version

Summary of OsREG560 (All List)

OrganismOryza sativa  
IDOsREG560  
SequenceCGCGTCTC  
Annotation  
PPDB Motif 
PLACE Motif 
Total Entry Count865  

Entry Sequences (865 entries)

LocusGene modelSequenceDescription
Os01g0157800AK121694GAGACGCGHeat shock protein DnaJ, N-terminal domain containing protein. 
J033072F06GAGACGCGNONE 
Os01g0184800AK073377CGCGTCTCPhosducin family protein. 
AK102544CGCGTCTCNONE 
J023047L21CGCGTCTCNONE 
J023135I09CGCGTCTCNONE 
J033028G17CGCGTCTCNONE 
J065164L07CGCGTCTCNONE 
J065193F22CGCGTCTCNONE 
J075035I10CGCGTCTCNONE 
J075168H15CGCGTCTCNONE 
Os01g0224700AK070386CGCGTCTCSimilar to Flavin monoxygenase-like protein floozy. 
Os01g0257400AK073920GAGACGCGZinc finger, CCCH-type domain containing protein. 
Os01g0263300006-024-C06CGCGTCTCNONE 
006-051-H05CGCGTCTCNONE 
011-038-H01CGCGTCTCNONE 
AK061583CGCGTCTCSimilar to Peroxidase 72 precursor (EC 1.11.1.7) (Atperox P72) (PRXR8) (ATP6a). 
AK102117CGCGTCTCNONE 
Os01g0618000AK064632GAGACGCGExonuclease domain containing protein. 
Os01g0662600009-056-E10GCGTCGCGTCTCNONE 
AK062234GCGTCGCGTCTCNONE 
AK098887GCGTCGCGTCTCNONE 
AK099656GCGTCGCGTCTCNONE 
AK119723GCGTCGCGTCTCSimilar to NifU-like protein. 
J013001K01GCGTCGCGTCTCNONE 
J013090F20GCGTCGCGTCTCNONE 
J013119A14GCGTCGCGTCTCNONE 
J013121P12GCGTCGCGTCTCNONE 
J033132I15GCGTCGCGTCTCNONE 
J075023F22GCGTCGCGTCTCNONE 
J075023M13GCGTCGCGTCTCNONE 
J100024D10GCGTCGCGTCTCNONE 
J100024N01GCGTCGCGTCTCNONE 
J100026H09GCGTCGCGTCTCNONE 
J100027H07GCGTCGCGTCTCNONE 
J100045K07GCGTCGCGTCTCNONE 
J100057K18GCGTCGCGTCTCNONE 
J100085C22GCGTCGCGTCTCNONE 
Os01g0675700003-128-A07GAGACGCGNONE 
006-037-C05GAGACGCGNONE 
AJ627256GAGACGCGNONE 
AK061495GAGACGCGNONE 
AK102396GAGACGCGNONE 
AK106121GAGACGCGSimilar to Auxin-responsive protein IAA14 (Indoleacetic acid-induced protein 14) (SOLITARY-ROOT protein). 
J065168F03GAGACGCGNONE 
J075198K21GAGACGCGNONE 
J100027E13GAGACGCGNONE 
J100074L18GAGACGCGNONE 
Os01g0682500AK068815CGCGTCTCConserved hypothetical protein. 
AK104091CGCGTCTCNONE 
J065010F21CGCGTCTCNONE 
J065096I15CGCGTCTCNONE 
Os01g0699400AK107168GAGACGCGACProtein kinase-like domain containing protein. 
Os01g0699600009-111-F06GAGACGCGNONE 
AK105196GAGACGCGProtein kinase-like domain containing protein. 
J065128A07GAGACGCGNONE 
Os01g0747400AK102467GAGACGCGProtein kinase-like domain containing protein. 
Os01g0757200AB092485CGCGTCTCNONE 
AK060666CGCGTCTCNONE 
AK060714CGCGTCTCNONE 
AK099350CGCGTCTCNONE 
AK101713CGCGTCTCSimilar to GA 2-oxidase 4. 
Os01g0770400006-112-B08GAGACGCGNONE 
AK061253GAGACGCGNONE 
AK061585GAGACGCGCyclin-like F-box domain containing protein. 
Os01g0776700J065046N20CGCGTCTCGTCGCGTCGGCTCGGConserved hypothetical protein. 
J100086L02CGCGTCTCGTCGCGTCGGCTCGGNONE 
Os02g0177700AK119941GCCCATGGCGCACGCGTCTCProtein of unknown function DUF588 family protein. 
Os02g0208100011-077-C09CGCGTCTCSimilar to Chloroplast ADP,ATP carrier protein 2, chloroplast precursor (ADP/ATP translocase 2) (Adenine nucleotide translocase 2). 
Os02g0245000AK119770GAGACGCGTGCGNONE 
AK119874GAGACGCGTGCGSWAP/Surp domain containing protein. 
J065038L11GAGACGCGTGCGNONE 
J100059I06GAGACGCGTGCGNONE 
J100076C23GAGACGCGTGCGNONE 
J100081P08GAGACGCGTGCGNONE 
J100084C13GAGACGCGTGCGNONE 
Os02g0320100AK103173GAGACGCGBacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p domain containing protein. 
Os02g0506600AK107967GAGACGCGConserved hypothetical protein. 
J065142J01GAGACGCGNONE 
J100044B16GAGACGCGNONE 
J100079K18GAGACGCGNONE 
J100086M04GAGACGCGNONE 
Os02g0530600AK102681CCCCCACGTCTCGCGTCTCBRCT domain containing protein. 
