version

Summary of OsREG562 (All List)

OrganismOryza sativa  
IDOsREG562  
SequenceCGGACGGC  
Annotation  
PPDB Motif 
PLACE Motif 
Total Entry Count2590  

Entry Sequences (2590 entries)

LocusGene modelSequenceDescription
Os01g0100700006-066-G10GCCGTCCGATNONE 
009-108-B10GCCGTCCGATNONE 
AK059844GCCGTCCGATNONE 
AK121523GCCGTCCGATSimilar to 40S ribosomal protein S5-1. 
J023037D16GCCGTCCGATNONE 
J033028P14GCCGTCCGATNONE 
J033064M07GCCGTCCGATNONE 
J033123M01GCCGTCCGATNONE 
J065026O07GCCGTCCGATNONE 
J065082A05GCCGTCCGATNONE 
J075003I02GCCGTCCGATNONE 
J075170J15GCCGTCCGATNONE 
J100040D18GCCGTCCGATNONE 
Os01g0134700AK111442CGGACGGCCCalmodulin binding protein-like family protein. 
J065141F12CGGACGGCCNONE 
J065156K22CGGACGGCCNONE 
J065160A12CGGACGGCCNONE 
Os01g0141600016-051-A03GATCGGACGGCTNONE 
016-051-A03GATCGGACGGCTNONE 
AK066922GATCGGACGGCTProtein of unknown function DUF647 family protein. 
AK066922GATCGGACGGCTProtein of unknown function DUF647 family protein. 
Os01g0191100009-011-A02CGGACGGCNONE 
009-028-D05CGGACGGCNONE 
009-058-B11CGGACGGCNONE 
009-151-D09CGGACGGCNONE 
013-026-G03CGGACGGCNONE 
013-063-F04CGGACGGCNONE 
013-069-B05CGGACGGCNONE 
014-029-E04CGGACGGCNONE 
014-072-H04CGGACGGCNONE 
014-089-E09CGGACGGCNONE 
015-047-G05CGGACGGCNONE 
016-033-G06CGGACGGCNONE 
AK058815CGGACGGCSimilar to Acidic ribosomal protein P2a-4 (Fragment). 
J023069C08CGGACGGCNONE 
J023077K21CGGACGGCNONE 
J023081F19CGGACGGCNONE 
J033052N11CGGACGGCNONE 
J033058N11CGGACGGCNONE 
J033114G05CGGACGGCNONE 
J033114O17CGGACGGCNONE 
J033129L14CGGACGGCNONE 
J053029I12CGGACGGCNONE 
J065067N19CGGACGGCNONE 
J065084I19CGGACGGCNONE 
J065099O03CGGACGGCNONE 
J065201I08CGGACGGCNONE 
J075035B08CGGACGGCNONE 
J075037B22CGGACGGCNONE 
J075054L16CGGACGGCNONE 
J075059D15CGGACGGCNONE 
J075164I08CGGACGGCNONE 
J075185J01CGGACGGCNONE 
J090042O06CGGACGGCNONE 
J090044F12CGGACGGCNONE 
J090063L02CGGACGGCNONE 
J090073I10CGGACGGCNONE 
J090078E18CGGACGGCNONE 
J100072K16CGGACGGCNONE 
Os01g0238500006-086-E04GGCCGTCCGNONE 
AK067076GGCCGTCCGSimilar to Branched-chain-amino-acid aminotransferase-like protein 3, chloroplast precursor. 
AK104302GGCCGTCCGNONE 
J013093D15GGCCGTCCGNONE 
J065038O05GGCCGTCCGNONE 
J075089I20GGCCGTCCGNONE 
J075122B01GGCCGTCCGNONE 
J090086G20GGCCGTCCGNONE 
Os01g0253000AK071644CGGACGGCSimilar to LpimPth3. 
Os01g0270300006-026-A05GATCGGACGGCCNONE 
AK060365GATCGGACGGCCNONE 
AK101508GATCGGACGGCCSimilar to Cationic peroxidase isozyme 40K precursor. 
AK103467GATCGGACGGCCNONE 
J033084K19GATCGGACGGCCNONE 
J033105B06GATCGGACGGCCNONE 
J100043C10GATCGGACGGCCNONE 
Os01g0283700AK107149AGCCGTCCGSimilar to Cinnamoyl-CoA reductase (EC 1.2.1.44). 
Os01g0305900Os01g0305900CGGACGGCSimilar to A-type R2R3 Myb protein (Fragment). 
Os01g0316800009-188-E08CGGACGGCCNONE 
AK058821CGGACGGCCNONE 
AK119788CGGACGGCCSimilar to 26 proteasome complex subunit DSS1 (Deleted in split hand/split foot protein 1) (Split hand/foot deleted protein 1). 
J065098A09CGGACGGCCNONE 
J065102J21CGGACGGCCNONE 
J065173M10CGGACGGCCNONE 
J075066K08CGGACGGCCNONE 
J080302B04CGGACGGCCNONE 
J080310P14CGGACGGCCNONE 
J080311I23CGGACGGCCNONE 
J080319N12CGGACGGCCNONE 
J100024D14CGGACGGCCNONE 
J100055N12CGGACGGCCNONE 
Os01g0337600AK099595GGCCGTCCGATPase, F1 complex, gamma subunit family protein. 
AK119468GGCCGTCCGNONE 
Os01g0347100AK100716CGGATCGGACGGCTProtein of unknown function DUF1399 family protein. 
Os01g0358300AK060388GCCGTCCGNONE 
AK072081GCCGTCCGTetratricopeptide-like helical domain containing protein. 
Os01g0364900AK121145TCGGACGGCTConserved hypothetical protein. 
J023078A10TCGGACGGCTNONE 
Os01g0506100AK102377ATCGGACGGCTGlobin-like family protein. 
AK109825ATCGGACGGCTNONE 
Os01g0513800012-032-E11AGCCGTCCGATNONE 
AK100776AGCCGTCCGATSimilar to Brix domain containing protein 1 homolog. 
J023120C10AGCCGTCCGATNONE 
J033044A22AGCCGTCCGATNONE 
J033048H13AGCCGTCCGATNONE 
J033118F03AGCCGTCCGATNONE 
J065176B05AGCCGTCCGATNONE 
J075026B19AGCCGTCCGATNONE 
J075048I23AGCCGTCCGATNONE 
J075141A19AGCCGTCCGATNONE 
J075148E05AGCCGTCCGATNONE 
J090031M12AGCCGTCCGATNONE 
Os01g0558500AK099982ATCGGACGGCCPWWP domain containing protein. 
J065096J12ATCGGACGGCCNONE 
Os01g0588500AK103037CGGACGGCSimilar to Avr9/Cf-9 induced kinase 1. 
Os01g0632700AK070692CGGACGGCNONE 
Os01g0632900Os01g0632900CGGACGGCNONE 
Os01g0637600AK106980GCCGTCCGATSimilar to Peptide deformylase, chloroplast precursor (EC 3.5.1.88) (PDF) (Polypeptide deformylase). 
Os01g0663400016-054-B01GATCGGACGGCNONE 
AK072283GATCGGACGGCSimilar to Aspartic proteinase oryzasin 1 precursor (EC 3.4.23.-). 
AK072645GATCGGACGGCNONE 
J065180A21GATCGGACGGCNONE 
J075026E13GATCGGACGGCNONE 
J075109M23GATCGGACGGCNONE 
J075151A02GATCGGACGGCNONE 
J090004B07GATCGGACGGCNONE 
J090023O22GATCGGACGGCNONE 
J090054G09GATCGGACGGCNONE 
J090058H13GATCGGACGGCNONE 
J090076G13GATCGGACGGCNONE 
J100057F11GATCGGACGGCNONE 
Os01g0672400AK060901TCGGACGGCNONE 
AK061329TCGGACGGCDrought induced 19 family protein. 
AK101922TCGGACGGCNONE 
Os01g0693900AK066034AGCCGTCCGATCNONE 
AK099894AGCCGTCCGATCPeptidyl-tRNA hydrolase family protein. 
J065165G19AGCCGTCCGATCNONE 
J100042C04AGCCGTCCGATCNONE 
Os01g0710800013-097-E05GGCCGTCCGNONE 
AK069973GGCCGTCCGNONE 
AK071099GGCCGTCCGConserved hypothetical protein. 
J023081K01GGCCGTCCGNONE 
J023123E16GGCCGTCCGNONE 
J033066B11GGCCGTCCGNONE 
J065144G11GGCCGTCCGNONE 
Os01g0731800AK121474TCGGACGGCTRINGv domain containing protein. 
J023148N13TCGGACGGCTNONE 
J065136G08TCGGACGGCTNONE 
Os01g0732200015-078-D03GATCGGACGGCTNONE 
AK067563GATCGGACGGCTGTP-binding protein, HSR1-related domain containing protein. 
J013111I12GATCGGACGGCTNONE 
J033113N16GATCGGACGGCTNONE 
J033124C05GATCGGACGGCTNONE 
Os01g0733600011-078-A01GCCGTCCGNONE 
AK066744GCCGTCCGFlavodoxin/nitric oxide synthase domain containing protein. 
J013088B01GCCGTCCGNONE 
J033075A12GCCGTCCGNONE 
J033092N03GCCGTCCGNONE 
J065077J07GCCGTCCGNONE 
J065088E23GCCGTCCGNONE 
J065207L12GCCGTCCGNONE 
J100033O20GCCGTCCGNONE 
J100037N08GCCGTCCGNONE 
J100041L09GCCGTCCGNONE 
J100061J09GCCGTCCGNONE 
J100069N11GCCGTCCGNONE 
Os01g0761100AK122112GCCGTCCGATCTesmin/TSO1-like, CXC domain containing protein. 
Os01g0766200AK069471AGCCGTCCGZinc finger, RING-type domain containing protein. 
AK069471ATCGGACGGCZinc finger, RING-type domain containing protein. 
AK070278AGCCGTCCGNONE 
AK070278ATCGGACGGCNONE 
J013074F08AGCCGTCCGNONE 
J013074F08ATCGGACGGCNONE 
J023023M16AGCCGTCCGNONE 
J023023M16ATCGGACGGCNONE 
J023049F08AGCCGTCCGNONE 
J023049F08ATCGGACGGCNONE 
J065061D21AGCCGTCCGNONE 
J065061D21ATCGGACGGCNONE 
J100083B13AGCCGTCCGNONE 
J100083B13ATCGGACGGCNONE 
Os01g0794400AK122041CGGACGGACGGACGGCThioredoxin domain 2 containing protein. 
Os01g0801000AK064082ATCGGACGGCCNONE 
AK101426ATCGGACGGCCSimilar to Apurinic endonuclease-redox protein (DNA-(apurinic or apyrimidinic site) lyase) (EC 4.2.99.18). 
Os01g0835500AK100241AGCCGTCCGSimilar to Respiratory burst oxidase protein. 
Os01g0837600AK108007ATCGGACGGCCConserved hypothetical protein 1589, plant family protein. 
J065005C19ATCGGACGGCCNONE 
J065025H20ATCGGACGGCCNONE 
J065061E22ATCGGACGGCCNONE 
J065065F14ATCGGACGGCCNONE 
J065083O21ATCGGACGGCCNONE 
J065201G05ATCGGACGGCCNONE 
Os01g0856900AK107570CGGACGGCCCGGTGlycoside hydrolase, starch-binding domain containing protein. 
J065081B03CGGACGGCCCGGTNONE 
J075028J03CGGACGGCCCGGTNONE 
J075052C05CGGACGGCCCGGTNONE 
J075199J04CGGACGGCCCGGTNONE 
J090052L20CGGACGGCCCGGTNONE 
J090075L24CGGACGGCCCGGTNONE 
Os01g0867300AK067919AATGGGCCGTCCGTCCGTCCSimilar to OSE2-like protein (Fragment). 
J013123H12AATGGGCCGTCCGTCCGTCCNONE 
J033046C11AATGGGCCGTCCGTCCGTCCNONE 
J033051I17AATGGGCCGTCCGTCCGTCCNONE 
U25283AATGGGCCGTCCGTCCGTCCNONE 
Os01g0867600AK102226CGGACGGCCCAGATSimilar to UDP-glucose:sterol glucosyltransferase (EC 2.4.1.173). 
Os01g0867900AK061366GCCACGTGGCGGACGGCProtein of unknown function DUF502 family protein. 
Os01g0896800AK065268AGCCGTCCGATCNONE 
AK104693AGCCGTCCGATCEukaryotic ribosomal protein L5 family protein. 
J013126P09AGCCGTCCGATCNONE 
J033046N15AGCCGTCCGATCNONE 
J090008K02AGCCGTCCGATCNONE 
J090024F15AGCCGTCCGATCNONE 
J090074I23AGCCGTCCGATCNONE 
J090093F03AGCCGTCCGATCNONE 
J090096N02AGCCGTCCGATCNONE 
Os01g0927000AK106700AGCCGTCCGATCSimilar to SET domain-containing protein SET118. 
AK106700ATCGGACGGCSimilar to SET domain-containing protein SET118. 
Os01g0942300AK063126GCCGTCCGSimilar to Beta glucanase precursor (EC 3.2.1.73) (Fragment). 
Os01g0949200AK102412CGGACGGCCCACCANONE 
J033093A04CGGACGGCCCACCANONE 
J065053P06CGGACGGCCCACCANONE 
J100086D18CGGACGGCCCACCANONE 
Os01g0975000AK103552CGGACGGCCNONE 
AK119662CGGACGGCCProtein of unknown function DUF966 family protein. 
J033132F15CGGACGGCCNONE 
J065012J09CGGACGGCCNONE 
J065166N08CGGACGGCCNONE 
Os02g0101000006-077-B05CGGACGGCNONE 
AK061115CGGACGGCNONE 
AK074023CGGACGGCAmino acid/polyamine transporter II family protein. 
J023072F24CGGACGGCNONE 
J033075N18CGGACGGCNONE 
J033122D03CGGACGGCNONE 
J033130O20CGGACGGCNONE 
J065021E10CGGACGGCNONE 
J065165D05CGGACGGCNONE 
J065198H22CGGACGGCNONE 
J075004G15CGGACGGCNONE 
J075004M13CGGACGGCNONE 
J075022I11CGGACGGCNONE 
J075083E20CGGACGGCNONE 
J075092K19CGGACGGCNONE 
J075116J22CGGACGGCNONE 
J075133P16CGGACGGCNONE 
Os02g0115900AF006825CGGACGGCCNONE 
AK065743CGGACGGCCEndosperm lumenal binding protein. 
AK119653CGGACGGCCNONE 
Os02g0121100012-035-F06GGCCGTCCGATCNONE 
013-031-H05GGCCGTCCGATCNONE 
013-058-E11GGCCGTCCGATCNONE 
014-010-D01GGCCGTCCGATCNONE 
AK070711GGCCGTCCGATCConserved hypothetical protein. 
AK119758GGCCGTCCGATCNONE 
J013033G12GGCCGTCCGATCNONE 
J023007M16GGCCGTCCGATCNONE 
J023020K20GGCCGTCCGATCNONE 
J023061H10GGCCGTCCGATCNONE 
J033027H20GGCCGTCCGATCNONE 
J033051E18GGCCGTCCGATCNONE 
J090005F12GGCCGTCCGATCNONE 
J090017A20GGCCGTCCGATCNONE 
J090018G11GGCCGTCCGATCNONE 
J090062C18GGCCGTCCGATCNONE 
J100027N10GGCCGTCCGATCNONE 
J100032L14GGCCGTCCGATCNONE 
J100045C14GGCCGTCCGATCNONE 
J100061M09GGCCGTCCGATCNONE 
J100062K11GGCCGTCCGATCNONE 
J100064H11GGCCGTCCGATCNONE 
J100074H16GGCCGTCCGATCNONE 
J100082N01GGCCGTCCGATCNONE 
Os02g0148100AF216317GATCGGACGGCCNONE 
AF241166GATCGGACGGCCNONE 
AK119650GATCGGACGGCCMAP kinase MAPK2 (MAP kinase 3). 
Os02g0148500AK068931CGGACGGCCSimilar to TIMING OF CAB 1 (Fragment). 
Os02g0159200AK102507CGGACGGCCProtein of unknown function DUF292, eukaryotic domain containing protein. 
J033095F16CGGACGGCCNONE 
J033095F24CGGACGGCCNONE 
Os02g0195500AK062207CGGACGGCNONE 
Os02g0216200AK108648AGCCGTCCGATCHypothetical protein. 
Os02g0219900004-018-E11ATCGGACGGCCCACGTNONE 
AK060915ATCGGACGGCCCACGTNONE 
AK099194ATCGGACGGCCCACGTNONE 
AK104206ATCGGACGGCCCACGTNONE 
AK104393ATCGGACGGCCCACGTSimilar to Epstein-Barr nuclear antigen-1 (EBNA-1). 
J023109D07ATCGGACGGCCCACGTNONE 
Os02g0220600AK061944ATCGGACGGCCGAGATElongation factor 1-gamma (EF-1-gamma) (eEF-1B gamma). 
AK061944GCCGTCCGATCElongation factor 1-gamma (EF-1-gamma) (eEF-1B gamma). 
