
Summary of OsREG563 (All List)

OrganismOryza sativa  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count4212  

Entry Sequences (4212 entries)

LocusGene modelSequenceDescription
Os01g0101600AK099952TACGGCCCAACARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
AK103808TGTTGGGCCGAC-type lectin domain containing protein. 
Os01g0104100AK072797TCGGCCCAACAZinc finger, RING-type domain containing protein. 
Os01g0134200AK102394AATTGGGCCGGCConserved hypothetical protein. 
AK121921ATTTGGGCCGGAIWS1, C-terminal family protein. 
Os01g0164500AK068747CACGGCCCAATSimilar to ATP-dependent RNA helicase-like protein. 
AK068405GGTTGGGCCGGAALG3 family protein. 
J075153K16GAGGCCCATTGGGCCGAAAConserved hypothetical protein. 
J075153K16TGCGGCCCAATTAGGGCCCAACTConserved hypothetical protein. 
AK109524TTTTGGGCCGTTPlant lipid transfer protein/Par allergen family protein. 
AK073330TCGGCCCAAGConserved hypothetical protein. 
AK073330TCTCGGCCCAACAConserved hypothetical protein. 
AK101946GTTTGGGCCGACCGTTGZinc finger, BED-type predicted domain containing protein. 
AK107453GCCGGCCCAAGTAGGCCCAGCSimilar to 60S acidic ribosomal protein P2-B (CaRP2B). 
Os01g0232700AK069972AAGGCCCAACGGCCCAAGCCCAAAASimilar to Histidinol dehydrogenase, chloroplast precursor (EC (HDH). Splice isoform 2. 
AK119511TCCGGCCCAAGSimilar to Cysteine protease inhibitor. 
AK100107TTTGGGCCGAMajor facilitator superfamily protein. 
Os01g0299400AK107814GGTTGGGCCAATTTTGGGCCGTASterile alpha motif homology domain containing protein. 
AK107814TGCGGCCCAAAASterile alpha motif homology domain containing protein. 
Os01g0301100AK105556AATTGGGCCGAConserved hypothetical protein. 
AK060078TGCGGCCCAAAUniversal stress protein (Usp) family protein. 
Os01g0306100AK111041TTTCGGCCCAATPlant specific eukaryotic initiation factor 4B family protein. 
AK063921GCGGCCCAATSimilar to Adenosine monophosphate binding protein 1 AMPBP1. 
AK072081TTCGGCCCAACTTetratricopeptide-like helical domain containing protein. 
AK061826AGTTGGGCCGAASimilar to 40S ribosomal protein S4. 
Os01g0530300AK111105AAGGCCCAATTGGGCCGAHypothetical protein. 
J075006K21CTCGGCCCAAAARNA polymerase Rbp10 domain containing protein. 
AK071219CCCAGCCCGGCCCAACCConserved hypothetical protein. 
Os01g0558500AK099982GCGGCCCAATPWWP domain containing protein. 
AK063416GTTGGGCCGGGGCCCATTAConserved hypothetical protein. 
Os01g0593700Os01g0593700AAACGGCCCAATSulphate anion transporter family protein. 
AK063911ATTTGGGCCGCAProtein prenyltransferase domain containing protein. 
Os01g0621700AK108938GACGGCCCAACCMyosin tail 2 domain containing protein. 
Os01g0640800AK065688CTTGGGCCGCAConserved hypothetical protein 48 family protein. 
AK063836TCGGCCCAAASingle-strand binding protein/Primosomal replication protein n family protein. 
Os01g0649000AK073564TCGGCCCAACGGCCWD40-like domain containing protein. 
Os01g0666500AK102689CTTGGGCCGCAConserved hypothetical protein. 
Os01g0680400AK067914CCCGGCCCAAAATAFII28-like protein family protein. 
AK121587GGACGGCCCAAATGuanine nucleotide-binding protein beta subunit-like protein (GPB-LR) (RWD). 
Os01g0706100AK072799CTTGGGCCGGTConserved hypothetical protein. 
Os01g0708700AK102451CAACGGCCCAAGIQ calmodulin-binding region domain containing protein. 
Os01g0733200AK066316GCGGCCCAAGCCCSimilar to Heat shock transcription factor 29 (Fragment). 
Os01g0738600AK073479GCGGCCCAAGENTH/VHS domain containing protein. 
Os01g0761100AK122112GCGGCCCAACATesmin/TSO1-like, CXC domain containing protein. 
Os01g0764600AK060621GTTTGGGCCGAGAFosfomycin resistance kinase FomA family protein. 
Os01g0765000AK101905TTTTGGGCCGASimilar to Deoxycytidylate deaminase (EC (dCMP deaminase). 
Os01g0772200AK060471GCGGCCCAAGTranscription initiation factor IIF, beta subunit family protein. 
AK062417TCCGGCCCAAATConserved hypothetical protein. 
Os01g0801700AK073813TTCGGCCCAAGGCCCConserved hypothetical protein. 
AK103408GCCGGCCCAAGRNA polymerase Rpb5, N-terminal domain containing protein. 