Os02g0586400006-066-D08GAGACGCGNONE 
006-073-A01GAGACGCGNONE 
J065088B17GAGACGCGNONE 
J075065L07GAGACGCGNONE 
J100017B20GAGACGCGNONE 
J100025B03GAGACGCGNONE 
Os02g0610500AK058536CGCGCGAGACGCGSimilar to CONSTANS-like protein CO9 (Fragment). 
AK058536CTCGCGCGCGCGTCTCSimilar to CONSTANS-like protein CO9 (Fragment). 
AK100097CGCGCGAGACGCGNONE 
AK100097CTCGCGCGCGCGTCTCNONE 
J090016D17CGCGCGAGACGCGNONE 
J090016D17CTCGCGCGCGCGTCTCNONE 
J090077O10CGCGCGAGACGCGNONE 
J090077O10CTCGCGCGCGCGTCTCNONE 
J090097J09CGCGCGAGACGCGNONE 
J090097J09CTCGCGCGCGCGTCTCNONE 
J100054K15CGCGCGAGACGCGNONE 
J100054K15CTCGCGCGCGCGTCTCNONE 
J100066N13CGCGCGAGACGCGNONE 
J100066N13CTCGCGCGCGCGTCTCNONE 
J100072H14CGCGCGAGACGCGNONE 
J100072H14CTCGCGCGCGCGTCTCNONE 
Os02g0630300AK108598CGCGTCTCNONE 
Os02g0700000AK100709GAGACGCGACPWWP domain containing protein. 
J013072L20GAGACGCGACNONE 
J023115E12GAGACGCGACNONE 
J033099N14GAGACGCGACNONE 
J033148H17GAGACGCGACNONE 
J100074E14GAGACGCGACNONE 
Os02g0780700AK063558CGCGTCTCLipase, class 3 family protein. 
Os02g0791500AK069596CGCGTCTCNONE 
AK071654CGCGTCTCSimilar to Nucleotide sugar epimerase-like protein (UDP-D-glucuronate 4- epimerase) (EC 5.1.3.6). 
J075023J20CGCGTCTCNONE 
J080023B15CGCGTCTCNONE 
J080041E14CGCGTCTCNONE 
J080064D08CGCGTCTCNONE 
Os02g0828800AK062497GAGACGCGConserved hypothetical protein. 
Os03g0117900AK108930CGCGTCTCSimilar to Transcription factor. 
Os03g0123300003-131-G09CGCGTCTCNONE 
AK058595CGCGTCTCNONE 
J075056B01CGCGTCTCNONE 
Os03g0136900AK067183GCCCACCACGCGTCTCSimilar to Aconitate hydratase, cytoplasmic (EC 4.2.1.3) (Citrate hydro-lyase) (Aconitase). 
Os03g0207400AK072292CGCGTCTCSimilar to Protein phosphatase 2C-like. 
AK072292CGCGTCTCSimilar to Protein phosphatase 2C-like. 
Os03g0263900AK121215GAGACGCGCalcium-binding EF-hand domain containing protein. 
J075115D02GAGACGCGNONE 
J090095P20GAGACGCGNONE 
Os03g0276500011-014-A06CGCGTCTCNONE 
012-043-E04CGCGTCTCNONE 
012-096-G01CGCGTCTCNONE 
014-005-A07CGCGTCTCNONE 
014-031-F09CGCGTCTCNONE 
014-040-C09CGCGTCTCNONE 
014-092-G02CGCGTCTCNONE 
AK072830CGCGTCTCNONE 
AK099275CGCGTCTCNONE 
AK109474CGCGTCTCSimilar to Heat shock protein 70. 
J013036E08CGCGTCTCNONE 
J013047P03CGCGTCTCNONE 
J013048H14CGCGTCTCNONE 
J013060E24CGCGTCTCNONE 
J013093N10CGCGTCTCNONE 
J013123K11CGCGTCTCNONE 
J013153C09CGCGTCTCNONE 
J023010D20CGCGTCTCNONE 
J023027O13CGCGTCTCNONE 
J023029B01CGCGTCTCNONE 
J023063G14CGCGTCTCNONE 
J023083D09CGCGTCTCNONE 
J023091M13CGCGTCTCNONE 
J023121M10CGCGTCTCNONE 
J023126D10CGCGTCTCNONE 
J023139H01CGCGTCTCNONE 
J023145B18CGCGTCTCNONE 
J033029G15CGCGTCTCNONE 
J033050K13CGCGTCTCNONE 
J033057L09CGCGTCTCNONE 
J033092M15CGCGTCTCNONE 
J065007N14CGCGTCTCNONE 
J065038E07CGCGTCTCNONE 
J065043A09CGCGTCTCNONE 
J065100C19CGCGTCTCNONE 
J065117C02CGCGTCTCNONE 
J065213I04CGCGTCTCNONE 
J090001F01CGCGTCTCNONE 
J090025D07CGCGTCTCNONE 
J090037C11CGCGTCTCNONE 
J090047N11CGCGTCTCNONE 
J090053O05CGCGTCTCNONE 
J090070F11CGCGTCTCNONE 
J090082O16CGCGTCTCNONE 
J090085F20CGCGTCTCNONE 
J090096N08CGCGTCTCNONE 
Os03g0305400009-198-D04GAGACGCGNONE 
013-012-C06GAGACGCGNONE 
014-034-D01GAGACGCGNONE 
AK071397GAGACGCGUniversal stress protein (Usp) family protein. 
J023012O22GAGACGCGNONE 
J023097A13GAGACGCGNONE 
J023107P16GAGACGCGNONE 
J023113C14GAGACGCGNONE 
Os03g0308900AK064183CGCGTCTCConserved hypothetical protein. 