AK104946ATCGGACGGCCGAGATNONE 
AK104946GCCGTCCGATCNONE 
D89802ATCGGACGGCCGAGATNONE 
D89802GCCGTCCGATCNONE 
J013042L22ATCGGACGGCCGAGATNONE 
J013042L22GCCGTCCGATCNONE 
J013056A14ATCGGACGGCCGAGATNONE 
J013056A14GCCGTCCGATCNONE 
J013120G13ATCGGACGGCCGAGATNONE 
J013120G13GCCGTCCGATCNONE 
J013155K19ATCGGACGGCCGAGATNONE 
J013155K19GCCGTCCGATCNONE 
J023002B10ATCGGACGGCCGAGATNONE 
J023002B10GCCGTCCGATCNONE 
J023080J19ATCGGACGGCCGAGATNONE 
J023080J19GCCGTCCGATCNONE 
J023081C08ATCGGACGGCCGAGATNONE 
J023081C08GCCGTCCGATCNONE 
J023090H05ATCGGACGGCCGAGATNONE 
J023090H05GCCGTCCGATCNONE 
J023091M07ATCGGACGGCCGAGATNONE 
J023091M07GCCGTCCGATCNONE 
J023115F09ATCGGACGGCCGAGATNONE 
J023115F09GCCGTCCGATCNONE 
J033025I23ATCGGACGGCCGAGATNONE 
J033025I23GCCGTCCGATCNONE 
J033026G12ATCGGACGGCCGAGATNONE 
J033026G12GCCGTCCGATCNONE 
J033035E15ATCGGACGGCCGAGATNONE 
J033035E15GCCGTCCGATCNONE 
J033040N13ATCGGACGGCCGAGATNONE 
J033040N13GCCGTCCGATCNONE 
J033046C17ATCGGACGGCCGAGATNONE 
J033046C17GCCGTCCGATCNONE 
J033069F02ATCGGACGGCCGAGATNONE 
J033069F02GCCGTCCGATCNONE 
J033071B16ATCGGACGGCCGAGATNONE 
J033071B16GCCGTCCGATCNONE 
J033071N22ATCGGACGGCCGAGATNONE 
J033071N22GCCGTCCGATCNONE 
J033088J02ATCGGACGGCCGAGATNONE 
J033088J02GCCGTCCGATCNONE 
J033092N24ATCGGACGGCCGAGATNONE 
J033092N24GCCGTCCGATCNONE 
J033093I09ATCGGACGGCCGAGATNONE 
J033093I09GCCGTCCGATCNONE 
J033126G06ATCGGACGGCCGAGATNONE 
J033126G06GCCGTCCGATCNONE 
J043003G15ATCGGACGGCCGAGATNONE 
J043003G15GCCGTCCGATCNONE 
J043010M11ATCGGACGGCCGAGATNONE 
J043010M11GCCGTCCGATCNONE 
J043024O20ATCGGACGGCCGAGATNONE 
J043024O20GCCGTCCGATCNONE 
J065092N03ATCGGACGGCCGAGATNONE 
J065092N03GCCGTCCGATCNONE 
J080004D17ATCGGACGGCCGAGATNONE 
J080004D17GCCGTCCGATCNONE 
J080010L09ATCGGACGGCCGAGATNONE 
J080010L09GCCGTCCGATCNONE 
J080021I11ATCGGACGGCCGAGATNONE 
J080021I11GCCGTCCGATCNONE 
J080022L01ATCGGACGGCCGAGATNONE 
J080022L01GCCGTCCGATCNONE 
J080029B01ATCGGACGGCCGAGATNONE 
J080029B01GCCGTCCGATCNONE 
J080032D11ATCGGACGGCCGAGATNONE 
J080032D11GCCGTCCGATCNONE 
J080039B11ATCGGACGGCCGAGATNONE 
J080039B11GCCGTCCGATCNONE 
J080040K17ATCGGACGGCCGAGATNONE 
J080040K17GCCGTCCGATCNONE 
J080041B21ATCGGACGGCCGAGATNONE 
J080041B21GCCGTCCGATCNONE 
J080052L24ATCGGACGGCCGAGATNONE 
J080052L24GCCGTCCGATCNONE 
J080054M12ATCGGACGGCCGAGATNONE 
J080054M12GCCGTCCGATCNONE 
J080057B15ATCGGACGGCCGAGATNONE 
J080057B15GCCGTCCGATCNONE 
J080078G15ATCGGACGGCCGAGATNONE 
J080078G15GCCGTCCGATCNONE 
J080078H06ATCGGACGGCCGAGATNONE 
J080078H06GCCGTCCGATCNONE 
J080079M03ATCGGACGGCCGAGATNONE 
J080079M03GCCGTCCGATCNONE 
J080088H16ATCGGACGGCCGAGATNONE 
J080088H16GCCGTCCGATCNONE 
J080093C11ATCGGACGGCCGAGATNONE 
J080093C11GCCGTCCGATCNONE 
J080095K09ATCGGACGGCCGAGATNONE 
J080095K09GCCGTCCGATCNONE 
J080095O20ATCGGACGGCCGAGATNONE 
J080095O20GCCGTCCGATCNONE 
J090009J19ATCGGACGGCCGAGATNONE 
J090009J19GCCGTCCGATCNONE 
J090040D04ATCGGACGGCCGAGATNONE 
J090040D04GCCGTCCGATCNONE 
J090052E14ATCGGACGGCCGAGATNONE 
J090052E14GCCGTCCGATCNONE 
J090063B14ATCGGACGGCCGAGATNONE 
J090063B14GCCGTCCGATCNONE 
J090071K04ATCGGACGGCCGAGATNONE 
J090071K04GCCGTCCGATCNONE 
J090075E12ATCGGACGGCCGAGATNONE 
J090075E12GCCGTCCGATCNONE 
J090087A06ATCGGACGGCCGAGATNONE 
J090087A06GCCGTCCGATCNONE 
J090094P03ATCGGACGGCCGAGATNONE 
J090094P03GCCGTCCGATCNONE 
J090098M14ATCGGACGGCCGAGATNONE 
J090098M14GCCGTCCGATCNONE 
Os02g0245000AK119770CGGACGGCNONE 
Os02g0287000006-107-B10AGCCGTCCGATCNONE 
006-120-E07AGCCGTCCGATCNONE 
AF052503AGCCGTCCGATCNONE 
AK059647AGCCGTCCGATCSimilar to 40S ribosomal protein S3a (CYC07 protein). 
AK099131AGCCGTCCGATCNONE 
J023048M05AGCCGTCCGATCNONE 
J033107L10AGCCGTCCGATCNONE 
J065019A12AGCCGTCCGATCNONE 
J065064J21AGCCGTCCGATCNONE 
J065071D15AGCCGTCCGATCNONE 
J065094L12AGCCGTCCGATCNONE 
J065095L06AGCCGTCCGATCNONE 
J065097J11AGCCGTCCGATCNONE 
J065099M08AGCCGTCCGATCNONE 
J065104D01AGCCGTCCGATCNONE 
J065107L02AGCCGTCCGATCNONE 
J065110D14AGCCGTCCGATCNONE 
J065135J07AGCCGTCCGATCNONE 
J065137C16AGCCGTCCGATCNONE 
J065150C07AGCCGTCCGATCNONE 
J065165I10AGCCGTCCGATCNONE 
J065189F07AGCCGTCCGATCNONE 
J065205L22AGCCGTCCGATCNONE 
J065214C09AGCCGTCCGATCNONE 
J065217G17AGCCGTCCGATCNONE 
J075029E17AGCCGTCCGATCNONE 
J075054O16AGCCGTCCGATCNONE 
J075068N23AGCCGTCCGATCNONE 
J075135N18AGCCGTCCGATCNONE 
J075152G09AGCCGTCCGATCNONE 
J075162D10AGCCGTCCGATCNONE 
J075164F11AGCCGTCCGATCNONE 
J080036L12AGCCGTCCGATCNONE 
J080049K18AGCCGTCCGATCNONE 
J080060P03AGCCGTCCGATCNONE 
J080062G16AGCCGTCCGATCNONE 
J080062G21AGCCGTCCGATCNONE 
J080064N07AGCCGTCCGATCNONE 
J080075I22AGCCGTCCGATCNONE 
J080086F20AGCCGTCCGATCNONE 
J080087G07AGCCGTCCGATCNONE 
J080088I06AGCCGTCCGATCNONE 
J080302B20AGCCGTCCGATCNONE 
J080303L14AGCCGTCCGATCNONE 
J080309O12AGCCGTCCGATCNONE 
J080317F12AGCCGTCCGATCNONE 
J080317P18AGCCGTCCGATCNONE 
J090013L15AGCCGTCCGATCNONE 
J090043N04AGCCGTCCGATCNONE 
J090085G01AGCCGTCCGATCNONE 
J090085G19AGCCGTCCGATCNONE 
Os02g0453300006-099-D03GGACGGACGGCCNONE 
009-120-D02GGACGGACGGCCNONE 
AK071220GGACGGACGGCCNONE 
AK109380GGACGGACGGCCConserved hypothetical protein. 
J023083M17GGACGGACGGCCNONE 
Os02g0462800AK110587GCCGTCCGATCWRKY transcription factor 42 (Transcription factor WRKY02). 
AY676923GCCGTCCGATCNONE 
Os02g0556700AK073875GGCCGTCCGATCT-complex 11 family protein. 
Os02g0572000AK105571GCCGTCCGConserved hypothetical protein. 
Os02g0622400005-010-C04AGCCGTCCGATCNONE 
AK061679AGCCGTCCGATCConserved hypothetical protein. 
J013058H01AGCCGTCCGATCNONE 
J013095D07AGCCGTCCGATCNONE 
J023054G05AGCCGTCCGATCNONE 
J023093A17AGCCGTCCGATCNONE 
J023146P16AGCCGTCCGATCNONE 
J033089D16AGCCGTCCGATCNONE 
J033099G12AGCCGTCCGATCNONE 
J033131N10AGCCGTCCGATCNONE 
J053073J04AGCCGTCCGATCNONE 
J053074P03AGCCGTCCGATCNONE 
J053075M06AGCCGTCCGATCNONE 
J053088K13AGCCGTCCGATCNONE 
J090039F18AGCCGTCCGATCNONE 
J090045M03AGCCGTCCGATCNONE 
Os02g0668100006-028-H02CGGACGGCNONE 
AK105878CGGACGGCPolyprenyl synthetase family protein. 
AK106165CGGACGGCNONE 
J013151O15CGGACGGCNONE 
Os02g0697600011-021-B01GCCGTCCGTCCGNONE 
AK121757GCCGTCCGTCCGAAA ATPase domain containing protein. 
Os02g0700000AK100709GCCGTCCGPWWP domain containing protein. 
J013072L20GCCGTCCGNONE 
J023115E12GCCGTCCGNONE 
J033099N14GCCGTCCGNONE 
J033148H17GCCGTCCGNONE 
J100074E14GCCGTCCGNONE 
Os02g0717600J090003H19CCCCCGCGACGCGGATCGGACGGCTNONE 
J100090A12CCCCCGCGACGCGGATCGGACGGCTConserved hypothetical protein. 
Os02g0750500AK101960GGCCGTCCGATSAM (and some other nucleotide) binding motif domain containing protein. 
J033075P05GGCCGTCCGATNONE 
J065054F02GGCCGTCCGATNONE 
J065124N03GGCCGTCCGATNONE 
J090001H12GGCCGTCCGATNONE 
J100057J01GGCCGTCCGATNONE 
J100062F12GGCCGTCCGATNONE 
Os02g0751300J033055P08CGGACGGCCCAGATProtein of unknown function DUF581 family protein. 
Os02g0754300009-048-D05AGCCGTCCGATNONE 
AK059012AGCCGTCCGATNONE 
AK068621AGCCGTCCGATNONE 
AK099805AGCCGTCCGATRibosomal protein L29 family protein. 
J065102P04AGCCGTCCGATNONE 
J065161I03AGCCGTCCGATNONE 
Os02g0776800AB042415GGCCGTCCGATNONE 
AK072308GGCCGTCCGATReplication protein A 70kDa. 
AK101212GGCCGTCCGATNONE 
J033031B02GGCCGTCCGATNONE 
J090004E18GGCCGTCCGATNONE 
J090084C24GGCCGTCCGATNONE 
Os02g0777800AK066978AGCCGTCCGSimilar to Avr9/Cf-9 induced kinase 1. 
Os02g0797300J023065F09GCCGTCCGNONE 
Os02g0807750J075136J04GCCGTCCGATCHypothetical protein. 
Os03g0111600AK101020AGCCGTCCGATCCCCACGTProtein of unknown function DUF1618 domain containing protein. 
J023149K08AGCCGTCCGATCCCCACGTNONE 
J033042K17AGCCGTCCGATCCCCACGTNONE 
J033073E05AGCCGTCCGATCCCCACGTNONE 
J043032K02AGCCGTCCGATCCCCACGTNONE 
J090009D04AGCCGTCCGATCCCCACGTNONE 
J090037M16AGCCGTCCGATCCCCACGTNONE 
Os03g0115200009-112-E09TCGGACGGCCCATGNONE 
AK071287TCGGACGGCCCATGSimilar to Partner of Nob1; Pno1p; Yor145cp like KH domain containing protein, transcripts identified by EST. 
J023088J06TCGGACGGCCCATGNONE 
J065075D17TCGGACGGCCCATGNONE 
J065108G15TCGGACGGCCCATGNONE 
J065165A16TCGGACGGCCCATGNONE 
J075015O12TCGGACGGCCCATGNONE 
J075022O06TCGGACGGCCCATGNONE 
J075031H14TCGGACGGCCCATGNONE 
J075033D10TCGGACGGCCCATGNONE 
J075070A04TCGGACGGCCCATGNONE 
J075127A05TCGGACGGCCCATGNONE 
J100070B16TCGGACGGCCCATGNONE 
Os03g0136200004-011-E10AGCCGTCCGATCNONE 
006-067-A08AGCCGTCCGATCNONE 
011-007-E02AGCCGTCCGATCNONE 
011-099-H10AGCCGTCCGATCNONE 
012-044-D08AGCCGTCCGATCNONE 
013-045-G12AGCCGTCCGATCNONE 
013-062-C09AGCCGTCCGATCNONE 
013-072-F09AGCCGTCCGATCNONE 
013-085-B12AGCCGTCCGATCNONE 
013-097-E09AGCCGTCCGATCNONE 
013-097-F09AGCCGTCCGATCNONE 
014-013-C09AGCCGTCCGATCNONE 
014-082-D08AGCCGTCCGATCNONE 
015-071-A09AGCCGTCCGATCNONE 
AF042333AGCCGTCCGATCNONE 
AK060887AGCCGTCCGATCNONE 
AK121681AGCCGTCCGATC24-methylenesterol C-methyltransferase 2 (EC 2.1.1.143) (24-sterol C- methyltransferase 2) (Sterol-C-methyltransferase 2). 
J013073N14AGCCGTCCGATCNONE 
J013123F01AGCCGTCCGATCNONE 
J023050A02AGCCGTCCGATCNONE 
J033046H22AGCCGTCCGATCNONE 
J033070A11AGCCGTCCGATCNONE 
J065059G11AGCCGTCCGATCNONE 
J065068F10AGCCGTCCGATCNONE 
J065164A10AGCCGTCCGATCNONE 
J075031F07AGCCGTCCGATCNONE 
J075054J01AGCCGTCCGATCNONE 
J075086M04AGCCGTCCGATCNONE 
J075118K23AGCCGTCCGATCNONE 
J075122A09AGCCGTCCGATCNONE 
J075123D06AGCCGTCCGATCNONE 
J075129A22AGCCGTCCGATCNONE 
J075161E07AGCCGTCCGATCNONE 
J075179H04AGCCGTCCGATCNONE 
J075181C06AGCCGTCCGATCNONE 
J075186A12AGCCGTCCGATCNONE 
J090014H16AGCCGTCCGATCNONE 
J090045G17AGCCGTCCGATCNONE 
J090048B09AGCCGTCCGATCNONE 
J090052J23AGCCGTCCGATCNONE 
J090052K22AGCCGTCCGATCNONE 
J090059F10AGCCGTCCGATCNONE 
J090080F19AGCCGTCCGATCNONE 
J100039J08AGCCGTCCGATCNONE 
J100044K02AGCCGTCCGATCNONE 
J100051E16AGCCGTCCGATCNONE 
J100053F08AGCCGTCCGATCNONE 
J100056F07AGCCGTCCGATCNONE 
J100058A10AGCCGTCCGATCNONE 
Os03g0145600015-010-B10CGGACGGCCCATCTNONE 
AK106243CGGACGGCCCATCTQuinonprotein alcohol dehydrogenase-like domain containing protein. 
Os03g0156500011-075-F02GGCCGTCCGNONE 
012-077-G10GGCCGTCCGNONE 
AK103466GGCCGTCCGLupus La protein family protein. 
J013088H17GGCCGTCCGNONE 
J013135G21GGCCGTCCGNONE 
J033050E10GGCCGTCCGNONE 
J033050J01GGCCGTCCGNONE 
J033129N23GGCCGTCCGNONE 
J065085L16GGCCGTCCGNONE 
J065101B19GGCCGTCCGNONE 
J065167N03GGCCGTCCGNONE 
J090009O21GGCCGTCCGNONE 
J090049D11GGCCGTCCGNONE 
J100017F23GGCCGTCCGNONE 
J100040E12GGCCGTCCGNONE 
J100055O18GGCCGTCCGNONE 
J100061K08GGCCGTCCGNONE 
J100072M05GGCCGTCCGNONE 
J100077B08GGCCGTCCGNONE 
J100086G03GGCCGTCCGNONE 
Os03g0160900J065071D24ATCGGACGGCTNONE 
J065132L03ATCGGACGGCTHypothetical protein. 
