACGCGNONE 
J075013J18GCGACGCGNONE 
J075018L23CGCGACGCGNONE 
J075018L23GCGACGCGNONE 
J075036E14CGCGACGCGNONE 
J075036E14GCGACGCGNONE 
J075039K21CGCGACGCGNONE 
J075039K21GCGACGCGNONE 
J075075H13CGCGACGCGNONE 
J075075H13GCGACGCGNONE 
J075091A14CGCGACGCGNONE 
J075091A14GCGACGCGNONE 
J075093I09CGCGACGCGNONE 
J075093I09GCGACGCGNONE 
J075136L17CGCGACGCGNONE 
J075136L17GCGACGCGNONE 
J075156M24CGCGACGCGNONE 
J075156M24GCGACGCGNONE 
J075174J01CGCGACGCGNONE 
J075174J01GCGACGCGNONE 
J075179P15CGCGACGCGNONE 
J075179P15GCGACGCGNONE 
J075181F02CGCGACGCGNONE 
J075181F02GCGACGCGNONE 
J075194L24CGCGACGCGNONE 
J075194L24GCGACGCGNONE 
J080302J02CGCGACGCGNONE 
J080302J02GCGACGCGNONE 
J080304J11CGCGACGCGNONE 
J080304J11GCGACGCGNONE 
J080308A15CGCGACGCGNONE 
J080308A15GCGACGCGNONE 
J100041B09CGCGACGCGNONE 
J100041B09GCGACGCGNONE 
Os06g0698748004-013-F09CCACGCGTCGCNONE 
006-099-E12CCACGCGTCGCNONE 
009-074-D06CCACGCGTCGCNONE 
009-081-C02CCACGCGTCGCNONE 
013-065-B10CCACGCGTCGCNONE 
AK100361CCACGCGTCGCConserved hypothetical protein. 
AK105781CCACGCGTCGCNONE 
J013088K23CCACGCGTCGCNONE 
J013158L05CCACGCGTCGCNONE 
J023083M02CCACGCGTCGCNONE 
J075034E21CCACGCGTCGCNONE 
J075049F24CCACGCGTCGCNONE 
J075055A21CCACGCGTCGCNONE 
J100044A04CCACGCGTCGCNONE 
J100058I01CCACGCGTCGCNONE 
Os06g0717900AK069070CGCGTCGCPeptidase A1, pepsin family protein. 
AK121147CGCGTCGCNONE 
J023007C05CGCGTCGCNONE 
J043040A14CGCGTCGCNONE 
Os07g0173200AK061624CCACGCGTCGCFrigida-like family protein. 
AK065275CCACGCGTCGCNONE 
AK098856CCACGCGTCGCNONE 
AK098899CCACGCGTCGCNONE 
Os07g0223100006-044-G07CGCGTCGCNONE 
006-071-E10CGCGTCGCNONE 
006-077-A04CGCGTCGCNONE 
009-162-H05CGCGTCGCNONE 
J023050M10CGCGTCGCNONE 
J023055F05CGCGTCGCNONE 
J023060I11CGCGTCGCNONE 
J023101M01CGCGTCGCNONE 
J065059J21CGCGTCGCNONE 
J065087I18CGCGTCGCNONE 
J065113L17CGCGTCGCNONE 
J065123E19CGCGTCGCNONE 
J065137O04CGCGTCGCNONE 
J065217M03CGCGTCGCNONE 
J090012O14CGCGTCGCNONE 
J090014C13CGCGTCGCNONE 
J090060C24CGCGTCGCNONE 
J100037H14CGCGTCGCNONE 
J100060E10CGCGTCGCNONE 
J100067L04CGCGTCGCNONE 
J100075G09CGCGTCGCNONE 
J100077C15CGCGTCGCNONE 
Os07g0262950J033120B02CGCGCGACGCGTGGConserved hypothetical protein. 
J075040G05CGCGCGACGCGTGGNONE 
J075160F23CGCGCGACGCGTGGNONE 
Os07g0422100013-054-G11CGCGTCGCNONE 
AK063592CGCGTCGCNONE 
J065165K10CGCGTCGCNONE 
J075021B01CGCGTCGCNONE 
J075087H22CGCGTCGCNONE 
J075118C10CGCGTCGCNONE 
J075134N03CGCGTCGCNONE 
J075151F23CGCGTCGCNONE 
U57639CGCGTCGCAWPM-19-like family protein. 
Os07g0496200AK064866CGCGTCGCGNONE 
AK065801CGCGTCGCGSimilar to NAD-dependent malic enzyme 62 kDa isoform, mitochondrial precursor (EC 1.1.1.39) (NAD-ME). 