Os03g0309000AK070071CGCGTCTCVirulence factor, pectin lyase fold family protein. 
Os03g0572900AK102204GAGACGCGMulti antimicrobial extrusion protein MatE family protein. 
Os03g0687000004-020-F11CGCGTCTCNONE 
AK065253CGCGTCTCConserved hypothetical protein. 
AK099321CGCGTCTCNONE 
AK099910CGCGTCTCNONE 
AK104378CGCGTCTCNONE 
J013002J10CGCGTCTCNONE 
J013096H20CGCGTCTCNONE 
J023012P19CGCGTCTCNONE 
J043027G24CGCGTCTCNONE 
Os03g0696300AK069854CGCGTCTCCCAAT-binding transcription factor, subunit B family protein. 
Os03g0722600J075145A04GAGACGCGCAP protein family protein. 
Os03g0743500AK067697CGCGTCTCSimilar to Calmodulin 1 (Fragment). 
J013118D08CGCGTCTCNONE 
J013126A03CGCGTCTCNONE 
J013134P14CGCGTCTCNONE 
J013134P16CGCGTCTCNONE 
J065038C16CGCGTCTCNONE 
J065102M18CGCGTCTCNONE 
J100089I23CGCGTCTCNONE 
Os03g0751100AK102404GAGACGCGSimilar to Isp4 protein-like. 
Os03g0772600AK120949GAGACGCGACGCGACGCGACGCGSimilar to Lectin-like receptor kinase 7;2. 
Os03g0784500AK109744CATCCACCCGCGTCGCGTCTCNONE 
Os03g0811600009-134-B07CGCGTCTCNONE 
AK071076CGCGTCTCSimilar to Peptidyl prolyl isomerase H. 
J023078H22CGCGTCTCNONE 
Os03g0844000AK059033GAGACGCGNONE 
AK065633GAGACGCGProtein prenyltransferase domain containing protein. 
J013031L22GAGACGCGNONE 
J065099H18GAGACGCGNONE 
Os04g0106300AK059655CGCGTCTCNONE 
AK101488CGCGTCTCSimilar to Arginase (EC 3.5.3.1). 
Os04g0380800J075004H10GAGACGCGConserved hypothetical protein. 
Os04g0414100006-038-F07CGCGTCTCNONE 
AK061508CGCGTCTCNONE 
Os04g0491500AK068089GAGACGCGNONE 
AK101116GAGACGCGTGF-beta receptor, type I/II extracellular region family protein. 
Os04g0530300009-053-E04GAGACGCGNONE 
009-074-E03GAGACGCGNONE 
AK066705GAGACGCGConserved hypothetical protein. 
Os04g0552300006-074-A08CCACGCGTCTCNONE 
AK061100CCACGCGTCTCNegative regulatory factor PREG family protein. 
Os04g0586500015-095-E09CGCGTCTCNONE 
AK106447CGCGTCTCConserved hypothetical protein. 
J075065I17CGCGTCTCNONE 
J100078J08CGCGTCTCNONE 
Os04g0674350J065104O14GAGACGCGNONE 
J065118J19GAGACGCGNONE 
J065167I12GAGACGCGHypothetical protein. 
Os04g0674400015-042-B08CGCGTCTCNONE 
AK102124CGCGTCTCSimilar to Anamorsin (Cytokine induced apoptosis inhibitor 1) (CUA001). Splice isoform 2. 
J013129O22CGCGTCTCNONE 
J023022I24CGCGTCTCNONE 
J023120A15CGCGTCTCNONE 
J023123P20CGCGTCTCNONE 
J033068P09CGCGTCTCNONE 
J033107G22CGCGTCTCNONE 
J033116G12CGCGTCTCNONE 
J033133F03CGCGTCTCNONE 
J033143B20CGCGTCTCNONE 
J043006G12CGCGTCTCNONE 
J043027M18CGCGTCTCNONE 
J043034H17CGCGTCTCNONE 
J090091E20CGCGTCTCNONE 
J100035H09CGCGTCTCNONE 
J100037J04CGCGTCTCNONE 
J100047J24CGCGTCTCNONE 
J100059G06CGCGTCTCNONE 
J100066O12CGCGTCTCNONE 
J100074G23CGCGTCTCNONE 
J100077M12CGCGTCTCNONE 
Os05g0119300004-011-B09CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
006-063-A03CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
006-077-E12CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
006-079-E12CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
006-100-B11CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
009-109-A12CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
009-123-C07CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
009-163-D09CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
009-170-D11CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
009-173-C01CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
009-192-E01CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
011-048-G01CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
AK060883CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
AK068289CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
AK071554CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
AK099495CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGXYPPX repeat containing protein. 
AY348312CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J013037L16CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J013088P04CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J013099D14CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J013146E19CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J013147E18CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J023104E19CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J023128O20CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J023132D16CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J023143E13CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J033028F15CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J033133D24CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J053091M07CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J075029L15CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J075097M12CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J075103J11CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J075138J10CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J075172K18CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080001C15CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080002M13CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080009K01CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080010N01CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080011D23CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080013C13CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080013M16CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080018J02CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080020F03CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080020G05CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080021D05CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080030A19CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080031A16CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080033J23CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080035H07CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080039M24CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080042B16CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080043B03CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080045G01CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080045K17CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080047A09CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080047I22CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080048M14CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080049J02CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080052C15CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080052E11CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080052M22CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080056O21CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080059J04CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080059O17CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080064N04CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080066A03CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080066I22CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080069C13CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080069J03CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080069N04CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080071A01CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080071C03CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080071J02CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080080D17CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080084O06CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080085O20CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080086H15CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080094K06CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080095C05CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080095G04CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080096F03CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J080096F20CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J090004H05CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J090012P10CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J090021B09CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J090034M08CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J090046G21CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J090055K24CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J090055L05CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J090057H17CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J090082K21CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J100022A07CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J100022M02CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J100069K11CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
J100086C24CTCGCGCGTCTCCATGGGCCCCACATGTCAGTGNONE 
Os05g0121800AK101222CGCACGCGTCTCConserved hypothetical protein. 