J075189L19ATCGGACGGCTNONE 
Os03g0177100AK068092AGCCGTCCGATCConserved hypothetical protein. 
J100036F01AGCCGTCCGATCNONE 
J100040N06AGCCGTCCGATCNONE 
J100043E08AGCCGTCCGATCNONE 
Os03g0178400AK108257CGGACGGCTEpoxide hydrolase family protein. 
Os03g0187700009-155-F05CCGTGGGCCGTCCGATCNONE 
J033140E21CCGTGGGCCGTCCGATCNONE 
J033142E21CCGTGGGCCGTCCGATCNONE 
J065014P17CCGTGGGCCGTCCGATCNONE 
J065083L20CCGTGGGCCGTCCGATCNONE 
J065092E08CCGTGGGCCGTCCGATCNONE 
J065154C08CCGTGGGCCGTCCGATCTarget SNARE coiled-coil region domain containing protein. 
J075142H08CCGTGGGCCGTCCGATCNONE 
J075175K21CCGTGGGCCGTCCGATCNONE 
J090070B20CCGTGGGCCGTCCGATCNONE 
J100071M06CCGTGGGCCGTCCGATCNONE 
Os03g0200400AK107086AGCCGTCCGConserved hypothetical protein. 
Os03g0217900AK119980AGCCGTCCGATConserved hypothetical protein. 
J053089K18AGCCGTCCGATNONE 
J090058B20AGCCGTCCGATNONE 
J090081L09AGCCGTCCGATNONE 
Os03g0227800016-033-F09GGCCGTCCGANONE 
AK063571GGCCGTCCGANONE 
AK103846GGCCGTCCGANONE 
J013028J20GGCCGTCCGANONE 
J013091I04GGCCGTCCGANONE 
J013100P18GGCCGTCCGANONE 
J013128L15GGCCGTCCGANONE 
J013153M09GGCCGTCCGANONE 
J033072J03GGCCGTCCGANONE 
J033074L07GGCCGTCCGANONE 
J033106H15GGCCGTCCGANONE 
J033148J22GGCCGTCCGANONE 
J065005B02GGCCGTCCGANONE 
J065009M20GGCCGTCCGANONE 
J065035E23GGCCGTCCGANONE 
J065039E24GGCCGTCCGANONE 
J065057P20GGCCGTCCGANONE 
J065066E10GGCCGTCCGANONE 
J065072G21GGCCGTCCGANONE 
J065076N07GGCCGTCCGANONE 
J065093G14GGCCGTCCGANONE 
J065127K10GGCCGTCCGANONE 
J065142O20GGCCGTCCGANONE 
J065165O18GGCCGTCCGANONE 
J065179O07GGCCGTCCGANONE 
J065203E15GGCCGTCCGANONE 
J080305J16GGCCGTCCGANONE 
J090008C14GGCCGTCCGANONE 
J090083E01GGCCGTCCGANONE 
J090092B02GGCCGTCCGANONE 
J090098O14GGCCGTCCGANONE 
J100042A12GGCCGTCCGANONE 
J100090K14GGCCGTCCGANONE 
Os03g0232500AK110980CGGACGGCCGTP-binding protein, HSR1-related domain containing protein. 
J100036C06CGGACGGCCNONE 
Os03g0245100AK059346ATCGGACGGCTNONE 
AK069529ATCGGACGGCTDihydrodipicolinate reductase family protein. 
AK102253ATCGGACGGCTNONE 
J023004J01ATCGGACGGCTNONE 
J033089J05ATCGGACGGCTNONE 
Os03g0269300011-021-H03AGCCGTCCGATCNONE 
011-029-B01AGCCGTCCGATCNONE 
AK111855AGCCGTCCGATCNONE 
AK111884AGCCGTCCGATCAcid phosphatase/vanadium-dependent haloperoxidase family protein. 
Os03g0275500AK065232CGGACGGCCEpsin, N-terminal domain containing protein. 
J013002H14CGGACGGCCNONE 
J013047G17CGGACGGCCNONE 
J013050M23CGGACGGCCNONE 
J013066D16CGGACGGCCNONE 
J013088C16CGGACGGCCNONE 
J023026P14CGGACGGCCNONE 
J023031E04CGGACGGCCNONE 
J023045C06CGGACGGCCNONE 
J023086K13CGGACGGCCNONE 
J023119G16CGGACGGCCNONE 
J033079G11CGGACGGCCNONE 
J033090O21CGGACGGCCNONE 
J033103H08CGGACGGCCNONE 
J033103M23CGGACGGCCNONE 
J033106J17CGGACGGCCNONE 
J033141M15CGGACGGCCNONE 
J090029G22CGGACGGCCNONE 
J090032O20CGGACGGCCNONE 
J090034P11CGGACGGCCNONE 
J090087D18CGGACGGCCNONE 
J100078E18CGGACGGCCNONE 
J100081C12CGGACGGCCNONE 
Os03g0284700AK069841GCCGTCCGHypothetical protein. 
Os03g0285800AF216315GCCGTCCGNONE 
AF216315GCCGTCCGATCNONE 
AF332873GCCGTCCGNONE 
AF332873GCCGTCCGATCNONE 
AF479883GCCGTCCGNONE 
AF479883GCCGTCCGATCNONE 
AF479884GCCGTCCGNONE 
AF479884GCCGTCCGATCNONE 
AJ250311GCCGTCCGNONE 
AJ250311GCCGTCCGATCNONE 
AJ486975GCCGTCCGNONE 
AJ486975GCCGTCCGATCNONE 
AK067339GCCGTCCGMAP Kinase. 
AK067339GCCGTCCGATCMAP Kinase. 
AK104834GCCGTCCGNONE 
AK104834GCCGTCCGATCNONE 
J013102O17GCCGTCCGNONE 
J013102O17GCCGTCCGATCNONE 
J023055N19GCCGTCCGNONE 
J023055N19GCCGTCCGATCNONE 
J023099F06GCCGTCCGNONE 
J023099F06GCCGTCCGATCNONE 
J065144H06GCCGTCCGNONE 
J065144H06GCCGTCCGATCNONE 
J065153A14GCCGTCCGNONE 
J065153A14GCCGTCCGATCNONE 
J065212K01GCCGTCCGNONE 
J065212K01GCCGTCCGATCNONE 
Os03g0300200AK102070ATCGGACGGCTSimilar to Ubiquitin-specific protease 16. 
Os03g0300300AK099693AGCCGTCCGAWD40-like domain containing protein. 
Os03g0314800AK103334GCCGTCCGATCPlant neutral invertase family protein. 
Os03g0387100AB026559ATCGGACGGCCCACGTGNONE 
AB026559ATCGGACGGCGCGCGACNONE 
AF022735ATCGGACGGCCCACGTGNONE 
AF022735ATCGGACGGCGCGCGACNONE 
AK058567ATCGGACGGCCCACGTGProteasome subunit alpha type 2 (EC 3.4.25.1) (20S proteasome alpha subunit B) (20S proteasome subunit alpha-2). 
AK058567ATCGGACGGCGCGCGACProteasome subunit alpha type 2 (EC 3.4.25.1) (20S proteasome alpha subunit B) (20S proteasome subunit alpha-2). 
AK101195ATCGGACGGCCCACGTGNONE 
AK101195ATCGGACGGCGCGCGACNONE 
J033030J15ATCGGACGGCCCACGTGNONE 
J033030J15ATCGGACGGCGCGCGACNONE 
J033102N16ATCGGACGGCCCACGTGNONE 
J033102N16ATCGGACGGCGCGCGACNONE 
J065056E08ATCGGACGGCCCACGTGNONE 
J065056E08ATCGGACGGCGCGCGACNONE 
J065112M11ATCGGACGGCCCACGTGNONE 
J065112M11ATCGGACGGCGCGCGACNONE 
J065170H07ATCGGACGGCCCACGTGNONE 
J065170H07ATCGGACGGCGCGCGACNONE 
J075003P17ATCGGACGGCCCACGTGNONE 
J075003P17ATCGGACGGCGCGCGACNONE 
J075074D06ATCGGACGGCCCACGTGNONE 
J075074D06ATCGGACGGCGCGCGACNONE 
J075127F20ATCGGACGGCCCACGTGNONE 
J075127F20ATCGGACGGCGCGCGACNONE 
J075129I01ATCGGACGGCCCACGTGNONE 
J075129I01ATCGGACGGCGCGCGACNONE 
J075178A10ATCGGACGGCCCACGTGNONE 
J075178A10ATCGGACGGCGCGCGACNONE 
J090071P12ATCGGACGGCCCACGTGNONE 
J090071P12ATCGGACGGCGCGCGACNONE 
J100090D18ATCGGACGGCCCACGTGNONE 
J100090D18ATCGGACGGCGCGCGACNONE 
Os03g0390600009-122-E09ATCTCGGCCGTCCGANONE 
009-122-E09GCCGTCCGATCNONE 
J065165K04ATCTCGGCCGTCCGANONE 
J065165K04GCCGTCCGATCNONE 
Os03g0425100AK070206GCCGTCCGATCHypothetical protein. 
J023042E01GCCGTCCGATCNONE 
Os03g0574300AK072541ATCGGACGGCCHypothetical protein. 
J023134M10ATCGGACGGCCNONE 
Os03g0639700AK099587GCCGTCCGSimilar to DNA repair protein recA, chloroplast precursor (Recombinase A). 
Os03g0654700AK107417CCACGGCCGTCCGProtein of unknown function DUF1637 family protein. 
Os03g0669600009-081-F01CGGACGGCCNONE 
AK073152CGGACGGCCNONE 
AK104971CGGACGGCCHypothetical protein. 
J065166I17CGGACGGCCNONE 
Os03g0670700009-028-B03GCCGTCCGATCNONE 
009-036-H12GCCGTCCGATCNONE 
009-053-H05GCCGTCCGATCNONE 
009-126-B02GCCGTCCGATCNONE 
009-135-D07GCCGTCCGATCNONE 
009-148-A03GCCGTCCGATCNONE 
009-148-A12GCCGTCCGATCNONE 
009-152-B02GCCGTCCGATCNONE 
009-153-B06GCCGTCCGATCNONE 
009-166-G05GCCGTCCGATCNONE 
009-181-A09GCCGTCCGATCNONE 
011-061-D07GCCGTCCGATCNONE 
012-043-C04GCCGTCCGATCNONE 
013-001-A02GCCGTCCGATCNONE 
013-004-F05GCCGTCCGATCNONE 
013-008-C08GCCGTCCGATCNONE 
013-015-B09GCCGTCCGATCNONE 
013-016-G05GCCGTCCGATCNONE 
013-023-A06GCCGTCCGATCNONE 
013-023-B06GCCGTCCGATCNONE 
013-032-F09GCCGTCCGATCNONE 
013-059-C07GCCGTCCGATCNONE 
013-071-E09GCCGTCCGATCNONE 
013-073-D06GCCGTCCGATCNONE 
013-077-C02GCCGTCCGATCNONE 
013-078-B12GCCGTCCGATCNONE 
013-093-A01GCCGTCCGATCNONE 
014-002-B12GCCGTCCGATCNONE 
014-003-E08GCCGTCCGATCNONE 
014-004-D06GCCGTCCGATCNONE 
014-007-C11GCCGTCCGATCNONE 
014-007-G10GCCGTCCGATCNONE 
014-019-C04GCCGTCCGATCNONE 
014-021-F05GCCGTCCGATCNONE 
014-024-G06GCCGTCCGATCNONE 
014-027-C07GCCGTCCGATCNONE 
014-027-D03GCCGTCCGATCNONE 
014-029-E07GCCGTCCGATCNONE 
014-031-B04GCCGTCCGATCNONE 
014-033-B05GCCGTCCGATCNONE 
014-033-C03GCCGTCCGATCNONE 
014-033-C12GCCGTCCGATCNONE 
014-036-F01GCCGTCCGATCNONE 
014-037-C04GCCGTCCGATCNONE 
014-040-H02GCCGTCCGATCNONE 
014-045-H04GCCGTCCGATCNONE 
014-045-H06GCCGTCCGATCNONE 
014-052-A08GCCGTCCGATCNONE 
014-076-G01GCCGTCCGATCNONE 
014-083-F04GCCGTCCGATCNONE 
014-086-E01GCCGTCCGATCNONE 
014-091-D02GCCGTCCGATCNONE 
014-091-F05GCCGTCCGATCNONE 
014-093-E10GCCGTCCGATCNONE 
014-100-C10GCCGTCCGATCNONE 
015-011-H02GCCGTCCGATCNONE 
015-073-B03GCCGTCCGATCNONE 
AF010579GCCGTCCGATCNONE 
AK059164GCCGTCCGATCSimilar to Glycine-rich RNA-binding, abscisic acid-inducible protein. 