Os07g0531600015-098-E11GCGACGCGNONE 
AK067845GCGACGCGPhospholipid/glycerol acyltransferase domain containing protein. 
J013124G01GCGACGCGNONE 
J065008E15GCGACGCGNONE 
J065052K14GCGACGCGNONE 
J065052L13GCGACGCGNONE 
J065058M02GCGACGCGNONE 
J065069M10GCGACGCGNONE 
J065135A14GCGACGCGNONE 
J065168O18GCGACGCGNONE 
J075070D14GCGACGCGNONE 
J075169B16GCGACGCGNONE 
Os07g0544800009-021-C02CGCGTCGCNONE 
009-170-G02CGCGTCGCNONE 
009-178-H12CGCGTCGCNONE 
AK069170CGCGTCGCSimilar to Oxygen-evolving enhancer protein 3-2, chloroplast precursor (OEE3) (16 kDa subunit of oxygen evolving system of photosystem II) (OEC 16 kDa subunit) (Ferredoxin-NADP reductase binding protein) (BP). 
AK099127CGCGTCGCNONE 
J065088D21CGCGTCGCNONE 
J065106G19CGCGTCGCNONE 
J065156I24CGCGTCGCNONE 
J065162C10CGCGTCGCNONE 
J065211G14CGCGTCGCNONE 
J075003F05CGCGTCGCNONE 
J075046I10CGCGTCGCNONE 
J075055M11CGCGTCGCNONE 
J075074I12CGCGTCGCNONE 
J075088B06CGCGTCGCNONE 
J075091K13CGCGTCGCNONE 
J075093I10CGCGTCGCNONE 
J075097M09CGCGTCGCNONE 
J075106H11CGCGTCGCNONE 
J075121C22CGCGTCGCNONE 
J075145F05CGCGTCGCNONE 
J075173H16CGCGTCGCNONE 
J075190L07CGCGTCGCNONE 
J100063N21CGCGTCGCNONE 
J100073C24CGCGTCGCNONE 
J100085E01CGCGTCGCNONE 
J100088I23CGCGTCGCNONE 
Os07g0546100AK058282GCGACGCGNONE 
Os07g0568300AK067784CGCGACGCGNONE 
AK067895CGCGACGCGSimilar to ZF protein (Fragment). 
J013119M01CGCGACGCGNONE 
J013120B09CGCGACGCGNONE 
J013123G12CGCGACGCGNONE 
J023012C12CGCGACGCGNONE 
J023020G17CGCGACGCGNONE 
J023037E23CGCGACGCGNONE 
J033076I01CGCGACGCGNONE 
J033108A07CGCGACGCGNONE 
J033138J02CGCGACGCGNONE 
J075033L09CGCGACGCGNONE 
J075049E02CGCGACGCGNONE 
J075060N23CGCGACGCGNONE 
J075094H13CGCGACGCGNONE 
J075179L18CGCGACGCGNONE 
J080005P09CGCGACGCGNONE 
J080044J03CGCGACGCGNONE 
J080062G20CGCGACGCGNONE 
J080063L23CGCGACGCGNONE 
J080065B16CGCGACGCGNONE 
J080071K09CGCGACGCGNONE 
J080089C23CGCGACGCGNONE 
J090008P21CGCGACGCGNONE 
J090046B22CGCGACGCGNONE 
J090094C19CGCGACGCGNONE 
J090096B19CGCGACGCGNONE 
J100060G03CGCGACGCGNONE 
J100082D16CGCGACGCGNONE 
Os07g0577600006-021-H11CGCGACGCGNONE 
006-022-B11CGCGACGCGNONE 
006-022-D10CGCGACGCGNONE 
006-022-E02CGCGACGCGNONE 
006-022-F03CGCGACGCGNONE 
006-023-C11CGCGACGCGNONE 
006-024-C10CGCGACGCGNONE 
006-024-C12CGCGACGCGNONE 
006-024-G12CGCGACGCGNONE 
006-026-C04CGCGACGCGNONE 
006-026-E05CGCGACGCGNONE 
006-026-E11CGCGACGCGNONE 
006-026-F09CGCGACGCGNONE 
006-026-H05CGCGACGCGNONE 