J033031D02CGCACGCGTCTCNONE 
J065078F10CGCACGCGTCTCNONE 
J065151J16CGCACGCGTCTCNONE 
J065151K04CGCACGCGTCTCNONE 
J090057E18CGCACGCGTCTCNONE 
Os05g0127300AK106429CCACGCGTCTCNONE 
AK121766CCACGCGTCTCRegulator of chromosome condensation/beta-lactamase-inhibitor protein II domain containing protein. 
J065021F23CCACGCGTCTCNONE 
J100041J04CCACGCGTCTCNONE 
Os05g0138300009-001-C07CGCGTCTCNONE 
009-026-D09CGCGTCTCNONE 
009-075-C10CGCGTCTCNONE 
009-085-A06CGCGTCTCNONE 
009-130-G05CGCGTCTCNONE 
009-143-F06CGCGTCTCNONE 
009-149-E08CGCGTCTCNONE 
009-175-D08CGCGTCTCNONE 
AB027607CGCGTCTCNONE 
AF503583CGCGTCTCHydrophobic protein LTI6B (Low temperature-induced protein 6B). 
AK070577CGCGTCTCNONE 
AK099873CGCGTCTCNONE 
AK119249CGCGTCTCNONE 
AY554051CGCGTCTCNONE 
AY607690CGCGTCTCNONE 
J013026E17CGCGTCTCNONE 
J013058L08CGCGTCTCNONE 
J013107C11CGCGTCTCNONE 
J013111G21CGCGTCTCNONE 
J013134C24CGCGTCTCNONE 
J023049I21CGCGTCTCNONE 
J023057O07CGCGTCTCNONE 
J033111G11CGCGTCTCNONE 
J043024C02CGCGTCTCNONE 
J043027M11CGCGTCTCNONE 
J053043G05CGCGTCTCNONE 
J065022J16CGCGTCTCNONE 
J065032H13CGCGTCTCNONE 
J065042N19CGCGTCTCNONE 
J065052P05CGCGTCTCNONE 
J065063H06CGCGTCTCNONE 
J065064O11CGCGTCTCNONE 
J065071C05CGCGTCTCNONE 
J065079G14CGCGTCTCNONE 
J065094L03CGCGTCTCNONE 
J065104N03CGCGTCTCNONE 
J065123G19CGCGTCTCNONE 
J065134C09CGCGTCTCNONE 
J065136H18CGCGTCTCNONE 
J065185C12CGCGTCTCNONE 
J065216J12CGCGTCTCNONE 
J075010F01CGCGTCTCNONE 
J075017C12CGCGTCTCNONE 
J075038K02CGCGTCTCNONE 
J075038K03CGCGTCTCNONE 
J075054H08CGCGTCTCNONE 
J075102J04CGCGTCTCNONE 
J075115B14CGCGTCTCNONE 
J075147J07CGCGTCTCNONE 
J075152K10CGCGTCTCNONE 
J075153F04CGCGTCTCNONE 
J075163G21CGCGTCTCNONE 
J075182H16CGCGTCTCNONE 
J080303G06CGCGTCTCNONE 
J080315P16CGCGTCTCNONE 
J080318E17CGCGTCTCNONE 
J080319J16CGCGTCTCNONE 
J100019K11CGCGTCTCNONE 
J100032G20CGCGTCTCNONE 
J100038N05CGCGTCTCNONE 
J100039P22CGCGTCTCNONE 
J100040C02CGCGTCTCNONE 
J100059C03CGCGTCTCNONE 
J100068E14CGCGTCTCNONE 
J100068J08CGCGTCTCNONE 
J100077C18CGCGTCTCNONE 
J100082K01CGCGTCTCNONE 
Os05g0170700J075130N13CGCGTCTCLeucine rich repeat, N-terminal domain containing protein. 
Os05g0300700014-079-G07GAGACGCGNONE 
AK063728GAGACGCGNONE 
Os05g0339200AK111022CGCGTCTCConserved hypothetical protein. 
Os05g0361700AJ575218GAGACGCGCGACGCGNONE 
AK100184GAGACGCGCGACGCGSimilar to EREBP-2 protein (Fragment). 
AK111676GAGACGCGCGACGCGNONE 
J013155B14GAGACGCGCGACGCGNONE 
J065073N01GAGACGCGCGACGCGNONE 
J065161J12GAGACGCGCGACGCGNONE 
J075074A07GAGACGCGCGACGCGNONE 
J100029H13GAGACGCGCGACGCGNONE 
Os05g0405400J090016P17GAGACGCGNONE 
Os05g0453700009-171-G06CGCGTCTCNONE 
015-019-F02CGCGTCTCNONE 
AB110169CGCGTCTCNONE 
AK063881CGCGTCTCSimilar to ENOD18 protein (Fragment). 
AK073600CGCGTCTCNONE 
J033048I03CGCGTCTCNONE 
J065026A09CGCGTCTCNONE 
J065028M08CGCGTCTCNONE 
J075140N01CGCGTCTCNONE 
Os05g0495100AK108028CGCGTCTCConserved hypothetical protein. 