AK070016GCCGTCCGATCNONE 
AK119238GCCGTCCGATCNONE 
AK119242GCCGTCCGATCNONE 
J023037K17GCCGTCCGATCNONE 
J033136F11GCCGTCCGATCNONE 
J065008C13GCCGTCCGATCNONE 
J065032K18GCCGTCCGATCNONE 
J065043N10GCCGTCCGATCNONE 
J065045E06GCCGTCCGATCNONE 
J065046P21GCCGTCCGATCNONE 
J065048J17GCCGTCCGATCNONE 
J065053I23GCCGTCCGATCNONE 
J065053P03GCCGTCCGATCNONE 
J065054C13GCCGTCCGATCNONE 
J065058I17GCCGTCCGATCNONE 
J065061I12GCCGTCCGATCNONE 
J065062E09GCCGTCCGATCNONE 
J065063P04GCCGTCCGATCNONE 
J065068J07GCCGTCCGATCNONE 
J065076D02GCCGTCCGATCNONE 
J065083O07GCCGTCCGATCNONE 
J065090J02GCCGTCCGATCNONE 
J065093N08GCCGTCCGATCNONE 
J065097F02GCCGTCCGATCNONE 
J065112H17GCCGTCCGATCNONE 
J065121B01GCCGTCCGATCNONE 
J065124F12GCCGTCCGATCNONE 
J065130L03GCCGTCCGATCNONE 
J065131K05GCCGTCCGATCNONE 
J065132C06GCCGTCCGATCNONE 
J065135J18GCCGTCCGATCNONE 
J065138J22GCCGTCCGATCNONE 
J065140G21GCCGTCCGATCNONE 
J065161B19GCCGTCCGATCNONE 
J065162F22GCCGTCCGATCNONE 
J065162M09GCCGTCCGATCNONE 
J065163D03GCCGTCCGATCNONE 
J065163O21GCCGTCCGATCNONE 
J065165H11GCCGTCCGATCNONE 
J065165O16GCCGTCCGATCNONE 
J065167N06GCCGTCCGATCNONE 
J065168I08GCCGTCCGATCNONE 
J065170A14GCCGTCCGATCNONE 
J065170L03GCCGTCCGATCNONE 
J065171C08GCCGTCCGATCNONE 
J065173G11GCCGTCCGATCNONE 
J065173M09GCCGTCCGATCNONE 
J065176P07GCCGTCCGATCNONE 
J065178K24GCCGTCCGATCNONE 
J065185O12GCCGTCCGATCNONE 
J065191E02GCCGTCCGATCNONE 
J065204H10GCCGTCCGATCNONE 
J075033C23GCCGTCCGATCNONE 
J075041M21GCCGTCCGATCNONE 
J075043F13GCCGTCCGATCNONE 
J075044D02GCCGTCCGATCNONE 
J075044J15GCCGTCCGATCNONE 
J075048L07GCCGTCCGATCNONE 
J075054G12GCCGTCCGATCNONE 
J075055J10GCCGTCCGATCNONE 
J075059F09GCCGTCCGATCNONE 
J075066M23GCCGTCCGATCNONE 
J075071O09GCCGTCCGATCNONE 
J075085G23GCCGTCCGATCNONE 
J075086B21GCCGTCCGATCNONE 
J075087L18GCCGTCCGATCNONE 
J075087L21GCCGTCCGATCNONE 
J075087N14GCCGTCCGATCNONE 
J075088O13GCCGTCCGATCNONE 
J075089B06GCCGTCCGATCNONE 
J075089E20GCCGTCCGATCNONE 
J075090J01GCCGTCCGATCNONE 
J075090L05GCCGTCCGATCNONE 
J075091G05GCCGTCCGATCNONE 
J075091N06GCCGTCCGATCNONE 
J075093G08GCCGTCCGATCNONE 
J075094C13GCCGTCCGATCNONE 
J075095K01GCCGTCCGATCNONE 
J075096C02GCCGTCCGATCNONE 
J075097L16GCCGTCCGATCNONE 
J075097O10GCCGTCCGATCNONE 
J075098H24GCCGTCCGATCNONE 
J075099H02GCCGTCCGATCNONE 
J075099J11GCCGTCCGATCNONE 
J075099L08GCCGTCCGATCNONE 
J075109I11GCCGTCCGATCNONE 
J075114F03GCCGTCCGATCNONE 
J075121G07GCCGTCCGATCNONE 
J075122D23GCCGTCCGATCNONE 
J075132O07GCCGTCCGATCNONE 
J075141L21GCCGTCCGATCNONE 
J075142I08GCCGTCCGATCNONE 
J075145A06GCCGTCCGATCNONE 
J075147J15GCCGTCCGATCNONE 
J075150B09GCCGTCCGATCNONE 
J075151E07GCCGTCCGATCNONE 
J075161M16GCCGTCCGATCNONE 
J075190I16GCCGTCCGATCNONE 
J075192L05GCCGTCCGATCNONE 
J075192O03GCCGTCCGATCNONE 
J075192O08GCCGTCCGATCNONE 
J075193L12GCCGTCCGATCNONE 
J080001M24GCCGTCCGATCNONE 
J080004E20GCCGTCCGATCNONE 
J080005K15GCCGTCCGATCNONE 
J080005L05GCCGTCCGATCNONE 
J080014P20GCCGTCCGATCNONE 
J080029D12GCCGTCCGATCNONE 
J080030H09GCCGTCCGATCNONE 
J080039G05GCCGTCCGATCNONE 
J080040E18GCCGTCCGATCNONE 
J080041B02GCCGTCCGATCNONE 
J080041E06GCCGTCCGATCNONE 
J080041G05GCCGTCCGATCNONE 
J080041G24GCCGTCCGATCNONE 
J080041H07GCCGTCCGATCNONE 
J080041K03GCCGTCCGATCNONE 
J080047G01GCCGTCCGATCNONE 
J080052E07GCCGTCCGATCNONE 
J080053B15GCCGTCCGATCNONE 
J080053N01GCCGTCCGATCNONE 
J080054I01GCCGTCCGATCNONE 
J080054N02GCCGTCCGATCNONE 
J080063P03GCCGTCCGATCNONE 
J080064E13GCCGTCCGATCNONE 
J080064G13GCCGTCCGATCNONE 
J080065F02GCCGTCCGATCNONE 
J080065G03GCCGTCCGATCNONE 
J080065K17GCCGTCCGATCNONE 
J080067D06GCCGTCCGATCNONE 
J080067H23GCCGTCCGATCNONE 
J080067M15GCCGTCCGATCNONE 
J080068B20GCCGTCCGATCNONE 
J080068G24GCCGTCCGATCNONE 
J080072K19GCCGTCCGATCNONE 
J080076I24GCCGTCCGATCNONE 
J080092F05GCCGTCCGATCNONE 
J080092K14GCCGTCCGATCNONE 
J080092N22GCCGTCCGATCNONE 
J080093K02GCCGTCCGATCNONE 
J080094C08GCCGTCCGATCNONE 
J080094E09GCCGTCCGATCNONE 
J080094E20GCCGTCCGATCNONE 
J080094G08GCCGTCCGATCNONE 
J080094H18GCCGTCCGATCNONE 
J080094P22GCCGTCCGATCNONE 
J080095J23GCCGTCCGATCNONE 
J080096F14GCCGTCCGATCNONE 
J080097A21GCCGTCCGATCNONE 
J080097I07GCCGTCCGATCNONE 
J080097J02GCCGTCCGATCNONE 
J080097K01GCCGTCCGATCNONE 
J080097K03GCCGTCCGATCNONE 
J080305H18GCCGTCCGATCNONE 
J080306G01GCCGTCCGATCNONE 
J080306O08GCCGTCCGATCNONE 
J080311I01GCCGTCCGATCNONE 
J080315N24GCCGTCCGATCNONE 
J090003K21GCCGTCCGATCNONE 
J090008C20GCCGTCCGATCNONE 
J090008K19GCCGTCCGATCNONE 
J090008P13GCCGTCCGATCNONE 
J090015H22GCCGTCCGATCNONE 
J090016M01GCCGTCCGATCNONE 
J090018E13GCCGTCCGATCNONE 
J090018G03GCCGTCCGATCNONE 
J090018L17GCCGTCCGATCNONE 
J090019H11GCCGTCCGATCNONE 
J090021B19GCCGTCCGATCNONE 
J090021K02GCCGTCCGATCNONE 
J090023H15GCCGTCCGATCNONE 
J090034E03GCCGTCCGATCNONE 
J090045D16GCCGTCCGATCNONE 
J090045I06GCCGTCCGATCNONE 
J090047L09GCCGTCCGATCNONE 
J090048B05GCCGTCCGATCNONE 
J090048D11GCCGTCCGATCNONE 
J090048N11GCCGTCCGATCNONE 
J090050F20GCCGTCCGATCNONE 
J090052M20GCCGTCCGATCNONE 
J090083H03GCCGTCCGATCNONE 
J090084C12GCCGTCCGATCNONE 
J090095B05GCCGTCCGATCNONE 
J090095M18GCCGTCCGATCNONE 
J100024I22GCCGTCCGATCNONE 
J100024J12GCCGTCCGATCNONE 
J100024J22GCCGTCCGATCNONE 
J100025F07GCCGTCCGATCNONE 
J100026B13GCCGTCCGATCNONE 
J100027N03GCCGTCCGATCNONE 
J100029F14GCCGTCCGATCNONE 
J100029L20GCCGTCCGATCNONE 
J100032C22GCCGTCCGATCNONE 
J100032I08GCCGTCCGATCNONE 
J100032O05GCCGTCCGATCNONE 
J100033J24GCCGTCCGATCNONE 
J100033L12GCCGTCCGATCNONE 
J100034K06GCCGTCCGATCNONE 
J100037D09GCCGTCCGATCNONE 
J100038H02GCCGTCCGATCNONE 
J100039A12GCCGTCCGATCNONE 
J100039N12GCCGTCCGATCNONE 
J100039O21GCCGTCCGATCNONE 
J100040K05GCCGTCCGATCNONE 
J100042A02GCCGTCCGATCNONE 
J100042A17GCCGTCCGATCNONE 
J100043C15GCCGTCCGATCNONE 
J100044A17GCCGTCCGATCNONE 
J100044E18GCCGTCCGATCNONE 
J100044I11GCCGTCCGATCNONE 
J100044J15GCCGTCCGATCNONE 
J100045E23GCCGTCCGATCNONE 
J100049B18GCCGTCCGATCNONE 
J100050G04GCCGTCCGATCNONE 
J100051D06GCCGTCCGATCNONE 
J100051H20GCCGTCCGATCNONE 
J100052J01GCCGTCCGATCNONE 
J100052K07GCCGTCCGATCNONE 
J100055I01GCCGTCCGATCNONE 
J100057D02GCCGTCCGATCNONE 
J100059G14GCCGTCCGATCNONE 
J100059G21GCCGTCCGATCNONE 
J100059H03GCCGTCCGATCNONE 
J100059H15GCCGTCCGATCNONE 
J100063E13GCCGTCCGATCNONE 
J100063M02GCCGTCCGATCNONE 
J100064B17GCCGTCCGATCNONE 
J100064F11GCCGTCCGATCNONE 
J100066G12GCCGTCCGATCNONE 
J100066H09GCCGTCCGATCNONE 
J100068B12GCCGTCCGATCNONE 
J100068L16GCCGTCCGATCNONE 
J100068M23GCCGTCCGATCNONE 
J100069A02GCCGTCCGATCNONE 
J100069D07GCCGTCCGATCNONE 
J100069M13GCCGTCCGATCNONE 
J100070C07GCCGTCCGATCNONE 
J100070J11GCCGTCCGATCNONE 
J100070L20GCCGTCCGATCNONE 
J100071H10GCCGTCCGATCNONE 
J100072L14GCCGTCCGATCNONE 
J100072N12GCCGTCCGATCNONE 
J100073A21GCCGTCCGATCNONE 
J100074K17GCCGTCCGATCNONE 
J100074M04GCCGTCCGATCNONE 
J100075F11GCCGTCCGATCNONE 
J100076E23GCCGTCCGATCNONE 
J100076G03GCCGTCCGATCNONE 
J100077K01GCCGTCCGATCNONE 
J100077N23GCCGTCCGATCNONE 
J100079H17GCCGTCCGATCNONE 
J100081N01GCCGTCCGATCNONE 
J100082E04GCCGTCCGATCNONE 
J100082K11GCCGTCCGATCNONE 
J100085H23GCCGTCCGATCNONE 
J100086O18GCCGTCCGATCNONE 
J100087F21GCCGTCCGATCNONE 
J100088E02GCCGTCCGATCNONE 
J100088F08GCCGTCCGATCNONE 
J100088G24GCCGTCCGATCNONE 
J100088K20GCCGTCCGATCNONE 
J100089B19GCCGTCCGATCNONE 
J100089K22GCCGTCCGATCNONE 
J100089N22GCCGTCCGATCNONE 
J100089O17GCCGTCCGATCNONE 
J100090N05GCCGTCCGATCNONE 
Os03g0684400AK100086GATCGGACGGCCCAGATMg2+ transporter protein, CorA-like family protein. 
Os03g0690000AK062756GATCGGACGGCCCACGCConserved hypothetical protein. 
J080302F19GATCGGACGGCCCACGCNONE 
J080303J23GATCGGACGGCCCACGCNONE 
J080303K16GATCGGACGGCCCACGCNONE 
J080306B15GATCGGACGGCCCACGCNONE 
J080309C02GATCGGACGGCCCACGCNONE 
J080312F13GATCGGACGGCCCACGCNONE 
J080312M04GATCGGACGGCCCACGCNONE 
J080315L20GATCGGACGGCCCACGCNONE 
Os03g0699300AK120407CCGAGCCGTCCGATCSimilar to Adenylosuccinate synthetase, chloroplast precursor (EC 6.3.4.4) (IMP-- aspartate ligase) (AdSS) (AMPSase). 
Os03g0728800AK068068ATCGGACGGCSimilar to RNA helicase (Fragment). 
J013129E17ATCGGACGGCNONE 
J065158C03ATCGGACGGCNONE 
J075173I18ATCGGACGGCNONE 
J075181P17ATCGGACGGCNONE 
J090026F13ATCGGACGGCNONE 
J090029J16ATCGGACGGCNONE 
J090058N01ATCGGACGGCNONE 
J090082F21ATCGGACGGCNONE 
J100067H15ATCGGACGGCNONE 
J100085I09ATCGGACGGCNONE 
Os03g0743200J065049G14CGGACGGCCNONE 
J065158O18CGGACGGCCNONE 
Os03g0746000AK073682AGCCGTCCGATCConserved hypothetical protein. 
AK111472AGCCGTCCGATCNONE 
J090083F05AGCCGTCCGATCNONE 
Os03g0751100AK102404CGGACGGCCSimilar to Isp4 protein-like. 
Os03g0789800AK067287GGCCGTCCGNONE 
AK120138GGCCGTCCGHypothetical protein. 
J013027L14GGCCGTCCGNONE 
J065093P21GGCCGTCCGNONE 
J065173F10GGCCGTCCGNONE 
J065211G18GGCCGTCCGNONE 
Os03g0811100AK072463ATCGGACGGCTSimilar to Magnesium-chelatase subunit chlD, chloroplast precursor (EC 6.6.1.1) (Mg-protoporphyrin IX chelatase) (Mg-chelatase subunit D). 
Os03g0815900013-097-G08AGCCGTCCGATCGGACNONE 
AK065258AGCCGTCCGATCGGACNONE 
AK119756AGCCGTCCGATCGGACSimilar to DNA-directed RNA polymerase. 
J013002J17AGCCGTCCGATCGGACNONE 
J013074A12AGCCGTCCGATCGGACNONE 
J023045C17AGCCGTCCGATCGGACNONE 
J033050E21AGCCGTCCGATCGGACNONE 
J053094P05AGCCGTCCGATCGGACNONE 
J090038F11AGCCGTCCGATCGGACNONE 
J090072J01AGCCGTCCGATCGGACNONE 
J100026H07AGCCGTCCGATCGGACNONE 
J100040O06AGCCGTCCGATCGGACNONE 
J100083D07AGCCGTCCGATCGGACNONE 
Os03g0822800AK069263GGCCGTCCGATCNONE 
AK099592GGCCGTCCGATCSimilar to Chaperone protein dnaJ 1. 
J013043N03GGCCGTCCGATCNONE 
Os03g0826800006-081-B04ATCGGACGGCTNONE 
015-050-A02ATCGGACGGCTNONE 
AK065702ATCGGACGGCTConserved hypothetical protein. 
AK119789ATCGGACGGCTNONE 
J013035P06ATCGGACGGCTNONE 
J023025I11ATCGGACGGCTNONE 
J065023J15ATCGGACGGCTNONE 
J065204K04ATCGGACGGCTNONE 
J075021L07ATCGGACGGCTNONE 
J075104F02ATCGGACGGCTNONE 
J075146J05ATCGGACGGCTNONE 
J100026H04ATCGGACGGCTNONE 
J100031M07ATCGGACGGCTNONE 
J100035A06ATCGGACGGCTNONE 
J100052J05ATCGGACGGCTNONE 
J100059F12ATCGGACGGCTNONE 
J100071F10ATCGGACGGCTNONE 
J100074G08ATCGGACGGCTNONE 
J100074G24ATCGGACGGCTNONE 
J100082L21ATCGGACGGCTNONE 
Os03g0847600AK066947GCCGTCCGASimilar to GAMYB-binding protein. 
AK098991GCCGTCCGANONE 
AK104847GCCGTCCGANONE 
Os04g0266400AK065632GCCGTCCGATNONE 
AK068202GCCGTCCGATSimilar to AHM2 (Fragment). 
AK072046GCCGTCCGATNONE 
AK105688GCCGTCCGATNONE 
Os04g0269900J065139P11CGGACGGCTNONE 
J100034P12CGGACGGCTNONE 
J100045D21CGGACGGCTNONE 
Os04g0270200006-099-F09ATCGGACGGCCNONE 
AK061854ATCGGACGGCCProtein of unknown function UPF0172 family protein. 
AK099002ATCGGACGGCCNONE 
J013110N19ATCGGACGGCCNONE 
J075054J19ATCGGACGGCCNONE 
Os04g0286400009-144-C10GCCGTCCGATNONE 
AK062974GCCGTCCGATHypothetical protein. 
Os04g0401800AB197127AGCCGTCCGATCCGDNA repair metallo-beta-lactamase domain containing protein. 
AB197127GATCGGACGGCTDNA repair metallo-beta-lactamase domain containing protein. 
AK103868AGCCGTCCGATCCGNONE 
AK103868GATCGGACGGCTNONE 
J033149H08AGCCGTCCGATCCGNONE 
J033149H08GATCGGACGGCTNONE 
J065020C11AGCCGTCCGATCCGNONE 
J065020C11GATCGGACGGCTNONE 
J075179J09AGCCGTCCGATCCGNONE 
J075179J09GATCGGACGGCTNONE 
J090034B13AGCCGTCCGATCCGNONE 
J090034B13GATCGGACGGCTNONE 
Os04g0496600AK065058ATCGGACGGCConserved hypothetical protein. 
J013001J09ATCGGACGGCNONE 
J013037C18ATCGGACGGCNONE 
J013126H05ATCGGACGGCNONE 
J090062G17ATCGGACGGCNONE 
Os04g0528100009-090-G06GATCGGACGGCTNONE 
009-168-C11GATCGGACGGCTNONE 
AK065957GATCGGACGGCTConserved hypothetical protein. 
J013039G20GATCGGACGGCTNONE 
J013044D08GATCGGACGGCTNONE 
J065013L14GATCGGACGGCTNONE 
J065143H08GATCGGACGGCTNONE 
J065146C14GATCGGACGGCTNONE 
J065149K22GATCGGACGGCTNONE 
J065156B18GATCGGACGGCTNONE 
J065201A04GATCGGACGGCTNONE 
J065209A04GATCGGACGGCTNONE 
Os04g0538400AK108230CGGACGGCSimilar to Nodulin 21 (N-21). 
J090006J20CGGACGGCNONE 
Os04g0540600AF464932CGGACGGCNONE 
AK071169CGGACGGCAldehyde dehydrogenase NAD(P)-dependent family protein. 
J023022A08CGGACGGCNONE 
J023127F17CGGACGGCNONE 
J033127K14CGGACGGCNONE 
J075060H15CGGACGGCNONE 
J080063F04CGGACGGCNONE 
J090030C21CGGACGGCNONE 
J090049I06CGGACGGCNONE 
Os04g0542800AK070304GCCGTCCGSimilar to Iron-phytosiderophore transporter protein yellow stripe 1. 
AY512582GCCGTCCGNONE 
Os04g0566900AK072344AGCCGTCCGATCConserved hypothetical protein. 
Os04g0568900AY224421CGGACGGCNONE 
Os04g0598000013-056-C01ATCGGACGGCNONE 
AK121673ATCGGACGGCConserved hypothetical protein. 
J013055M22ATCGGACGGCNONE 
J023038C06ATCGGACGGCNONE 
J033068C09ATCGGACGGCNONE 
J075026L16ATCGGACGGCNONE 
J075099K14ATCGGACGGCNONE 
J075121B18ATCGGACGGCNONE 
J075156K08ATCGGACGGCNONE 
J075190I04ATCGGACGGCNONE 
J080315E20ATCGGACGGCNONE 
J090049E09ATCGGACGGCNONE 
J100024F09ATCGGACGGCNONE 
J100041H21ATCGGACGGCNONE 
J100073L07ATCGGACGGCNONE 
J100077K04ATCGGACGGCNONE 
J100080P09ATCGGACGGCNONE 
J100087E22ATCGGACGGCNONE 
Os04g0602800AK100925AGCCGTCCGSimilar to Yarrowia lipolytica chromosome D of strain CLIB99 of Yarrowia lipolytica. 