006-027-D03CGCGACGCGNONE 
006-028-C04CGCGACGCGNONE 
006-029-G10CGCGACGCGNONE 
006-030-A11CGCGACGCGNONE 
006-030-D12CGCGACGCGNONE 
006-031-G05CGCGACGCGNONE 
006-032-H06CGCGACGCGNONE 
006-033-A02CGCGACGCGNONE 
006-033-A06CGCGACGCGNONE 
006-034-B10CGCGACGCGNONE 
006-034-F07CGCGACGCGNONE 
006-035-A08CGCGACGCGNONE 
006-035-F07CGCGACGCGNONE 
006-036-A04CGCGACGCGNONE 
006-036-B04CGCGACGCGNONE 
006-037-D02CGCGACGCGNONE 
006-037-F12CGCGACGCGNONE 
006-037-H12CGCGACGCGNONE 
006-040-G12CGCGACGCGNONE 
006-040-H03CGCGACGCGNONE 
006-040-H06CGCGACGCGNONE 
006-042-B12CGCGACGCGNONE 
006-042-H10CGCGACGCGNONE 
006-044-G09CGCGACGCGNONE 
006-045-C04CGCGACGCGNONE 
006-046-B10CGCGACGCGNONE 
006-047-A05CGCGACGCGNONE 
006-048-D05CGCGACGCGNONE 
006-049-A08CGCGACGCGNONE 
006-050-C07CGCGACGCGNONE 
006-050-H10CGCGACGCGNONE 
006-051-G03CGCGACGCGNONE 
006-052-A01CGCGACGCGNONE 
006-052-A05CGCGACGCGNONE 
006-052-B03CGCGACGCGNONE 
006-052-D10CGCGACGCGNONE 
006-054-D03CGCGACGCGNONE 
006-055-A12CGCGACGCGNONE 
006-055-C05CGCGACGCGNONE 
006-055-F05CGCGACGCGNONE 
006-055-H10CGCGACGCGNONE 
006-056-A02CGCGACGCGNONE 
006-056-D07CGCGACGCGNONE 
006-057-A03CGCGACGCGNONE 
006-057-B06CGCGACGCGNONE 
006-057-H08CGCGACGCGNONE 
006-058-C04CGCGACGCGNONE 
006-058-F06CGCGACGCGNONE 
006-059-C10CGCGACGCGNONE 
006-059-G08CGCGACGCGNONE 
006-060-E10CGCGACGCGNONE 
006-061-B10CGCGACGCGNONE 
006-062-A05CGCGACGCGNONE 
006-062-B04CGCGACGCGNONE 
006-063-A04CGCGACGCGNONE 
006-063-D01CGCGACGCGNONE 
006-063-G12CGCGACGCGNONE 
006-064-D12CGCGACGCGNONE 
006-066-A03CGCGACGCGNONE 
006-066-C03CGCGACGCGNONE 
006-067-A03CGCGACGCGNONE 
006-067-G07CGCGACGCGNONE 
006-068-A06CGCGACGCGNONE 
006-069-D04CGCGACGCGNONE 
006-069-G05CGCGACGCGNONE 
006-070-H08CGCGACGCGNONE 
006-071-A05CGCGACGCGNONE 
006-071-H11CGCGACGCGNONE 
006-072-A07CGCGACGCGNONE 
006-072-B02CGCGACGCGNONE 
006-072-D11CGCGACGCGNONE 
006-072-H12CGCGACGCGNONE 
006-075-G06CGCGACGCGNONE 
006-077-B09CGCGACGCGNONE 
006-078-D01CGCGACGCGNONE 
006-078-D02CGCGACGCGNONE 
006-078-E05CGCGACGCGNONE 
006-078-G07CGCGACGCGNONE 
006-079-C03CGCGACGCGNONE 
006-079-F12CGCGACGCGNONE 
006-079-H01CGCGACGCGNONE 
006-080-D04CGCGACGCGNONE 
006-080-H04CGCGACGCGNONE 
006-081-A10CGCGACGCGNONE 
006-082-G02CGCGACGCGNONE 
006-082-H07CGCGACGCGNONE 
006-083-B03CGCGACGCGNONE 
006-085-A09CGCGACGCGNONE 
006-085-A12CGCGACGCGNONE 
006-085-F07CGCGACGCGNONE 
006-086-B11CGCGACGCGNONE 
006-086-D01CGCGACGCGNONE 