AK119168TACGGCCCAATTEndothelial monocyte-activating polypeptide II precursor pro-EMAP II family protein. 
AK073775TTATGGGCCGTTGTTTGGGCTTTGGGCCGGAClathrin adaptor complex, small chain family protein. 
Os01g0854800AK109676CTTGGGCCGASimilar to Cytochrome P450 86A1 (EC 1.14.-.-) (CYPLXXXVI) (P450-dependent fatty acid omega-hydroxylase). 
J065124H21CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGConserved hypothetical protein. 
AK100381CTCGGCCCAAAAPutative 5-3 exonuclease domain containing protein. 
Os01g0881100AK109822GCGGCCCAAACGGCCEpsin, N-terminal domain containing protein. 
Os01g0888700AK073376ACTGGGCCGGCCCAATProtein of unknown function RIO1 family protein. 
Os01g0888800AK070163TACGGCCCAAAAConserved hypothetical protein. 
Os01g0891400J065077E24TTTTGGGCCGAAConserved hypothetical protein. 
AK067623GCGGCCCAAACConserved hypothetical protein. 
Os01g0908800AK065889ATTTGGGCCGAProtein prenyltransferase domain containing protein. 
016-088-H02ATTGGGCCGGGCCGAProtein prenyltransferase domain containing protein. 
Os01g0915800AK103859TACGGCCCAATASimilar to FK506-binding protein 2-2 precursor (EC (Peptidyl-prolyl cis- trans isomerase) (PPIase) (Rotamase) (15 kDa FKBP) (FKBP-15-2). 
AK103859TTTTGGGCCGGGCCCAAACSimilar to FK506-binding protein 2-2 precursor (EC (Peptidyl-prolyl cis- trans isomerase) (PPIase) (Rotamase) (15 kDa FKBP) (FKBP-15-2). 
Os01g0920200AK120182AAACGGCCCAAAASimilar to E(Y)2 homolog (DC6) (Enhancer of yellow 2 homolog). 
Os01g0939100AK070064GTTTGGGCCGTASimilar to Calmodulin-stimulated calcium-ATPase. 
AK070588GCGGCCCAAGSimilar to Esterase D (EC 
AK070056CTTGGGCCGTGGSimilar to Beta-1,3-glucanase precursor. 
Os01g0946200AK071060CACGGCCCAAGNo apical meristem (NAM) protein domain containing protein. 
Os01g0960300AK100099TGCGGCCCAAGSimilar to Glucose inhibited division protein A. 
Os01g0960800AK073977TTTGGGCCGAAProtein Transporter, Pam16 family protein. 
AK058564TGTTGGGCCGTAProtein of unknown function YGGT family protein. 
Os01g0971600AK070366GTTTGGGCCGAGSimilar to Sn-glycerol-3-phosphate dehydrogenase (Fragment). 
AK121401GCCGGCCCAATSimilar to 15.9 kDa subunit of RNA polymerase II. 
Os02g0119700AK108777CCACGGCCCAATAProtein prenyltransferase domain containing protein. 
Os02g0129900Os02g0129900TACGGCCCAACTPGAP1-like family protein. 
AK109376TCGGCCCAAAAProteasome subunit alpha type 1 (EC (20S proteasome alpha subunit F) (20S proteasome subunit alpha-6) (Proteasome component C2). 
Os02g0135600AK069843TGCGGCCCAATTCAGCCCATGTConserved hypothetical protein. 
Os02g0135700AK100570ACATGGGCTGAATTGGGCCGCADNA polymerase V family protein. 
AK061569ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCAssDNA-binding transcriptional regulator family protein. 
AK061569TGTTGGGCCGGGssDNA-binding transcriptional regulator family protein. 
AK121223ACCGGCCCAATTSimilar to 40S ribosomal protein S14. 
Os02g0179100AK058557TCCGGCCCAACAMetal-dependent phosphohydrolase, HD region domain containing protein. 
AK106917AAACGGCCCAAAAUbiquitin domain containing protein. 
Os02g0190900AK111037GCCCAATTTGGGCCGGGCCGTGPhytoene dehydrogenase-like protein. 
AK111037TTTTGGGCCGGGCCCATTAPhytoene dehydrogenase-like protein. 
Os02g0190950J075001E02CACGGCCCGGCCCAAATTGGGCConserved hypothetical protein. 
AK061629TTTCGGCCCAACASimilar to Thioredoxin peroxidase. 
Os02g0215950J090051K07GCGGCCCATACATTTGGGCCGGGConserved hypothetical protein. 
AK059059AATTGGGCCGCASimilar to Beta-galactosidase precursor (EC (Lactase) (Acid beta- galactosidase) (Exo-(1-->4)-beta-D-galactanase). 
AK059059GTTTGGGCCGASimilar to Beta-galactosidase precursor (EC (Lactase) (Acid beta- galactosidase) (Exo-(1-->4)-beta-D-galactanase). 
Os02g0241100Os02g0241100TTCGGCCCAAAAProtein kinase-like domain containing protein. 
Os02g0250600J075143F23AGTTGGGCCGTCLate embryogenesis abundant protein repeat containing protein. 