Os05g0540800AK060731CGCGTCTCNONE 
AK071090CGCGTCTCHomeodomain-like containing protein. 
J013095F03CGCGTCTCNONE 
J023079C11CGCGTCTCNONE 
J033080E08CGCGTCTCNONE 
Os06g0132100012-025-C11CGCGTCTCNONE 
AK072859CGCGTCTCLung seven transmembrane receptor family protein. 
AK100206CGCGTCTCNONE 
AK105429CGCGTCTCNONE 
J023042H07CGCGTCTCNONE 
J023062I04CGCGTCTCNONE 
J023143I01CGCGTCTCNONE 
J053027J22CGCGTCTCNONE 
J053027P18CGCGTCTCNONE 
J053035D09CGCGTCTCNONE 
J053079P13CGCGTCTCNONE 
J053094E24CGCGTCTCNONE 
J075125J21CGCGTCTCNONE 
J100080J04CGCGTCTCNONE 
Os06g0199100AK120323GAGACGCGCGAGProtein prenyltransferase domain containing protein. 
Os06g0265000AK100247CCCACGCGTCTCSimilar to Asparagine synthetase. 
D83378CCCACGCGTCTCNONE 
J013033O15CCCACGCGTCTCNONE 
J013037K20CCCACGCGTCTCNONE 
J013058I07CCCACGCGTCTCNONE 
J033125M21CCCACGCGTCTCNONE 
J033142B02CCCACGCGTCTCNONE 
J043030E23CCCACGCGTCTCNONE 
J043034K11CCCACGCGTCTCNONE 
J053050B10CCCACGCGTCTCNONE 
J053061I09CCCACGCGTCTCNONE 
J053068F17CCCACGCGTCTCNONE 
J053074G11CCCACGCGTCTCNONE 
J053095N11CCCACGCGTCTCNONE 
J090028M17CCCACGCGTCTCNONE 
J090031O08CCCACGCGTCTCNONE 
J090094C22CCCACGCGTCTCNONE 
J100045M24CCCACGCGTCTCNONE 
J100055P03CCCACGCGTCTCNONE 
J100073O10CCCACGCGTCTCNONE 
J100081K21CCCACGCGTCTCNONE 
U55873CCCACGCGTCTCNONE 
Os06g0589800AK101039GAGACGCGProtein kinase-like domain containing protein. 
Os06g0691000AK100072CCCCCGCGTCTCNONE 
Os06g0696400011-019-C01CCCCCGCGTCTCTGGCCCCCACACNONE 
011-027-D04CCCCCGCGTCTCTGGCCCCCACACNONE 
013-051-H10CCCCCGCGTCTCTGGCCCCCACACNONE 
013-054-A06CCCCCGCGTCTCTGGCCCCCACACNONE 
013-061-D06CCCCCGCGTCTCTGGCCCCCACACNONE 
013-088-F04CCCCCGCGTCTCTGGCCCCCACACNONE 
014-018-C07CCCCCGCGTCTCTGGCCCCCACACNONE 
014-026-E10CCCCCGCGTCTCTGGCCCCCACACNONE 
AK058291CCCCCGCGTCTCTGGCCCCCACACNONE 
AK066125CCCCCGCGTCTCTGGCCCCCACACNONE 
AK104912CCCCCGCGTCTCTGGCCCCCACACNONE 
BT014685CCCCCGCGTCTCTGGCCCCCACACSimilar to Xyloglucan endotransglucosylase/hydrolase protein 24 precursor (EC 2.4.1.207) (At-XTH24) (XTH-24) (Meristem protein 5) (MERI-5 protein) (MERI5 protein) (Endo-xyloglucan transferase) (Xyloglucan endo-1,4-beta-D-glucanase). 
J013059H08CCCCCGCGTCTCTGGCCCCCACACNONE 
J065065L22CCCCCGCGTCTCTGGCCCCCACACNONE 
J065084O06CCCCCGCGTCTCTGGCCCCCACACNONE 
J075006O13CCCCCGCGTCTCTGGCCCCCACACNONE 
J075013J18CCCCCGCGTCTCTGGCCCCCACACNONE 
J075018L23CCCCCGCGTCTCTGGCCCCCACACNONE 
J075036E14CCCCCGCGTCTCTGGCCCCCACACNONE 
J075039K21CCCCCGCGTCTCTGGCCCCCACACNONE 
J075075H13CCCCCGCGTCTCTGGCCCCCACACNONE 
J075091A14CCCCCGCGTCTCTGGCCCCCACACNONE 
J075093I09CCCCCGCGTCTCTGGCCCCCACACNONE 
J075136L17CCCCCGCGTCTCTGGCCCCCACACNONE 
J075156M24CCCCCGCGTCTCTGGCCCCCACACNONE 
J075174J01CCCCCGCGTCTCTGGCCCCCACACNONE 
J075179P15CCCCCGCGTCTCTGGCCCCCACACNONE 
J075181F02CCCCCGCGTCTCTGGCCCCCACACNONE 
J075194L24CCCCCGCGTCTCTGGCCCCCACACNONE 
J080302J02CCCCCGCGTCTCTGGCCCCCACACNONE 
J080304J11CCCCCGCGTCTCTGGCCCCCACACNONE 
J080308A15CCCCCGCGTCTCTGGCCCCCACACNONE 
J100041B09CCCCCGCGTCTCTGGCCCCCACACNONE 
Os06g0714900AK071975CAAGTGGGAGACGCGNONE 
AK105337CAAGTGGGAGACGCGProtein kinase-like domain containing protein. 