006-086-G04CGCGACGCGNONE 
006-087-E04CGCGACGCGNONE 
006-087-G09CGCGACGCGNONE 
006-088-E11CGCGACGCGNONE 
006-088-G10CGCGACGCGNONE 
006-088-H01CGCGACGCGNONE 
006-089-B04CGCGACGCGNONE 
006-089-D05CGCGACGCGNONE 
006-089-F07CGCGACGCGNONE 
006-089-H07CGCGACGCGNONE 
006-090-B06CGCGACGCGNONE 
006-090-H05CGCGACGCGNONE 
006-091-E11CGCGACGCGNONE 
006-092-H01CGCGACGCGNONE 
006-093-B08CGCGACGCGNONE 
006-093-C07CGCGACGCGNONE 
006-093-F02CGCGACGCGNONE 
006-093-G05CGCGACGCGNONE 
006-093-G06CGCGACGCGNONE 
006-094-D10CGCGACGCGNONE 
006-094-H07CGCGACGCGNONE 
006-095-G03CGCGACGCGNONE 
006-096-A06CGCGACGCGNONE 
006-096-E03CGCGACGCGNONE 
006-097-B03CGCGACGCGNONE 
006-097-D03CGCGACGCGNONE 
006-098-B07CGCGACGCGNONE 
006-098-G05CGCGACGCGNONE 
006-099-F05CGCGACGCGNONE 
006-100-H10CGCGACGCGNONE 
006-100-H12CGCGACGCGNONE 
006-101-A06CGCGACGCGNONE 
006-101-A08CGCGACGCGNONE 
006-101-A12CGCGACGCGNONE 
006-101-D04CGCGACGCGNONE 
006-101-G07CGCGACGCGNONE 
006-102-B12CGCGACGCGNONE 
006-102-E09CGCGACGCGNONE 
006-102-F02CGCGACGCGNONE 
006-103-D09CGCGACGCGNONE 
006-105-D05CGCGACGCGNONE 
006-105-D08CGCGACGCGNONE 
006-106-C07CGCGACGCGNONE 
006-106-F12CGCGACGCGNONE 
006-107-D01CGCGACGCGNONE 
006-109-C05CGCGACGCGNONE 
006-109-C08CGCGACGCGNONE 
006-109-D02CGCGACGCGNONE 
006-111-F03CGCGACGCGNONE 
006-112-C12CGCGACGCGNONE 
006-112-D08CGCGACGCGNONE 
006-113-A01CGCGACGCGNONE 
006-113-B03CGCGACGCGNONE 
006-113-C11CGCGACGCGNONE 
006-113-E07CGCGACGCGNONE 
006-113-F08CGCGACGCGNONE 
006-114-D08CGCGACGCGNONE 
006-114-H08CGCGACGCGNONE 
006-115-A08CGCGACGCGNONE 
006-115-A09CGCGACGCGNONE 
006-115-G05CGCGACGCGNONE 
006-117-B06CGCGACGCGNONE 
006-117-B09CGCGACGCGNONE 
006-117-F11CGCGACGCGNONE 
006-117-G10CGCGACGCGNONE 
006-117-H08CGCGACGCGNONE 
006-118-C06CGCGACGCGNONE 
006-118-G11CGCGACGCGNONE 
006-119-H03CGCGACGCGNONE 
006-120-D01CGCGACGCGNONE 
006-120-D12CGCGACGCGNONE 
006-120-H04CGCGACGCGNONE 
009-022-E12CGCGACGCGNONE 
009-044-H02CGCGACGCGNONE 
009-074-B08CGCGACGCGNONE 
009-145-B08CGCGACGCGNONE 
009-156-D09CGCGACGCGNONE 
009-163-F03CGCGACGCGNONE 
009-193-G03CGCGACGCGNONE 
AF010321CGCGACGCGNONE 
AK060987CGCGACGCGNONE 
AK070051CGCGACGCGNONE 
AK103966CGCGACGCGNONE 
AK104016CGCGACGCGNONE 
AK104127CGCGACGCGNONE 
AK104177CGCGACGCGNONE 
AK104283CGCGACGCGNONE 
AK104608CGCGACGCGNONE 
AK104651CGCGACGCGNONE 
AK119176CGCGACGCGSimilar to Type II chlorophyll a/b binding protein from photosystem I precursor. 