Os02g0301400AK121646GCGGCCCAAGThioredoxin-like fold domain containing protein. 
Os02g0304800Os02g0304800GGCCCGGCCCAAATProtein prenyltransferase domain containing protein. 
Os02g0312700AK072956CACGGCCCAAAGTCCCACCATP11 family protein. 
AK063459CACGGCCCAACTConserved hypothetical protein. 
Os02g0537500AK068689TCCGGCCCATTGGGCCGCSimilar to E2F homolog. 
Os02g0565000AK120665TCCGTCCGGCCCAACAHomeodomain-like containing protein. 
AK072362CTTGGGCCGGCCCConserved hypothetical protein. 
Os02g0593900Os02g0593900TATTGGGCCGAAAMethyltransferases-related family protein. 
Os02g0616600AK106681CCGAGCCGGCCCAAATCGGCCCACACConserved hypothetical protein. 
Os02g0621500AK120798TTTCGGCCCAACCZinc finger, RING-type domain containing protein. 
Os02g0629800AK121915ATTGGGCCGGTSimilar to Defensin precursor. 
AK063500CACGGCCCAATAGGCCCATTAProtein prenyltransferase domain containing protein. 
AK059694CTTGGGCCGGAUbiquitin-conjugating enzyme, E2 domain containing protein. 
AK072855TCCGGCCCAAGProteasome subunit alpha type 2 (EC (20S proteasome alpha subunit B) (20S proteasome subunit alpha-2). 
AK106548ACATGGGCCGAGATCGGCCCAACTConserved hypothetical protein. 
AY363174TACGGCCCAAGSimilar to 3-isopropylmalate dehydratase, small subunit. 
Os02g0682600AK108470TACGGCCCAATTZinc finger, Tim10/DDP-type family protein. 
AK102993TGTTGGGCCGGTConserved hypothetical protein. 
AK121757CTTGGGCCGCAAAA ATPase domain containing protein. 
AK106164TGTTGGGCCGCTubby family protein. 
Os02g0723200AK108140GCGGCCCAACCSimilar to Alpha galactosyltransferase (Fragment). 
AK121427CACGGCCCAATTConserved hypothetical protein. 
Os02g0736500AK065166GTTTGGGCCGGGCNicastrin family protein. 
Os02g0741500AK068867CCATGGGCCTTGGGCCGAGRibbon-helix-helix domain containing protein. 
AK068867TCCGGCCCAAACRibbon-helix-helix domain containing protein. 
Os02g0744000AK064898TCCGGCCCAAACConserved hypothetical protein. 
Os02g0750500AK101960TACGGCCCGGCCCAATASAM (and some other nucleotide) binding motif domain containing protein. 
Os02g0752300AK072544AACGGCCCAACCConserved hypothetical protein. 
AK072544GCGGCCCAAATConserved hypothetical protein. 
Os02g0775900AK119974GGTTGGGCCGGAConserved hypothetical protein. 
Os02g0778200AK065948ACCGGCCCAAGTTGGCCCAAGAminoacyl-tRNA synthetase, class I family protein. 
AK121143CTTGGGCCGGAConserved hypothetical protein. 
AK121143GCTGGGCCGGCCCAACConserved hypothetical protein. 
AK119261TTCGGCCCAATSimilar to Small heat stress protein class CIII. 
AK061452AAACGGCCCAAGConserved hypothetical protein. 
Os02g0810300AK059363TCGGCCCAAGGCCCAGTASimilar to NBD-like protein. 
Os02g0814800AK109850ATTTGGGCCGTGGlutathione S-transferase, C-terminal-like domain containing protein. 
Os02g0815500AK099733CCCGGCCCAATTAlcohol dehydrogenase class III (EC (Glutathione-dependent formaldehyde dehydrogenase) (EC (FDH) (FALDH) (GSH-FDH). 
Os02g0819700AK067374GTTTGGGCCGAAZinc finger, Zim17-type family protein. 
Os02g0823600AK070498AGTTGGGCCGTTGGConserved hypothetical protein. 
AK070498TCCGGCCCAAAConserved hypothetical protein. 
Os02g0824700009-023-E06AATTGGGCCGCSimilar to Vacuolar ATP synthase subunit F (EC (V-ATPase F subunit) (Vacuolar proton pump F subunit) (V-ATPase 14 kDa subunit). 
AK067965CTCGGCCCAAATSimilar to Cell division inhibitor. 
Os03g0113700AK103835AGTTGGGCCGGGCCGTGGSimilar to Heat shock 70 kDa protein, mitochondrial precursor. 
AK103835CCTGGGCCGGCCCAAAASimilar to Heat shock 70 kDa protein, mitochondrial precursor. 
Os03g0113800AK065925CCACGGCCCGGCCCAACTProtein prenyltransferase domain containing protein. 
AK065925TTTTGGGCCGGCCCAGGProtein prenyltransferase domain containing protein. 
AK071287TTTCGGCCCAATASimilar to Partner of Nob1; Pno1p; Yor145cp like KH domain containing protein, transcripts identified by EST. 