Os07g0124600AK073437GGACGCGTCTCRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J033042K24GGACGCGTCTCNONE 
J033136G07GGACGCGTCTCNONE 
J065092I12GGACGCGTCTCNONE 
J065132F04GGACGCGTCTCNONE 
J065143I11GGACGCGTCTCNONE 
Os07g0184800AK059544CGCGTCTCSimilar to Variant of histone H1. 
AK099050CGCGTCTCNONE 
AK102642CGCGTCTCNONE 
AK106132CGCGTCTCNONE 
J023037O08CGCGTCTCNONE 
J023050M02CGCGTCTCNONE 
J023087A10CGCGTCTCNONE 
J033027D14CGCGTCTCNONE 
J033028N17CGCGTCTCNONE 
J033043P10CGCGTCTCNONE 
J033051D07CGCGTCTCNONE 
J033073M07CGCGTCTCNONE 
J033075H01CGCGTCTCNONE 
J033084E04CGCGTCTCNONE 
J033096D10CGCGTCTCNONE 
J033100F04CGCGTCTCNONE 
J033114B06CGCGTCTCNONE 
J033117C10CGCGTCTCNONE 
J033140B21CGCGTCTCNONE 
J043034J07CGCGTCTCNONE 
J065006F04CGCGTCTCNONE 
J065130H16CGCGTCTCNONE 
J075020G13CGCGTCTCNONE 
J075108M17CGCGTCTCNONE 
J080018A06CGCGTCTCNONE 
J080037J11CGCGTCTCNONE 
J080048F15CGCGTCTCNONE 
J080057D16CGCGTCTCNONE 
J080069A10CGCGTCTCNONE 
J080086L09CGCGTCTCNONE 
J080088A17CGCGTCTCNONE 
J100046F24CGCGTCTCNONE 
Os07g0267300AK071612GAGACGCGHypothetical protein. 
J065115L02GAGACGCGNONE 
J075013O04GAGACGCGNONE 
Os07g0499800AK120716CGCGTCTCZinc finger, RING-type domain containing protein. 
Os07g0545400009-136-E03CGCGTCTCNONE 
013-015-G08CGCGTCTCNONE 
AK059228CGCGTCTCNONE 
J065040D09CGCGTCTCNONE 
J065051C19CGCGTCTCNONE 
J065139B05CGCGTCTCNONE 
J065160E20CGCGTCTCNONE 
J065207I17CGCGTCTCNONE 
J080319M24CGCGTCTCNONE 
Os07g0584900AK058404GAGACGCGNONE 
AK059561GAGACGCGArmadillo-like helical domain containing protein. 
J023062J12GAGACGCGNONE 
J075199M03GAGACGCGNONE 
Os07g0589000AK069813GAGACGCGLateral organ boundaries, LOB domain containing protein. 
J023030F23GAGACGCGNONE 
J065165H21GAGACGCGNONE 
J065193G01GAGACGCGNONE 
J075093F03GAGACGCGNONE 
Os07g0608800AK059637TGTGGGCCCGCGTCTCSimilar to Peroxisome assembly protein 10 (Peroxin-10) (AthPEX10) (Pex10p) (PER8). 
Os08g0138500AK102951GAGACGCGSimilar to Helix-loop-helix-like protein (Fragment). 
AY224458GAGACGCGNONE 
J033115D14GAGACGCGNONE 
J065013F04GAGACGCGNONE 
J065050P11GAGACGCGNONE 
J065063K18GAGACGCGNONE 
J090054H10GAGACGCGNONE 
J100083F11GAGACGCGNONE 
Os08g0374600AK072505CGCGTCTCNONE 
AY224427CGCGTCTCSimilar to Receptor kinase-like protein. 
J065027B17CGCGTCTCNONE 
J065049G01CGCGTCTCNONE 
J065051K03CGCGTCTCNONE 
J065078B15CGCGTCTCNONE 
J065092I16CGCGTCTCNONE 
J065092K14CGCGTCTCNONE 
J065094E03CGCGTCTCNONE 
J065137G22CGCGTCTCNONE 
J065178O15CGCGTCTCNONE 
J065212M24CGCGTCTCNONE 
J075032O05CGCGTCTCNONE 
J075036F19CGCGTCTCNONE 
J075092B17CGCGTCTCNONE 
J075093F18CGCGTCTCNONE 
J075095C09CGCGTCTCNONE 
J075095E11CGCGTCTCNONE 
J075116P20CGCGTCTCNONE 
J075122D13CGCGTCTCNONE 
J075128J11CGCGTCTCNONE 
J075130C19CGCGTCTCNONE 
J075154C07CGCGTCTCNONE 
J075194D23CGCGTCTCNONE 
J100060C21CGCGTCTCNONE 
Os08g0419100015-086-C04CGCGTCTCNONE 
AK106423CGCGTCTCConserved hypothetical protein. 
