version

Summary of OsREG563 (All List)

OrganismOryza sativa  
IDOsREG563  
SequenceCGGCCCAA  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count4212  

Entry Sequences (4212 entries)

LocusGene modelSequenceDescription
Os01g0101600AK099952TACGGCCCAACARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
AK122118TACGGCCCAACANONE 
J013123J12TACGGCCCAACANONE 
J033026O19TACGGCCCAACANONE 
J033128C08TACGGCCCAACANONE 
J065116M14TACGGCCCAACANONE 
J090058F15TACGGCCCAACANONE 
J090079F20TACGGCCCAACANONE 
Os01g0104000AK072087TGTTGGGCCGANONE 
AK103808TGTTGGGCCGAC-type lectin domain containing protein. 
Os01g0104100AK072797TCGGCCCAACAZinc finger, RING-type domain containing protein. 
AK104280TCGGCCCAACANONE 
Os01g0134200AK102394AATTGGGCCGGCConserved hypothetical protein. 
Os01g0141100012-043-A12GCGGCCCAAGNONE 
AK062139GCGGCCCAAGNONE 
J013110M14GCGGCCCAAGNONE 
J013114F09GCGGCCCAAGNONE 
J033036J01GCGGCCCAAGNONE 
Os01g0147200016-005-F02ATTTGGGCCGGANONE 
AK106463ATTTGGGCCGGANONE 
AK121921ATTTGGGCCGGAIWS1, C-terminal family protein. 
J033098O16ATTTGGGCCGGANONE 
J033106E16ATTTGGGCCGGANONE 
J043026D12ATTTGGGCCGGANONE 
J065070B04ATTTGGGCCGGANONE 
J065162L03ATTTGGGCCGGANONE 
J065166F01ATTTGGGCCGGANONE 
J075030A13ATTTGGGCCGGANONE 
J075093O12ATTTGGGCCGGANONE 
J075106K15ATTTGGGCCGGANONE 
J075107F20ATTTGGGCCGGANONE 
J090031F21ATTTGGGCCGGANONE 
J090079E17ATTTGGGCCGGANONE 
Os01g0164500AK068747CACGGCCCAATSimilar to ATP-dependent RNA helicase-like protein. 
AK103737CACGGCCCAATNONE 
Os01g0172000012-070-G06GGTTGGGCCGGANONE 
AK068405GGTTGGGCCGGAALG3 family protein. 
J013149A07GGTTGGGCCGGANONE 
J053047H05GGTTGGGCCGGANONE 
J065075N03GGTTGGGCCGGANONE 
J065093G22GGTTGGGCCGGANONE 
J065130N21GGTTGGGCCGGANONE 
J065143P05GGTTGGGCCGGANONE 
J065216H07GGTTGGGCCGGANONE 
J075013B06GGTTGGGCCGGANONE 
J075196M05GGTTGGGCCGGANONE 
J100039G24GGTTGGGCCGGANONE 
J100041B11GGTTGGGCCGGANONE 
J100069A16GGTTGGGCCGGANONE 
J100069L12GGTTGGGCCGGANONE 
J100074P16GGTTGGGCCGGANONE 
Os01g0179901J075009I05GAGGCCCATTGGGCCGAAANONE 
J075009I05TGCGGCCCAATTAGGGCCCAACTNONE 
J075058D09GAGGCCCATTGGGCCGAAANONE 
J075058D09TGCGGCCCAATTAGGGCCCAACTNONE 
J075153K16GAGGCCCATTGGGCCGAAAConserved hypothetical protein. 
J075153K16TGCGGCCCAATTAGGGCCCAACTConserved hypothetical protein. 
Os01g0219500AK106863TTTTGGGCCGTTNONE 
AK109524TTTTGGGCCGTTPlant lipid transfer protein/Par allergen family protein. 
J075053J18TTTTGGGCCGTTNONE 
J080023G09TTTTGGGCCGTTNONE 
J080051F19TTTTGGGCCGTTNONE 
J080085H15TTTTGGGCCGTTNONE 
Os01g0221300011-021-E12TCGGCCCAAGNONE 
011-021-E12TCTCGGCCCAACANONE 
AK073330TCGGCCCAAGConserved hypothetical protein. 
AK073330TCTCGGCCCAACAConserved hypothetical protein. 
J013130J18TCGGCCCAAGNONE 
J013130J18TCTCGGCCCAACANONE 
J033024A12TCGGCCCAAGNONE 
J033024A12TCTCGGCCCAACANONE 
J065063H09TCGGCCCAAGNONE 
J065063H09TCTCGGCCCAACANONE 
J065093G05TCGGCCCAAGNONE 
J065093G05TCTCGGCCCAACANONE 
J090007K12TCGGCCCAAGNONE 
J090007K12TCTCGGCCCAACANONE 
Os01g0222700012-011-E01GTTTGGGCCGACCGTTGNONE 
AK068883GTTTGGGCCGACCGTTGNONE 
AK101946GTTTGGGCCGACCGTTGZinc finger, BED-type predicted domain containing protein. 
J033075C16GTTTGGGCCGACCGTTGNONE 
J043013D08GTTTGGGCCGACCGTTGNONE 
J065089G19GTTTGGGCCGACCGTTGNONE 
J065197K19GTTTGGGCCGACCGTTGNONE 
J075161L21GTTTGGGCCGACCGTTGNONE 
Os01g0231700012-002-F11GCCGGCCCAAGTAGGCCCAGCNONE 
013-082-F05GCCGGCCCAAGTAGGCCCAGCNONE 
AK107453GCCGGCCCAAGTAGGCCCAGCSimilar to 60S acidic ribosomal protein P2-B (CaRP2B). 
J065005L22GCCGGCCCAAGTAGGCCCAGCNONE 
J065023E21GCCGGCCCAAGTAGGCCCAGCNONE 
J065036H21GCCGGCCCAAGTAGGCCCAGCNONE 
J065037M24GCCGGCCCAAGTAGGCCCAGCNONE 
J065049L04GCCGGCCCAAGTAGGCCCAGCNONE 
J065072F17GCCGGCCCAAGTAGGCCCAGCNONE 
J065085H10GCCGGCCCAAGTAGGCCCAGCNONE 
J065109N19GCCGGCCCAAGTAGGCCCAGCNONE 
J065117M19GCCGGCCCAAGTAGGCCCAGCNONE 
J065144C15GCCGGCCCAAGTAGGCCCAGCNONE 
J065159G24GCCGGCCCAAGTAGGCCCAGCNONE 
J065164N14GCCGGCCCAAGTAGGCCCAGCNONE 
J075025K16GCCGGCCCAAGTAGGCCCAGCNONE 
J075057L05GCCGGCCCAAGTAGGCCCAGCNONE 
J075070I16GCCGGCCCAAGTAGGCCCAGCNONE 
J075089D10GCCGGCCCAAGTAGGCCCAGCNONE 
J075138F10GCCGGCCCAAGTAGGCCCAGCNONE 
J090018C11GCCGGCCCAAGTAGGCCCAGCNONE 
J100018L19GCCGGCCCAAGTAGGCCCAGCNONE 
J100024B14GCCGGCCCAAGTAGGCCCAGCNONE 
J100048L02GCCGGCCCAAGTAGGCCCAGCNONE 
J100055A22GCCGGCCCAAGTAGGCCCAGCNONE 
J100069K01GCCGGCCCAAGTAGGCCCAGCNONE 
Os01g0232700AK069972AAGGCCCAACGGCCCAAGCCCAAAASimilar to Histidinol dehydrogenase, chloroplast precursor (EC 1.1.1.23) (HDH). Splice isoform 2. 
J075090M12AAGGCCCAACGGCCCAAGCCCAAAANONE 
J075146A12AAGGCCCAACGGCCCAAGCCCAAAANONE 
Os01g0270100006-096-H09TCCGGCCCAAGNONE 
009-009-C10TCCGGCCCAAGNONE 
009-054-E06TCCGGCCCAAGNONE 
014-085-F09TCCGGCCCAAGNONE 
AK073275TCCGGCCCAAGNONE 
AK104155TCCGGCCCAAGNONE 
AK119511TCCGGCCCAAGSimilar to Cysteine protease inhibitor. 
J033025K21TCCGGCCCAAGNONE 
J075065H10TCCGGCCCAAGNONE 
J075143G10TCCGGCCCAAGNONE 
J100059J02TCCGGCCCAAGNONE 
Os01g0279700AK067683TTTGGGCCGANONE 
AK100107TTTGGGCCGAMajor facilitator superfamily protein. 
J023004N09TTTGGGCCGANONE 
J075019L14TTTGGGCCGANONE 
J075187F21TTTGGGCCGANONE 
Os01g0299400AK107814GGTTGGGCCAATTTTGGGCCGTASterile alpha motif homology domain containing protein. 
AK107814TGCGGCCCAAAASterile alpha motif homology domain containing protein. 
J065112H10GGTTGGGCCAATTTTGGGCCGTANONE 
J065112H10TGCGGCCCAAAANONE 
Os01g0301100AK105556AATTGGGCCGAConserved hypothetical protein. 
Os01g0303800006-024-G06TGCGGCCCAAANONE 
006-025-F12TGCGGCCCAAANONE 
006-085-E12TGCGGCCCAAANONE 
006-092-F12TGCGGCCCAAANONE 
AK060078TGCGGCCCAAAUniversal stress protein (Usp) family protein. 
AK121626TGCGGCCCAAANONE 
J023044K21TGCGGCCCAAANONE 
J023069K09TGCGGCCCAAANONE 
J023091A17TGCGGCCCAAANONE 
J033048C05TGCGGCCCAAANONE 
J033126M13TGCGGCCCAAANONE 
J065040E06TGCGGCCCAAANONE 
J065060D14TGCGGCCCAAANONE 
Os01g0306100AK111041TTTCGGCCCAATPlant specific eukaryotic initiation factor 4B family protein. 
Os01g0328400006-092-H09GCGGCCCAATANONE 
009-085-A02GCGGCCCAATANONE 
012-078-B03GCGGCCCAATANONE 
AK061988GCGGCCCAATAUbiquitin. 
J013073B13GCGGCCCAATANONE 
J023135L09GCGGCCCAATANONE 
J023135O07GCGGCCCAATANONE 
J033027B12GCGGCCCAATANONE 
J033084P17GCGGCCCAATANONE 
J065010M05GCGGCCCAATANONE 
J065021N11GCGGCCCAATANONE 
J065021N12GCGGCCCAATANONE 
J065031K11GCGGCCCAATANONE 
J065072P04GCGGCCCAATANONE 
J065098D05GCGGCCCAATANONE 
J065122N23GCGGCCCAATANONE 
J065129L13GCGGCCCAATANONE 
J065135N13GCGGCCCAATANONE 
J065215N10GCGGCCCAATANONE 
J075120N22GCGGCCCAATANONE 
J090011G23GCGGCCCAATANONE 
J090014F06GCGGCCCAATANONE 
J090040G23GCGGCCCAATANONE 
J090075I20GCGGCCCAATANONE 
J090075N01GCGGCCCAATANONE 
J090089B04GCGGCCCAATANONE 
J090090F08GCGGCCCAATANONE 
J090091M17GCGGCCCAATANONE 
J090094L03GCGGCCCAATANONE 
J090099L06GCGGCCCAATANONE 
J100018A18GCGGCCCAATANONE 
J100027H13GCGGCCCAATANONE 
J100069C05GCGGCCCAATANONE 
J100086L10GCGGCCCAATANONE 
Os01g0342900011-017-G10GCGGCCCAATNONE 
AK063921GCGGCCCAATSimilar to Adenosine monophosphate binding protein 1 AMPBP1. 
J033050H23GCGGCCCAATNONE 
J065097A19GCGGCCCAATNONE 
Os01g0358300AK060388TTCGGCCCAACTNONE 
AK072081TTCGGCCCAACTTetratricopeptide-like helical domain containing protein. 
Os01g0358400006-031-B11AGTTGGGCCGAANONE 
006-083-B11AGTTGGGCCGAANONE 
006-083-C09AGTTGGGCCGAANONE 
006-088-H03AGTTGGGCCGAANONE 
006-102-H05AGTTGGGCCGAANONE 
AK061826AGTTGGGCCGAASimilar to 40S ribosomal protein S4. 
J013105M07AGTTGGGCCGAANONE 
J013155A16AGTTGGGCCGAANONE 
J033025C03AGTTGGGCCGAANONE 
J033072L20AGTTGGGCCGAANONE 
J033095I15AGTTGGGCCGAANONE 
J033105E03AGTTGGGCCGAANONE 
J033112G18AGTTGGGCCGAANONE 
J033125D09AGTTGGGCCGAANONE 
J065100L16AGTTGGGCCGAANONE 
J065176I05AGTTGGGCCGAANONE 
J090001C14AGTTGGGCCGAANONE 
J090058E15AGTTGGGCCGAANONE 
J090068F07AGTTGGGCCGAANONE 
Os01g0530300AK111105AAGGCCCAATTGGGCCGAHypothetical protein. 
J090023M11AAGGCCCAATTGGGCCGANONE 
J090053G13AAGGCCCAATTGGGCCGANONE 
Os01g0530366J075001P06CTCGGCCCAAAANONE 
J075006K21CTCGGCCCAAAARNA polymerase Rbp10 domain containing protein. 
J075030G13CTCGGCCCAAAANONE 
Os01g0551000006-104-A04CCCAGCCCGGCCCAACCNONE 
009-183-B08CCCAGCCCGGCCCAACCNONE 
AK071219CCCAGCCCGGCCCAACCConserved hypothetical protein. 
AK106034CCCAGCCCGGCCCAACCNONE 
Os01g0558500AK099982GCGGCCCAATPWWP domain containing protein. 
J065096J12GCGGCCCAATNONE 
Os01g0558600006-120-G12ATCTCGGCCCGGCCCGGCCCAACTNONE 
J013100N20ATCTCGGCCCGGCCCGGCCCAACTNONE 
J033043P09ATCTCGGCCCGGCCCGGCCCAACTNONE 
J033125M18ATCTCGGCCCGGCCCGGCCCAACTNONE 
J053043N11ATCTCGGCCCGGCCCGGCCCAACTNONE 
J065008E07ATCTCGGCCCGGCCCGGCCCAACTNONE 
J065080O16ATCTCGGCCCGGCCCGGCCCAACTNONE 
J075002G24ATCTCGGCCCGGCCCGGCCCAACTNONE 
J075123C09ATCTCGGCCCGGCCCGGCCCAACTNONE 
S66160ATCTCGGCCCGGCCCGGCCCAACTRas-related protein RIC1. 