AK100925GGCCGTCCGATCSimilar to Yarrowia lipolytica chromosome D of strain CLIB99 of Yarrowia lipolytica. 
Os04g0623700AK071587AGCCGTCCGNONE 
J023101P16AGCCGTCCGNONE 
J100044N20AGCCGTCCGNONE 
J100052H13AGCCGTCCGNONE 
J100075E05AGCCGTCCGNONE 
Y10118AGCCGTCCGSimilar to Signal recognition particle 14 kDa protein (SRP14). 
Os04g0627900AK108443CCGTCGGACGGCCGAGATCACGCCACGTCTranslation initiation factor SUI1 domain containing protein. 
J065178D17CCGTCGGACGGCCGAGATCACGCCACGTCNONE 
Os04g0644100AK106954CGGACGGCCCAGATSterile alpha motif homology domain containing protein. 
AK106954GCCGTCCGATSterile alpha motif homology domain containing protein. 
Os04g0669600AK110767CGGACGGCPhospholipase/Carboxylesterase family protein. 
AK110767CGGACGGCPhospholipase/Carboxylesterase family protein. 
J065195K10CGGACGGCNONE 
J065195K10CGGACGGCNONE 
Os05g0100500AK071466GATCGGACGGCCCAGGSimilar to Debaryomyces hansenii chromosome F of strain CBS767 of Debaryomyces hansenii. 
Os05g0102000AK064690GGCCGTCCGSAM dependent carboxyl methyltransferase family protein. 
J065086M17GGCCGTCCGNONE 
J065128C12GGCCGTCCGNONE 
Os05g0111200009-033-A06CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
AK101693CGGACGGCGCGGGTGGGTGGGCCCCACASimilar to Amino acid selective channel protein. 
J065006E13CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075001D12CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075005J18CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075009L08CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075012M21CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075019K17CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075020D07CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075041D11CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075051C03CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075060C05CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075079N09CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075094B04CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075108E08CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075115G05CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075147L21CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075161G12CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075168J11CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075168L11CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
J075174F22CGGACGGCGCGGGTGGGTGGGCCCCACANONE 
Os05g0112101J065141G20AGCCGTCCGATCEpsin, N-terminal domain containing protein. 
Os05g0140100003-106-D03CGGACGGCNONE 
AJ495784CGGACGGCNONE 
AK099636CGGACGGCNONE 
AK104345CGGACGGCNONE 
AK111821CGGACGGCMyb, DNA-binding domain containing protein. 
J013059L07CGGACGGCNONE 
J065073K19CGGACGGCNONE 
J065098F13CGGACGGCNONE 
J065104A20CGGACGGCNONE 
J065138N24CGGACGGCNONE 
J065180J07CGGACGGCNONE 
Os05g0297900AK071238AGCCGTCCGATCSimilar to Signal peptidase 18 subunit (Fragment). 
J013159C03AGCCGTCCGATCNONE 
J023041J06AGCCGTCCGATCNONE 
J023085B09AGCCGTCCGATCNONE 
J033031J11AGCCGTCCGATCNONE 
J065010C22AGCCGTCCGATCNONE 
J065032E10AGCCGTCCGATCNONE 
J065141O18AGCCGTCCGATCNONE 
J065155K04AGCCGTCCGATCNONE 
Os05g0319700AK107192GCCGTCCGSimilar to Protein kinase-like protein (Fragment). 
Os05g0328000AK107977GATCGGACGGCCConserved hypothetical protein. 
AK107977GGCCGTCCGATCConserved hypothetical protein. 
J065005I02GATCGGACGGCCNONE 
J065005I02GGCCGTCCGATCNONE 
J065049M05GATCGGACGGCCNONE 
J065049M05GGCCGTCCGATCNONE 
J080005F01GATCGGACGGCCNONE 
J080005F01GGCCGTCCGATCNONE 
J080005H15GATCGGACGGCCNONE 
J080005H15GGCCGTCCGATCNONE 
J080005K23GATCGGACGGCCNONE 
J080005K23GGCCGTCCGATCNONE 
J080007O03GATCGGACGGCCNONE 
J080007O03GGCCGTCCGATCNONE 
J080013H09GATCGGACGGCCNONE 
J080013H09GGCCGTCCGATCNONE 
J080024C02GATCGGACGGCCNONE 
J080024C02GGCCGTCCGATCNONE 
J080026M22GATCGGACGGCCNONE 
J080026M22GGCCGTCCGATCNONE 
J080029K21GATCGGACGGCCNONE 
J080029K21GGCCGTCCGATCNONE 
J080032K04GATCGGACGGCCNONE 
J080032K04GGCCGTCCGATCNONE 
J080034M16GATCGGACGGCCNONE 
J080034M16GGCCGTCCGATCNONE 
J080037G11GATCGGACGGCCNONE 
J080037G11GGCCGTCCGATCNONE 
J080040L01GATCGGACGGCCNONE 
J080040L01GGCCGTCCGATCNONE 
J080041D13GATCGGACGGCCNONE 
J080041D13GGCCGTCCGATCNONE 
J080043G20GATCGGACGGCCNONE 
J080043G20GGCCGTCCGATCNONE 
J080046H17GATCGGACGGCCNONE 
J080046H17GGCCGTCCGATCNONE 
J080048A05GATCGGACGGCCNONE 
J080048A05GGCCGTCCGATCNONE 
J080064C21GATCGGACGGCCNONE 
J080064C21GGCCGTCCGATCNONE 
J080067E15GATCGGACGGCCNONE 
J080067E15GGCCGTCCGATCNONE 
J080071P05GATCGGACGGCCNONE 
J080071P05GGCCGTCCGATCNONE 
J080074H16GATCGGACGGCCNONE 
J080074H16GGCCGTCCGATCNONE 
J080076A18GATCGGACGGCCNONE 
J080076A18GGCCGTCCGATCNONE 
J080076D20GATCGGACGGCCNONE 
J080076D20GGCCGTCCGATCNONE 
J080077J15GATCGGACGGCCNONE 
J080077J15GGCCGTCCGATCNONE 
J080085J11GATCGGACGGCCNONE 
J080085J11GGCCGTCCGATCNONE 
J080086E08GATCGGACGGCCNONE 
J080086E08GGCCGTCCGATCNONE 
J080088I23GATCGGACGGCCNONE 
J080088I23GGCCGTCCGATCNONE 
J080088I24GATCGGACGGCCNONE 
J080088I24GGCCGTCCGATCNONE 
J080089D05GATCGGACGGCCNONE 
J080089D05GGCCGTCCGATCNONE 
J080093B04GATCGGACGGCCNONE 
J080093B04GGCCGTCCGATCNONE 
J080093D07GATCGGACGGCCNONE 
J080093D07GGCCGTCCGATCNONE 
J080094A09GATCGGACGGCCNONE 
J080094A09GGCCGTCCGATCNONE 
J080096I12GATCGGACGGCCNONE 
J080096I12GGCCGTCCGATCNONE 
J080097L23GATCGGACGGCCNONE 
J080097L23GGCCGTCCGATCNONE 
Os05g0339000016-094-B12AGCCGTCCGNONE 
J075038J09AGCCGTCCGNONE 
J075124F11AGCCGTCCGNONE 
J075143E13AGCCGTCCGVHS domain containing protein. 
J075165E01AGCCGTCCGNONE 
J075185F12AGCCGTCCGNONE 
J100060N16AGCCGTCCGNONE 
J100066M21AGCCGTCCGNONE 
J100089K17AGCCGTCCGNONE 
Os05g0348100006-028-F04ATCGGACGGCCCATGTAGCCCAACTNONE 
009-036-C03ATCGGACGGCCCATGTAGCCCAACTNONE 
009-040-H02ATCGGACGGCCCATGTAGCCCAACTNONE 
009-173-H12ATCGGACGGCCCATGTAGCCCAACTNONE 
AK061434ATCGGACGGCCCATGTAGCCCAACTConserved hypothetical protein. 
J065137N04ATCGGACGGCCCATGTAGCCCAACTNONE 
J065164C10ATCGGACGGCCCATGTAGCCCAACTNONE 
J065210H22ATCGGACGGCCCATGTAGCCCAACTNONE 
Os05g0349800011-076-D06CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
014-037-D12CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
AK063677CCGAGCCGTCCGCGTCGCCGCGCGACACGTEmbryonic abundant protein 1. 
AK119674CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J053027D20CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J053039D11CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J053047P16CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J053048F05CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J053058E11CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J053060C03CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J053082N12CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J065017B15CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J065117G02CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J065212K21CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J075001H18CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J075003F20CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J075026F11CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J075035F13CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J075055C12CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J075067L20CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J075067O13CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J075070A12CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J075089E05CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J075128J17CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J075134M19CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J075192L11CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
J075199D14CCGAGCCGTCCGCGTCGCCGCGCGACACGTNONE 
Os05g0382600AK068231CGGACGGCAnnexin family protein. 
J013147O19CGGACGGCNONE 
Os05g0395300AK066212CGGACGGCATCCGACGGProtein of unknown function DUF21 domain containing protein. 
Os05g0413200006-067-C03GCCGTCCGATCCGNONE 
006-080-C03GCCGTCCGATCCGNONE 
006-095-G10GCCGTCCGATCCGNONE 
006-115-G11GCCGTCCGATCCGNONE 
013-040-E05GCCGTCCGATCCGNONE 
AB104732GCCGTCCGATCCGNONE 
AK122099GCCGTCCGATCCGBeta-tubulin. 
J033087H20GCCGTCCGATCCGNONE 
J033117C18GCCGTCCGATCCGNONE 
J033125G10GCCGTCCGATCCGNONE 
Os05g0510100Os05g0510100CGGACGGCProtein of unknown function DUF567 family protein. 
Os05g0510700AK070308GATCGGACGGCTCGGBSD domain containing protein. 
Os05g0519700AK121414GCCGTCCGNONE 
J023133A22GCCGTCCGNONE 
Os05g0547850009-102-F03CGGATCGGACGGCCNONE 
013-076-H08CGGATCGGACGGCCNONE 
AK058330CGGATCGGACGGCCNONE 
AK122158CGGATCGGACGGCCDNA-binding TFAR19-related protein family protein. 
AY626826CGGATCGGACGGCCNONE 
J043012O19CGGATCGGACGGCCNONE 
J043038O15CGGATCGGACGGCCNONE 
J053094L06CGGATCGGACGGCCNONE 
Os05g0548100AK060333AGCCGTCCGATCCGConserved hypothetical protein. 
AK100682AGCCGTCCGATCCGNONE 
J013151E01AGCCGTCCGATCCGNONE 
J023113L22AGCCGTCCGATCCGNONE 
J043027A19AGCCGTCCGATCCGNONE 
J075093E06AGCCGTCCGATCCGNONE 
J090060D15AGCCGTCCGATCCGNONE 
J090082J03AGCCGTCCGATCCGNONE 
J100050E01AGCCGTCCGATCCGNONE 
Os05g0585900AK062575CGGACGGCMitochondrial substrate carrier family protein. 
AK098854CGGACGGCNONE 
J013000H16CGGACGGCNONE 
J033118D07CGGACGGCNONE 
Os05g0586600AB096011GGCCGTCCGATPlastid sigma factor SIG5. 
AB096071GGCCGTCCGATNONE 
AK105697GGCCGTCCGATNONE 
Os05g0592300AK068520GCCGTCCGTCCGProtein of unknown function DUF1637 family protein. 
Os05g0597100011-044-C10ATCGGACGGCCNONE 
AF255711ATCGGACGGCCNONE 
AK072845ATCGGACGGCCSimilar to Nucleolar histone deacetylase HD2-p39. 
J023050H16ATCGGACGGCCNONE 
J023135M22ATCGGACGGCCNONE 
J023141B21ATCGGACGGCCNONE 
J023142J09ATCGGACGGCCNONE 
J033025E09ATCGGACGGCCNONE 
J033111A20ATCGGACGGCCNONE 
J033126I01ATCGGACGGCCNONE 
Os06g0105900AK072638CCATGGGCCGTCCGConserved hypothetical protein. 
Os06g0134800014-049-H04AGCCGTCCGNONE 
AK063692AGCCGTCCGGlycine cleavage T protein (aminomethyl transferase) family protein. 
Os06g0146300AK101052ATCGGACGGCConserved hypothetical protein. 
J075003H04ATCGGACGGCNONE 
J075039J08ATCGGACGGCNONE 
J075054H14ATCGGACGGCNONE 
J075091E08ATCGGACGGCNONE 
J075097L20ATCGGACGGCNONE 
J075179P07ATCGGACGGCNONE 
Os06g0147600AK107817AGCCGTCCGConserved hypothetical protein. 
Os06g0168600AK068858CGGACGGCTSimilar to Ribonucleotide reductase. 
Os06g0220600AK058664GCCGTCCGTCCGTCCConserved hypothetical protein. 
J075096L21GCCGTCCGTCCGTCCNONE 
Os06g0245800AK066714ATCGGACGGCSimilar to Alanyl-tRNA synthetase. 
Os06g0264500AK120596CGGACGGCCTGF-beta receptor, type I/II extracellular region family protein. 
Os06g0360300006-049-B04CGGACGGCNONE 
AK070247CGGACGGCNONE 
AK105919CGGACGGCNAD-dependent epimerase/dehydratase family protein. 
J023042K01CGGACGGCNONE 
J100036D24CGGACGGCNONE 
Os06g0360600004-004-E05GCCGTCCGATNONE 
AK059997GCCGTCCGATNONE 
Os06g0505400AK068107ATCGGACGGCTAbortive infection protein family protein. 
J013074E10ATCGGACGGCTNONE 
J013130C21ATCGGACGGCTNONE 
J033070J05ATCGGACGGCTNONE 
J033139B07ATCGGACGGCTNONE 
J043040G03ATCGGACGGCTNONE 
J065169G13ATCGGACGGCTNONE 
J075005M22ATCGGACGGCTNONE 
J075021E02ATCGGACGGCTNONE 
J075038D02ATCGGACGGCTNONE 
J075076G19ATCGGACGGCTNONE 
Os06g0506100AK107403GATCGGACGGCTProtein prenyltransferase domain containing protein. 
Os06g0571400011-027-C01CGGACGGCCNONE 
013-005-G03CGGACGGCCNONE 
015-053-G02CGGACGGCCNONE 
016-077-A05CGGACGGCCNONE 
AK068226CGGACGGCCSimilar to Elongation factor 1 gamma-like protein (Fragment). 
AK103928CGGACGGCCNONE 
AK104931CGGACGGCCNONE 
AY224444CGGACGGCCNONE 
J013044F14CGGACGGCCNONE 
J013092L16CGGACGGCCNONE 
J033028B03CGGACGGCCNONE 
J033048B03CGGACGGCCNONE 
J033065D21CGGACGGCCNONE 
J033087A07CGGACGGCCNONE 
J033108N12CGGACGGCCNONE 
J033111G07CGGACGGCCNONE 
J043009P12CGGACGGCCNONE 
J075079P19CGGACGGCCNONE 
J090056J24CGGACGGCCNONE 
J090071D10CGGACGGCCNONE 
Os06g0622300AK064549CGGACGGCNONE 
AK071559CGGACGGCNONE 
Os06g0656800AK109762GCCGTCCGBeta-Ig-H3/fasciclin domain containing protein. 
Os06g0666400AK108002GATCGGACGGCTVQ domain containing protein. 
J065043C22GATCGGACGGCTNONE 
J065120O19GATCGGACGGCTNONE 
J075197D23GATCGGACGGCTNONE 
J100030E22GATCGGACGGCTNONE 
J100031I22GATCGGACGGCTNONE 
J100072I12GATCGGACGGCTNONE 
Os06g0716700AB037681ATCGGACGGCSimilar to Endoplasmin homolog precursor (GRP94 homolog). 
AB037681CCGAGCCGTCCGATCSimilar to Endoplasmin homolog precursor (GRP94 homolog). 
AK063385ATCGGACGGCNONE 
AK063385CCGAGCCGTCCGATCNONE 
AK102478ATCGGACGGCNONE 
AK102478CCGAGCCGTCCGATCNONE 
J013030D18ATCGGACGGCNONE 
J013030D18CCGAGCCGTCCGATCNONE 
J090091L06ATCGGACGGCNONE 
J090091L06CCGAGCCGTCCGATCNONE 
Os07g0145250J075010B04ATCGGACGGCTNONE 
J075030M07ATCGGACGGCTNONE 
J075039C20ATCGGACGGCTNONE 
J075047G02ATCGGACGGCTNONE 
J075059C09ATCGGACGGCTNONE 
J075093A20ATCGGACGGCTNONE 
J075122B05ATCGGACGGCTNONE 
J075130K10ATCGGACGGCTConserved hypothetical protein. 
J075138D05ATCGGACGGCTNONE 
J075161C12ATCGGACGGCTNONE 
Os07g0191000AK071379CGGACGGCInositol monophosphatase family protein. 
AK103440CGGACGGCNONE 
Os07g0209000AK059111GATCGGACGGCCCAGATSimilar to Dolichyl-di-phosphooligosaccharide-protein glycotransferase (Oligosaccharyltransferase)-like. 