AK101870GCCGGCCCAATAConstitutive photomorphogenic 11. 
Os03g0124300AK069148CCACGGCCCAAACConserved hypothetical protein. 
AK099355CACGGCCCAAGSimilar to Chitinase (EC (Fragment). 
Os03g0133300AK064510TGTTGGGCCGGGCCGAConserved hypothetical protein. 
Os03g0135600J065183G03TCCGGCCCAAAAnkyrin repeat containing protein. 
Os03g0138600Os03g0138600AGTTGGGCCGAAGAAGCCCATAProtein of unknown function DUF810 family protein. 
Os03g0146400AK111974GCGGCCCAAGSimilar to Lethal leaf-spot 1 (Fragment). 
AK106420GTTTGGGCCGTAAromatic-ring hydroxylase family protein. 
AK063559TTTTGGGCCGTAProtein prenyltransferase domain containing protein. 
Os03g0161400Os03g0161400TCGGCCCAACCIQ calmodulin-binding region domain containing protein. 
AK121533GTTTGGGCCGAGSimilar to Histone H2A. 
Os03g0167600AK121254TTTGGGCCGCSimilar to Male sterility protein 2. 
Os03g0172200AK069130AATTGGGCCGGCArmadillo-like helical domain containing protein. 
Os03g0181600AK067807TACGGCCCAACTSimilar to GATA transcription factor 25 (ZIM-like 2 protein). 
AK061289CTTGGGCCGGCCCATGRibosomal protein S2 family protein. 
Os03g0186800AK100356CACGGCCCAACAModifier of rudimentary, Modr family protein. 
AK105523ATTTGGGCCGGGCPeptidase S10, serine carboxypeptidase family protein. 
AK070573AGTTGGGCCGGTGRIM-19 family protein. 
AK062601GCCGGCCCAATASimilar to TATA-binding protein associated factor 2N (RNA-binding protein 56) (TAFII68) (TAF(II)68). 
Os03g0210400AK065966ATTGGGCCGCProtein prenyltransferase domain containing protein. 
AK065966ATTTGGGCCGCProtein prenyltransferase domain containing protein. 
AK073785GCGGCCCAATTSimilar to Superoxide dismutase (EC 
AK071799GGCCCGGCCCAACAConserved hypothetical protein. 
AK071799TAATGGGCCCGGCCCAAACConserved hypothetical protein. 
AK061178TGTTGGGCCGGGCCSimilar to AGL157Cp. 
AK062522AGTTGGGCCGAGASimilar to 40S ribosomal protein S20 (S22) (Fragment). 
Os03g0256400AK073854GTTTGGGCCGCAGGGCCCACAASimilar to Imidazole glycerol phosphate synthase hisHF, chloroplast precursor (IGP synthase) (ImGP synthase) (IGPS) [Includes: Glutamine amidotransferase (EC 2.4.2.-); Cyclase (EC 4.1.3.-)]. 
Os03g0257600Os03g0257600TCGGCCCAACProtein of unknown function DUF292, eukaryotic domain containing protein. 
AK100114AATTGGGCCTTTTTGGGCCGASimilar to Lectin-like receptor kinase 7;2. 
AK119243ATTTGGGCCGAAALow molecular mass heat shock protein Oshsp17.3. 
AK106069ATTGGGCCGAProtein of unknown function DUF296 domain containing protein. 
AK109474AACGGCCCAAGSimilar to Heat shock protein 70. 
AK109474ACCGGCCCAACSimilar to Heat shock protein 70. 
AK066019TACGGCCCAAATATPase, F0 complex, subunit B/B', bacterial and chloroplast family protein. 
Os03g0279400AK101851CCACGGCCCAAGSimilar to Arginine biosynthesis bifunctional protein argJ 1 [Includes: Glutamate N-acetyltransferase (EC (Ornithine acetyltransferase) (Ornithine transacetylase) (OATase); Amino-acid acetyltransferase (EC (N-acetylglutamate synthase) (AGS)] [Contains: Arginine biosynthesis bifunctional protein argJ1 alpha chain; Arginine biosynthesis bifunctional protein argJ1 beta chain]. 
AK065887ATTTGGGCCGAGSimilar to In2-1 protein. 
Os03g0284000Os03g0284000CTTGGGCCGTGCTTGGGCTGCConserved hypothetical protein. 
AK063663GGCCCGGCCCAAGSimilar to Protein disulfide isomerase. 
Os03g0293100AK060680GGCCCGGCCCAAAConserved hypothetical protein. 
AK112010ATTTGGGCCGAAAZinc finger, RING-type domain containing protein. 
Os03g0312600AK073391CTTGGGCCGGCSimilar to XPA-binding protein 1 (HUSSY-23). 
Os03g0335100AK107094CTTGGGCCGTTConserved hypothetical protein. 
Os03g0338600AK066604CTTGGGCCGAtRNA pseudouridine synthase family protein. 
AK059599CCACGGCCCAACSimilar to 60S ribosomal protein L22-2. 
AK105813TCCGGCCCAATAPhotosystem II protein PsbX family protein. 