Os01g0590200011-100-E06GTTGGGCCGGGGCCCATTANONE 
012-005-A05GTTGGGCCGGGGCCCATTANONE 
AK063416GTTGGGCCGGGGCCCATTAConserved hypothetical protein. 
AK099235GTTGGGCCGGGGCCCATTANONE 
AK105022GTTGGGCCGGGGCCCATTANONE 
J065030D21GTTGGGCCGGGGCCCATTANONE 
J065031C10GTTGGGCCGGGGCCCATTANONE 
J065105A22GTTGGGCCGGGGCCCATTANONE 
J065173M19GTTGGGCCGGGGCCCATTANONE 
J075188F15GTTGGGCCGGGGCCCATTANONE 
J090050C15GTTGGGCCGGGGCCCATTANONE 
J100058K07GTTGGGCCGGGGCCCATTANONE 
Os01g0593700Os01g0593700AAACGGCCCAATSulphate anion transporter family protein. 
Os01g0616600009-171-H09ATTTGGGCCGCANONE 
011-005-G09ATTTGGGCCGCANONE 
012-089-C03ATTTGGGCCGCANONE 
AK063911ATTTGGGCCGCAProtein prenyltransferase domain containing protein. 
AK101490ATTTGGGCCGCANONE 
Os01g0621700AK108938GACGGCCCAACCMyosin tail 2 domain containing protein. 
J100033P13GACGGCCCAACCNONE 
Os01g0640800AK065688CTTGGGCCGCAConserved hypothetical protein 48 family protein. 
J013042L10CTTGGGCCGCANONE 
J013121H08CTTGGGCCGCANONE 
Os01g0642900009-109-F01TCGGCCCAAANONE 
AK063836TCGGCCCAAASingle-strand binding protein/Primosomal replication protein n family protein. 
AK073560TCGGCCCAAANONE 
J033043K18TCGGCCCAAANONE 
J100023C05TCGGCCCAAANONE 
J100038C15TCGGCCCAAANONE 
J100039C23TCGGCCCAAANONE 
Os01g0649000AK073564TCGGCCCAACGGCCWD40-like domain containing protein. 
Os01g0666500AK102689CTTGGGCCGCAConserved hypothetical protein. 
Os01g0680400AK067914CCCGGCCCAAAATAFII28-like protein family protein. 
J065039K13CCCGGCCCAAAANONE 
J065042K22CCCGGCCCAAAANONE 
J080016E23CCCGGCCCAAAANONE 
J080064E22CCCGGCCCAAAANONE 
Os01g0686800006-098-B12GGACGGCCCAAATNONE 
006-113-H04GGACGGCCCAAATNONE 
AK060428GGACGGCCCAAATNONE 
AK098877GGACGGCCCAAATNONE 
AK098893GGACGGCCCAAATNONE 
AK121587GGACGGCCCAAATGuanine nucleotide-binding protein beta subunit-like protein (GPB-LR) (RWD). 
D38231GGACGGCCCAAATNONE 
J013001E12GGACGGCCCAAATNONE 
J013001N15GGACGGCCCAAATNONE 
J013098G22GGACGGCCCAAATNONE 
J023004P15GGACGGCCCAAATNONE 
J023014D09GGACGGCCCAAATNONE 
J023020G09GGACGGCCCAAATNONE 
J023034A19GGACGGCCCAAATNONE 
J023050I11GGACGGCCCAAATNONE 
J023079D13GGACGGCCCAAATNONE 
J023091B11GGACGGCCCAAATNONE 
J023099M03GGACGGCCCAAATNONE 
J023101H20GGACGGCCCAAATNONE 
J023106P14GGACGGCCCAAATNONE 
J023111F19GGACGGCCCAAATNONE 
J023132C22GGACGGCCCAAATNONE 
J023139O03GGACGGCCCAAATNONE 
J023146O10GGACGGCCCAAATNONE 
J033022G16GGACGGCCCAAATNONE 
J033030C10GGACGGCCCAAATNONE 
J033032G18GGACGGCCCAAATNONE 
J033034N09GGACGGCCCAAATNONE 
J033037K24GGACGGCCCAAATNONE 
J033038B22GGACGGCCCAAATNONE 
J033061E06GGACGGCCCAAATNONE 
J033065F08GGACGGCCCAAATNONE 
J033065I24GGACGGCCCAAATNONE 
J033069L01GGACGGCCCAAATNONE 
J033086N21GGACGGCCCAAATNONE 
J033102I06GGACGGCCCAAATNONE 
J033111N07GGACGGCCCAAATNONE 
J033118K11GGACGGCCCAAATNONE 
J033125D08GGACGGCCCAAATNONE 
J033129P22GGACGGCCCAAATNONE 
J033131L12GGACGGCCCAAATNONE 
J033139D08GGACGGCCCAAATNONE 
J033141J08GGACGGCCCAAATNONE 
J043024B14GGACGGCCCAAATNONE 
J053048G19GGACGGCCCAAATNONE 
J065023B15GGACGGCCCAAATNONE 
J065082C15GGACGGCCCAAATNONE 
J065087D24GGACGGCCCAAATNONE 
J065122D11GGACGGCCCAAATNONE 
J065128P13GGACGGCCCAAATNONE 
J065149I19GGACGGCCCAAATNONE 
J065154E16GGACGGCCCAAATNONE 
J065156K21GGACGGCCCAAATNONE 
J065166H09GGACGGCCCAAATNONE 
J065169F24GGACGGCCCAAATNONE 
J065194I16GGACGGCCCAAATNONE 
J065213M20GGACGGCCCAAATNONE 
J075020F19GGACGGCCCAAATNONE 
J075051J16GGACGGCCCAAATNONE 
J075093C18GGACGGCCCAAATNONE 
J075119H02GGACGGCCCAAATNONE 
J075120J11GGACGGCCCAAATNONE 
J075173A15GGACGGCCCAAATNONE 
J080302B05GGACGGCCCAAATNONE 
J080304G10GGACGGCCCAAATNONE 
J080305E13GGACGGCCCAAATNONE 
J080315L11GGACGGCCCAAATNONE 
J090005H15GGACGGCCCAAATNONE 
J090021C24GGACGGCCCAAATNONE 
J090025H24GGACGGCCCAAATNONE 
J090025M11GGACGGCCCAAATNONE 
J090026C22GGACGGCCCAAATNONE 
J090027H15GGACGGCCCAAATNONE 
J090034B17GGACGGCCCAAATNONE 
J090045G11GGACGGCCCAAATNONE 
J090048H02GGACGGCCCAAATNONE 
J090051N04GGACGGCCCAAATNONE 
J090052I06GGACGGCCCAAATNONE 
J090054L17GGACGGCCCAAATNONE 
J090060M22GGACGGCCCAAATNONE 
J090075N17GGACGGCCCAAATNONE 
J090079K13GGACGGCCCAAATNONE 
J090086H08GGACGGCCCAAATNONE 
J090094N20GGACGGCCCAAATNONE 
J100021F03GGACGGCCCAAATNONE 
J100031M01GGACGGCCCAAATNONE 
J100033I18GGACGGCCCAAATNONE 
J100034P07GGACGGCCCAAATNONE 
J100043M16GGACGGCCCAAATNONE 
J100046J12GGACGGCCCAAATNONE 
J100055F09GGACGGCCCAAATNONE 
J100057D19GGACGGCCCAAATNONE 
J100060O10GGACGGCCCAAATNONE 
J100064G09GGACGGCCCAAATNONE 
J100077F24GGACGGCCCAAATNONE 
J100080E12GGACGGCCCAAATNONE 
J100089J04GGACGGCCCAAATNONE 
Os01g0706100AK072799CTTGGGCCGGTConserved hypothetical protein. 
J013049G14CTTGGGCCGGTNONE 
J023136E17CTTGGGCCGGTNONE 
Os01g0708700AK102451CAACGGCCCAAGIQ calmodulin-binding region domain containing protein. 
Os01g0733200AK066316GCGGCCCAAGCCCSimilar to Heat shock transcription factor 29 (Fragment). 
AY344493GCGGCCCAAGCCCNONE 
J013066G03GCGGCCCAAGCCCNONE 
J090034J08GCGGCCCAAGCCCNONE 
Os01g0738600AK073479GCGGCCCAAGENTH/VHS domain containing protein. 
AK120616GCGGCCCAAGNONE 
J013046M12GCGGCCCAAGNONE 
J013152B11GCGGCCCAAGNONE 
J023007A09GCGGCCCAAGNONE 
J023007N03GCGGCCCAAGNONE 
J023042A01GCGGCCCAAGNONE 
J023059P06GCGGCCCAAGNONE 
J023113A05GCGGCCCAAGNONE 
J033044K11GCGGCCCAAGNONE 
J033082E04GCGGCCCAAGNONE 
J090033B13GCGGCCCAAGNONE 
J090062H08GCGGCCCAAGNONE 
J100086G23GCGGCCCAAGNONE 
Os01g0761100AK122112GCGGCCCAACATesmin/TSO1-like, CXC domain containing protein. 
Os01g0764600AK060621GTTTGGGCCGAGAFosfomycin resistance kinase FomA family protein. 
J013111L18GTTTGGGCCGAGANONE 
J013134N08GTTTGGGCCGAGANONE 
Os01g0765000AK101905TTTTGGGCCGASimilar to Deoxycytidylate deaminase (EC 3.5.4.12) (dCMP deaminase). 
Os01g0772200AK060471GCGGCCCAAGTranscription initiation factor IIF, beta subunit family protein. 
AK103491GCGGCCCAAGNONE 
J023093E05GCGGCCCAAGNONE 
J023101M03GCGGCCCAAGNONE 
J033130N17GCGGCCCAAGNONE 
J043021L02GCGGCCCAAGNONE 
J065001E22GCGGCCCAAGNONE 
J065070G06GCGGCCCAAGNONE 
J065081D15GCGGCCCAAGNONE 
J065123G09GCGGCCCAAGNONE 
J065170K04GCGGCCCAAGNONE 
J065187A01GCGGCCCAAGNONE 
J065210E10GCGGCCCAAGNONE 
J075172K06GCGGCCCAAGNONE 
Os01g0773500009-029-F02TCCGGCCCAAATNONE 
AK062417TCCGGCCCAAATConserved hypothetical protein. 
Os01g0788900AK073287GCGGCCCAAACNONE 
Os01g0801700AK073813TTCGGCCCAAGGCCCConserved hypothetical protein. 
J033067K14TTCGGCCCAAGGCCCNONE 
Os01g0805800006-057-H04GCCGGCCCAAGNONE 
006-106-H01GCCGGCCCAAGNONE 
AK059963GCCGGCCCAAGNONE 
AK103408GCCGGCCCAAGRNA polymerase Rpb5, N-terminal domain containing protein. 
Os01g0821800015-005-A04TACGGCCCAATTNONE 
AK073951TACGGCCCAATTNONE 
AK103171TACGGCCCAATTNONE 
AK119168TACGGCCCAATTEndothelial monocyte-activating polypeptide II precursor pro-EMAP II family protein. 
J023031A22TACGGCCCAATTNONE 
J033098N09TACGGCCCAATTNONE 
J033121G11TACGGCCCAATTNONE 
J090030L03TACGGCCCAATTNONE 
Os01g0838800AK066366TTATGGGCCGTTGTTTGGGCTTTGGGCCGGANONE 
AK073775TTATGGGCCGTTGTTTGGGCTTTGGGCCGGAClathrin adaptor complex, small chain family protein. 
J013067M01TTATGGGCCGTTGTTTGGGCTTTGGGCCGGANONE 
J033030I24TTATGGGCCGTTGTTTGGGCTTTGGGCCGGANONE 
J090089A10TTATGGGCCGTTGTTTGGGCTTTGGGCCGGANONE 
Os01g0851100AK071217GCGGCCCAAGNONE 
Os01g0854800AK109676CTTGGGCCGASimilar to Cytochrome P450 86A1 (EC 1.14.-.-) (CYPLXXXVI) (P450-dependent fatty acid omega-hydroxylase). 
J100041A10CTTGGGCCGANONE 
Os01g0863166J065007F23CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
J065124H21CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGConserved hypothetical protein. 
Os01g0872700AK066633CTCGGCCCAAAANONE 
AK100381CTCGGCCCAAAAPutative 5-3 exonuclease domain containing protein. 
J013028K13CTCGGCCCAAAANONE 
J013038C19CTCGGCCCAAAANONE 
J023024P16CTCGGCCCAAAANONE 
J023074N21CTCGGCCCAAAANONE 
J023085E21CTCGGCCCAAAANONE 
J033034K14CTCGGCCCAAAANONE 
J033044N04CTCGGCCCAAAANONE 
J033052O10CTCGGCCCAAAANONE 
J033087J09CTCGGCCCAAAANONE 
J033129L17CTCGGCCCAAAANONE 
J033143O07CTCGGCCCAAAANONE 
J065014M22CTCGGCCCAAAANONE 
J065025H10CTCGGCCCAAAANONE 
J065051H21CTCGGCCCAAAANONE 
J065123E05CTCGGCCCAAAANONE 
J065181P03CTCGGCCCAAAANONE 
J100064B21CTCGGCCCAAAANONE 
Os01g0881100AK109822GCGGCCCAAACGGCCEpsin, N-terminal domain containing protein. 
Os01g0888700AK073376ACTGGGCCGGCCCAATProtein of unknown function RIO1 family protein. 
J033030B16ACTGGGCCGGCCCAATNONE 
J033098D06ACTGGGCCGGCCCAATNONE 
J033112A12ACTGGGCCGGCCCAATNONE 
J043003L24ACTGGGCCGGCCCAATNONE 
Os01g0888800AK070163TACGGCCCAAAAConserved hypothetical protein. 
J065181H02TACGGCCCAAAANONE 
Os01g0891400J065077E24TTTTGGGCCGAAConserved hypothetical protein. 
J065206I07TTTTGGGCCGAANONE 
Os01g0894700009-177-F04GCGGCCCAAACNONE 
AK067623GCGGCCCAAACConserved hypothetical protein. 
AK104876GCGGCCCAAACNONE 
J013095G01GCGGCCCAAACNONE 
J013108L20GCGGCCCAAACNONE 
J013120P13GCGGCCCAAACNONE 
Os01g0908800AK065889ATTTGGGCCGAProtein prenyltransferase domain containing protein. 