Os08g0460000006-021-D02CGCGTCTCNONE 
006-023-C09CGCGTCTCNONE 
006-023-D06CGCGTCTCNONE 
006-024-C01CGCGTCTCNONE 
006-024-E06CGCGTCTCNONE 
006-024-F03CGCGTCTCNONE 
006-024-G03CGCGTCTCNONE 
006-027-G06CGCGTCTCNONE 
006-028-C07CGCGTCTCNONE 
006-028-D12CGCGTCTCNONE 
006-028-G12CGCGTCTCNONE 
006-028-H06CGCGTCTCNONE 
006-029-B10CGCGTCTCNONE 
006-030-G03CGCGTCTCNONE 
006-030-G10CGCGTCTCNONE 
006-031-B09CGCGTCTCNONE 
006-031-D10CGCGTCTCNONE 
006-031-F05CGCGTCTCNONE 
006-032-C02CGCGTCTCNONE 
006-033-H11CGCGTCTCNONE 
006-034-B04CGCGTCTCNONE 
006-034-D05CGCGTCTCNONE 
006-034-D10CGCGTCTCNONE 
006-034-G07CGCGTCTCNONE 
006-035-D11CGCGTCTCNONE 
006-035-G10CGCGTCTCNONE 
006-036-B01CGCGTCTCNONE 
006-036-E12CGCGTCTCNONE 
006-037-C09CGCGTCTCNONE 
006-037-H07CGCGTCTCNONE 
006-038-B06CGCGTCTCNONE 
006-039-D12CGCGTCTCNONE 
006-040-A08CGCGTCTCNONE 
006-040-E08CGCGTCTCNONE 
006-041-G09CGCGTCTCNONE 
006-043-H12CGCGTCTCNONE 
006-044-F10CGCGTCTCNONE 
006-044-G06CGCGTCTCNONE 
006-045-C03CGCGTCTCNONE 
006-049-H09CGCGTCTCNONE 
006-050-B10CGCGTCTCNONE 
006-050-F10CGCGTCTCNONE 
006-051-G09CGCGTCTCNONE 
006-052-E09CGCGTCTCNONE 
006-052-H05CGCGTCTCNONE 
006-054-G01CGCGTCTCNONE 
006-055-A08CGCGTCTCNONE 
006-056-B06CGCGTCTCNONE 
006-056-C02CGCGTCTCNONE 
006-056-G01CGCGTCTCNONE 
006-057-F05CGCGTCTCNONE 
006-057-H06CGCGTCTCNONE 
006-058-B04CGCGTCTCNONE 
006-058-F07CGCGTCTCNONE 
006-059-D04CGCGTCTCNONE 
006-059-G10CGCGTCTCNONE 
006-063-B07CGCGTCTCNONE 
006-064-D11CGCGTCTCNONE 
006-066-A09CGCGTCTCNONE 
006-066-B09CGCGTCTCNONE 
006-066-E11CGCGTCTCNONE 
006-067-D07CGCGTCTCNONE 
006-068-B04CGCGTCTCNONE 
006-069-E10CGCGTCTCNONE 
006-069-F10CGCGTCTCNONE 
006-070-G09CGCGTCTCNONE 
006-074-C09CGCGTCTCNONE 
006-077-C05CGCGTCTCNONE 
006-077-G01CGCGTCTCNONE 
006-078-H03CGCGTCTCNONE 
006-080-F01CGCGTCTCNONE 
006-081-E04CGCGTCTCNONE 
006-082-B05CGCGTCTCNONE 
006-082-D07CGCGTCTCNONE 
006-082-G09CGCGTCTCNONE 
006-083-A12CGCGTCTCNONE 
006-083-D12CGCGTCTCNONE 
006-084-D03CGCGTCTCNONE 
006-086-D08CGCGTCTCNONE 
006-087-A03CGCGTCTCNONE 
006-087-H03CGCGTCTCNONE 
006-087-H04CGCGTCTCNONE 
006-088-E01CGCGTCTCNONE 
006-089-B02CGCGTCTCNONE 
006-089-D12CGCGTCTCNONE 
006-090-B09CGCGTCTCNONE 
006-090-C10CGCGTCTCNONE 
006-090-D10CGCGTCTCNONE 
006-090-F01CGCGTCTCNONE 
006-091-F05CGCGTCTCNONE 
006-091-G06CGCGTCTCNONE 
006-093-B07CGCGTCTCNONE 
006-094-E11CGCGTCTCNONE 
006-094-H10CGCGTCTCNONE 
006-095-A06CGCGTCTCNONE 
006-095-A10CGCGTCTCNONE 
006-096-F01CGCGTCTCNONE 
006-098-D09CGCGTCTCNONE 
006-098-F03CGCGTCTCNONE 
006-100-A08CGCGTCTCNONE 
006-101-B12CGCGTCTCNONE 
006-101-C10CGCGTCTCNONE 
006-102-A06CGCGTCTCNONE 
006-102-B10CGCGTCTCNONE 
006-102-F04CGCGTCTCNONE 
006-103-B09CGCGTCTCNONE 
006-103-F04CGCGTCTCNONE 
006-105-B01CGCGTCTCNONE 
006-106-D12CGCGTCTCNONE 
006-106-F01CGCGTCTCNONE 
006-106-H02CGCGTCTCNONE 
006-107-F01CGCGTCTCNONE 
006-108-H01CGCGTCTCNONE 
006-109-H04CGCGTCTCNONE 
006-110-E11CGCGTCTCNONE 
006-111-C08CGCGTCTCNONE 
006-111-F04CGCGTCTCNONE 
006-112-A10CGCGTCTCNONE 
006-112-F04CGCGTCTCNONE 
006-112-H11CGCGTCTCNONE 
006-113-D11CGCGTCTCNONE 
006-113-E03CGCGTCTCNONE 
006-113-F03CGCGTCTCNONE 
006-114-A10CGCGTCTCNONE 
006-114-D12CGCGTCTCNONE 
006-114-G02CGCGTCTCNONE 
006-116-A03CGCGTCTCNONE 
006-117-C12CGCGTCTCNONE 
006-118-C10CGCGTCTCNONE 
006-118-E09CGCGTCTCNONE 
006-120-A12CGCGTCTCNONE 
006-120-E02CGCGTCTCNONE 