AK099319GATCGGACGGCCCAGATNONE 
Os07g0213400003-104-B01GCCGTCCGATNONE 
AK062273GCCGTCCGATConserved hypothetical protein. 
J065122P17GCCGTCCGATNONE 
J065160A01GCCGTCCGATNONE 
J090065M11GCCGTCCGATNONE 
Os07g0224000009-060-E01ATCGGACGGCTNONE 
J065042D20ATCGGACGGCTNONE 
J065127D14ATCGGACGGCTNONE 
J065176C24ATCGGACGGCTNONE 
J065188M12ATCGGACGGCTNONE 
J065194L14ATCGGACGGCTNONE 
J075060P09ATCGGACGGCTNONE 
J075134C14ATCGGACGGCTRibosomal protein L24E family protein. 
J075192M12ATCGGACGGCTNONE 
J100032N01ATCGGACGGCTNONE 
Os07g0238700AK067680GCCGTCCGATCNONE 
AK101492GCCGTCCGATCSimilar to Glutamate dehydrogenase (EC 1.4.1.3) (GDH). 
J013114K24GCCGTCCGATCNONE 
J033042P14GCCGTCCGATCNONE 
J065021G13GCCGTCCGATCNONE 
J065121C20GCCGTCCGATCNONE 
J065124D06GCCGTCCGATCNONE 
J065157D02GCCGTCCGATCNONE 
J065157K12GCCGTCCGATCNONE 
J065212K07GCCGTCCGATCNONE 
J080301G13GCCGTCCGATCNONE 
J080308E14GCCGTCCGATCNONE 
J080311J11GCCGTCCGATCNONE 
J080313O06GCCGTCCGATCNONE 
Os07g0242400011-047-A07CGGACGGCNONE 
AK063340CGGACGGCCyclin-like F-box domain containing protein. 
Os07g0421300AK121014GCCGTCCGSimilar to Alpha glucosidase-like protein. 
Os07g0432800012-025-C05AGCCGTCCGNONE 
AK063456AGCCGTCCGMyb, DNA-binding domain containing protein. 
J053025J09AGCCGTCCGNONE 
J053052K16AGCCGTCCGNONE 
J053060G01AGCCGTCCGNONE 
J053096H11AGCCGTCCGNONE 
J075033O13AGCCGTCCGNONE 
Os07g0546000AF188065GCCGTCCGNONE 
AK061800GCCGTCCGNONE 
AK065871GCCGTCCGSimilar to Isopentenyl pyrophosphate:dimethyllallyl pyrophosphate isomerase (EC 5.3.3.2) (Fragment). 
J013024C02GCCGTCCGNONE 
J013035F03GCCGTCCGNONE 
J013044J20GCCGTCCGNONE 
Os07g0586000AK069212ATCGGACGGCCCConserved hypothetical protein. 
Os07g0606600AK111621CGGACGGCCNONE 
AK112118CGGACGGCCSimilar to Nuclear factor Y transcription factor subunit B homolog. 
J080301F22CGGACGGCCNONE 
Os07g0681500AK103662GATCGGACGGCCCAGATNONE 
AK121650GATCGGACGGCCCAGATAnkyrin repeat containing protein. 
Os07g0686500AK119424GCCGTCCGProtein of unknown function DUF630 domain containing protein. 
J065064P13GCCGTCCGNONE 
J065070L21GCCGTCCGNONE 
J065196A06GCCGTCCGNONE 
J065216M14GCCGTCCGNONE 
Os08g0127100003-104-H01CGGACGGCACACACCNONE 
015-032-F08CGGACGGCACACACCNONE 
AK065217CGGACGGCACACACCNONE 
AK102015CGGACGGCACACACCAmino acid transporter, transmembrane family protein. 
J013002G10CGGACGGCACACACCNONE 
J013152E01CGGACGGCACACACCNONE 
J023007G24CGGACGGCACACACCNONE 
J023019F17CGGACGGCACACACCNONE 
J023074N19CGGACGGCACACACCNONE 
J023120E22CGGACGGCACACACCNONE 
J023120J05CGGACGGCACACACCNONE 
J023125E14CGGACGGCACACACCNONE 
J023145J12CGGACGGCACACACCNONE 
J033092G02CGGACGGCACACACCNONE 
J065019M06CGGACGGCACACACCNONE 
J065029J04CGGACGGCACACACCNONE 
J065031G24CGGACGGCACACACCNONE 
J065043J15CGGACGGCACACACCNONE 
J065049A17CGGACGGCACACACCNONE 
J065055N20CGGACGGCACACACCNONE 
J065062O05CGGACGGCACACACCNONE 
J065083A02CGGACGGCACACACCNONE 
J065086H21CGGACGGCACACACCNONE 
J065109F15CGGACGGCACACACCNONE 
J065121C11CGGACGGCACACACCNONE 
J065132J19CGGACGGCACACACCNONE 
J065135C06CGGACGGCACACACCNONE 
J065194N14CGGACGGCACACACCNONE 
J065201A20CGGACGGCACACACCNONE 
J100027B05CGGACGGCACACACCNONE 
J100036C02CGGACGGCACACACCNONE 
J100043G09CGGACGGCACACACCNONE 
J100048A10CGGACGGCACACACCNONE 
J100056I17CGGACGGCACACACCNONE 
J100062N21CGGACGGCACACACCNONE 
J100064N15CGGACGGCACACACCNONE 
J100082K15CGGACGGCACACACCNONE 
Os08g0128200AK120428CGGACGGCConserved hypothetical protein. 
Os08g0150800AK101530GATCGGACGGCSimilar to Tyrosyl-tRNA synthetase (Tyrosyl-tRNA ligase; TyrRS). class-I aaRS. 
Os08g0187700AK099689GATCGGACGGCCGAGAGCCCATCARegulation of nuclear pre-mRNA protein domain containing protein. 
Os08g0192800AK059490ATCTGGGCCGTCCGATCNONE 
AK101678ATCTGGGCCGTCCGATCNONE 
AK120613ATCTGGGCCGTCCGATCBromodomain containing protein. 
J080039B22ATCTGGGCCGTCCGATCNONE 
J080039I23ATCTGGGCCGTCCGATCNONE 
J080074D19ATCTGGGCCGTCCGATCNONE 
J080086N13ATCTGGGCCGTCCGATCNONE 
Os08g0224200AK101331CGGACGGCCCGGTSimilar to Ythdf2-prov protein. 
Os08g0299000AK061379CGGACGGCCNONE 
AK099389CGGACGGCCNONE 
AK101640CGGACGGCCProtein of unknown function DUF52 domain containing protein. 
J013100G13CGGACGGCCNONE 
J013153N09CGGACGGCCNONE 
J023097N06CGGACGGCCNONE 
J023123C12CGGACGGCCNONE 
J033088G14CGGACGGCCNONE 
J065033G10CGGACGGCCNONE 
J065128B01CGGACGGCCNONE 
J100085I01CGGACGGCCNONE 
Os08g0319900AK108030CGGACGGCPutative cyclase family protein. 
Os08g0414300AK072217AGCCGTCCGConserved hypothetical protein. 
J065039C07AGCCGTCCGNONE 
J065098N11AGCCGTCCGNONE 
J065120J15AGCCGTCCGNONE 
J075076H12AGCCGTCCGNONE 
J075101N16AGCCGTCCGNONE 
J080010A07AGCCGTCCGNONE 
J080023C16AGCCGTCCGNONE 
J080027G22AGCCGTCCGNONE 
J080053D02AGCCGTCCGNONE 
J080065E17AGCCGTCCGNONE 
J080068C15AGCCGTCCGNONE 
J090061J10AGCCGTCCGNONE 
Os08g0435900003-113-D09GCCGTCCGNONE 
003-113-D09GGCCGTCCGATCNONE 
003-131-A04GCCGTCCGNONE 
003-131-A04GGCCGTCCGATCNONE 
006-021-D09GCCGTCCGNONE 
006-021-D09GGCCGTCCGATCNONE 
006-023-F09GCCGTCCGNONE 
006-023-F09GGCCGTCCGATCNONE 
006-024-H07GCCGTCCGNONE 
006-024-H07GGCCGTCCGATCNONE 
006-025-F06GCCGTCCGNONE 
006-025-F06GGCCGTCCGATCNONE 
006-025-H01GCCGTCCGNONE 
006-025-H01GGCCGTCCGATCNONE 
006-025-H10GCCGTCCGNONE 
006-025-H10GGCCGTCCGATCNONE 
006-026-A07GCCGTCCGNONE 
006-026-A07GGCCGTCCGATCNONE 
006-026-E01GCCGTCCGNONE 
006-026-E01GGCCGTCCGATCNONE 
006-026-F04GCCGTCCGNONE 
006-026-F04GGCCGTCCGATCNONE 
006-027-A01GCCGTCCGNONE 
006-027-A01GGCCGTCCGATCNONE 
006-029-H01GCCGTCCGNONE 
006-029-H01GGCCGTCCGATCNONE 
006-030-D02GCCGTCCGNONE 
006-030-D02GGCCGTCCGATCNONE 
006-032-C03GCCGTCCGNONE 
006-032-C03GGCCGTCCGATCNONE 
006-034-C02GCCGTCCGNONE 
006-034-C02GGCCGTCCGATCNONE 
006-035-H10GCCGTCCGNONE 
006-035-H10GGCCGTCCGATCNONE 
006-039-C01GCCGTCCGNONE 
006-039-C01GGCCGTCCGATCNONE 
006-039-H08GCCGTCCGNONE 
006-039-H08GGCCGTCCGATCNONE 
006-040-D09GCCGTCCGNONE 
006-040-D09GGCCGTCCGATCNONE 
006-040-F05GCCGTCCGNONE 
006-040-F05GGCCGTCCGATCNONE 
006-044-D04GCCGTCCGNONE 
006-044-D04GGCCGTCCGATCNONE 
006-044-F09GCCGTCCGNONE 
006-044-F09GGCCGTCCGATCNONE 
006-044-G05GCCGTCCGNONE 
006-044-G05GGCCGTCCGATCNONE 
006-045-C06GCCGTCCGNONE 
006-045-C06GGCCGTCCGATCNONE 
006-046-B04GCCGTCCGNONE 
006-046-B04GGCCGTCCGATCNONE 
006-047-D03GCCGTCCGNONE 
006-047-D03GGCCGTCCGATCNONE 
006-048-C10GCCGTCCGNONE 
006-048-C10GGCCGTCCGATCNONE 
006-048-D10GCCGTCCGNONE 
006-048-D10GGCCGTCCGATCNONE 
006-050-H01GCCGTCCGNONE 
006-050-H01GGCCGTCCGATCNONE 
006-051-D12GCCGTCCGNONE 
006-051-D12GGCCGTCCGATCNONE 
006-053-B05GCCGTCCGNONE 
006-053-B05GGCCGTCCGATCNONE 
006-054-B12GCCGTCCGNONE 
006-054-B12GGCCGTCCGATCNONE 
006-054-E05GCCGTCCGNONE 
006-054-E05GGCCGTCCGATCNONE 
006-054-H06GCCGTCCGNONE 
006-054-H06GGCCGTCCGATCNONE 
006-056-H02GCCGTCCGNONE 
006-056-H02GGCCGTCCGATCNONE 
006-059-A07GCCGTCCGNONE 
006-059-A07GGCCGTCCGATCNONE 
006-059-G02GCCGTCCGNONE 
006-059-G02GGCCGTCCGATCNONE 
006-059-G12GCCGTCCGNONE 
006-059-G12GGCCGTCCGATCNONE 
006-061-F01GCCGTCCGNONE 
006-061-F01GGCCGTCCGATCNONE 
006-061-H10GCCGTCCGNONE 
006-061-H10GGCCGTCCGATCNONE 
006-063-B02GCCGTCCGNONE 
006-063-B02GGCCGTCCGATCNONE 
006-064-H12GCCGTCCGNONE 
006-064-H12GGCCGTCCGATCNONE 
006-068-D06GCCGTCCGNONE 
006-068-D06GGCCGTCCGATCNONE 
006-071-H08GCCGTCCGNONE 
006-071-H08GGCCGTCCGATCNONE 
006-072-E10GCCGTCCGNONE 
006-072-E10GGCCGTCCGATCNONE 
006-074-C06GCCGTCCGNONE 
006-074-C06GGCCGTCCGATCNONE 
006-074-D12GCCGTCCGNONE 
006-074-D12GGCCGTCCGATCNONE 
006-076-H06GCCGTCCGNONE 
006-076-H06GGCCGTCCGATCNONE 
006-077-E04GCCGTCCGNONE 
006-077-E04GGCCGTCCGATCNONE 
006-081-H01GCCGTCCGNONE 
006-081-H01GGCCGTCCGATCNONE 
006-082-E11GCCGTCCGNONE 
006-082-E11GGCCGTCCGATCNONE 
006-083-G10GCCGTCCGNONE 
006-083-G10GGCCGTCCGATCNONE 
006-084-B05GCCGTCCGNONE 
006-084-B05GGCCGTCCGATCNONE 
006-085-C06GCCGTCCGNONE 
006-085-C06GGCCGTCCGATCNONE 
006-088-C04GCCGTCCGNONE 
006-088-C04GGCCGTCCGATCNONE 
006-088-F11GCCGTCCGNONE 
006-088-F11GGCCGTCCGATCNONE 
006-088-H11GCCGTCCGNONE 
006-088-H11GGCCGTCCGATCNONE 
006-090-F06GCCGTCCGNONE 
006-090-F06GGCCGTCCGATCNONE 
006-091-B01GCCGTCCGNONE 
006-091-B01GGCCGTCCGATCNONE 
006-091-C10GCCGTCCGNONE 
006-091-C10GGCCGTCCGATCNONE 
006-091-G11GCCGTCCGNONE 
006-091-G11GGCCGTCCGATCNONE 
006-092-A11GCCGTCCGNONE 
006-092-A11GGCCGTCCGATCNONE 
006-092-F10GCCGTCCGNONE 
006-092-F10GGCCGTCCGATCNONE 
006-093-D01GCCGTCCGNONE 
006-093-D01GGCCGTCCGATCNONE 
006-093-E11GCCGTCCGNONE 
006-093-E11GGCCGTCCGATCNONE 
006-095-F09GCCGTCCGNONE 
006-095-F09GGCCGTCCGATCNONE 
006-096-B05GCCGTCCGNONE 
006-096-B05GGCCGTCCGATCNONE 
006-096-B06GCCGTCCGNONE 
006-096-B06GGCCGTCCGATCNONE 
006-096-B11GCCGTCCGNONE 
006-096-B11GGCCGTCCGATCNONE 
006-099-E04GCCGTCCGNONE 
006-099-E04GGCCGTCCGATCNONE 
006-100-A01GCCGTCCGNONE 
006-100-A01GGCCGTCCGATCNONE 
006-100-E04GCCGTCCGNONE 
006-100-E04GGCCGTCCGATCNONE 
006-104-B09GCCGTCCGNONE 
006-104-B09GGCCGTCCGATCNONE 
006-106-A09GCCGTCCGNONE 
006-106-A09GGCCGTCCGATCNONE 
006-107-C07GCCGTCCGNONE 
006-107-C07GGCCGTCCGATCNONE 
006-107-H03GCCGTCCGNONE 
006-107-H03GGCCGTCCGATCNONE 
006-109-B12GCCGTCCGNONE 
006-109-B12GGCCGTCCGATCNONE 
006-109-F10GCCGTCCGNONE 
006-109-F10GGCCGTCCGATCNONE 
006-110-C10GCCGTCCGNONE 
006-110-C10GGCCGTCCGATCNONE 
006-110-E09GCCGTCCGNONE 
006-110-E09GGCCGTCCGATCNONE 
006-114-H07GCCGTCCGNONE 
006-114-H07GGCCGTCCGATCNONE 
006-115-A06GCCGTCCGNONE 
006-115-A06GGCCGTCCGATCNONE 
006-115-A12GCCGTCCGNONE 
006-115-A12GGCCGTCCGATCNONE 
006-115-C10GCCGTCCGNONE 
006-115-C10GGCCGTCCGATCNONE 
006-115-D10GCCGTCCGNONE 
006-115-D10GGCCGTCCGATCNONE 
006-116-D02GCCGTCCGNONE 
006-116-D02GGCCGTCCGATCNONE 
006-117-C11GCCGTCCGNONE 
006-117-C11GGCCGTCCGATCNONE 
006-119-H09GCCGTCCGNONE 
006-119-H09GGCCGTCCGATCNONE 
009-008-B04GCCGTCCGNONE 
009-008-B04GGCCGTCCGATCNONE 
009-021-A04GCCGTCCGNONE 
009-021-A04GGCCGTCCGATCNONE 
009-026-H09GCCGTCCGNONE 
009-026-H09GGCCGTCCGATCNONE 
009-027-D10GCCGTCCGNONE 
009-027-D10GGCCGTCCGATCNONE 
009-030-B11GCCGTCCGNONE 
009-030-B11GGCCGTCCGATCNONE 
009-040-E08GCCGTCCGNONE 
009-040-E08GGCCGTCCGATCNONE 
009-049-E10GCCGTCCGNONE 
009-049-E10GGCCGTCCGATCNONE 
009-058-C12GCCGTCCGNONE 
009-058-C12GGCCGTCCGATCNONE 
009-061-G01GCCGTCCGNONE 
009-061-G01GGCCGTCCGATCNONE 
009-079-G09GCCGTCCGNONE 
009-079-G09GGCCGTCCGATCNONE 
009-081-F08GCCGTCCGNONE 
009-081-F08GGCCGTCCGATCNONE 
009-096-F04GCCGTCCGNONE 
009-096-F04GGCCGTCCGATCNONE 
009-103-D05GCCGTCCGNONE 
009-103-D05GGCCGTCCGATCNONE 
009-119-F08GCCGTCCGNONE 
009-119-F08GGCCGTCCGATCNONE 
009-123-B02GCCGTCCGNONE 
009-123-B02GGCCGTCCGATCNONE 
009-128-H11GCCGTCCGNONE 
009-128-H11GGCCGTCCGATCNONE 
009-131-B06GCCGTCCGNONE 
009-131-B06GGCCGTCCGATCNONE 
009-142-H06GCCGTCCGNONE 
009-142-H06GGCCGTCCGATCNONE 
009-156-C01GCCGTCCGNONE 
009-156-C01GGCCGTCCGATCNONE 
009-165-D02GCCGTCCGNONE 
009-165-D02GGCCGTCCGATCNONE 
009-168-G10GCCGTCCGNONE 
009-168-G10GGCCGTCCGATCNONE 
009-175-F03GCCGTCCGNONE 
009-175-F03GGCCGTCCGATCNONE 
009-178-E06GCCGTCCGNONE 
009-178-E06GGCCGTCCGATCNONE 
009-179-G04GCCGTCCGNONE 
009-179-G04GGCCGTCCGATCNONE 
009-181-C10GCCGTCCGNONE 
009-181-C10GGCCGTCCGATCNONE 
009-182-D09GCCGTCCGNONE 
009-182-D09GGCCGTCCGATCNONE 
009-183-D07GCCGTCCGNONE 
009-183-D07GGCCGTCCGATCNONE 
AF094775GCCGTCCGNONE 
AF094775GGCCGTCCGATCNONE 
AK060222GCCGTCCGSimilar to LHC I type IV chlorophyll binding protein (Fragment). 