AK065547CTTGGGCCGTGSimilar to ASF/SF2-like pre-mRNA splicing factor SRP32''. 
Os03g0347800AK073756TCGGCCCAAACPeptidyl-tRNA hydrolase family protein. 
AK073312GGTTGGGCCGAAALow temperature viability protein family protein. 
AB025187TTCGGCCCAACTSimilar to Cytochrome c oxidase subunit 6b. 
AK121839TAAGCCCATCCGGCCCAAATHypothetical protein. 
Os03g0633800AK073044GGGCTTGGGCCGTGGTGGGTGGGCCCCACACSimilar to IAA6 (Fragment). 
Os03g0646300AK069229TTTTGGGCCGCSimilar to Cyclic nucleotide-gated channel A (Fragment). 
AK062094TCGGCCCAATTSimilar to RGP-3 (Fragment). 
AK059896GCGGCCCAAACSimilar to Ferredoxin. 
AK062981TATTGGGCCGGTConserved hypothetical protein. 
AK066216CTTGGGCCGCProtein of unknown function DUF1295 family protein. 
Os03g0708600AK069199CACGGCCCAAATDEAD/DEAH box helicase, N-terminal domain containing protein. 
AK069199CACGGCCCAAGDEAD/DEAH box helicase, N-terminal domain containing protein. 
AK062406CTTGGGCCGGAMembrane-associated proteins in eicosanoid and glutathione metabolism (MAPEG) family protein. 
Os03g0712200AK073205TCGGCCCAAACZinc finger, RanBP2-type domain containing protein. 
Os03g0716200Os03g0716200GCGGCCCAAConserved hypothetical protein. 
Os03g0727100AK068587GTTTGGGCCGTAAGGCCCAACAConserved hypothetical protein. 
AF058697GACGGCCCAAAAMADS14 protein. 
Os03g0763000AK120812GTTGGGCCGAACAGCCCASimilar to Casein kinase II alpha subunit. 
Os03g0765000AK073918TGCGGCCCAACTSimilar to Serine/threonine-protein kinase 12 (EC (Aurora-B) (Fragment). 
Os03g0766900AK066137CACGGCCCAATTAllene oxide synthase. 
Os03g0767700AK073586TCGGCCCAATAAACGGGCCCGGTConserved hypothetical protein. 
AK121608CAACGGCCCAACACytochrome c oxidase, subunit VIa family protein. 
Os03g0776900AK107941CCCGGCCCAATTSimilar to DNAJ protein-like. 
Os03g0786600AK109838TACGGCCCAATAProtein of unknown function DUF860, plant family protein. 
AK068660CTCGGCCCAATSimilar to Heat shock transcription factor 31 (Fragment). 
Os03g0800800AK065406GCGGCCCAACSMAD/FHA domain containing protein. 
Os03g0802300AK120564AGTGGGCCTTGGGCCGAGAConserved hypothetical protein. 
AK063484TCCGGCCCAATTConserved hypothetical protein. 
AK063484TCTCGGCCCAATAConserved hypothetical protein. 
AK103496GTTTGGGCCGGGCCGTCProtein of unknown function DUF1639 family protein. 
Os03g0807800AK064984TATTGGGCCGAAGAGGCCCAGCCCACTTGSimilar to 40S ribosomal protein S2 (Fragment). 
AK111534TCGGCCCAATAGGCCCAAGSimilar to Auxin-resistance protein AXR1. 
AK119690GCCGGCCCAAGSimilar to ZPT2-13. 
Os03g0822200AK069405GCGGCCCAACANAD-dependent epimerase/dehydratase family protein. 
AK067084CTCGGCCCACAAGCGGCCCAACTSimilar to RNA-binding protein RZ-1. 
Os03g0841100AK120279TATTGGGCCGTGTCGGCCCACCTEGF domain containing protein. 
AK061198CCCGGCCCAACASimilar to 30S ribosomal protein S6, chloroplast precursor (Fragment). 
Os03g0850600AK067191AGTTGGGCCGGGACGGCCACGTGGCGConserved hypothetical protein. 
AK067191TATTGGGCCGGAConserved hypothetical protein. 
AK067191TGCGGCCCAATConserved hypothetical protein. 
AK060496TTTGGGCCGGCSimilar to Transcription factor homolog BTF3-like protein. 
AK061374TGTTGGGCCGCAProtein of unknown function UPF0131 family protein. 
AK066032AATTGGGCCGAAProteasome component region PCI domain containing protein. 
AK070523TACGGCCCAATAD111/G-patch domain containing protein. 
AK121763CCCGGCCCAACAConserved hypothetical protein. 
AK121763GGGACCCACCCCACCCGGCCCAAGConserved hypothetical protein. 
Os04g0206500AK110892TCGGCCCAAGUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
Os04g0208400AK069629CTTGGGCCGTGCTTGGGCCGTGGCyclin-like F-box domain containing protein. 
Os04g0378200AK103076ACCGGCCCAAACSterile alpha motif SAM domain containing protein. 
AK121192CTCGGCCCAATASimilar to 40S ribosomal protein S14 (Clone MCH2). 