009-017-F07CGCGTCTCNONE 
009-024-C07CGCGTCTCNONE 
009-030-E03CGCGTCTCNONE 
009-051-G03CGCGTCTCNONE 
009-076-G09CGCGTCTCNONE 
009-077-C06CGCGTCTCNONE 
009-093-F01CGCGTCTCNONE 
009-114-C10CGCGTCTCNONE 
009-115-B02CGCGTCTCNONE 
009-133-H04CGCGTCTCNONE 
009-149-E04CGCGTCTCNONE 
009-151-G04CGCGTCTCNONE 
009-158-C03CGCGTCTCNONE 
009-158-E03CGCGTCTCNONE 
009-168-B05CGCGTCTCNONE 
009-169-H11CGCGTCTCNONE 
009-172-B09CGCGTCTCNONE 
009-176-A06CGCGTCTCNONE 
009-183-C09CGCGTCTCNONE 
009-183-G06CGCGTCTCNONE 
009-184-B05CGCGTCTCNONE 
009-184-D10CGCGTCTCNONE 
009-186-F08CGCGTCTCNONE 
009-187-D03CGCGTCTCNONE 
009-187-F10CGCGTCTCNONE 
009-200-F04CGCGTCTCNONE 
013-017-C09CGCGTCTCNONE 
013-036-C08CGCGTCTCNONE 
013-038-C10CGCGTCTCNONE 
013-040-A07CGCGTCTCNONE 
013-054-G08CGCGTCTCNONE 
013-057-E06CGCGTCTCNONE 
013-078-C05CGCGTCTCNONE 
013-093-G08CGCGTCTCNONE 
AB010876CGCGTCTCNONE 
AF032975CGCGTCTCSimilar to Germin-like protein 1 precursor. 
AF051156CGCGTCTCNONE 
AK065284CGCGTCTCNONE 
AK104729CGCGTCTCNONE 
J013002M08CGCGTCTCNONE 
J013021J02CGCGTCTCNONE 
J013121H18CGCGTCTCNONE 
J013158P05CGCGTCTCNONE 
J065001N07CGCGTCTCNONE 
J065016A06CGCGTCTCNONE 
J065024N09CGCGTCTCNONE 
J065038E15CGCGTCTCNONE 
J065115D12CGCGTCTCNONE 
J065116H23CGCGTCTCNONE 
J065190E16CGCGTCTCNONE 
J075032F24CGCGTCTCNONE 
J075065A05CGCGTCTCNONE 
J075066H22CGCGTCTCNONE 
J075108F04CGCGTCTCNONE 
J075161A05CGCGTCTCNONE 
Os08g0526100011-072-E04CGCGTCTCCCCCANONE 
AK100965CGCGTCTCCCCCANAD-dependent epimerase/dehydratase family protein. 
J023142D13CGCGTCTCCCCCANONE 
J033132L16CGCGTCTCCCCCANONE 
J090006E20CGCGTCTCCCCCANONE 
J100069L13CGCGTCTCCCCCANONE 
Os08g0563300009-007-B01GAGACGCGNONE 
AK062315GAGACGCGSimilar to Bet1-like SNARE 1-1 (AtBET11) (Bet1/Sft1-like SNARE 14a) (AtBS14a). 
J065095F04GAGACGCGNONE 
Os09g0445600AK107839GAGACGCGACGCConserved hypothetical protein. 
Os09g0471900AK073815CGCGTCTCCAGCCCACACGBacterial Fmu (Sun)/eukaryotic nucleolar NOL1/Nop2p domain containing protein. 
Os09g0534800009-128-G09GAGACGCGACNONE 
AF464908GAGACGCGACNONE 
AK068941GAGACGCGACTranscription initiation factor IIB (General transcription factor TFIIB). 
J013170A08GAGACGCGACNONE 
J023123L05GAGACGCGACNONE 
J043020O05GAGACGCGACNONE 
Os11g0130300AK059597CGCGTCTCNse1 non-SMC component of SMC5-6 complex family protein. 
AK101224CGCGTCTCNONE 
J033031D09CGCGTCTCNONE 
J033135B02CGCGTCTCNONE 
J100021A17CGCGTCTCNONE 
J100066G09CGCGTCTCNONE 
Os11g0580000AK119421CGCGTCTCArmadillo-like helical domain containing protein. 
AK119421GAGACGCGArmadillo-like helical domain containing protein. 
AK121905CGCGTCTCNONE 
AK121905GAGACGCGNONE 
J033105I06CGCGTCTCNONE 
J033105I06GAGACGCGNONE 
J090022C10CGCGTCTCNONE 
J090022C10GAGACGCGNONE 
J090024J23CGCGTCTCNONE 
J090024J23GAGACGCGNONE 
J090044F24CGCGTCTCNONE 
J090044F24GAGACGCGNONE 
Os12g0122450Os12g0122450GAGACGCGNONE 
Os12g0156400012-065-D02CGCGTCTCNONE 
AK072086CGCGTCTCNONE 
AK099278CGCGTCTCDcp1-like decapping family protein. 
J013063H09CGCGTCTCNONE 
J023125D09CGCGTCTCNONE 
J023149G21CGCGTCTCNONE 
J033064E07CGCGTCTCNONE 
J033093C07CGCGTCTCNONE 
J033107E06CGCGTCTCNONE 
J075172A11CGCGTCTCNONE 
J090009E07CGCGTCTCNONE 
J090023F13CGCGTCTCNONE 
J090071N18CGCGTCTCNONE 
Os12g0440400AK064643CGCGTCTCHypothetical protein. 
Os12g0489400AK062351CGCGTCTCTCCGCHypothetical protein. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.