J065013J05CGCGACGCGNONE 
J065129D23CGCGACGCGNONE 
J065138E06CGCGACGCGNONE 
J065179N22CGCGACGCGNONE 
J065192A07CGCGACGCGNONE 
J065208G16CGCGACGCGNONE 
J075013K01CGCGACGCGNONE 
J075017B12CGCGACGCGNONE 
J075018O17CGCGACGCGNONE 
J075023H05CGCGACGCGNONE 
J075053L02CGCGACGCGNONE 
J075067I01CGCGACGCGNONE 
J075083D19CGCGACGCGNONE 
J075083G03CGCGACGCGNONE 
J075084F12CGCGACGCGNONE 
J075088K18CGCGACGCGNONE 
J075094A18CGCGACGCGNONE 
J075094I22CGCGACGCGNONE 
J075097E17CGCGACGCGNONE 
J075098I24CGCGACGCGNONE 
J075110K19CGCGACGCGNONE 
J075118G21CGCGACGCGNONE 
J075118J20CGCGACGCGNONE 
J075120G14CGCGACGCGNONE 
J075120H20CGCGACGCGNONE 
J075127H23CGCGACGCGNONE 
J075139M03CGCGACGCGNONE 
J075142E17CGCGACGCGNONE 
J075149N17CGCGACGCGNONE 
J075152A20CGCGACGCGNONE 
J075157N22CGCGACGCGNONE 
J075159K21CGCGACGCGNONE 
J075173B20CGCGACGCGNONE 
J075192N20CGCGACGCGNONE 
J075196A07CGCGACGCGNONE 
J075199N04CGCGACGCGNONE 
J080005P10CGCGACGCGNONE 
J080025I24CGCGACGCGNONE 
J080064D09CGCGACGCGNONE 
J080064N24CGCGACGCGNONE 
J080068B02CGCGACGCGNONE 
J080097K04CGCGACGCGNONE 
J080097K19CGCGACGCGNONE 
J080097N20CGCGACGCGNONE 
J100055P07CGCGACGCGNONE 
Os07g0584500003-129-F05GTCGCGTCGCGTCNONE 
006-119-H08GTCGCGTCGCGTCNONE 
011-022-G03GTCGCGTCGCGTCNONE 
AK067725GTCGCGTCGCGTCRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
AK121109GTCGCGTCGCGTCNONE 
J013055C05GTCGCGTCGCGTCNONE 
J013062F12GTCGCGTCGCGTCNONE 
J013069J22GTCGCGTCGCGTCNONE 
J013114I11GTCGCGTCGCGTCNONE 
J023072P12GTCGCGTCGCGTCNONE 
Os07g0592200AK099740GCGACGCGPeptidase A1, pepsin family protein. 
AK110717GCGACGCGNONE 
Os07g0641700009-030-F09CGCGTCGCNONE 
014-030-D10CGCGTCGCNONE 
AF009413CGCGTCGCSimilar to 10 kDa chaperonin (Protein CPN10) (Protein groES). 
AK059154CGCGTCGCNONE 
AK119728CGCGTCGCNONE 
AK122129CGCGTCGCNONE 
J023057A19CGCGTCGCNONE 
J023143P09CGCGTCGCNONE 
J033132M21CGCGTCGCNONE 
J065039D07CGCGTCGCNONE 
J065062M22CGCGTCGCNONE 
J065071L10CGCGTCGCNONE 
J065088N13CGCGTCGCNONE 
J065115D21CGCGTCGCNONE 
J065187D07CGCGTCGCNONE 
J075011B03CGCGTCGCNONE 
J075011K23CGCGTCGCNONE 
J075029J17CGCGTCGCNONE 
J075038J07CGCGTCGCNONE 
J075065A18CGCGTCGCNONE 
J075083P05CGCGTCGCNONE 
J075101G24CGCGTCGCNONE 
J075127E19CGCGTCGCNONE 
J075161K23CGCGTCGCNONE 
J075175D23CGCGTCGCNONE 
J090044M07CGCGTCGCNONE 
J090065G16CGCGTCGCNONE 
J090065J11CGCGTCGCNONE 
J090097M02CGCGTCGCNONE 
J090099D02CGCGTCGCNONE 
J100056A20CGCGTCGCNONE 
J100063M21CGCGTCGCNONE 
Os07g0656700J065166M23GCGACGCGUncharacterized protein UPF0114 family protein. 
Os07g0657100AK108253CGCGACGCGACGCGGlyoxalase/extradiol ring-cleavage dioxygenase domain containing protein. 
AK108253CGCGACGCGACGCGGlyoxalase/extradiol ring-cleavage dioxygenase domain containing protein. 
J075072F01CGCGACGCGACGCGNONE 
J075072F01CGCGACGCGACGCGNONE 
J075078C21CGCGACGCGACGCGNONE 
J075078C21CGCGACGCGACGCGNONE 
J075147E12CGCGACGCGACGCGNONE 
J075147E12CGCGACGCGACGCGNONE 
J075180N10CGCGACGCGACGCGNONE 
J075180N10CGCGACGCGACGCGNONE 
J075197D01CGCGACGCGACGCGNONE 
J075197D01CGCGACGCGACGCGNONE 
Os07g0659300AK069789CGCGACGCGConserved hypothetical protein. 