Os01g0913800011-060-B02ATTGGGCCGGGCCGANONE 
016-088-H02ATTGGGCCGGGCCGAProtein prenyltransferase domain containing protein. 
Os01g0915800AK103859TACGGCCCAATASimilar to FK506-binding protein 2-2 precursor (EC 5.2.1.8) (Peptidyl-prolyl cis- trans isomerase) (PPIase) (Rotamase) (15 kDa FKBP) (FKBP-15-2). 
AK103859TTTTGGGCCGGGCCCAAACSimilar to FK506-binding protein 2-2 precursor (EC 5.2.1.8) (Peptidyl-prolyl cis- trans isomerase) (PPIase) (Rotamase) (15 kDa FKBP) (FKBP-15-2). 
J090051E20TACGGCCCAATANONE 
J090051E20TTTTGGGCCGGGCCCAAACNONE 
J090056H03TACGGCCCAATANONE 
J090056H03TTTTGGGCCGGGCCCAAACNONE 
J090058L14TACGGCCCAATANONE 
J090058L14TTTTGGGCCGGGCCCAAACNONE 
J090058P16TACGGCCCAATANONE 
J090058P16TTTTGGGCCGGGCCCAAACNONE 
J090076C19TACGGCCCAATANONE 
J090076C19TTTTGGGCCGGGCCCAAACNONE 
J100086P14TACGGCCCAATANONE 
J100086P14TTTTGGGCCGGGCCCAAACNONE 
Os01g0920200AK120182AAACGGCCCAAAASimilar to E(Y)2 homolog (DC6) (Enhancer of yellow 2 homolog). 
J013034A14AAACGGCCCAAAANONE 
J013063O14AAACGGCCCAAAANONE 
J023023D20AAACGGCCCAAAANONE 
J075121J02AAACGGCCCAAAANONE 
Os01g0939100AK070064GTTTGGGCCGTASimilar to Calmodulin-stimulated calcium-ATPase. 
Os01g0939700AK059803GCGGCCCAAGNONE 
AK070588GCGGCCCAAGSimilar to Esterase D (EC 3.1.1.1). 
AK111469GCGGCCCAAGNONE 
J090021L11GCGGCCCAAGNONE 
Os01g0944700006-058-E06CTTGGGCCGTGGNONE 
006-065-A04CTTGGGCCGTGGNONE 
006-076-E07CTTGGGCCGTGGNONE 
006-087-A09CTTGGGCCGTGGNONE 
006-091-B05CTTGGGCCGTGGNONE 
006-105-C12CTTGGGCCGTGGNONE 
006-108-G03CTTGGGCCGTGGNONE 
006-113-C02CTTGGGCCGTGGNONE 
006-115-G03CTTGGGCCGTGGNONE 
009-047-H03CTTGGGCCGTGGNONE 
009-120-E11CTTGGGCCGTGGNONE 
009-195-C06CTTGGGCCGTGGNONE 
009-199-D12CTTGGGCCGTGGNONE 
013-006-E01CTTGGGCCGTGGNONE 
013-025-C06CTTGGGCCGTGGNONE 
013-035-D10CTTGGGCCGTGGNONE 
AF443600CTTGGGCCGTGGNONE 
AK070056CTTGGGCCGTGGSimilar to Beta-1,3-glucanase precursor. 
J013106C20CTTGGGCCGTGGNONE 
J023023O17CTTGGGCCGTGGNONE 
J023038J21CTTGGGCCGTGGNONE 
J023041A20CTTGGGCCGTGGNONE 
J023066P09CTTGGGCCGTGGNONE 
J023072F21CTTGGGCCGTGGNONE 
J023090L19CTTGGGCCGTGGNONE 
J023093M17CTTGGGCCGTGGNONE 
J023120D21CTTGGGCCGTGGNONE 
J023134O19CTTGGGCCGTGGNONE 
J023141D14CTTGGGCCGTGGNONE 
J033026N18CTTGGGCCGTGGNONE 
J033048M05CTTGGGCCGTGGNONE 
J033070N13CTTGGGCCGTGGNONE 
J033143C11CTTGGGCCGTGGNONE 
J033143O12CTTGGGCCGTGGNONE 
J043015L22CTTGGGCCGTGGNONE 
J053048D16CTTGGGCCGTGGNONE 
J053053L14CTTGGGCCGTGGNONE 
J053059O17CTTGGGCCGTGGNONE 
J053060N14CTTGGGCCGTGGNONE 
J053077B10CTTGGGCCGTGGNONE 
J053090L06CTTGGGCCGTGGNONE 
J053090M04CTTGGGCCGTGGNONE 
J075032N21CTTGGGCCGTGGNONE 
J075074O15CTTGGGCCGTGGNONE 
J075078I24CTTGGGCCGTGGNONE 
J090081N23CTTGGGCCGTGGNONE 
Os01g0946200AK071060CACGGCCCAAGNo apical meristem (NAM) protein domain containing protein. 
J023080K20CACGGCCCAAGNONE 
Os01g0949200AK102412ACCGGCCCAACTNONE 
J033093A04ACCGGCCCAACTNONE 
J065053P06ACCGGCCCAACTNONE 
J100086D18ACCGGCCCAACTNONE 
Os01g0949700AK069037GCCCGGCCCAATNONE 
J023004F17GCCCGGCCCAATNONE 
J065063D04GCCCGGCCCAATNONE 
J065196H02GCCCGGCCCAATNONE 
J075198A05GCCCGGCCCAATNONE 
Os01g0960300AK100099TGCGGCCCAAGSimilar to Glucose inhibited division protein A. 
Os01g0960800AK073977TTTGGGCCGAAProtein Transporter, Pam16 family protein. 
AY313247TTTGGGCCGAANONE 
J033075P16TTTGGGCCGAANONE 
J065051H06TTTGGGCCGAANONE 
J065167L02TTTGGGCCGAANONE 
J090083C22TTTGGGCCGAANONE 
Os01g0966200009-079-H11TGTTGGGCCGTANONE 
009-124-G10TGTTGGGCCGTANONE 
AK058564TGTTGGGCCGTAProtein of unknown function YGGT family protein. 
AK098935TGTTGGGCCGTANONE 
Os01g0971600AK070366GTTTGGGCCGAGSimilar to Sn-glycerol-3-phosphate dehydrogenase (Fragment). 
Os02g0116900009-017-C02GCCGGCCCAATNONE 
AK121401GCCGGCCCAATSimilar to 15.9 kDa subunit of RNA polymerase II. 
J013105H09GCCGGCCCAATNONE 
J023131N03GCCGGCCCAATNONE 
J033145N08GCCGGCCCAATNONE 
J065105G09GCCGGCCCAATNONE 
J075086L06GCCGGCCCAATNONE 
Os02g0119700AK108777CCACGGCCCAATAProtein prenyltransferase domain containing protein. 
Os02g0129900Os02g0129900TACGGCCCAACTPGAP1-like family protein. 
Os02g0133800006-092-D12TCGGCCCAAAANONE 
006-111-G01TCGGCCCAAAANONE 
AK103646TCGGCCCAAAANONE 
AK109376TCGGCCCAAAAProteasome subunit alpha type 1 (EC 3.4.25.1) (20S proteasome alpha subunit F) (20S proteasome subunit alpha-6) (Proteasome component C2). 
D37886TCGGCCCAAAANONE 
J033135B19TCGGCCCAAAANONE 
J065200F01TCGGCCCAAAANONE 
J065213J11TCGGCCCAAAANONE 
J075031N16TCGGCCCAAAANONE 
J075032N17TCGGCCCAAAANONE 
J075047P04TCGGCCCAAAANONE 
J075063D01TCGGCCCAAAANONE 
J075105F23TCGGCCCAAAANONE 
J075121E16TCGGCCCAAAANONE 
J075176F10TCGGCCCAAAANONE 
J075182M16TCGGCCCAAAANONE 
J075190E09TCGGCCCAAAANONE 
J075191B14TCGGCCCAAAANONE 
J100055J24TCGGCCCAAAANONE 
J100066H24TCGGCCCAAAANONE 
J100073N01TCGGCCCAAAANONE 
Os02g0135600AK069843TGCGGCCCAATTCAGCCCATGTConserved hypothetical protein. 
J023034H09TGCGGCCCAATTCAGCCCATGTNONE 
J033090D08TGCGGCCCAATTCAGCCCATGTNONE 
J100025N07TGCGGCCCAATTCAGCCCATGTNONE 
J100075G18TGCGGCCCAATTCAGCCCATGTNONE 
Os02g0135700AK100570ACATGGGCTGAATTGGGCCGCADNA polymerase V family protein. 
Os02g0158400006-048-F06ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
006-048-F06TGTTGGGCCGGGNONE 
AK061569ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCAssDNA-binding transcriptional regulator family protein. 
AK061569TGTTGGGCCGGGssDNA-binding transcriptional regulator family protein. 
AK099479ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
AK099479TGTTGGGCCGGGNONE 
AK104768ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
AK104768TGTTGGGCCGGGNONE 
J013025B22ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J013025B22TGTTGGGCCGGGNONE 
J023009C03ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J023009C03TGTTGGGCCGGGNONE 
J033115N14ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J033115N14TGTTGGGCCGGGNONE 
J065036F05ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J065036F05TGTTGGGCCGGGNONE 
J065191K17ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J065191K17TGTTGGGCCGGGNONE 
J065202K16ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J065202K16TGTTGGGCCGGGNONE 
J075053E14ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075053E14TGTTGGGCCGGGNONE 
J075101E04ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075101E04TGTTGGGCCGGGNONE 
J075111C06ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075111C06TGTTGGGCCGGGNONE 
J075137O04ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075137O04TGTTGGGCCGGGNONE 
J075139E07ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075139E07TGTTGGGCCGGGNONE 
J075143K07ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075143K07TGTTGGGCCGGGNONE 
J075144K15ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075144K15TGTTGGGCCGGGNONE 
J075164L14ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075164L14TGTTGGGCCGGGNONE 
J075199D06ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075199D06TGTTGGGCCGGGNONE 
J090010G24ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J090010G24TGTTGGGCCGGGNONE 
J090017C18ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J090017C18TGTTGGGCCGGGNONE 
J090066F01ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J090066F01TGTTGGGCCGGGNONE 
J090088G01ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J090088G01TGTTGGGCCGGGNONE 
Os02g0162500009-181-F03ACCGGCCCAATTNONE 
AK058907ACCGGCCCAATTNONE 
AK121223ACCGGCCCAATTSimilar to 40S ribosomal protein S14. 
J023090I10ACCGGCCCAATTNONE 
J023136J11ACCGGCCCAATTNONE 
J053097J20ACCGGCCCAATTNONE 
J053098F01ACCGGCCCAATTNONE 
J065065B09ACCGGCCCAATTNONE 
J065082M04ACCGGCCCAATTNONE 
J065188O05ACCGGCCCAATTNONE 
J075057P15ACCGGCCCAATTNONE 
J075061J08ACCGGCCCAATTNONE 
J075061N15ACCGGCCCAATTNONE 
J075131I08ACCGGCCCAATTNONE 
J075141H13ACCGGCCCAATTNONE 
J080062E14ACCGGCCCAATTNONE 
J080062P15ACCGGCCCAATTNONE 
J080318G17ACCGGCCCAATTNONE 
J080319G19ACCGGCCCAATTNONE 
J090001L10ACCGGCCCAATTNONE 
J090024I18ACCGGCCCAATTNONE 
J090033F24ACCGGCCCAATTNONE 
J090036M16ACCGGCCCAATTNONE 
J090040I24ACCGGCCCAATTNONE 
J090048P06ACCGGCCCAATTNONE 
J090049B12ACCGGCCCAATTNONE 
J090068C02ACCGGCCCAATTNONE 
J090069O04ACCGGCCCAATTNONE 
J090084H22ACCGGCCCAATTNONE 
J100022L03ACCGGCCCAATTNONE 
J100028O14ACCGGCCCAATTNONE 
J100028O18ACCGGCCCAATTNONE 
J100032A15ACCGGCCCAATTNONE 
J100033D21ACCGGCCCAATTNONE 
J100034J23ACCGGCCCAATTNONE 
J100043K22ACCGGCCCAATTNONE 
J100052M22ACCGGCCCAATTNONE 
J100053N03ACCGGCCCAATTNONE 
J100074N24ACCGGCCCAATTNONE 
J100082J10ACCGGCCCAATTNONE 
Os02g0179100AK058557TCCGGCCCAACAMetal-dependent phosphohydrolase, HD region domain containing protein. 
J080311O10TCCGGCCCAACANONE 
Os02g0188500AK102004AAACGGCCCAAAANONE 
AK106917AAACGGCCCAAAAUbiquitin domain containing protein. 
J090039N13AAACGGCCCAAAANONE 
Os02g0190900AK111037GCCCAATTTGGGCCGGGCCGTGPhytoene dehydrogenase-like protein. 
AK111037TTTTGGGCCGGGCCCATTAPhytoene dehydrogenase-like protein. 
Os02g0190950J075001E02CACGGCCCGGCCCAAATTGGGCConserved hypothetical protein. 
J075117E23CACGGCCCGGCCCAAATTGGGCNONE 
J075117F23CACGGCCCGGCCCAAATTGGGCNONE 
J075144M12CACGGCCCGGCCCAAATTGGGCNONE 
J075145H10CACGGCCCGGCCCAAATTGGGCNONE 
J075186B15CACGGCCCGGCCCAAATTGGGCNONE 
Os02g0192700004-020-H12TTTCGGCCCAACANONE 
006-024-H06TTTCGGCCCAACANONE 
006-042-F06TTTCGGCCCAACANONE 
006-050-D04TTTCGGCCCAACANONE 
006-059-E10TTTCGGCCCAACANONE 
006-070-B02TTTCGGCCCAACANONE 
006-084-A09TTTCGGCCCAACANONE 
006-114-E11TTTCGGCCCAACANONE 
006-117-E05TTTCGGCCCAACANONE 
009-126-D11TTTCGGCCCAACANONE 
AK061629TTTCGGCCCAACASimilar to Thioredoxin peroxidase. 
AK065909TTTCGGCCCAACANONE 
J013043E11TTTCGGCCCAACANONE 
J065038I09TTTCGGCCCAACANONE 
J065078C12TTTCGGCCCAACANONE 
J065122O14TTTCGGCCCAACANONE 
J065198H04TTTCGGCCCAACANONE 
Os02g0215950J090051K07GCGGCCCATACATTTGGGCCGGGConserved hypothetical protein. 