AK106155ATTGGGCCGCAConserved hypothetical protein. 
AK105415ATTGGGCCGGCNonsense-mediated decay UPF3 domain containing protein. 
Os04g0444900AK063657TACGGCCCAAGSimilar to Alfin-1. 
AK059948ATTGGGCCGAAASimilar to Cysteine proteinase EP-B 1 precursor (EC 3.4.22.-). 
AK059948ATTTGGGCCGCASimilar to Cysteine proteinase EP-B 1 precursor (EC 3.4.22.-). 
AK101116TTTCGGCCCGGCCCAACCTGF-beta receptor, type I/II extracellular region family protein. 
Os04g0495900AK061559TACGGCCCAAAAConserved hypothetical protein. 
Os04g0508000AK071432ATTGGGCCGAGATProtein of unknown function DUF231, plant domain containing protein. 
AK121759ATCTCGGCCCAATConserved hypothetical protein. 
Os04g0520900AK068793TCTCGGCCCAAATProtein prenyltransferase domain containing protein. 
AK066169CACGGCCCAAAAConserved hypothetical protein. 
Os04g0551300AK103502CTTGGGCCGTCSimilar to Growth regulator like protein. 
AK121568GTTTGGGCCGGTSimilar to T-complex protein 1, alpha subunit (TCP-1-alpha) (CCT-alpha). 
Os04g0592500AK066893TACGGCCCAAAAPhosphoenolpyruvate carboxykinase (ATP) family protein. 
Os04g0595000AK106907TTTTGGGCCGTGGGCTPeptidase A1, pepsin family protein. 
AK066289TACGGCCCAAATPeptidase M24A, methionine aminopeptidase, subfamily 1 protein. 
AK063022GCCCGGCCCAAGConserved hypothetical protein. 
AK071230CGATGGGCCTTGTAATGGGCCACGGCCCAACAProtein prenyltransferase domain containing protein. 
AK071230TGGATGGGCCGAGCACGGCCCAAAProtein prenyltransferase domain containing protein. 
Os04g0625600AK070994AGTTGGGCCGCTRAF-like domain containing protein. 
AK070994TTTTGGGCCGGATRAF-like domain containing protein. 
Os04g0640800AK065522GTTTGGGCCGTCProgrammed cell death protein 2, C-terminal domain containing protein. 
AK065522TATTGGGCCGGAProgrammed cell death protein 2, C-terminal domain containing protein. 
AK099088AATTGGGCCGTCCSimilar to COP9 signalosome complex subunit 5b (EC 3.4.-.-) (Signalosome subunit 5b) (Jun activation domain-binding homolog 1). 
Os04g0658100AK065495CAACGGCCCAAAAHistone-fold domain containing protein. 
AK062995CACGGCCCAACCHCH domain containing protein. 
AK062995TCCGGCCCAAAACHCH domain containing protein. 
AK067481AGTTGGGCTTGGGCCGCSimilar to 50S ribosomal protein L28, chloroplast precursor. 
AK066175TACGGCCCAAATSimilar to RNA helicase (Fragment). 
Os05g0120800AK066865TCCGGCCCAACAConserved hypothetical protein. 
J065066C12GACGGCCCAATConserved hypothetical protein. 
Os05g0126200AK059554GCGGCCCAACAConserved hypothetical protein. 
AK059554GTCGAGTCATTGGGCCGGGCCCATATConserved hypothetical protein. 
AK120934CTTGGGCCGCCGGCCCATCTConserved hypothetical protein. 
AK062421TGTTGGGCCGTTRibosomal protein S27, mitochondrial family protein. 
Os05g0156200AK071622GCCGGCCCAATTConserved hypothetical protein. 
Os05g0169400AK073439TCCGGCCCAACProtein of unknown function DUF1421 family protein. 
Os05g0194600AK102487AATGGGCTATTGGGCCGAPeptidase M22, O-sialoglycoprotein endopeptidase family protein. 
Os05g0219800AK102822CACGGCCCAATASimilar to Clone ZZD1128 mRNA sequence. 
AK106308CACGGCCCAAASimilar to Glycine-rich RNA-binding protein GRP2A. 
Os05g0227700AK067567AATTGGGCCGGCCCATTAGGTGGATGGGCCCACTConserved hypothetical protein. 
Os05g0227800AK110997AGTGGGCCCATCCACCTAATGGGCCGGCCCAATTHomeodomain-like containing protein. 
Os05g0241400AK107803ATATGGGCCTATTGGGCCGGGCConserved hypothetical protein. 
Os05g0256000AK104927TATTGGGCCAGGACGGCCCAACASimilar to TGF-beta receptor-interacting protein 1. 
AK109444AGTTGGGCCGGATAFII55 protein conserved region domain containing protein. 
Os05g0365500AK072352GACGGCCCAACProtein prenyltransferase domain containing protein. 
Os05g0393800AK069074TCGGCCCAACProtein of unknown function DUF221 domain containing protein. 
Os05g0400600AK072045TCCGGCCCAACTCobalt transport protein family protein. 