Os07g0681400009-117-B11CGCACGCGTCGCGNONE 
AK062850CGCACGCGTCGCGSimilar to Calcium-binding protein CAST. 
J065025F13CGCACGCGTCGCGNONE 
Os07g0691300009-078-C12CGCGACGCGNONE 
009-132-H04CGCGACGCGNONE 
AK069499CGCGACGCGWound-induced WI12 family protein. 
Os07g0695400015-036-B08CGCGTCGCGTCGCNONE 
015-036-B08GCGTCGCGTCGCGTGCGNONE 
AK100615CGCGTCGCGTCGCNONE 
AK100615GCGTCGCGTCGCGTGCGNONE 
AK106304CGCGTCGCGTCGCKIP1-like domain containing protein. 
AK106304GCGTCGCGTCGCGTGCGKIP1-like domain containing protein. 
J023108B01CGCGTCGCGTCGCNONE 
J023108B01GCGTCGCGTCGCGTGCGNONE 
Os08g0110300016-022-A12CGCGTCGCNONE 
AK067360CGCGTCGCLongin domain containing protein. 
J013102A15CGCGTCGCNONE 
J065047M18CGCGTCGCNONE 
J065068F21CGCGTCGCNONE 
J065090H15CGCGTCGCNONE 
J065096I06CGCGTCGCNONE 
J065166D03CGCGTCGCNONE 
J090014K09CGCGTCGCNONE 
J090024I21CGCGTCGCNONE 
J090079I01CGCGTCGCNONE 
Os08g0127600AK058365CGCGACGCGHeat shock protein DnaJ, N-terminal domain containing protein. 
AK068373CGCGACGCGNONE 
J013149L10CGCGACGCGNONE 
J075027H17CGCGACGCGNONE 
J075060F10CGCGACGCGNONE 
Os08g0144100AK071435TCGCGCGCGCGACGCGSimilar to Avr9/Cf-9 rapidly elicited protein 31. 
Os08g0163400AB005290CGCGTCGCGSigma-70 factor family protein. 
AK065997CGCGTCGCGNONE 
AK071725CGCGTCGCGNONE 
Os08g0175200AK072367CGCGTCGCProtein of unknown function DUF292, eukaryotic domain containing protein. 
J013149H16CGCGTCGCNONE 
J023075K04CGCGTCGCNONE 
J023082L15CGCGTCGCNONE 
J043015G07CGCGTCGCNONE 
J065052L17CGCGTCGCNONE 
J065202P07CGCGTCGCNONE 
J075061D17CGCGTCGCNONE 
J100088P13CGCGTCGCNONE 
Os08g0243500AK068915CGCGTCGCGCGCCCAATTSimilar to NADPH-cytochrome P450 oxydoreductase isoform 2. 
AK099083CGCGTCGCGCGCCCAATTNONE 
Os08g0346400003-103-D08CGCGACGCGNONE 
009-135-G12CGCGACGCGNONE 
AK059644CGCGACGCGNONE 
AK062928CGCGACGCGNONE 
AK103873CGCGACGCGSimilar to Phosphate starvation regulator protein (Regulatory protein of P- starvation acclimation response Psr1). 
J033149L11CGCGACGCGNONE 
J065137E08CGCGACGCGNONE 
J065194M22CGCGACGCGNONE 
J075083O16CGCGACGCGNONE 
Os08g0379400006-112-H05CGCGTCGCNONE 
AK112013CGCGTCGCNONE 
J023019N13CGCGTCGCNONE 
Os08g0402500AK108881GCGCGCGACGCGACGCGConserved hypothetical protein. 
Os08g0428400AK060047GCGACGCGNONE 
J033129L12GCGACGCGNONE 
Os08g0461800012-071-E12GCGACGCGNONE 
AK066516GCGACGCGNONE 
AK067364GCGACGCGConserved hypothetical protein. 
AK098966GCGACGCGNONE 
Os08g0484700J065041E01CGCGACGCGACHomeodomain-like containing protein. 
Os08g0485700AK068131GCGCGCGACGCGNONE 
AK069097GCGCGCGACGCGMethyl-CpG binding domain containing protein. 
J013130L03GCGCGCGACGCGNONE 
Os08g0512500009-155-B08GCGACGCGNONE 
AK068227GCGACGCGSimilar to Thylakoid lumen protein, chloroplast. 