Os02g0219200016-016-C03AATTGGGCCGCANONE 
016-016-C03GTTTGGGCCGANONE 
AK059059AATTGGGCCGCASimilar to Beta-galactosidase precursor (EC 3.2.1.23) (Lactase) (Acid beta- galactosidase) (Exo-(1-->4)-beta-D-galactanase). 
AK059059GTTTGGGCCGASimilar to Beta-galactosidase precursor (EC 3.2.1.23) (Lactase) (Acid beta- galactosidase) (Exo-(1-->4)-beta-D-galactanase). 
Os02g0241100Os02g0241100TTCGGCCCAAAAProtein kinase-like domain containing protein. 
Os02g0250600J075143F23AGTTGGGCCGTCLate embryogenesis abundant protein repeat containing protein. 
Os02g0301400AK121646GCGGCCCAAGThioredoxin-like fold domain containing protein. 
J033028E10GCGGCCCAAGNONE 
J033058J23GCGGCCCAAGNONE 
Os02g0304800Os02g0304800GGCCCGGCCCAAATProtein prenyltransferase domain containing protein. 
Os02g0312700AK072956CACGGCCCAAAGTCCCACCATP11 family protein. 
AK102909CACGGCCCAAAGTCCCACCNONE 
J065017G18CACGGCCCAAAGTCCCACCNONE 
J075066A05CACGGCCCAAAGTCCCACCNONE 
Os02g0445700011-046-C10GCGGCCCAAGNONE 
Os02g0461200012-026-A12CACGGCCCAACTNONE 
AK063459CACGGCCCAACTConserved hypothetical protein. 
J065183F11CACGGCCCAACTNONE 
J075190G18CACGGCCCAACTNONE 
Os02g0537500AK068689TCCGGCCCATTGGGCCGCSimilar to E2F homolog. 
Os02g0565000AK120665TCCGTCCGGCCCAACAHomeodomain-like containing protein. 
J100070C12TCCGTCCGGCCCAACANONE 
J100074L08TCCGTCCGGCCCAACANONE 
Os02g0593400016-051-C08CTTGGGCCGGCCCNONE 
AK064226CTTGGGCCGGCCCNONE 
AK072362CTTGGGCCGGCCCConserved hypothetical protein. 
AK109015CTTGGGCCGGCCCNONE 
J023063B12CTTGGGCCGGCCCNONE 
J065192M02CTTGGGCCGGCCCNONE 
J075182N05CTTGGGCCGGCCCNONE 
Os02g0593900Os02g0593900TATTGGGCCGAAAMethyltransferases-related family protein. 
Os02g0616600AK106681CCGAGCCGGCCCAAATCGGCCCACACConserved hypothetical protein. 
J065062G16CCGAGCCGGCCCAAATCGGCCCACACNONE 
Os02g0621500AK120798TTTCGGCCCAACCZinc finger, RING-type domain containing protein. 
Os02g0629800AK121915ATTGGGCCGGTSimilar to Defensin precursor. 
J033106C08ATTGGGCCGGTNONE 
J065053G20ATTGGGCCGGTNONE 
J065114P06ATTGGGCCGGTNONE 
J065174H18ATTGGGCCGGTNONE 
J065183J04ATTGGGCCGGTNONE 
J080310C15ATTGGGCCGGTNONE 
Os02g0633200012-053-F09CACGGCCCAATAGGCCCATTANONE 
015-051-C09CACGGCCCAATAGGCCCATTANONE 
AK063500CACGGCCCAATAGGCCCATTAProtein prenyltransferase domain containing protein. 
J065019K23CACGGCCCAATAGGCCCATTANONE 
J065205C16CACGGCCCAATAGGCCCATTANONE 
Os02g0634800003-004-F03CTTGGGCCGGANONE 
AK059694CTTGGGCCGGAUbiquitin-conjugating enzyme, E2 domain containing protein. 
J013067H17CTTGGGCCGGANONE 
J053077G20CTTGGGCCGGANONE 
J075195F14CTTGGGCCGGANONE 
Os02g0634900006-032-G12TCCGGCCCAAGNONE 
006-033-E09TCCGGCCCAAGNONE 
006-117-F10TCCGGCCCAAGNONE 
006-118-E01TCCGGCCCAAGNONE 
013-056-G08TCCGGCCCAAGNONE 
AK059769TCCGGCCCAAGNONE 
AK068583TCCGGCCCAAGNONE 
AK072855TCCGGCCCAAGProteasome subunit alpha type 2 (EC 3.4.25.1) (20S proteasome alpha subunit B) (20S proteasome subunit alpha-2). 
AK106210TCCGGCCCAAGNONE 
J023138P05TCCGGCCCAAGNONE 
J023143J07TCCGGCCCAAGNONE 
J033022O09TCCGGCCCAAGNONE 
J033111L02TCCGGCCCAAGNONE 
J033135O03TCCGGCCCAAGNONE 
J065005K19TCCGGCCCAAGNONE 
J065044C17TCCGGCCCAAGNONE 
J065116K09TCCGGCCCAAGNONE 
J065119O21TCCGGCCCAAGNONE 
J075014L05TCCGGCCCAAGNONE 
J075109H16TCCGGCCCAAGNONE 
J075117D04TCCGGCCCAAGNONE 
Os02g0638000AK103830ACATGGGCCGAGATCGGCCCAACTNONE 
AK106548ACATGGGCCGAGATCGGCCCAACTConserved hypothetical protein. 
Os02g0655300006-024-H05TACGGCCCAAGNONE 
006-032-G04TACGGCCCAAGNONE 
006-045-F03TACGGCCCAAGNONE 
006-076-D04TACGGCCCAAGNONE 
006-086-C09TACGGCCCAAGNONE 
006-104-C07TACGGCCCAAGNONE 
AK061544TACGGCCCAAGNONE 
AK103778TACGGCCCAAGNONE 
AK106107TACGGCCCAAGNONE 
AK120006TACGGCCCAAGNONE 
AY363174TACGGCCCAAGSimilar to 3-isopropylmalate dehydratase, small subunit. 
J033145B21TACGGCCCAAGNONE 
J065021C16TACGGCCCAAGNONE 
J065182F01TACGGCCCAAGNONE 
J075063I18TACGGCCCAAGNONE 
J075151E01TACGGCCCAAGNONE 
J075198K18TACGGCCCAAGNONE 
J090026M06TACGGCCCAAGNONE 
J090081H02TACGGCCCAAGNONE 
J100061E20TACGGCCCAAGNONE 
Os02g0682600AK108470TACGGCCCAATTZinc finger, Tim10/DDP-type family protein. 
J065019B06TACGGCCCAATTNONE 
J065065L01TACGGCCCAATTNONE 
Os02g0697200015-013-B10TGTTGGGCCGGTNONE 
AK059475TGTTGGGCCGGTNONE 
AK102993TGTTGGGCCGGTConserved hypothetical protein. 
J033079I18TGTTGGGCCGGTNONE 
J033082A14TGTTGGGCCGGTNONE 
J065047H08TGTTGGGCCGGTNONE 
J065131M14TGTTGGGCCGGTNONE 
Os02g0697600011-021-B01CTTGGGCCGCANONE 
AK121757CTTGGGCCGCAAAA ATPase domain containing protein. 
Os02g0705300006-028-G05TGTTGGGCCGCNONE 
006-064-H09TGTTGGGCCGCNONE 
AK062089TGTTGGGCCGCNONE 
AK064855TGTTGGGCCGCNONE 
AK106164TGTTGGGCCGCTubby family protein. 
Os02g0723200AK108140GCGGCCCAACCSimilar to Alpha galactosyltransferase (Fragment). 
J090087D22GCGGCCCAACCNONE 
Os02g0727500009-018-G06CACGGCCCAATTNONE 
AK121427CACGGCCCAATTConserved hypothetical protein. 
J023136B21CACGGCCCAATTNONE 
J033044C13CACGGCCCAATTNONE 
J043037O12CACGGCCCAATTNONE 
J053072C14CACGGCCCAATTNONE 
J065008B15CACGGCCCAATTNONE 
J065033I12CACGGCCCAATTNONE 
J065077I18CACGGCCCAATTNONE 
J065149G03CACGGCCCAATTNONE 
J065159H07CACGGCCCAATTNONE 
J065162I17CACGGCCCAATTNONE 
J065168H02CACGGCCCAATTNONE 
J065176N09CACGGCCCAATTNONE 
J065178K23CACGGCCCAATTNONE 
J065216N03CACGGCCCAATTNONE 
J080001G08CACGGCCCAATTNONE 
J080002C09CACGGCCCAATTNONE 
J080007N17CACGGCCCAATTNONE 
J080009B04CACGGCCCAATTNONE 
J080009B17CACGGCCCAATTNONE 
J080011O15CACGGCCCAATTNONE 
J080022B06CACGGCCCAATTNONE 
J080022C13CACGGCCCAATTNONE 
J080024L04CACGGCCCAATTNONE 
J080031G21CACGGCCCAATTNONE 
J080035N14CACGGCCCAATTNONE 
J080036O14CACGGCCCAATTNONE 
J080040P10CACGGCCCAATTNONE 
J080042D03CACGGCCCAATTNONE 
J080042H05CACGGCCCAATTNONE 
J080042I20CACGGCCCAATTNONE 
J080043A01CACGGCCCAATTNONE 
J080043F17CACGGCCCAATTNONE 
J080046I19CACGGCCCAATTNONE 
J080053L20CACGGCCCAATTNONE 
J080055A20CACGGCCCAATTNONE 
J080055F01CACGGCCCAATTNONE 
J080056L02CACGGCCCAATTNONE 
J080058H02CACGGCCCAATTNONE 
J080059F11CACGGCCCAATTNONE 
J080062C03CACGGCCCAATTNONE 
J080064A07CACGGCCCAATTNONE 
J080064K15CACGGCCCAATTNONE 
J080067M17CACGGCCCAATTNONE 
J080067N17CACGGCCCAATTNONE 
J080068G07CACGGCCCAATTNONE 
J080069H15CACGGCCCAATTNONE 
J080069L08CACGGCCCAATTNONE 
J080069L20CACGGCCCAATTNONE 
J080069L21CACGGCCCAATTNONE 
J080069N20CACGGCCCAATTNONE 
J080071N24CACGGCCCAATTNONE 
J080074K17CACGGCCCAATTNONE 
J080076H08CACGGCCCAATTNONE 
J080082F19CACGGCCCAATTNONE 
J080086O16CACGGCCCAATTNONE 
J090025A19CACGGCCCAATTNONE 
J090025M06CACGGCCCAATTNONE 
J090070D02CACGGCCCAATTNONE 
Os02g0736500AK065166GTTTGGGCCGGGCNicastrin family protein. 
J013099D16GTTTGGGCCGGGCNONE 
Os02g0741500AK068867CCATGGGCCTTGGGCCGAGRibbon-helix-helix domain containing protein. 
AK068867TCCGGCCCAAACRibbon-helix-helix domain containing protein. 
Os02g0744000AK064898TCCGGCCCAAACConserved hypothetical protein. 
AK104827TCCGGCCCAAACNONE 
J013000L12TCCGGCCCAAACNONE 
J013156N02TCCGGCCCAAACNONE 
J065001H14TCCGGCCCAAACNONE 
J065038D18TCCGGCCCAAACNONE 
J065039I18TCCGGCCCAAACNONE 
J065047C13TCCGGCCCAAACNONE 
J065053J09TCCGGCCCAAACNONE 
J065064G03TCCGGCCCAAACNONE 
J065066M05TCCGGCCCAAACNONE 
J065068O10TCCGGCCCAAACNONE 
J065090H22TCCGGCCCAAACNONE 
J065113L19TCCGGCCCAAACNONE 
J065121M02TCCGGCCCAAACNONE 
J065122K23TCCGGCCCAAACNONE 
J065138C12TCCGGCCCAAACNONE 
J065153E14TCCGGCCCAAACNONE 
J065156N12TCCGGCCCAAACNONE 
J065158L20TCCGGCCCAAACNONE 
J065166I06TCCGGCCCAAACNONE 
J065174L15TCCGGCCCAAACNONE 
J065175N03TCCGGCCCAAACNONE 
J090092C23TCCGGCCCAAACNONE 
Os02g0750500AK101960TACGGCCCGGCCCAATASAM (and some other nucleotide) binding motif domain containing protein. 
J033075P05TACGGCCCGGCCCAATANONE 
J065054F02TACGGCCCGGCCCAATANONE 
J065124N03TACGGCCCGGCCCAATANONE 
J090001H12TACGGCCCGGCCCAATANONE 
J100057J01TACGGCCCGGCCCAATANONE 
J100062F12TACGGCCCGGCCCAATANONE 
Os02g0752300AK072544AACGGCCCAACCConserved hypothetical protein. 
AK072544GCGGCCCAAATConserved hypothetical protein. 
J023132N16AACGGCCCAACCNONE 
J023132N16GCGGCCCAAATNONE 
J033069F17AACGGCCCAACCNONE 
J033069F17GCGGCCCAAATNONE 
Os02g0768600006-034-F01TCTGGCCCGGCCCAAACNONE 
006-046-G07TCTGGCCCGGCCCAAACNONE 
006-054-C07TCTGGCCCGGCCCAAACNONE 
006-056-F07TCTGGCCCGGCCCAAACNONE 
006-100-C02TCTGGCCCGGCCCAAACNONE 
AK059725TCTGGCCCGGCCCAAACNONE 
AK098996TCTGGCCCGGCCCAAACNONE 
AK099120TCTGGCCCGGCCCAAACNONE 
AK104659TCTGGCCCGGCCCAAACNONE 
J065043H04TCTGGCCCGGCCCAAACNONE 
J075034N21TCTGGCCCGGCCCAAACNONE 
J075145C18TCTGGCCCGGCCCAAACNONE 
J080016H01TCTGGCCCGGCCCAAACNONE 
J080040F01TCTGGCCCGGCCCAAACNONE 
J080047L23TCTGGCCCGGCCCAAACNONE 
J080049B22TCTGGCCCGGCCCAAACNONE 
J080062J16TCTGGCCCGGCCCAAACNONE 
J080064C23TCTGGCCCGGCCCAAACNONE 
J080064L22TCTGGCCCGGCCCAAACNONE 
J080077N01TCTGGCCCGGCCCAAACNONE 
J080097G17TCTGGCCCGGCCCAAACNONE 
J100065L15TCTGGCCCGGCCCAAACNONE 
J100066K23TCTGGCCCGGCCCAAACNONE 
J100088C07TCTGGCCCGGCCCAAACNONE 
J100090H09TCTGGCCCGGCCCAAACNONE 
Os02g0775900AK119974GGTTGGGCCGGAConserved hypothetical protein. 