Os05g0412800AF402803GCCCGGCCGGCCCAAATSimilar to Glutathione S-transferase GST 41 (EC 
AK121867GCGGCCCAAAAProtein of unknown function DUF502 family protein. 
Os05g0443300Os05g0443300AGTTGGGCCGCSec23/Sec24 trunk region domain containing protein. 
Os05g0451300AK108341AGTGGGCCACCTCGCCCGGCCCAACCConserved hypothetical protein. 
Os05g0456000AK058420TCCGGCCCAACATGGATGGGCCTAMitochondrial glycoprotein family protein. 
Os05g0458400AK069936GATCCGACGGCCCAAACSimilar to AAA-metalloprotease FtsH. 
AK066739TCCGGCCCAATTClathrin adaptor complex, small chain family protein. 
Os05g0481000AK059369GCGGCCCAATGCN5-related N-acetyltransferase domain containing protein. 
AK101340CTTGGGCCGTAKrr1 family protein. 
Os05g0506900AK106697AATTGGGCCGAGBrix domain containing protein. 
Os05g0509200AK061566TATTGGGCCGANADH dehydrogenase (ubiquinone), 24 kDa subunit family protein. 
AK061147CTCGGCCCAATLipolytic enzyme, G-D-S-L family protein. 
Os05g0531500AK120867CTTGGGCCGCProtein of unknown function DUF616 family protein. 
Os05g0539300Os05g0539300AATTGGGCCGCAProtein of unknown function DUF295 family protein. 
AK103819AATTGGGCCGAAAFlap endonuclease-1a (EC 3.-.-.-) (OsFEN-1a). 
AK071090AGTTGGGCCGGCCCAATAHomeodomain-like containing protein. 
AK062488ATTTGGGCCGGCConserved hypothetical protein. 
AK122158AGATGGGCCTTGGGCCGAAADNA-binding TFAR19-related protein family protein. 
Os05g0548100AK060333CTCGGCCCAAGConserved hypothetical protein. 
AK060333TTTCGGCCCAAGGCCCATATConserved hypothetical protein. 
AK062890GCGGCCCAACAFerredoxin domain containing protein. 
AK102111CTTGGGCTCGGCCCAACAArmadillo-like helical domain containing protein. 
Os05g0565000AK102673TACGGCCCAACTSimilar to 60S ribosomal protein L18a-1. 
AK102673TCCGGCCCAAACSimilar to 60S ribosomal protein L18a-1. 
AK067090TATTGGGCCGCASimilar to Urease accessory protein G. 
AK067090TCCGGCCCAACCSimilar to Urease accessory protein G. 
AK112068CCATGGGCTTTGTTGGGCCGGTGTP-binding protein, HSR1-related domain containing protein. 
AK112068TATTGGGCCGGCCCAAGGTP-binding protein, HSR1-related domain containing protein. 
AK059883CAGGTGGGCTTGGGCCGCAProtein of unknown function DUF1645 family protein. 
AK062369AGCCCATGCGGCCCAAAAConserved hypothetical protein. 
Os05g0571600Os05g0571600TTTCGGCCCAACCConserved hypothetical protein. 
AK099181GACGGCCCAAACGCGGAGAGConserved hypothetical protein. 
AK101235ATTTGGGCCGGACyclin-like F-box domain containing protein. 
AK105979ACATGGGCTCGGCCCAAGCCACGTCHigh-affinity nickel-transporter family protein. 
Os06g0116800AK058985CACGGCCCAATASimilar to GFA2. 
Os06g0136000AK060303ACCGGCCCAATSimilar to Hypersensitive-induced reaction protein 4. 
Os06g0136700AK065081TTTCGGCCCAATSteroid nuclear receptor, ligand-binding domain containing protein. 
AK063371TGTTGGGCCGGGCCGTGLeucine carboxyl methyltransferase family protein. 
Os06g0144000AK068998TGTTGGGCCGCBRCT domain containing protein. 
AK099578ATTTGGGCCGGCCCAGGConserved hypothetical protein. 
Os06g0157800AK121504TATTGGGCCGATTTGGGCTGTSimilar to CG7224 (Fragment). 
AK121504TATTGGGCCGGCCCSimilar to CG7224 (Fragment). 
AK099356CTTGGGCCGGGCCGlutathione S-transferase, C-terminal-like domain containing protein. 
Os06g0174350J043034B05AGTGGGCCTAGTTGGGCCGGAConserved hypothetical protein. 
Os06g0214300AK108107TACGGCCCAACTEsterase/lipase/thioesterase domain containing protein. 
Os06g0247800AK102187GGCCCGGCCCAACCSimilar to Dynamin-like protein (Fragment). 
Os06g0291100J043017O10CCGAGCCGGCCCAAGTCAGCCCACAAHypothetical protein. 
Os06g0319700AK120884GGCCCGGCCCAACGCCCAGCCCSimilar to 60S ribosomal protein L31. 
Os06g0332600AK121615CTCGGCCCAATAConserved hypothetical protein. 
Os06g0482200AK119703TGTTGGGCCGCAThioredoxin fold domain containing protein. 