Os08g0512700AK060545GCGACGCGSimilar to 3-hydroxy-3-methylglutaryl coenzyme A reductase (EC 1.1.1.34) (Fragment). 
Os08g0564300006-049-F07GTCGCGTCGCTGGGCTNONE 
AK105923GTCGCGTCGCTGGGCTNONE 
Os09g0241100AK109602CGCGTCGCNONE 
Os09g0251800006-100-E12CGCGACGCGACGCNONE 
AK061218CGCGACGCGACGCC2 calcium/lipid-binding region, CaLB domain containing protein. 
AK104010CGCGACGCGACGCNONE 
J065048A02CGCGACGCGACGCNONE 
J065073P10CGCGACGCGACGCNONE 
J065075B09CGCGACGCGACGCNONE 
J065112B05CGCGACGCGACGCNONE 
J090014H10CGCGACGCGACGCNONE 
Os09g0265050J065112H09CGCGCGACGCGTGGConserved hypothetical protein. 
Os09g0325700011-041-G03CGCGACGCGNONE 
AK063334CGCGACGCGSimilar to Protein phpsphatase 2C (PP2C) (EC 3.1.3.16). 
J080317M24CGCGACGCGNONE 
Os09g0338400AK059171CGCGTCGCNONE 
AK068798CGCGTCGCNONE 
AK072043CGCGTCGCNONE 
AK098947CGCGTCGCSimilar to Cysteine desulfurase, mitochondrial precursor (EC 2.8.1.7) (m-Nfs1). 
Os09g0370300AK108199CGCGTCGCGSimilar to Iron sulfur subunit of succinate dehydrogenase (Truncated) and ribosomal protein S14 precursor. 
Os09g0433650J075094M19GCGACGCGTobacco mosaic virus coat protein family protein. 
Os09g0434500006-048-E11GCGACGCGNONE 
AF364176GCGACGCGNONE 
AK104576GCGACGCGNONE 
AK104723GCGACGCGNONE 
AK111690GCGACGCGSimilar to Ethylene response factor 2. 
AY831392GCGACGCGNONE 
J013041D04GCGACGCGNONE 
Os09g0456200015-025-E01CCACGCGTCGCGCGCNONE 
AK065873CCACGCGTCGCGCGCSimilar to BZIP transcription factor ABI5. 
J013049N23CCACGCGTCGCGCGCNONE 
J033128E10CCACGCGTCGCGCGCNONE 
Os09g0480100009-120-H03GTCGCGTCGCNONE 
AK062866GTCGCGTCGCConserved hypothetical protein. 
Os09g0493700015-091-G11GCGACGCGNONE 
AK068501GCGACGCGSimilar to CUC2. 
AK099237GCGACGCGNONE 
J013155B08GCGACGCGNONE 
J023006E01GCGACGCGNONE 
J023060K23GCGACGCGNONE 
J023100B11GCGACGCGNONE 
J033026L19GCGACGCGNONE 
J033129J12GCGACGCGNONE 
J033149K09GCGACGCGNONE 
J065045I06GCGACGCGNONE 
J065061A10GCGACGCGNONE 
J065101H05GCGACGCGNONE 
J065135A03GCGACGCGNONE 
J065169C16GCGACGCGNONE 
J100047C11GCGACGCGNONE 
J100047K07GCGACGCGNONE 
Os09g0493800011-053-H02CGCGTCGCNONE 
015-024-E10CGCGTCGCNONE 
AK103057CGCGTCGCSimilar to Chaperone protein dnaJ 10 (AtJ10) (AtDjC10). 
AK105408CGCGTCGCNONE 
J033117K03CGCGTCGCNONE 
J065135F16CGCGTCGCNONE 
J065140A21CGCGTCGCNONE 
J075018O14CGCGTCGCNONE 
J075033C15CGCGTCGCNONE 
Os09g0497400009-087-E03CGCGTCGCGTCNONE 
AK058354CGCGTCGCGTCNONE 
J013159B19CGCGTCGCGTCNONE 
J023011D22CGCGTCGCGTCNONE 
J023081K05CGCGTCGCGTCNONE 
J033060O14CGCGTCGCGTCNONE 
J075020I08CGCGTCGCGTCNONE 
J075034J03CGCGTCGCGTCNONE 
J075049M15CGCGTCGCGTCNONE 
J075065K02CGCGTCGCGTCNONE 
J075099L06CGCGTCGCGTCNONE 
Os09g0525500AK107918CGCGACGCGYY1 protein precursor. 