Os02g0778200AK065948ACCGGCCCAAGTTGGCCCAAGAminoacyl-tRNA synthetase, class I family protein. 
Os02g0780500AK072784CTTGGGCCGGANONE 
AK072784GCTGGGCCGGCCCAACNONE 
AK121143CTTGGGCCGGAConserved hypothetical protein. 
AK121143GCTGGGCCGGCCCAACConserved hypothetical protein. 
J023075M13CTTGGGCCGGANONE 
J023075M13GCTGGGCCGGCCCAACNONE 
J023077P14CTTGGGCCGGANONE 
J023077P14GCTGGGCCGGCCCAACNONE 
J023123C16CTTGGGCCGGANONE 
J023123C16GCTGGGCCGGCCCAACNONE 
J023142P06CTTGGGCCGGANONE 
J023142P06GCTGGGCCGGCCCAACNONE 
Os02g0782500013-043-A07TTCGGCCCAATNONE 
013-068-B10TTCGGCCCAATNONE 
013-093-A08TTCGGCCCAATNONE 
014-083-C12TTCGGCCCAATNONE 
AK063602TTCGGCCCAATNONE 
AK119261TTCGGCCCAATSimilar to Small heat stress protein class CIII. 
J065013N12TTCGGCCCAATNONE 
J075136E01TTCGGCCCAATNONE 
J075149G04TTCGGCCCAATNONE 
Os02g0788500006-024-A02AAACGGCCCAAGNONE 
006-031-G02AAACGGCCCAAGNONE 
006-081-F11AAACGGCCCAAGNONE 
006-082-H05AAACGGCCCAAGNONE 
AK061452AAACGGCCCAAGConserved hypothetical protein. 
AK104117AAACGGCCCAAGNONE 
AK104526AAACGGCCCAAGNONE 
J075024D11AAACGGCCCAAGNONE 
J075056B12AAACGGCCCAAGNONE 
J075108H12AAACGGCCCAAGNONE 
J075156P10AAACGGCCCAAGNONE 
J075197A19AAACGGCCCAAGNONE 
Os02g0801900006-113-E02CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
AK109488CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
AK109498CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGConserved hypothetical protein. 
J065007D19CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
J065035G11CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
J065044E05CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
J065112N01CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
J065143B03CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
J065159A16CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
J090007K23CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
J090045N09CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
J090049L20CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
Os02g0810300AK059363TCGGCCCAAGGCCCAGTASimilar to NBD-like protein. 
AK099203TCGGCCCAAGGCCCAGTANONE 
Os02g0814800AK109850ATTTGGGCCGTGGlutathione S-transferase, C-terminal-like domain containing protein. 
Os02g0815500AK099733CCCGGCCCAATTAlcohol dehydrogenase class III (EC 1.1.1.1) (Glutathione-dependent formaldehyde dehydrogenase) (EC 1.2.1.1) (FDH) (FALDH) (GSH-FDH). 
J013089P19CCCGGCCCAATTNONE 
J043022H19CCCGGCCCAATTNONE 
J065008L14CCCGGCCCAATTNONE 
J065016G09CCCGGCCCAATTNONE 
J065023C22CCCGGCCCAATTNONE 
J065024K13CCCGGCCCAATTNONE 
J065043D14CCCGGCCCAATTNONE 
J065052K16CCCGGCCCAATTNONE 
J065058D17CCCGGCCCAATTNONE 
J065087L03CCCGGCCCAATTNONE 
J065107H15CCCGGCCCAATTNONE 
J065110E12CCCGGCCCAATTNONE 
J065124P14CCCGGCCCAATTNONE 
J065131B20CCCGGCCCAATTNONE 
J065155I10CCCGGCCCAATTNONE 
J065172J02CCCGGCCCAATTNONE 
J065184D04CCCGGCCCAATTNONE 
J065189D21CCCGGCCCAATTNONE 
J065201O14CCCGGCCCAATTNONE 
J065203D20CCCGGCCCAATTNONE 
J065206M13CCCGGCCCAATTNONE 
J065211E14CCCGGCCCAATTNONE 
J065217J21CCCGGCCCAATTNONE 
J090004A20CCCGGCCCAATTNONE 
Os02g0819700AK067374GTTTGGGCCGAAZinc finger, Zim17-type family protein. 
AK099160GTTTGGGCCGAANONE 
J100086K17GTTTGGGCCGAANONE 
Os02g0823600AK070498AGTTGGGCCGTTGGConserved hypothetical protein. 
AK070498TCCGGCCCAAAConserved hypothetical protein. 
J065055C02AGTTGGGCCGTTGGNONE 
J065055C02TCCGGCCCAAANONE 
J065098A17AGTTGGGCCGTTGGNONE 
J065098A17TCCGGCCCAAANONE 
J065119B13AGTTGGGCCGTTGGNONE 
J065119B13TCCGGCCCAAANONE 
J065146F10AGTTGGGCCGTTGGNONE 
J065146F10TCCGGCCCAAANONE 
J065209G06AGTTGGGCCGTTGGNONE 
J065209G06TCCGGCCCAAANONE 
J080001K12AGTTGGGCCGTTGGNONE 
J080001K12TCCGGCCCAAANONE 
J080004O17AGTTGGGCCGTTGGNONE 
J080004O17TCCGGCCCAAANONE 
J080005P21AGTTGGGCCGTTGGNONE 
J080005P21TCCGGCCCAAANONE 
J080009M18AGTTGGGCCGTTGGNONE 
J080009M18TCCGGCCCAAANONE 
J080013O18AGTTGGGCCGTTGGNONE 
J080013O18TCCGGCCCAAANONE 
J080014B04AGTTGGGCCGTTGGNONE 
J080014B04TCCGGCCCAAANONE 
J080014O21AGTTGGGCCGTTGGNONE 
J080014O21TCCGGCCCAAANONE 
J080015B04AGTTGGGCCGTTGGNONE 
J080015B04TCCGGCCCAAANONE 
J080016B17AGTTGGGCCGTTGGNONE 
J080016B17TCCGGCCCAAANONE 
J080017G09AGTTGGGCCGTTGGNONE 
J080017G09TCCGGCCCAAANONE 
J080022A17AGTTGGGCCGTTGGNONE 
J080022A17TCCGGCCCAAANONE 
J080024M10AGTTGGGCCGTTGGNONE 
J080024M10TCCGGCCCAAANONE 
J080025F17AGTTGGGCCGTTGGNONE 
J080025F17TCCGGCCCAAANONE 
J080025O16AGTTGGGCCGTTGGNONE 
J080025O16TCCGGCCCAAANONE 
J080029H09AGTTGGGCCGTTGGNONE 
J080029H09TCCGGCCCAAANONE 
J080030G24AGTTGGGCCGTTGGNONE 
J080030G24TCCGGCCCAAANONE 
J080031E02AGTTGGGCCGTTGGNONE 
J080031E02TCCGGCCCAAANONE 
J080032A18AGTTGGGCCGTTGGNONE 
J080032A18TCCGGCCCAAANONE 
J080032G24AGTTGGGCCGTTGGNONE 
J080032G24TCCGGCCCAAANONE 
J080033C05AGTTGGGCCGTTGGNONE 
J080033C05TCCGGCCCAAANONE 
J080033N19AGTTGGGCCGTTGGNONE 
J080033N19TCCGGCCCAAANONE 
J080035H10AGTTGGGCCGTTGGNONE 
J080035H10TCCGGCCCAAANONE 
J080035L05AGTTGGGCCGTTGGNONE 
J080035L05TCCGGCCCAAANONE 
J080042N09AGTTGGGCCGTTGGNONE 
J080042N09TCCGGCCCAAANONE 
J080044C14AGTTGGGCCGTTGGNONE 
J080044C14TCCGGCCCAAANONE 
J080048K16AGTTGGGCCGTTGGNONE 
J080048K16TCCGGCCCAAANONE 
J080050L07AGTTGGGCCGTTGGNONE 
J080050L07TCCGGCCCAAANONE 
J080051L06AGTTGGGCCGTTGGNONE 
J080051L06TCCGGCCCAAANONE 
J080051P22AGTTGGGCCGTTGGNONE 
J080051P22TCCGGCCCAAANONE 
J080053D09AGTTGGGCCGTTGGNONE 
J080053D09TCCGGCCCAAANONE 
J080053J15AGTTGGGCCGTTGGNONE 
J080053J15TCCGGCCCAAANONE 
J080053O12AGTTGGGCCGTTGGNONE 
J080053O12TCCGGCCCAAANONE 
J080057L01AGTTGGGCCGTTGGNONE 
J080057L01TCCGGCCCAAANONE 
J080062E08AGTTGGGCCGTTGGNONE 
J080062E08TCCGGCCCAAANONE 
J080062I09AGTTGGGCCGTTGGNONE 
J080062I09TCCGGCCCAAANONE 
J080063A21AGTTGGGCCGTTGGNONE 
J080063A21TCCGGCCCAAANONE 
J080063E04AGTTGGGCCGTTGGNONE 
J080063E04TCCGGCCCAAANONE 
J080063E08AGTTGGGCCGTTGGNONE 
J080063E08TCCGGCCCAAANONE 
J080064D15AGTTGGGCCGTTGGNONE 
J080064D15TCCGGCCCAAANONE 
J080064N15AGTTGGGCCGTTGGNONE 
J080064N15TCCGGCCCAAANONE 
J080068F13AGTTGGGCCGTTGGNONE 
J080068F13TCCGGCCCAAANONE 
J080070L16AGTTGGGCCGTTGGNONE 
J080070L16TCCGGCCCAAANONE 
J080072O17AGTTGGGCCGTTGGNONE 
J080072O17TCCGGCCCAAANONE 
J080075A07AGTTGGGCCGTTGGNONE 
J080075A07TCCGGCCCAAANONE 
J080076H10AGTTGGGCCGTTGGNONE 
J080076H10TCCGGCCCAAANONE 
J080077K19AGTTGGGCCGTTGGNONE 
J080077K19TCCGGCCCAAANONE 
J080078E19AGTTGGGCCGTTGGNONE 
J080078E19TCCGGCCCAAANONE 
J080082A02AGTTGGGCCGTTGGNONE 
J080082A02TCCGGCCCAAANONE 
J080083O05AGTTGGGCCGTTGGNONE 
J080083O05TCCGGCCCAAANONE 
J080091I07AGTTGGGCCGTTGGNONE 
J080091I07TCCGGCCCAAANONE 
J080094K10AGTTGGGCCGTTGGNONE 
J080094K10TCCGGCCCAAANONE 
J080094N03AGTTGGGCCGTTGGNONE 
J080094N03TCCGGCCCAAANONE 
J080096F09AGTTGGGCCGTTGGNONE 
J080096F09TCCGGCCCAAANONE 
J080097O04AGTTGGGCCGTTGGNONE 
J080097O04TCCGGCCCAAANONE 
J090037B19AGTTGGGCCGTTGGNONE 
J090037B19TCCGGCCCAAANONE 
J100017A13AGTTGGGCCGTTGGNONE 
J100017A13TCCGGCCCAAANONE 
J100068N22AGTTGGGCCGTTGGNONE 
J100068N22TCCGGCCCAAANONE 
J100072C06AGTTGGGCCGTTGGNONE 
J100072C06TCCGGCCCAAANONE 
Os02g0824700009-023-E06AATTGGGCCGCSimilar to Vacuolar ATP synthase subunit F (EC 3.6.3.14) (V-ATPase F subunit) (Vacuolar proton pump F subunit) (V-ATPase 14 kDa subunit). 
J065010L18AATTGGGCCGCNONE 
J065017H21AATTGGGCCGCNONE 
J065052N02AATTGGGCCGCNONE 
J065053M01AATTGGGCCGCNONE 
J065064B14AATTGGGCCGCNONE 
J065146K22AATTGGGCCGCNONE 
Os02g0834700AK061331CTCGGCCCAAATNONE 
AK067965CTCGGCCCAAATSimilar to Cell division inhibitor. 
Os03g0113700AK103835AGTTGGGCCGGGCCGTGGSimilar to Heat shock 70 kDa protein, mitochondrial precursor. 
AK103835CCTGGGCCGGCCCAAAASimilar to Heat shock 70 kDa protein, mitochondrial precursor. 
Os03g0113800AK065925CCACGGCCCGGCCCAACTProtein prenyltransferase domain containing protein. 
AK065925TTTTGGGCCGGCCCAGGProtein prenyltransferase domain containing protein. 
J013047E20CCACGGCCCGGCCCAACTNONE 
J013047E20TTTTGGGCCGGCCCAGGNONE 
J065026F21CCACGGCCCGGCCCAACTNONE 
J065026F21TTTTGGGCCGGCCCAGGNONE 
J065047B03CCACGGCCCGGCCCAACTNONE 
J065047B03TTTTGGGCCGGCCCAGGNONE 
J065054J12CCACGGCCCGGCCCAACTNONE 
J065054J12TTTTGGGCCGGCCCAGGNONE 
J065079M24CCACGGCCCGGCCCAACTNONE 
J065079M24TTTTGGGCCGGCCCAGGNONE 
J065093M07CCACGGCCCGGCCCAACTNONE 
J065093M07TTTTGGGCCGGCCCAGGNONE 
J065153F02CCACGGCCCGGCCCAACTNONE 
J065153F02TTTTGGGCCGGCCCAGGNONE 
J065155E21CCACGGCCCGGCCCAACTNONE 
J065155E21TTTTGGGCCGGCCCAGGNONE 
J065179H15CCACGGCCCGGCCCAACTNONE 
J065179H15TTTTGGGCCGGCCCAGGNONE 
J075019N02CCACGGCCCGGCCCAACTNONE 
J075019N02TTTTGGGCCGGCCCAGGNONE 
J075089E01CCACGGCCCGGCCCAACTNONE 
J075089E01TTTTGGGCCGGCCCAGGNONE 
J090066I18CCACGGCCCGGCCCAACTNONE 
J090066I18TTTTGGGCCGGCCCAGGNONE 
J090087K20CCACGGCCCGGCCCAACTNONE 
J090087K20TTTTGGGCCGGCCCAGGNONE 
J100079F05CCACGGCCCGGCCCAACTNONE 
J100079F05TTTTGGGCCGGCCCAGGNONE 
Os03g0115200009-112-E09TTTCGGCCCAATANONE 
AK071287TTTCGGCCCAATASimilar to Partner of Nob1; Pno1p; Yor145cp like KH domain containing protein, transcripts identified by EST. 