AK073116TGTTGGGCCGGGCCConserved hypothetical protein. 
AK108074TACGGCCCAAAProtein of unknown function DUF862, eukaryotic domain containing protein. 
AK121337CCCACCTGTTGGGCCGGGCCCACTProtein of unknown function UPF0197 family protein. 
J065039O05TTCGGCCCAACGlucose/ribitol dehydrogenase family protein. 
Os06g0592500AK119729CAACGGCCCAAAASimilar to Ethylene-responsive transcriptional coactivator. 
Os06g0622700AK107021TCTCGGCCCAATTEukaryotic transcription factor, DNA-binding domain containing protein. 
AK122074TTTCGGCCCAAATProtein of unknown function FAF1 domain containing protein. 
Os06g0647900AK073750GCGGCCCAACAConserved hypothetical protein. 
AK073750GCGGCCCAACAConserved hypothetical protein. 
Os06g0673800AK066054TACGGCCCAAATHypothetical protein. 
AK063252GGTTGGGCCGGALike-Sm ribonucleoprotein, core family protein. 
AK064816GGTTGGGCCGCZinc finger, CCCH-type domain containing protein. 
Os06g0683200AK060024CTTGGGCCGTASimilar to 50S ribosomal protein L24, chloroplast precursor (CL24). 
Os06g0683800AK110639CGGCTCGGCCCAAATConserved hypothetical protein. 
AK101144AATTGGGCCGCRNA polymerase I specific transcription initiation factor RRN3 family protein. 
Os06g0690600AK107925GACGGCCCAACTConserved hypothetical protein. 
Os06g0710300AK121344CTTGGGCCGAAUncharacterized protein UPF0114 family protein. 
Os06g0715000AK107114TTCGGCCCAATTConserved hypothetical protein. 
Os07g0105300AK107419TCGGCCCAAACConserved hypothetical protein. 
AK071499TATTGGGCCGGAConserved hypothetical protein. 
AK060737ATTTGGGCCGTCCAldo/keto reductase family protein. 
Os07g0146600J075074M15CACGGCCCAACAConserved hypothetical protein. 
Os07g0158900AK064980GCGGCCCAAGCyclin-like F-box domain containing protein. 
J065210M20CTCGGCCCAAATSimilar to Dolichyl pyrophosphate Man9GlcNAc2 alpha-1,3-glucosyltransferase (EC 2.4.1.-) (Dolichyl-P-Glc:Man9GlcNAc2-PP-dolichyl glucosyltransferase). 
AK073533TCTGGGCCGTTTGGGCCGAASMAD/FHA domain containing protein. 
Os07g0191000AK071379TTCGGCCCAAACGGCCCAGAInositol monophosphatase family protein. 
AK058966ATTTGGGCCGCMak16 protein family protein. 
AK073463CTTGGGCCGTGCTTGGGCCGTGGSimilar to RNA helicase (Fragment). 
AK121702ATTTGGGCCGASimilar to 60S ribosomal protein L44. 
AK104968ATTGGGCCGGTThioesterase superfamily domain containing protein. 
AK121807GCGGCCCAAATDNA-directed RNA polymerase, 14 to 18 kDa subunit family protein. 
AK058326TTCGGCCCAACACGTCACSimilar to SL15-like (Fragment). 
Os07g0490300AK068288GCCGGCCCAAGSimilar to Preproacrosin. 
Os07g0490400AK067941CTTGGGCCGGCPeptidylprolyl isomerase, FKBP-type domain containing protein. 
Os07g0555400AK070977CTTGGGCCGTGCTTGGGCTGAConserved hypothetical protein. 
AK109399GCCCGGCCCAAAASimilar to Type III chlorophyll a/b-binding protein (Fragment). 
Os07g0564000AK069806AGTTGGGCCGAGAConserved hypothetical protein. 
Os07g0565000AK121056GTTTGGGCCTTCTTGGGCCGASimilar to 40S ribosomal protein S11. 
Os07g0570700AK065242TTCGGCCCAACTRibosome recycling factor family protein. 
Os07g0572500AK108612ACCGGCCCAACCConserved hypothetical protein. 
Os07g0573600AK073925GTTTGGGCCGGGCCGAAAREX1 DNA Repair family protein. 
Os07g0586700AK102792CACGGCCCAAACCCAGCCCAAAAConserved hypothetical protein. 
AK108488AGTTGGGCCGCConserved hypothetical protein. 
AK066349GCGGCCCAACTPrefoldin related, ubiquitously expressed transcript family protein. 
Os07g0607200AK065746CCAAGCCCACGGCCCAACCProtein of unknown function DUF751 family protein. 
AK065746CTCGGCCCAACAProtein of unknown function DUF751 family protein. 
AK065746TTCGGCCCAACAProtein of unknown function DUF751 family protein. 
AK102448ATTTGGGCCGGAAlpha 1-2 subunit of 20S proteasome. 
AK102448TTTTGGGCCGCAAlpha 1-2 subunit of 20S proteasome. 
Os07g0616900AK071047CTCGGCCCAAAAProtein of unknown function DUF500 family protein.