D50575CGCGACGCGNONE 
Os09g0525900006-115-E04CGCGTCGCGNONE 
AK059988CGCGTCGCGRhomboid-like protein family protein. 
AK071290CGCGTCGCGNONE 
J013153K05CGCGTCGCGNONE 
J023087M04CGCGTCGCGNONE 
J065165B13CGCGTCGCGNONE 
J075013G15CGCGTCGCGNONE 
J075028A09CGCGTCGCGNONE 
J075031I06CGCGTCGCGNONE 
J075051C21CGCGTCGCGNONE 
J075114H22CGCGTCGCGNONE 
J075129A19CGCGTCGCGNONE 
J075129M12CGCGTCGCGNONE 
J075166N24CGCGTCGCGNONE 
J075167M23CGCGTCGCGNONE 
J075168D10CGCGTCGCGNONE 
Os09g0534800009-128-G09CGCGACGCGACCGAGCCGNONE 
AF464908CGCGACGCGACCGAGCCGNONE 
AK068941CGCGACGCGACCGAGCCGTranscription initiation factor IIB (General transcription factor TFIIB). 
J013170A08CGCGACGCGACCGAGCCGNONE 
J023123L05CGCGACGCGACCGAGCCGNONE 
J043020O05CGCGACGCGACCGAGCCGNONE 
Os09g0547300AK102669GCGACGCGNONE 
Os09g0551600005-020-H08CGCGTCGCGCGCNONE 
006-043-E02CGCGTCGCGCGCNONE 
013-043-F03CGCGTCGCGCGCNONE 
AK066658CGCGTCGCGCGCSimilar to HMGd1 protein (Nucleasome/chromatin assembly factor D protein NFD101). 
J013071N11CGCGTCGCGCGCNONE 
J065177J20CGCGTCGCGCGCNONE 
J075041D06CGCGTCGCGCGCNONE 
J075199H24CGCGTCGCGCGCNONE 
J080001G07CGCGTCGCGCGCNONE 
J080024A12CGCGTCGCGCGCNONE 
J080025B15CGCGTCGCGCGCNONE 
J090017G07CGCGTCGCGCGCNONE 
J090050G23CGCGTCGCGCGCNONE 
J090083G11CGCGTCGCGCGCNONE 
Os11g0244800AK103215GCGACGCGACGCGSimilar to Alfin-1. 
J065009E13GCGACGCGACGCGNONE 
J065027D16GCGACGCGACGCGNONE 
J065085B06GCGACGCGACGCGNONE 
J065180O17GCGACGCGACGCGNONE 
J090010C16GCGACGCGACGCGNONE 
J090039K20GCGACGCGACGCGNONE 
Os11g0542100J065162B12GTCGCGTCGCZinc finger, RING-type domain containing protein. 
Os12g0114100AK067447GTCGCGTCGCSimilar to MAP kinase-like protein. 
AK072172GTCGCGTCGCNONE 
J013075O15GTCGCGTCGCNONE 
J013129I24GTCGCGTCGCNONE 
J090058A14GTCGCGTCGCNONE 
Os12g0141000J065041B13GCGACGCGConserved hypothetical protein. 
J065110D03GCGACGCGNONE 
J065183O10GCGACGCGNONE 
Os12g0149300AK110842CGCGTCGCGCGCSimilar to Xyloglucan 6-xylosyltransferase (EC 2.4.2.39) (AtXT1). 
Os12g0182200009-110-C10GTCGCGTCGCNONE 
AK069414GTCGCGTCGCNONE 
Os12g0255866J075127N18CGCGCGACGCGTGGConserved hypothetical protein. 
Os12g0297400005-006-D01CGCGTCGCNONE 
005-006-D01CGCGTCGCNONE 
AK061658CGCGTCGCHypothetical protein. 
AK061658CGCGTCGCHypothetical protein. 
Os12g0509300AK108497CGCGTCGCGConserved hypothetical protein. 
Os12g0592900AK064058CGCGACGCGNONE 
AK120039CGCGACGCGHypothetical protein. 
J065081M07CGCGACGCGNONE 
J065105G17CGCGACGCGNONE 
J075017E06CGCGACGCGNONE 
J075040M14CGCGACGCGNONE 
J075052I18CGCGACGCGNONE 
J075055J23CGCGACGCGNONE 
J075057L03CGCGACGCGNONE 
J075099C10CGCGACGCGNONE 
J075104C21CGCGACGCGNONE 
J075172L12CGCGACGCGNONE 
J075179D22CGCGACGCGNONE 
J075182G07CGCGACGCGNONE 
J075194N11CGCGACGCGNONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.