J023088J06TTTCGGCCCAATANONE 
J065075D17TTTCGGCCCAATANONE 
J065108G15TTTCGGCCCAATANONE 
J065165A16TTTCGGCCCAATANONE 
J075015O12TTTCGGCCCAATANONE 
J075022O06TTTCGGCCCAATANONE 
J075031H14TTTCGGCCCAATANONE 
J075033D10TTTCGGCCCAATANONE 
J075070A04TTTCGGCCCAATANONE 
J075127A05TTTCGGCCCAATANONE 
J100070B16TTTCGGCCCAATANONE 
Os03g0116500AF106844GCCGGCCCAATANONE 
AK101870GCCGGCCCAATAConstitutive photomorphogenic 11. 
J023055L16GCCGGCCCAATANONE 
J023088I16GCCGGCCCAATANONE 
J033070E21GCCGGCCCAATANONE 
J065124N22GCCGGCCCAATANONE 
J075152A19GCCGGCCCAATANONE 
J075181J21GCCGGCCCAATANONE 
J090011F23GCCGGCCCAATANONE 
Os03g0124300AK069148CCACGGCCCAAACConserved hypothetical protein. 
AK106076CCACGGCCCAAACNONE 
J023003G19CCACGGCCCAAACNONE 
Os03g0132900006-025-D05CACGGCCCAAGNONE 
006-080-C01CACGGCCCAAGNONE 
AF001501CACGGCCCAAGNONE 
AK059871CACGGCCCAAGNONE 
AK099355CACGGCCCAAGSimilar to Chitinase (EC 3.2.1.14) (Fragment). 
J033022O03CACGGCCCAAGNONE 
J033044P19CACGGCCCAAGNONE 
J033119B12CACGGCCCAAGNONE 
J075009H20CACGGCCCAAGNONE 
J075122E04CACGGCCCAAGNONE 
J075161D07CACGGCCCAAGNONE 
Os03g0133300AK064510TGTTGGGCCGGGCCGAConserved hypothetical protein. 
Os03g0135600J065183G03TCCGGCCCAAAAnkyrin repeat containing protein. 
Os03g0138600Os03g0138600AGTTGGGCCGAAGAAGCCCATAProtein of unknown function DUF810 family protein. 
Os03g0146400AK111974GCGGCCCAAGSimilar to Lethal leaf-spot 1 (Fragment). 
AK120554GCGGCCCAAGNONE 
J075060J10GCGGCCCAAGNONE 
Os03g0153900015-084-H06GTTTGGGCCGTANONE 
AK106420GTTTGGGCCGTAAromatic-ring hydroxylase family protein. 
Os03g0159700012-100-B09TTTTGGGCCGTANONE 
AK063559TTTTGGGCCGTAProtein prenyltransferase domain containing protein. 
J065197I24TTTTGGGCCGTANONE 
J090089G20TTTTGGGCCGTANONE 
Os03g0161400Os03g0161400TCGGCCCAACCIQ calmodulin-binding region domain containing protein. 
Os03g0162200009-031-E05GTTTGGGCCGAGNONE 
013-049-D04GTTTGGGCCGAGNONE 
013-082-E03GTTTGGGCCGAGNONE 
014-039-G04GTTTGGGCCGAGNONE 
014-098-G11GTTTGGGCCGAGNONE 
AK061605GTTTGGGCCGAGNONE 
AK121533GTTTGGGCCGAGSimilar to Histone H2A. 
J033024D06GTTTGGGCCGAGNONE 
J033030P21GTTTGGGCCGAGNONE 
J065063C20GTTTGGGCCGAGNONE 
J065064A18GTTTGGGCCGAGNONE 
J065147G02GTTTGGGCCGAGNONE 
J065204K06GTTTGGGCCGAGNONE 
J090004C22GTTTGGGCCGAGNONE 
J090014K02GTTTGGGCCGAGNONE 
J090074E10GTTTGGGCCGAGNONE 
J090086L09GTTTGGGCCGAGNONE 
Os03g0167600AK121254TTTGGGCCGCSimilar to Male sterility protein 2. 
Os03g0172200AK069130AATTGGGCCGGCArmadillo-like helical domain containing protein. 
Os03g0181600AK067807TACGGCCCAACTSimilar to GATA transcription factor 25 (ZIM-like 2 protein). 
AK101197TACGGCCCAACTNONE 
Os03g0182600006-028-E05CTTGGGCCGGCCCATGNONE 
006-047-F10CTTGGGCCGGCCCATGNONE 
009-123-C08CTTGGGCCGGCCCATGNONE 
016-033-G05CTTGGGCCGGCCCATGNONE 
AK061289CTTGGGCCGGCCCATGRibosomal protein S2 family protein. 
AK066899CTTGGGCCGGCCCATGNONE 
J013065H05CTTGGGCCGGCCCATGNONE 
J023012F15CTTGGGCCGGCCCATGNONE 
J023065M10CTTGGGCCGGCCCATGNONE 
J033079N15CTTGGGCCGGCCCATGNONE 
J033109E21CTTGGGCCGGCCCATGNONE 
J033148M14CTTGGGCCGGCCCATGNONE 
J043015G23CTTGGGCCGGCCCATGNONE 
J043022M01CTTGGGCCGGCCCATGNONE 
J053060D01CTTGGGCCGGCCCATGNONE 
J053062E24CTTGGGCCGGCCCATGNONE 
J053096N12CTTGGGCCGGCCCATGNONE 
J053098N02CTTGGGCCGGCCCATGNONE 
J090024N09CTTGGGCCGGCCCATGNONE 
J090027G22CTTGGGCCGGCCCATGNONE 
J090043C10CTTGGGCCGGCCCATGNONE 
J090063F05CTTGGGCCGGCCCATGNONE 
J090066J05CTTGGGCCGGCCCATGNONE 
J090073I17CTTGGGCCGGCCCATGNONE 
J090087L04CTTGGGCCGGCCCATGNONE 
J100075O12CTTGGGCCGGCCCATGNONE 
Os03g0186800AK100356CACGGCCCAACAModifier of rudimentary, Modr family protein. 
Os03g0192100AK064747ATTTGGGCCGGGCNONE 
AK105523ATTTGGGCCGGGCPeptidase S10, serine carboxypeptidase family protein. 
Os03g0192400009-081-A03AGTTGGGCCGGTNONE 
009-159-B02AGTTGGGCCGGTNONE 
AK070573AGTTGGGCCGGTGRIM-19 family protein. 
J023056B01AGTTGGGCCGGTNONE 
J023075G06AGTTGGGCCGGTNONE 
J033048K16AGTTGGGCCGGTNONE 
J033048L16AGTTGGGCCGGTNONE 
J053031H23AGTTGGGCCGGTNONE 
J065002H14AGTTGGGCCGGTNONE 
J065006G22AGTTGGGCCGGTNONE 
J065032G13AGTTGGGCCGGTNONE 
J065056A09AGTTGGGCCGGTNONE 
J065078I01AGTTGGGCCGGTNONE 
J065095G01AGTTGGGCCGGTNONE 
J065095I18AGTTGGGCCGGTNONE 
J065134M18AGTTGGGCCGGTNONE 
J065158P07AGTTGGGCCGGTNONE 
J065165K17AGTTGGGCCGGTNONE 
J065181J12AGTTGGGCCGGTNONE 
J065189N09AGTTGGGCCGGTNONE 
J065200D13AGTTGGGCCGGTNONE 
J065202H20AGTTGGGCCGGTNONE 
J065215K20AGTTGGGCCGGTNONE 
J075049N19AGTTGGGCCGGTNONE 
J075147J16AGTTGGGCCGGTNONE 
J090081E19AGTTGGGCCGGTNONE 
J100017C16AGTTGGGCCGGTNONE 
J100039M16AGTTGGGCCGGTNONE 
J100043E23AGTTGGGCCGGTNONE 
J100063L12AGTTGGGCCGGTNONE 
J100079F22AGTTGGGCCGGTNONE 
Os03g0204900009-041-G04GCCGGCCCAATANONE 
AK062601GCCGGCCCAATASimilar to TATA-binding protein associated factor 2N (RNA-binding protein 56) (TAFII68) (TAF(II)68). 
Os03g0210400AK065966ATTGGGCCGCProtein prenyltransferase domain containing protein. 
AK065966ATTTGGGCCGCProtein prenyltransferase domain containing protein. 
Os03g0219200011-045-E01GCGGCCCAATTNONE 
AK073785GCGGCCCAATTSimilar to Superoxide dismutase (EC 1.15.1.1). 
J033068D19GCGGCCCAATTNONE 
J043009H23GCGGCCCAATTNONE 
Os03g0240700009-086-G10GGCCCGGCCCAACANONE 
009-086-G10TAATGGGCCCGGCCCAAACNONE 
AK071799GGCCCGGCCCAACAConserved hypothetical protein. 
AK071799TAATGGGCCCGGCCCAAACConserved hypothetical protein. 
J023112A13GGCCCGGCCCAACANONE 
J023112A13TAATGGGCCCGGCCCAAACNONE 
J043022A01GGCCCGGCCCAACANONE 
J043022A01TAATGGGCCCGGCCCAAACNONE 
J065106A01GGCCCGGCCCAACANONE 
J065106A01TAATGGGCCCGGCCCAAACNONE 
J075023P22GGCCCGGCCCAACANONE 
J075023P22TAATGGGCCCGGCCCAAACNONE 
J075138I21GGCCCGGCCCAACANONE 
J075138I21TAATGGGCCCGGCCCAAACNONE 
J075173L02GGCCCGGCCCAACANONE 
J075173L02TAATGGGCCCGGCCCAAACNONE 
Os03g0240800006-092-D05GTTTGGGCCGGGCCCATTANONE 
006-092-D05TGTTGGGCCGGGCCNONE 
AK059292GTTTGGGCCGGGCCCATTANONE 
AK059292TGTTGGGCCGGGCCNONE 
AK061178GTTTGGGCCGGGCCCATTASimilar to AGL157Cp. 
AK061178TGTTGGGCCGGGCCSimilar to AGL157Cp. 
AK121552GTTTGGGCCGGGCCCATTANONE 
AK121552TGTTGGGCCGGGCCNONE 
J023131D06GTTTGGGCCGGGCCCATTANONE 
J023131D06TGTTGGGCCGGGCCNONE 
J033033E14GTTTGGGCCGGGCCCATTANONE 
J033033E14TGTTGGGCCGGGCCNONE 
J033105B01GTTTGGGCCGGGCCCATTANONE 
J033105B01TGTTGGGCCGGGCCNONE 
J033114L18GTTTGGGCCGGGCCCATTANONE 
J033114L18TGTTGGGCCGGGCCNONE 
J033132N24GTTTGGGCCGGGCCCATTANONE 
J033132N24TGTTGGGCCGGGCCNONE 
J065032H03GTTTGGGCCGGGCCCATTANONE 
J065032H03TGTTGGGCCGGGCCNONE 
J065115J20GTTTGGGCCGGGCCCATTANONE 
J065115J20TGTTGGGCCGGGCCNONE 
J065150C05GTTTGGGCCGGGCCCATTANONE 
J065150C05TGTTGGGCCGGGCCNONE 
J080302A11GTTTGGGCCGGGCCCATTANONE 
J080302A11TGTTGGGCCGGGCCNONE 
J080302H16GTTTGGGCCGGGCCCATTANONE 
J080302H16TGTTGGGCCGGGCCNONE 
J080305M12GTTTGGGCCGGGCCCATTANONE 
J080305M12TGTTGGGCCGGGCCNONE 
J080306F13GTTTGGGCCGGGCCCATTANONE 
J080306F13TGTTGGGCCGGGCCNONE 
J080312A06GTTTGGGCCGGGCCCATTANONE 
J080312A06TGTTGGGCCGGGCCNONE 
J090088P09GTTTGGGCCGGGCCCATTANONE 
J090088P09TGTTGGGCCGGGCCNONE 
Os03g0249400009-059-H08AGTTGGGCCGAGANONE 
AK062522AGTTGGGCCGAGASimilar to 40S ribosomal protein S20 (S22) (Fragment). 
J053031I05AGTTGGGCCGAGANONE 
J053052E06AGTTGGGCCGAGANONE 
J053061K22AGTTGGGCCGAGANONE 
J065108I02AGTTGGGCCGAGANONE 
Os03g0256400AK073854GTTTGGGCCGCAGGGCCCACAASimilar to Imidazole glycerol phosphate synthase hisHF, chloroplast precursor (IGP synthase) (ImGP synthase) (IGPS) [Includes: Glutamine amidotransferase (EC 2.4.2.-); Cyclase (EC 4.1.3.-)]. 
Os03g0257600Os03g0257600TCGGCCCAACProtein of unknown function DUF292, eukaryotic domain containing protein. 
Os03g0257900009-150-G06AATTGGGCCTTTTTGGGCCGANONE 
009-181-H05AATTGGGCCTTTTTGGGCCGANONE 
AK063892AATTGGGCCTTTTTGGGCCGANONE 
AK100114AATTGGGCCTTTTTGGGCCGASimilar to Lectin-like receptor kinase 7;2. 
AK103486AATTGGGCCTTTTTGGGCCGANONE 
J023006K11AATTGGGCCTTTTTGGGCCGANONE 
J075005E15AATTGGGCCTTTTTGGGCCGANONE 
J075007K24AATTGGGCCTTTTTGGGCCGANONE 
J075034G06AATTGGGCCTTTTTGGGCCGANONE 
J075051I19AATTGGGCCTTTTTGGGCCGANONE 
J075076A08AATTGGGCCTTTTTGGGCCGANONE 
J075096H04AATTGGGCCTTTTTGGGCCGANONE 
J075115I09AATTGGGCCTTTTTGGGCCGANONE 
J075132K23AATTGGGCCTTTTTGGGCCGANONE 
J075147C17AATTGGGCCTTTTTGGGCCGANONE 
J090059O20AATTGGGCCTTTTTGGGCCGANONE 
Os03g0266900013-080-C12ATTTGGGCCGAAANONE 
014-010-A09ATTTGGGCCGAAANONE 
014-013-G10ATTTGGGCCGAAANONE 
014-019-D06ATTTGGGCCGAAANONE 
014-030-F08ATTTGGGCCGAAANONE 
014-039-C05ATTTGGGCCGAAANONE 
014-053-H08ATTTGGGCCGAAANONE 
014-089-F06ATTTGGGCCGAAANONE 
014-094-A05ATTTGGGCCGAAANONE 
014-098-C12ATTTGGGCCGAAANONE 
AK119243ATTTGGGCCGAAALow molecular mass heat shock protein Oshsp17.3. 