AK060222GGCCGTCCGATCSimilar to LHC I type IV chlorophyll binding protein (Fragment). 
AK067712GCCGTCCGNONE 
AK067712GGCCGTCCGATCNONE 
AK067809GCCGTCCGNONE 
AK067809GGCCGTCCGATCNONE 
AK103921GCCGTCCGNONE 
AK103921GGCCGTCCGATCNONE 
AK104416GCCGTCCGNONE 
AK104416GGCCGTCCGATCNONE 
AK104499GCCGTCCGNONE 
AK104499GGCCGTCCGATCNONE 
AY445626GCCGTCCGNONE 
AY445626GGCCGTCCGATCNONE 
J013120H04GCCGTCCGNONE 
J013120H04GGCCGTCCGATCNONE 
J013121A03GCCGTCCGNONE 
J013121A03GGCCGTCCGATCNONE 
J013127D22GCCGTCCGNONE 
J013127D22GGCCGTCCGATCNONE 
J023088A04GCCGTCCGNONE 
J023088A04GGCCGTCCGATCNONE 
J023132O20GCCGTCCGNONE 
J023132O20GGCCGTCCGATCNONE 
J053026I18GCCGTCCGNONE 
J053026I18GGCCGTCCGATCNONE 
J053032G14GCCGTCCGNONE 
J053032G14GGCCGTCCGATCNONE 
J053055E21GCCGTCCGNONE 
J053055E21GGCCGTCCGATCNONE 
J053070F24GCCGTCCGNONE 
J053070F24GGCCGTCCGATCNONE 
J065034E08GCCGTCCGNONE 
J065034E08GGCCGTCCGATCNONE 
J065085O17GCCGTCCGNONE 
J065085O17GGCCGTCCGATCNONE 
J065156H20GCCGTCCGNONE 
J065156H20GGCCGTCCGATCNONE 
J065171C21GCCGTCCGNONE 
J065171C21GGCCGTCCGATCNONE 
J065173A20GCCGTCCGNONE 
J065173A20GGCCGTCCGATCNONE 
J065173C02GCCGTCCGNONE 
J065173C02GGCCGTCCGATCNONE 
J065182N01GCCGTCCGNONE 
J065182N01GGCCGTCCGATCNONE 
J075001K11GCCGTCCGNONE 
J075001K11GGCCGTCCGATCNONE 
J075002K18GCCGTCCGNONE 
J075002K18GGCCGTCCGATCNONE 
J075005P06GCCGTCCGNONE 
J075005P06GGCCGTCCGATCNONE 
J075006P21GCCGTCCGNONE 
J075006P21GGCCGTCCGATCNONE 
J075008G02GCCGTCCGNONE 
J075008G02GGCCGTCCGATCNONE 
J075009D08GCCGTCCGNONE 
J075009D08GGCCGTCCGATCNONE 
J075013D09GCCGTCCGNONE 
J075013D09GGCCGTCCGATCNONE 
J075013D15GCCGTCCGNONE 
J075013D15GGCCGTCCGATCNONE 
J075016F05GCCGTCCGNONE 
J075016F05GGCCGTCCGATCNONE 
J075016F18GCCGTCCGNONE 
J075016F18GGCCGTCCGATCNONE 
J075016K07GCCGTCCGNONE 
J075016K07GGCCGTCCGATCNONE 
J075016M08GCCGTCCGNONE 
J075016M08GGCCGTCCGATCNONE 
J075021G21GCCGTCCGNONE 
J075021G21GGCCGTCCGATCNONE 
J075025G06GCCGTCCGNONE 
J075025G06GGCCGTCCGATCNONE 
J075029M11GCCGTCCGNONE 
J075029M11GGCCGTCCGATCNONE 
J075035E01GCCGTCCGNONE 
J075035E01GGCCGTCCGATCNONE 
J075038M21GCCGTCCGNONE 
J075038M21GGCCGTCCGATCNONE 
J075039G20GCCGTCCGNONE 
J075039G20GGCCGTCCGATCNONE 
J075040K18GCCGTCCGNONE 
J075040K18GGCCGTCCGATCNONE 
J075041G13GCCGTCCGNONE 
J075041G13GGCCGTCCGATCNONE 
J075042O03GCCGTCCGNONE 
J075042O03GGCCGTCCGATCNONE 
J075047C01GCCGTCCGNONE 
J075047C01GGCCGTCCGATCNONE 
J075047M08GCCGTCCGNONE 
J075047M08GGCCGTCCGATCNONE 
J075052L02GCCGTCCGNONE 
J075052L02GGCCGTCCGATCNONE 
J075055E24GCCGTCCGNONE 
J075055E24GGCCGTCCGATCNONE 
J075056F22GCCGTCCGNONE 
J075056F22GGCCGTCCGATCNONE 
J075068B12GCCGTCCGNONE 
J075068B12GGCCGTCCGATCNONE 
J075068D01GCCGTCCGNONE 
J075068D01GGCCGTCCGATCNONE 
J075069H19GCCGTCCGNONE 
J075069H19GGCCGTCCGATCNONE 
J075071J21GCCGTCCGNONE 
J075071J21GGCCGTCCGATCNONE 
J075072O06GCCGTCCGNONE 
J075072O06GGCCGTCCGATCNONE 
J075075J05GCCGTCCGNONE 
J075075J05GGCCGTCCGATCNONE 
J075079E21GCCGTCCGNONE 
J075079E21GGCCGTCCGATCNONE 
J075079H05GCCGTCCGNONE 
J075079H05GGCCGTCCGATCNONE 
J075081L10GCCGTCCGNONE 
J075081L10GGCCGTCCGATCNONE 
J075087D17GCCGTCCGNONE 
J075087D17GGCCGTCCGATCNONE 
J075088B07GCCGTCCGNONE 
J075088B07GGCCGTCCGATCNONE 
J075088D22GCCGTCCGNONE 
J075088D22GGCCGTCCGATCNONE 
J075090E03GCCGTCCGNONE 
J075090E03GGCCGTCCGATCNONE 
J075095L09GCCGTCCGNONE 
J075095L09GGCCGTCCGATCNONE 
J075098G08GCCGTCCGNONE 
J075098G08GGCCGTCCGATCNONE 
J075099M10GCCGTCCGNONE 
J075099M10GGCCGTCCGATCNONE 
J075101D01GCCGTCCGNONE 
J075101D01GGCCGTCCGATCNONE 
J075102H24GCCGTCCGNONE 
J075102H24GGCCGTCCGATCNONE 
J075103A05GCCGTCCGNONE 
J075103A05GGCCGTCCGATCNONE 
J075106A15GCCGTCCGNONE 
J075106A15GGCCGTCCGATCNONE 
J075106L10GCCGTCCGNONE 
J075106L10GGCCGTCCGATCNONE 
J075108H11GCCGTCCGNONE 
J075108H11GGCCGTCCGATCNONE 
J075110D12GCCGTCCGNONE 
J075110D12GGCCGTCCGATCNONE 
J075114A06GCCGTCCGNONE 
J075114A06GGCCGTCCGATCNONE 
J075116G16GCCGTCCGNONE 
J075116G16GGCCGTCCGATCNONE 
J075118B13GCCGTCCGNONE 
J075118B13GGCCGTCCGATCNONE 
J075119C20GCCGTCCGNONE 
J075119C20GGCCGTCCGATCNONE 
J075122F24GCCGTCCGNONE 
J075122F24GGCCGTCCGATCNONE 
J075129D14GCCGTCCGNONE 
J075129D14GGCCGTCCGATCNONE 
J075132L06GCCGTCCGNONE 
J075132L06GGCCGTCCGATCNONE 
J075133E22GCCGTCCGNONE 
J075133E22GGCCGTCCGATCNONE 
J075140L09GCCGTCCGNONE 
J075140L09GGCCGTCCGATCNONE 
J075140L24GCCGTCCGNONE 
J075140L24GGCCGTCCGATCNONE 
J075146J17GCCGTCCGNONE 
J075146J17GGCCGTCCGATCNONE 
J075148A09GCCGTCCGNONE 
J075148A09GGCCGTCCGATCNONE 
J075152D01GCCGTCCGNONE 
J075152D01GGCCGTCCGATCNONE 
J075153L22GCCGTCCGNONE 
J075153L22GGCCGTCCGATCNONE 
J075156B08GCCGTCCGNONE 
J075156B08GGCCGTCCGATCNONE 
J075158D24GCCGTCCGNONE 
J075158D24GGCCGTCCGATCNONE 
J075158H14GCCGTCCGNONE 
J075158H14GGCCGTCCGATCNONE 
J075167M07GCCGTCCGNONE 
J075167M07GGCCGTCCGATCNONE 
J075172F21GCCGTCCGNONE 
J075172F21GGCCGTCCGATCNONE 
J075175J15GCCGTCCGNONE 
J075175J15GGCCGTCCGATCNONE 
J075183C13GCCGTCCGNONE 
J075183C13GGCCGTCCGATCNONE 
J075190A08GCCGTCCGNONE 
J075190A08GGCCGTCCGATCNONE 
J075190E08GCCGTCCGNONE 
J075190E08GGCCGTCCGATCNONE 
J075190H21GCCGTCCGNONE 
J075190H21GGCCGTCCGATCNONE 
J075194C13GCCGTCCGNONE 
J075194C13GGCCGTCCGATCNONE 
J075195E18GCCGTCCGNONE 
J075195E18GGCCGTCCGATCNONE 
J075197H09GCCGTCCGNONE 
J075197H09GGCCGTCCGATCNONE 
J075199J01GCCGTCCGNONE 
J075199J01GGCCGTCCGATCNONE 
J080310L13GCCGTCCGNONE 
J080310L13GGCCGTCCGATCNONE 
J080311F02GCCGTCCGNONE 
J080311F02GGCCGTCCGATCNONE 
J080311H17GCCGTCCGNONE 
J080311H17GGCCGTCCGATCNONE 
J080315M04GCCGTCCGNONE 
J080315M04GGCCGTCCGATCNONE 
J080316A09GCCGTCCGNONE 
J080316A09GGCCGTCCGATCNONE 
J080319D20GCCGTCCGNONE 
J080319D20GGCCGTCCGATCNONE 
J080319L04GCCGTCCGNONE 
J080319L04GGCCGTCCGATCNONE 
J090002C14GCCGTCCGNONE 
J090002C14GGCCGTCCGATCNONE 
J090031P04GCCGTCCGNONE 
J090031P04GGCCGTCCGATCNONE 
J090050E09GCCGTCCGNONE 
J090050E09GGCCGTCCGATCNONE 
J100048H01GCCGTCCGNONE 
J100048H01GGCCGTCCGATCNONE 
J100089C18GCCGTCCGNONE 
J100089C18GGCCGTCCGATCNONE 
Os08g0481500J065054C23CGGACGGCConserved hypothetical protein. 
J065218E06CGGACGGCNONE 
Os08g0485700AK068131ATCGGACGGCNONE 
AK069097ATCGGACGGCMethyl-CpG binding domain containing protein. 
J013130L03ATCGGACGGCNONE 
Os08g0503800AK101954AGCCGTCCGATCTGGTGGGCCCACACSimilar to Beta-(1,2)-xylosyltransferase (EC 2.4.2.38). 
Os09g0281900AK121112CGGATCGGACGGCTThyroid hormone receptor-associated protein complex component TRAP170- like protein. 
J023073I01CGGATCGGACGGCTNONE 
Os09g0325300011-005-H08CCGAGCCGTCCGATNONE 
AK068435CCGAGCCGTCCGATConserved hypothetical protein. 
AK073998CCGAGCCGTCCGATNONE 
J033071H21CCGAGCCGTCCGATNONE 
J065214H05CCGAGCCGTCCGATNONE 
Os09g0382400009-125-E12GATCGGACGGCTCGGNONE 
AK062891GATCGGACGGCTCGGConserved hypothetical protein. 
J065069H20GATCGGACGGCTCGGNONE 
J065137I22GATCGGACGGCTCGGNONE 
J065218O10GATCGGACGGCTCGGNONE 
Os09g0386500014-051-B12ATCGGACGGCNONE 
014-051-B12GCCGTCCGNONE 
016-068-G02ATCGGACGGCNONE 
016-068-G02GCCGTCCGNONE 
AK064072ATCGGACGGCBromo adjacent region domain containing protein. 
AK064072GCCGTCCGBromo adjacent region domain containing protein. 
AK099307ATCGGACGGCNONE 
AK099307GCCGTCCGNONE 
J023141K03ATCGGACGGCNONE 
J023141K03GCCGTCCGNONE 
J065166A18ATCGGACGGCNONE 
J065166A18GCCGTCCGNONE 
J080304I17ATCGGACGGCNONE 
J080304I17GCCGTCCGNONE 
J080309J05ATCGGACGGCNONE 
J080309J05GCCGTCCGNONE 
J080310J18ATCGGACGGCNONE 
J080310J18GCCGTCCGNONE 
J080313A02ATCGGACGGCNONE 
J080313A02GCCGTCCGNONE 
J080315M03ATCGGACGGCNONE 
J080315M03GCCGTCCGNONE 
J080316O03ATCGGACGGCNONE 
J080316O03GCCGTCCGNONE 
J080319C13ATCGGACGGCNONE 
J080319C13GCCGTCCGNONE 
J090009O16ATCGGACGGCNONE 
J090009O16GCCGTCCGNONE 
J090048C05ATCGGACGGCNONE 
J090048C05GCCGTCCGNONE 
J100081G18ATCGGACGGCNONE 
J100081G18GCCGTCCGNONE 
Os09g0416400J075067A16TCGGACGGCGGAGAGGTGGGCCCGGAConserved hypothetical protein. 
J075104N21TCGGACGGCGGAGAGGTGGGCCCGGANONE 
J075106F04TCGGACGGCGGAGAGGTGGGCCCGGANONE 
J075131F08TCGGACGGCGGAGAGGTGGGCCCGGANONE 
Os09g0462700AK060597ATCGGACGGCTNONE 
AK067260ATCGGACGGCTSimilar to RNA Binding Protein 47. 
Os09g0467700AK061600GGGCCGTCCGATCConserved hypothetical protein. 
Os09g0567900006-026-B10GATCGGACGGCNONE 
AK061415GATCGGACGGCInosine/uridine-preferring nucleoside hydrolase domain containing protein. 
J075028A10GATCGGACGGCNONE 
J075065B13GATCGGACGGCNONE 
Os09g0570400AK065287GATCGGACGGCTMajor facilitator superfamily protein. 
J013002M15GATCGGACGGCTNONE 
J013030F15GATCGGACGGCTNONE 
J013055E11GATCGGACGGCTNONE 
J013071P13GATCGGACGGCTNONE 
J013072E15GATCGGACGGCTNONE 
J013072G14GATCGGACGGCTNONE 
J013075F17GATCGGACGGCTNONE 
J013089I20GATCGGACGGCTNONE 
J013092E05GATCGGACGGCTNONE 
J013121F02GATCGGACGGCTNONE 
J013122D22GATCGGACGGCTNONE 
J013156E24GATCGGACGGCTNONE 
J023042O15GATCGGACGGCTNONE 
J023104D22GATCGGACGGCTNONE 
J033065I08GATCGGACGGCTNONE 
J033131C03GATCGGACGGCTNONE 
J090064E11GATCGGACGGCTNONE 
J100063G18GATCGGACGGCTNONE 
Os11g0237700J100060P16CGGACGGCConserved hypothetical protein. 