AK119717ATTTGGGCCGAAANONE 
D12635ATTTGGGCCGAAANONE 
M80186ATTTGGGCCGAAANONE 
Os03g0270000006-051-C05ATTGGGCCGANONE 
006-100-A03ATTGGGCCGANONE 
006-114-F11ATTGGGCCGANONE 
AK061579ATTGGGCCGANONE 
AK106069ATTGGGCCGAProtein of unknown function DUF296 domain containing protein. 
J023102O16ATTGGGCCGANONE 
J065017C10ATTGGGCCGANONE 
J065059M01ATTGGGCCGANONE 
J065104I08ATTGGGCCGANONE 
J065120B10ATTGGGCCGANONE 
J065130K08ATTGGGCCGANONE 
J065140F09ATTGGGCCGANONE 
J065166E07ATTGGGCCGANONE 
Os03g0270700AK119531TGTTGGGCCGTANONE 
Os03g0276500011-014-A06AACGGCCCAAGNONE 
011-014-A06ACCGGCCCAACNONE 
012-043-E04AACGGCCCAAGNONE 
012-043-E04ACCGGCCCAACNONE 
012-096-G01AACGGCCCAAGNONE 
012-096-G01ACCGGCCCAACNONE 
014-005-A07AACGGCCCAAGNONE 
014-005-A07ACCGGCCCAACNONE 
014-031-F09AACGGCCCAAGNONE 
014-031-F09ACCGGCCCAACNONE 
014-040-C09AACGGCCCAAGNONE 
014-040-C09ACCGGCCCAACNONE 
014-092-G02AACGGCCCAAGNONE 
014-092-G02ACCGGCCCAACNONE 
AK072830AACGGCCCAAGNONE 
AK072830ACCGGCCCAACNONE 
AK099275AACGGCCCAAGNONE 
AK099275ACCGGCCCAACNONE 
AK109474AACGGCCCAAGSimilar to Heat shock protein 70. 
AK109474ACCGGCCCAACSimilar to Heat shock protein 70. 
J013036E08AACGGCCCAAGNONE 
J013036E08ACCGGCCCAACNONE 
J013047P03AACGGCCCAAGNONE 
J013047P03ACCGGCCCAACNONE 
J013048H14AACGGCCCAAGNONE 
J013048H14ACCGGCCCAACNONE 
J013060E24AACGGCCCAAGNONE 
J013060E24ACCGGCCCAACNONE 
J013093N10AACGGCCCAAGNONE 
J013093N10ACCGGCCCAACNONE 
J013123K11AACGGCCCAAGNONE 
J013123K11ACCGGCCCAACNONE 
J013153C09AACGGCCCAAGNONE 
J013153C09ACCGGCCCAACNONE 
J023010D20AACGGCCCAAGNONE 
J023010D20ACCGGCCCAACNONE 
J023027O13AACGGCCCAAGNONE 
J023027O13ACCGGCCCAACNONE 
J023029B01AACGGCCCAAGNONE 
J023029B01ACCGGCCCAACNONE 
J023063G14AACGGCCCAAGNONE 
J023063G14ACCGGCCCAACNONE 
J023083D09AACGGCCCAAGNONE 
J023083D09ACCGGCCCAACNONE 
J023091M13AACGGCCCAAGNONE 
J023091M13ACCGGCCCAACNONE 
J023121M10AACGGCCCAAGNONE 
J023121M10ACCGGCCCAACNONE 
J023126D10AACGGCCCAAGNONE 
J023126D10ACCGGCCCAACNONE 
J023139H01AACGGCCCAAGNONE 
J023139H01ACCGGCCCAACNONE 
J023145B18AACGGCCCAAGNONE 
J023145B18ACCGGCCCAACNONE 
J033029G15AACGGCCCAAGNONE 
J033029G15ACCGGCCCAACNONE 
J033050K13AACGGCCCAAGNONE 
J033050K13ACCGGCCCAACNONE 
J033057L09AACGGCCCAAGNONE 
J033057L09ACCGGCCCAACNONE 
J033092M15AACGGCCCAAGNONE 
J033092M15ACCGGCCCAACNONE 
J065007N14AACGGCCCAAGNONE 
J065007N14ACCGGCCCAACNONE 
J065038E07AACGGCCCAAGNONE 
J065038E07ACCGGCCCAACNONE 
J065043A09AACGGCCCAAGNONE 
J065043A09ACCGGCCCAACNONE 
J065100C19AACGGCCCAAGNONE 
J065100C19ACCGGCCCAACNONE 
J065117C02AACGGCCCAAGNONE 
J065117C02ACCGGCCCAACNONE 
J065213I04AACGGCCCAAGNONE 
J065213I04ACCGGCCCAACNONE 
J090001F01AACGGCCCAAGNONE 
J090001F01ACCGGCCCAACNONE 
J090025D07AACGGCCCAAGNONE 
J090025D07ACCGGCCCAACNONE 
J090037C11AACGGCCCAAGNONE 
J090037C11ACCGGCCCAACNONE 
J090047N11AACGGCCCAAGNONE 
J090047N11ACCGGCCCAACNONE 
J090053O05AACGGCCCAAGNONE 
J090053O05ACCGGCCCAACNONE 
J090070F11AACGGCCCAAGNONE 
J090070F11ACCGGCCCAACNONE 
J090082O16AACGGCCCAAGNONE 
J090082O16ACCGGCCCAACNONE 
J090085F20AACGGCCCAAGNONE 
J090085F20ACCGGCCCAACNONE 
J090096N08AACGGCCCAAGNONE 
J090096N08ACCGGCCCAACNONE 
Os03g0278900006-049-H12TACGGCCCAAATNONE 
006-082-A07TACGGCCCAAATNONE 
009-169-C04TACGGCCCAAATNONE 
AK066019TACGGCCCAAATATPase, F0 complex, subunit B/B', bacterial and chloroplast family protein. 
AK105925TACGGCCCAAATNONE 
AY224460TACGGCCCAAATNONE 
J065021K17TACGGCCCAAATNONE 
J065141H24TACGGCCCAAATNONE 
J065142J20TACGGCCCAAATNONE 
J065152J03TACGGCCCAAATNONE 
J065163A13TACGGCCCAAATNONE 
J065191I21TACGGCCCAAATNONE 
J065193K12TACGGCCCAAATNONE 
J075003D01TACGGCCCAAATNONE 
J075017D24TACGGCCCAAATNONE 
J075060F20TACGGCCCAAATNONE 
J075154C11TACGGCCCAAATNONE 
J075173F04TACGGCCCAAATNONE 
Os03g0279400AK101851CCACGGCCCAAGSimilar to Arginine biosynthesis bifunctional protein argJ 1 [Includes: Glutamate N-acetyltransferase (EC 2.3.1.35) (Ornithine acetyltransferase) (Ornithine transacetylase) (OATase); Amino-acid acetyltransferase (EC 2.3.1.1) (N-acetylglutamate synthase) (AGS)] [Contains: Arginine biosynthesis bifunctional protein argJ1 alpha chain; Arginine biosynthesis bifunctional protein argJ1 beta chain]. 
AK106253CCACGGCCCAAGNONE 
J023079P21CCACGGCCCAAGNONE 
J023120G14CCACGGCCCAAGNONE 
J090042F16CCACGGCCCAAGNONE 
Os03g0283100006-097-E01ATTTGGGCCGAGNONE 
AK061849ATTTGGGCCGAGNONE 
AK065887ATTTGGGCCGAGSimilar to In2-1 protein. 
J013044J05ATTTGGGCCGAGNONE 
J013130I02ATTTGGGCCGAGNONE 
J013162M18ATTTGGGCCGAGNONE 
J023014O17ATTTGGGCCGAGNONE 
J023139N17ATTTGGGCCGAGNONE 
Os03g0284000Os03g0284000CTTGGGCCGTGCTTGGGCTGCConserved hypothetical protein. 
Os03g0287900009-074-B07GGCCCGGCCCAAGNONE 
014-027-E07GGCCCGGCCCAAGNONE 
AK063663GGCCCGGCCCAAGSimilar to Protein disulfide isomerase. 
J065009N21GGCCCGGCCCAAGNONE 
Os03g0293100AK060680GGCCCGGCCCAAAConserved hypothetical protein. 
J065193F02GGCCCGGCCCAAANONE 
J075003N10GGCCCGGCCCAAANONE 
Os03g0297100AK059192GCGGCCCAAANONE 
AK122143GCGGCCCAAANONE 
J023012D24GCGGCCCAAANONE 
J023041A08GCGGCCCAAANONE 
J033067H08GCGGCCCAAANONE 
J033131K19GCGGCCCAAANONE 
J033136J20GCGGCCCAAANONE 
J053027D07GCGGCCCAAANONE 
J065191B01GCGGCCCAAANONE 
J075112A12GCGGCCCAAANONE 
J075136D05GCGGCCCAAANONE 
J090073P06GCGGCCCAAANONE 
J100026B16GCGGCCCAAANONE 
J100068P21GCGGCCCAAANONE 
J100088C15GCGGCCCAAANONE 
Os03g0302700006-099-F12ATTTGGGCCGAAANONE 
AK112010ATTTGGGCCGAAAZinc finger, RING-type domain containing protein. 
AK121656ATTTGGGCCGAAANONE 
J075090A19ATTTGGGCCGAAANONE 
J075148M06ATTTGGGCCGAAANONE 
Os03g0312600AK073391CTTGGGCCGGCSimilar to XPA-binding protein 1 (HUSSY-23). 
Os03g0335100AK107094CTTGGGCCGTTConserved hypothetical protein. 
Os03g0338600AK066604CTTGGGCCGAtRNA pseudouridine synthase family protein. 
Os03g0343500009-042-G06CCACGGCCCAACNONE 
009-063-D01CCACGGCCCAACNONE 
009-156-H09CCACGGCCCAACNONE 
AB117995CCACGGCCCAACNONE 
AK058737CCACGGCCCAACNONE 
AK059599CCACGGCCCAACSimilar to 60S ribosomal protein L22-2. 
AK121502CCACGGCCCAACNONE 
J023082D10CCACGGCCCAACNONE 
J033022G11CCACGGCCCAACNONE 
J075048M16CCACGGCCCAACNONE 
J075049O20CCACGGCCCAACNONE 
J075082I02CCACGGCCCAACNONE 
J075105G01CCACGGCCCAACNONE 
J075131K05CCACGGCCCAACNONE 
J080002H01CCACGGCCCAACNONE 
J080003H01CCACGGCCCAACNONE 
J080005G08CCACGGCCCAACNONE 
J080011M13CCACGGCCCAACNONE 
J080020M02CCACGGCCCAACNONE 
J080026N24CCACGGCCCAACNONE 
J080028L09CCACGGCCCAACNONE 
J080032O14CCACGGCCCAACNONE 
J080033J12CCACGGCCCAACNONE 
J080035D05CCACGGCCCAACNONE 
J080039H01CCACGGCCCAACNONE 
J080044B07CCACGGCCCAACNONE 
J080044E23CCACGGCCCAACNONE 
J080049N11CCACGGCCCAACNONE 
J080050A21CCACGGCCCAACNONE 
J080055L24CCACGGCCCAACNONE 
J080059N20CCACGGCCCAACNONE 
J080061F04CCACGGCCCAACNONE 
J080078I16CCACGGCCCAACNONE 
J080079G24CCACGGCCCAACNONE 
J080080K13CCACGGCCCAACNONE 
J080083G20CCACGGCCCAACNONE 
J080087B08CCACGGCCCAACNONE 
J080091L19CCACGGCCCAACNONE 
J080094D06CCACGGCCCAACNONE 
J090038L06CCACGGCCCAACNONE 
J090075H06CCACGGCCCAACNONE 
J090081D12CCACGGCCCAACNONE 
Os03g0343900009-077-C03TCCGGCCCAATANONE 
AK105813TCCGGCCCAATAPhotosystem II protein PsbX family protein. 
J100059N03TCCGGCCCAATANONE 
J100079C20TCCGGCCCAATANONE 
Os03g0344100009-166-F10CTTGGGCCGTGNONE 
AK061903CTTGGGCCGTGNONE 
AK065547CTTGGGCCGTGSimilar to ASF/SF2-like pre-mRNA splicing factor SRP32''. 
J023095G24CTTGGGCCGTGNONE 
J033087C06CTTGGGCCGTGNONE 
J053073I09CTTGGGCCGTGNONE 
J065189D11CTTGGGCCGTGNONE 
J090032B15CTTGGGCCGTGNONE 
Os03g0347800AK073756TCGGCCCAAACPeptidyl-tRNA hydrolase family protein. 
Os03g0372700AK064323GGTTGGGCCGAAANONE 
AK073312GGTTGGGCCGAAALow temperature viability protein family protein. 
Os03g0390400009-175-E06TTCGGCCCAACTNONE 
013-040-G01TTCGGCCCAACTNONE 
014-050-G05TTCGGCCCAACTNONE 
AB025187TTCGGCCCAACTSimilar to Cytochrome c oxidase subunit 6b. 
AK120174TTCGGCCCAACTNONE 
J013033A17TTCGGCCCAACTNONE 
J023028J08TTCGGCCCAACTNONE 
J023061N05TTCGGCCCAACTNONE 
J023077A03TTCGGCCCAACTNONE 
J023086E01TTCGGCCCAACTNONE 
J033022A08TTCGGCCCAACTNONE 
J033040F24TTCGGCCCAACTNONE 
J075073I24TTCGGCCCAACTNONE 
J075081H01TTCGGCCCAACTNONE 
J075175N19TTCGGCCCAACTNONE 
J100025M03TTCGGCCCAACTNONE 
J100036J06TTCGGCCCAACTNONE 
J100045O18TTCGGCCCAACTNONE 
J100062G15TTCGGCCCAACTNONE 
J100090N19TTCGGCCCAACTNONE 
Os03g0581800009-177-G11TAAGCCCATCCGGCCCAAATNONE 
AK059201TAAGCCCATCCGGCCCAAATNONE 
AK121839TAAGCCCATCCGGCCCAAATHypothetical protein. 