J100065I12CGGACGGCNONE 
Os11g0267400AK069552AGCCGTCCGATCSimilar to ClpC. 
AK100126AGCCGTCCGATCNONE 
Os11g0461300006-094-F10CGGACGGCNONE 
006-094-F10CGGACGGCNONE 
AK061200CGGACGGCUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
AK061200CGGACGGCUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
Os11g0530600AB000801GCCGTCCGSimilar to Chalcone synthase C2 (EC 2.3.1.74) (Naringenin-chalcone synthase C2). 
AK067810GCCGTCCGNONE 
D29697GCCGTCCGNONE 
J013119K06GCCGTCCGNONE 
J023001C21GCCGTCCGNONE 
J023081C19GCCGTCCGNONE 
J065026K21GCCGTCCGNONE 
J065040A17GCCGTCCGNONE 
J065043H01GCCGTCCGNONE 
J065093P05GCCGTCCGNONE 
J065104P15GCCGTCCGNONE 
J065127C09GCCGTCCGNONE 
J065140D08GCCGTCCGNONE 
X89859GCCGTCCGNONE 
Os11g0537400003-126-A11AGCCGTCCGATCNONE 
Os11g0600700016-011-B06GCCGTCCGATCNONE 
AK061258GCCGTCCGATCNONE 
AK071098GCCGTCCGATCSimilar to RING domain protein. 
J023081C09GCCGTCCGATCNONE 
J065027B11GCCGTCCGATCNONE 
J075024M24GCCGTCCGATCNONE 
J100023I11GCCGTCCGATCNONE 
J100069G17GCCGTCCGATCNONE 
Os11g0620400AK068224ATCGGACGGCCCACGTNONE 
AK120270ATCGGACGGCCCACGTConserved hypothetical protein. 
Os11g0660500009-031-D10AGCCGTCCGNONE 
009-031-D10GATCGGACGGCNONE 
009-031-D10GATCGGACGGCCNONE 
009-100-G09AGCCGTCCGNONE 
009-100-G09GATCGGACGGCNONE 
009-100-G09GATCGGACGGCCNONE 
009-162-G10AGCCGTCCGNONE 
009-162-G10GATCGGACGGCNONE 
009-162-G10GATCGGACGGCCNONE 
009-183-H11AGCCGTCCGNONE 
009-183-H11GATCGGACGGCNONE 
009-183-H11GATCGGACGGCCNONE 
013-010-B11AGCCGTCCGNONE 
013-010-B11GATCGGACGGCNONE 
013-010-B11GATCGGACGGCCNONE 
013-050-A05AGCCGTCCGNONE 
013-050-A05GATCGGACGGCNONE 
013-050-A05GATCGGACGGCCNONE 
013-070-E10AGCCGTCCGNONE 
013-070-E10GATCGGACGGCNONE 
013-070-E10GATCGGACGGCCNONE 
AK105453AGCCGTCCGSimilar to Translationally controlled tumor protein (Fragment). 
AK105453GATCGGACGGCSimilar to Translationally controlled tumor protein (Fragment). 
AK105453GATCGGACGGCCSimilar to Translationally controlled tumor protein (Fragment). 
D12626AGCCGTCCGNONE 
D12626GATCGGACGGCNONE 
D12626GATCGGACGGCCNONE 
J013128M15AGCCGTCCGNONE 
J013128M15GATCGGACGGCNONE 
J013128M15GATCGGACGGCCNONE 
J023004I19AGCCGTCCGNONE 
J023004I19GATCGGACGGCNONE 
J023004I19GATCGGACGGCCNONE 
J033114F08AGCCGTCCGNONE 
J033114F08GATCGGACGGCNONE 
J033114F08GATCGGACGGCCNONE 
J033147I20AGCCGTCCGNONE 
J033147I20GATCGGACGGCNONE 
J033147I20GATCGGACGGCCNONE 
J065031M04AGCCGTCCGNONE 
J065031M04GATCGGACGGCNONE 
J065031M04GATCGGACGGCCNONE 
J065033J03AGCCGTCCGNONE 
J065033J03GATCGGACGGCNONE 
J065033J03GATCGGACGGCCNONE 
J065038E01AGCCGTCCGNONE 
J065038E01GATCGGACGGCNONE 
J065038E01GATCGGACGGCCNONE 
J065048O06AGCCGTCCGNONE 
J065048O06GATCGGACGGCNONE 
J065048O06GATCGGACGGCCNONE 
J065054E01AGCCGTCCGNONE 
J065054E01GATCGGACGGCNONE 
J065054E01GATCGGACGGCCNONE 
J065075N08AGCCGTCCGNONE 
J065075N08GATCGGACGGCNONE 
J065075N08GATCGGACGGCCNONE 
J065080C07AGCCGTCCGNONE 
J065080C07GATCGGACGGCNONE 
J065080C07GATCGGACGGCCNONE 
J065096A12AGCCGTCCGNONE 
J065096A12GATCGGACGGCNONE 
J065096A12GATCGGACGGCCNONE 
J065115P22AGCCGTCCGNONE 
J065115P22GATCGGACGGCNONE 
J065115P22GATCGGACGGCCNONE 
J065122I21AGCCGTCCGNONE 
J065122I21GATCGGACGGCNONE 
J065122I21GATCGGACGGCCNONE 
J065127A13AGCCGTCCGNONE 
J065127A13GATCGGACGGCNONE 
J065127A13GATCGGACGGCCNONE 
J065158B06AGCCGTCCGNONE 
J065158B06GATCGGACGGCNONE 
J065158B06GATCGGACGGCCNONE 
J065162E04AGCCGTCCGNONE 
J065162E04GATCGGACGGCNONE 
J065162E04GATCGGACGGCCNONE 
J065162E05AGCCGTCCGNONE 
J065162E05GATCGGACGGCNONE 
J065162E05GATCGGACGGCCNONE 
J065163L06AGCCGTCCGNONE 
J065163L06GATCGGACGGCNONE 
J065163L06GATCGGACGGCCNONE 
J065177B16AGCCGTCCGNONE 
J065177B16GATCGGACGGCNONE 
J065177B16GATCGGACGGCCNONE 
J065181M15AGCCGTCCGNONE 
J065181M15GATCGGACGGCNONE 
J065181M15GATCGGACGGCCNONE 
J065201G15AGCCGTCCGNONE 
J065201G15GATCGGACGGCNONE 
J065201G15GATCGGACGGCCNONE 
J065202J06AGCCGTCCGNONE 
J065202J06GATCGGACGGCNONE 
J065202J06GATCGGACGGCCNONE 
J075002B19AGCCGTCCGNONE 
J075002B19GATCGGACGGCNONE 
J075002B19GATCGGACGGCCNONE 
J075008G19AGCCGTCCGNONE 
J075008G19GATCGGACGGCNONE 
J075008G19GATCGGACGGCCNONE 
J075010P05AGCCGTCCGNONE 
J075010P05GATCGGACGGCNONE 
J075010P05GATCGGACGGCCNONE 
J075018H23AGCCGTCCGNONE 
J075018H23GATCGGACGGCNONE 
J075018H23GATCGGACGGCCNONE 
J075051E18AGCCGTCCGNONE 
J075051E18GATCGGACGGCNONE 
J075051E18GATCGGACGGCCNONE 
J075053C24AGCCGTCCGNONE 
J075053C24GATCGGACGGCNONE 
J075053C24GATCGGACGGCCNONE 
J075077B06AGCCGTCCGNONE 
J075077B06GATCGGACGGCNONE 
J075077B06GATCGGACGGCCNONE 
J075080B11AGCCGTCCGNONE 
J075080B11GATCGGACGGCNONE 
J075080B11GATCGGACGGCCNONE 
J075083M04AGCCGTCCGNONE 
J075083M04GATCGGACGGCNONE 
J075083M04GATCGGACGGCCNONE 
J075085H01AGCCGTCCGNONE 
J075085H01GATCGGACGGCNONE 
J075085H01GATCGGACGGCCNONE 
J075109E11AGCCGTCCGNONE 
J075109E11GATCGGACGGCNONE 
J075109E11GATCGGACGGCCNONE 
J075111O09AGCCGTCCGNONE 
J075111O09GATCGGACGGCNONE 
J075111O09GATCGGACGGCCNONE 
J075130D13AGCCGTCCGNONE 
J075130D13GATCGGACGGCNONE 
J075130D13GATCGGACGGCCNONE 
J075132H13AGCCGTCCGNONE 
J075132H13GATCGGACGGCNONE 
J075132H13GATCGGACGGCCNONE 
J075147H19AGCCGTCCGNONE 
J075147H19GATCGGACGGCNONE 
J075147H19GATCGGACGGCCNONE 
J075148J01AGCCGTCCGNONE 
J075148J01GATCGGACGGCNONE 
J075148J01GATCGGACGGCCNONE 
J075159A18AGCCGTCCGNONE 
J075159A18GATCGGACGGCNONE 
J075159A18GATCGGACGGCCNONE 
J075166F03AGCCGTCCGNONE 
J075166F03GATCGGACGGCNONE 
J075166F03GATCGGACGGCCNONE 
J075191F09AGCCGTCCGNONE 
J075191F09GATCGGACGGCNONE 
J075191F09GATCGGACGGCCNONE 
J075192K09AGCCGTCCGNONE 
J075192K09GATCGGACGGCNONE 
J075192K09GATCGGACGGCCNONE 
J080006P15AGCCGTCCGNONE 
J080006P15GATCGGACGGCNONE 
J080006P15GATCGGACGGCCNONE 
J080013J18AGCCGTCCGNONE 
J080013J18GATCGGACGGCNONE 
J080013J18GATCGGACGGCCNONE 
J080023O06AGCCGTCCGNONE 
J080023O06GATCGGACGGCNONE 
J080023O06GATCGGACGGCCNONE 
J080024I17AGCCGTCCGNONE 
J080024I17GATCGGACGGCNONE 
J080024I17GATCGGACGGCCNONE 
J080029P03AGCCGTCCGNONE 
J080029P03GATCGGACGGCNONE 
J080029P03GATCGGACGGCCNONE 
J080030C14AGCCGTCCGNONE 
J080030C14GATCGGACGGCNONE 
J080030C14GATCGGACGGCCNONE 
J080038K15AGCCGTCCGNONE 
J080038K15GATCGGACGGCNONE 
J080038K15GATCGGACGGCCNONE 
J080042I15AGCCGTCCGNONE 
J080042I15GATCGGACGGCNONE 
J080042I15GATCGGACGGCCNONE 
J080053L07AGCCGTCCGNONE 
J080053L07GATCGGACGGCNONE 
J080053L07GATCGGACGGCCNONE 
J080061H12AGCCGTCCGNONE 
J080061H12GATCGGACGGCNONE 
J080061H12GATCGGACGGCCNONE 
J080064H24AGCCGTCCGNONE 
J080064H24GATCGGACGGCNONE 
J080064H24GATCGGACGGCCNONE 
J080066J20AGCCGTCCGNONE 
J080066J20GATCGGACGGCNONE 
J080066J20GATCGGACGGCCNONE 
J080074N07AGCCGTCCGNONE 
J080074N07GATCGGACGGCNONE 
J080074N07GATCGGACGGCCNONE 
J080079F16AGCCGTCCGNONE 
J080079F16GATCGGACGGCNONE 
J080079F16GATCGGACGGCCNONE 
J080079O07AGCCGTCCGNONE 
J080079O07GATCGGACGGCNONE 
J080079O07GATCGGACGGCCNONE 
J080092E15AGCCGTCCGNONE 
J080092E15GATCGGACGGCNONE 
J080092E15GATCGGACGGCCNONE 
J080301F19AGCCGTCCGNONE 
J080301F19GATCGGACGGCNONE 
J080301F19GATCGGACGGCCNONE 
J080302O21AGCCGTCCGNONE 
J080302O21GATCGGACGGCNONE 
J080302O21GATCGGACGGCCNONE 
J080306L02AGCCGTCCGNONE 
J080306L02GATCGGACGGCNONE 
J080306L02GATCGGACGGCCNONE 
J080307F16AGCCGTCCGNONE 
J080307F16GATCGGACGGCNONE 
J080307F16GATCGGACGGCCNONE 
J080307G01AGCCGTCCGNONE 
J080307G01GATCGGACGGCNONE 
J080307G01GATCGGACGGCCNONE 
J080307K01AGCCGTCCGNONE 
J080307K01GATCGGACGGCNONE 
J080307K01GATCGGACGGCCNONE 
J080309O22AGCCGTCCGNONE 
J080309O22GATCGGACGGCNONE 
J080309O22GATCGGACGGCCNONE 
J080311E17AGCCGTCCGNONE 
J080311E17GATCGGACGGCNONE 
J080311E17GATCGGACGGCCNONE 
J080311N08AGCCGTCCGNONE 
J080311N08GATCGGACGGCNONE 
J080311N08GATCGGACGGCCNONE 
J080312O12AGCCGTCCGNONE 
J080312O12GATCGGACGGCNONE 
J080312O12GATCGGACGGCCNONE 
J080315C08AGCCGTCCGNONE 
J080315C08GATCGGACGGCNONE 
J080315C08GATCGGACGGCCNONE 
J080316D07AGCCGTCCGNONE 
J080316D07GATCGGACGGCNONE 
J080316D07GATCGGACGGCCNONE 
J080318C17AGCCGTCCGNONE 
J080318C17GATCGGACGGCNONE 
J080318C17GATCGGACGGCCNONE 
J090004B08AGCCGTCCGNONE 
J090004B08GATCGGACGGCNONE 
J090004B08GATCGGACGGCCNONE 
J090009K02AGCCGTCCGNONE 
J090009K02GATCGGACGGCNONE 
J090009K02GATCGGACGGCCNONE 
J090025O15AGCCGTCCGNONE 
J090025O15GATCGGACGGCNONE 
J090025O15GATCGGACGGCCNONE 
J090026L03AGCCGTCCGNONE 
J090026L03GATCGGACGGCNONE 
J090026L03GATCGGACGGCCNONE 
J090036P17AGCCGTCCGNONE 
J090036P17GATCGGACGGCNONE 
J090036P17GATCGGACGGCCNONE 
J090047A21AGCCGTCCGNONE 
J090047A21GATCGGACGGCNONE 
J090047A21GATCGGACGGCCNONE 
J090053O03AGCCGTCCGNONE 
J090053O03GATCGGACGGCNONE 
J090053O03GATCGGACGGCCNONE 
J090059C04AGCCGTCCGNONE 
J090059C04GATCGGACGGCNONE 
J090059C04GATCGGACGGCCNONE 
J090062O21AGCCGTCCGNONE 
J090062O21GATCGGACGGCNONE 
J090062O21GATCGGACGGCCNONE 
J090064M11AGCCGTCCGNONE 
J090064M11GATCGGACGGCNONE 
J090064M11GATCGGACGGCCNONE 
J090070C14AGCCGTCCGNONE 
J090070C14GATCGGACGGCNONE 
J090070C14GATCGGACGGCCNONE 
J090075I03AGCCGTCCGNONE 
J090075I03GATCGGACGGCNONE 
J090075I03GATCGGACGGCCNONE 
J090081G22AGCCGTCCGNONE 
J090081G22GATCGGACGGCNONE 
J090081G22GATCGGACGGCCNONE 
J090083E18AGCCGTCCGNONE 
J090083E18GATCGGACGGCNONE 
J090083E18GATCGGACGGCCNONE 
J090084A05AGCCGTCCGNONE 
J090084A05GATCGGACGGCNONE 
J090084A05GATCGGACGGCCNONE 
J100019L11AGCCGTCCGNONE 
J100019L11GATCGGACGGCNONE 
J100019L11GATCGGACGGCCNONE 
J100022D16AGCCGTCCGNONE 
J100022D16GATCGGACGGCNONE 
J100022D16GATCGGACGGCCNONE 
J100042F09AGCCGTCCGNONE 
J100042F09GATCGGACGGCNONE 
J100042F09GATCGGACGGCCNONE 
J100051J12AGCCGTCCGNONE 
J100051J12GATCGGACGGCNONE 
J100051J12GATCGGACGGCCNONE 
J100065G21AGCCGTCCGNONE 
J100065G21GATCGGACGGCNONE 
J100065G21GATCGGACGGCCNONE 
J100066D08AGCCGTCCGNONE 
J100066D08GATCGGACGGCNONE 
J100066D08GATCGGACGGCCNONE 
J100069H04AGCCGTCCGNONE 
J100069H04GATCGGACGGCNONE 
J100069H04GATCGGACGGCCNONE 
J100078I16AGCCGTCCGNONE 
J100078I16GATCGGACGGCNONE 
J100078I16GATCGGACGGCCNONE 
J100090D15AGCCGTCCGNONE 
J100090D15GATCGGACGGCNONE 
J100090D15GATCGGACGGCCNONE 
Os12g0106700AK106509CGGACGGCSimilar to OsPK4. 
Os12g0146500AK107470GCCGTCCGProtein of unknown function DUF668 family protein. 
Os12g0502100Os12g0502100AGCCGTCCGATCConserved hypothetical protein. 
Os12g0562100AK064831GATCGGACGGCCConserved hypothetical protein. 
AK065844GATCGGACGGCCNONE 
J013000F11GATCGGACGGCCNONE 
Os12g0605300AK108664GCCGTCCGATCTesmin/TSO1-like, CXC domain containing protein. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.