J023022K06TAAGCCCATCCGGCCCAAATNONE 
J023110K21TAAGCCCATCCGGCCCAAATNONE 
J033100N18TAAGCCCATCCGGCCCAAATNONE 
J033120D11TAAGCCCATCCGGCCCAAATNONE 
J065044P15TAAGCCCATCCGGCCCAAATNONE 
J065102G22TAAGCCCATCCGGCCCAAATNONE 
J065149N14TAAGCCCATCCGGCCCAAATNONE 
J065201L18TAAGCCCATCCGGCCCAAATNONE 
J065205K10TAAGCCCATCCGGCCCAAATNONE 
J075035D19TAAGCCCATCCGGCCCAAATNONE 
J075073E06TAAGCCCATCCGGCCCAAATNONE 
J075134M11TAAGCCCATCCGGCCCAAATNONE 
J090004P12TAAGCCCATCCGGCCCAAATNONE 
J090070H20TAAGCCCATCCGGCCCAAATNONE 
J090087B04TAAGCCCATCCGGCCCAAATNONE 
J100028F10TAAGCCCATCCGGCCCAAATNONE 
J100036M18TAAGCCCATCCGGCCCAAATNONE 
J100065C24TAAGCCCATCCGGCCCAAATNONE 
J100080O13TAAGCCCATCCGGCCCAAATNONE 
Os03g0633800AK073044GGGCTTGGGCCGTGGTGGGTGGGCCCCACACSimilar to IAA6 (Fragment). 
J065038L22GGGCTTGGGCCGTGGTGGGTGGGCCCCACACNONE 
J065185C13GGGCTTGGGCCGTGGTGGGTGGGCCCCACACNONE 
Os03g0646300AK069229TTTTGGGCCGCSimilar to Cyclic nucleotide-gated channel A (Fragment). 
Os03g0681900006-042-F08TCGGCCCAATTNONE 
009-043-F12TCGGCCCAATTNONE 
AK061750TCGGCCCAATTNONE 
AK062094TCGGCCCAATTSimilar to RGP-3 (Fragment). 
J033034F01TCGGCCCAATTNONE 
J033131F11TCGGCCCAATTNONE 
J033143N03TCGGCCCAATTNONE 
Os03g0685000009-031-F08GCGGCCCAAACNONE 
AK059896GCGGCCCAAACSimilar to Ferredoxin. 
AK098989GCGGCCCAAACNONE 
AK099303GCGGCCCAAACNONE 
J065041E14GCGGCCCAAACNONE 
J065085G22GCGGCCCAAACNONE 
Os03g0685900009-026-A09TATTGGGCCGGTNONE 
009-145-C09TATTGGGCCGGTNONE 
AK062981TATTGGGCCGGTConserved hypothetical protein. 
J065001D12TATTGGGCCGGTNONE 
J065023B10TATTGGGCCGGTNONE 
J065041E10TATTGGGCCGGTNONE 
J065046C01TATTGGGCCGGTNONE 
J065146I22TATTGGGCCGGTNONE 
J065184F20TATTGGGCCGGTNONE 
J075011E15TATTGGGCCGGTNONE 
J075048H17TATTGGGCCGGTNONE 
J075070H15TATTGGGCCGGTNONE 
J075133C01TATTGGGCCGGTNONE 
J075170D02TATTGGGCCGGTNONE 
J090001G08TATTGGGCCGGTNONE 
J090026B09TATTGGGCCGGTNONE 
J100055M03TATTGGGCCGGTNONE 
Os03g0708400006-108-F11CTTGGGCCGCNONE 
AK066216CTTGGGCCGCProtein of unknown function DUF1295 family protein. 
Os03g0708600AK069199CACGGCCCAAATDEAD/DEAH box helicase, N-terminal domain containing protein. 
AK069199CACGGCCCAAGDEAD/DEAH box helicase, N-terminal domain containing protein. 
AK069658CACGGCCCAAATNONE 
AK069658CACGGCCCAAGNONE 
J023008E04CACGGCCCAAATNONE 
J023008E04CACGGCCCAAGNONE 
J023030D22CACGGCCCAAATNONE 
J023030D22CACGGCCCAAGNONE 
J033027E16CACGGCCCAAATNONE 
J033027E16CACGGCCCAAGNONE 
J033046D09CACGGCCCAAATNONE 
J033046D09CACGGCCCAAGNONE 
J033068I10CACGGCCCAAATNONE 
J033068I10CACGGCCCAAGNONE 
J033135A12CACGGCCCAAATNONE 
J033135A12CACGGCCCAAGNONE 
J065027E22CACGGCCCAAATNONE 
J065027E22CACGGCCCAAGNONE 
J065191K23CACGGCCCAAATNONE 
J065191K23CACGGCCCAAGNONE 
J090054D15CACGGCCCAAATNONE 
J090054D15CACGGCCCAAGNONE 
J090058J15CACGGCCCAAATNONE 
J090058J15CACGGCCCAAGNONE 
Os03g0709000009-027-F11CTTGGGCCGGANONE 
009-147-F02CTTGGGCCGGANONE 
015-068-A04CTTGGGCCGGANONE 
AK062406CTTGGGCCGGAMembrane-associated proteins in eicosanoid and glutathione metabolism (MAPEG) family protein. 
Os03g0712200AK073205TCGGCCCAAACZinc finger, RanBP2-type domain containing protein. 
AK098968TCGGCCCAAACNONE 
Os03g0716200Os03g0716200GCGGCCCAAConserved hypothetical protein. 
Os03g0727100AK068587GTTTGGGCCGTAAGGCCCAACAConserved hypothetical protein. 
J013153F04GTTTGGGCCGTAAGGCCCAACANONE 
J065165J09GTTTGGGCCGTAAGGCCCAACANONE 
Os03g0748500AK110695TTTCGGCCCAAGNONE 
AK110695TTTCGGCCCAAGNONE 
Os03g0752800AB041020GACGGCCCAAAANONE 
AF058697GACGGCCCAAAAMADS14 protein. 
AF139664GACGGCCCAAAANONE 
AK121171GACGGCCCAAAANONE 
AY332478GACGGCCCAAAANONE 
AY551916GACGGCCCAAAANONE 
J023081C04GACGGCCCAAAANONE 
Os03g0763000AK120812GTTGGGCCGAACAGCCCASimilar to Casein kinase II alpha subunit. 
Os03g0765000AK073918TGCGGCCCAACTSimilar to Serine/threonine-protein kinase 12 (EC 2.7.1.37) (Aurora-B) (Fragment). 
Os03g0766000AK070596AGTTGGGCCGGGNONE 
AK104743AGTTGGGCCGGGNONE 
AK106079AGTTGGGCCGGGNONE 
J013063M09AGTTGGGCCGGGNONE 
J023056A03AGTTGGGCCGGGNONE 
J043038L07AGTTGGGCCGGGNONE 
J053067N16AGTTGGGCCGGGNONE 
J053073G09AGTTGGGCCGGGNONE 
J053075I19AGTTGGGCCGGGNONE 
Os03g0766900AK066137CACGGCCCAATTAllene oxide synthase. 
AK071361CACGGCCCAATTNONE 
AK103989CACGGCCCAATTNONE 
J023090K09CACGGCCCAATTNONE 
J043022H11CACGGCCCAATTNONE 
J053078F12CACGGCCCAATTNONE 
Os03g0767700AK073586TCGGCCCAATAAACGGGCCCGGTConserved hypothetical protein. 
J033050D05TCGGCCCAATAAACGGGCCCGGTNONE 
Os03g0772800009-023-E05CAACGGCCCAACANONE 
009-059-F12CAACGGCCCAACANONE 
009-114-B08CAACGGCCCAACANONE 
009-115-G09CAACGGCCCAACANONE 
009-151-D08CAACGGCCCAACANONE 
009-158-A10CAACGGCCCAACANONE 
009-191-H02CAACGGCCCAACANONE 
009-192-E05CAACGGCCCAACANONE 
009-197-F11CAACGGCCCAACANONE 
AK059576CAACGGCCCAACANONE 
AK121608CAACGGCCCAACACytochrome c oxidase, subunit VIa family protein. 
J023087H20CAACGGCCCAACANONE 
J023105P14CAACGGCCCAACANONE 
J033026P15CAACGGCCCAACANONE 
J033042K10CAACGGCCCAACANONE 
J033133C09CAACGGCCCAACANONE 
J065123K13CAACGGCCCAACANONE 
J075190D03CAACGGCCCAACANONE 
J080310M14CAACGGCCCAACANONE 
J080317L14CAACGGCCCAACANONE 
J100067J19CAACGGCCCAACANONE 
J100079H21CAACGGCCCAACANONE 
Os03g0776900AK107941CCCGGCCCAATTSimilar to DNAJ protein-like. 
J053100E14CCCGGCCCAATTNONE 
J075111A12CCCGGCCCAATTNONE 
Os03g0786600AK109838TACGGCCCAATAProtein of unknown function DUF860, plant family protein. 
Os03g0795900012-092-G05CTCGGCCCAATNONE 
015-043-D09CTCGGCCCAATNONE 
016-078-G11CTCGGCCCAATNONE 
AK068660CTCGGCCCAATSimilar to Heat shock transcription factor 31 (Fragment). 
J013162K14CTCGGCCCAATNONE 
J023001L04CTCGGCCCAATNONE 
J053032K11CTCGGCCCAATNONE 
J065059E10CTCGGCCCAATNONE 
J065095H19CTCGGCCCAATNONE 
J065181M06CTCGGCCCAATNONE 
J100047D11CTCGGCCCAATNONE 
J100068G04CTCGGCCCAATNONE 
Os03g0800800AK065406GCGGCCCAACSMAD/FHA domain containing protein. 
J013020B01GCGGCCCAACNONE 
J033116K11GCGGCCCAACNONE 
J090079M08GCGGCCCAACNONE 
Os03g0802300AK120564AGTGGGCCTTGGGCCGAGAConserved hypothetical protein. 
AK120687AGTGGGCCTTGGGCCGAGANONE 
Os03g0803800012-043-D10TCCGGCCCAATTNONE 
012-043-D10TCTCGGCCCAATANONE 
AK063484TCCGGCCCAATTConserved hypothetical protein. 
AK063484TCTCGGCCCAATAConserved hypothetical protein. 
Os03g0807200011-031-F07GTTTGGGCCGGGCCGTCNONE 
AK063932GTTTGGGCCGGGCCGTCNONE 
AK103496GTTTGGGCCGGGCCGTCProtein of unknown function DUF1639 family protein. 
J033131A04GTTTGGGCCGGGCCGTCNONE 
J065109O03GTTTGGGCCGGGCCGTCNONE 
J080001M11GTTTGGGCCGGGCCGTCNONE 
J080002H18GTTTGGGCCGGGCCGTCNONE 
J080005I08GTTTGGGCCGGGCCGTCNONE 
J080006B05GTTTGGGCCGGGCCGTCNONE 
J080006D17GTTTGGGCCGGGCCGTCNONE 
J080007M19GTTTGGGCCGGGCCGTCNONE 
J080011E07GTTTGGGCCGGGCCGTCNONE 
J080012H06GTTTGGGCCGGGCCGTCNONE 
J080014D08GTTTGGGCCGGGCCGTCNONE 
J080017D06GTTTGGGCCGGGCCGTCNONE 
J080017K17GTTTGGGCCGGGCCGTCNONE 
J080020B17GTTTGGGCCGGGCCGTCNONE 
J080021O05GTTTGGGCCGGGCCGTCNONE 
J080021O15GTTTGGGCCGGGCCGTCNONE 
J080023I18GTTTGGGCCGGGCCGTCNONE 
J080025A21GTTTGGGCCGGGCCGTCNONE 
J080027P22GTTTGGGCCGGGCCGTCNONE 
J080028M22GTTTGGGCCGGGCCGTCNONE 
J080029B09GTTTGGGCCGGGCCGTCNONE 
J080029M07GTTTGGGCCGGGCCGTCNONE 
J080029M17GTTTGGGCCGGGCCGTCNONE 
J080030H23GTTTGGGCCGGGCCGTCNONE 
J080030K16GTTTGGGCCGGGCCGTCNONE 
J080030L19GTTTGGGCCGGGCCGTCNONE 
J080031A12GTTTGGGCCGGGCCGTCNONE 
J080031N21GTTTGGGCCGGGCCGTCNONE 
J080032G05GTTTGGGCCGGGCCGTCNONE 
J080032P20GTTTGGGCCGGGCCGTCNONE 
J080033H20GTTTGGGCCGGGCCGTCNONE 
J080034H22GTTTGGGCCGGGCCGTCNONE 
J080034J03GTTTGGGCCGGGCCGTCNONE 
J080034J16GTTTGGGCCGGGCCGTCNONE 
J080034N01GTTTGGGCCGGGCCGTCNONE 
J080035K20GTTTGGGCCGGGCCGTCNONE 
J080036I04GTTTGGGCCGGGCCGTCNONE 
J080036I19GTTTGGGCCGGGCCGTCNONE 
J080036O21GTTTGGGCCGGGCCGTCNONE 
J080038D06GTTTGGGCCGGGCCGTCNONE 
J080039J15GTTTGGGCCGGGCCGTCNONE 
J080039P18GTTTGGGCCGGGCCGTCNONE 
J080041H20GTTTGGGCCGGGCCGTCNONE 
J080041M11GTTTGGGCCGGGCCGTCNONE 
J080042F14GTTTGGGCCGGGCCGTCNONE 
J080043G10GTTTGGGCCGGGCCGTCNONE 
J080043J02GTTTGGGCCGGGCCGTCNONE 
J080044C19GTTTGGGCCGGGCCGTCNONE 
J080044G11GTTTGGGCCGGGCCGTCNONE 
J080045M03GTTTGGGCCGGGCCGTCNONE 
J080045N07GTTTGGGCCGGGCCGTCNONE 
J080047K14GTTTGGGCCGGGCCGTCNONE 
J080049I21GTTTGGGCCGGGCCGTCNONE 
J080050A06GTTTGGGCCGGGCCGTCNONE 
J080050I16GTTTGGGCCGGGCCGTCNONE 
J080050N16GTTTGGGCCGGGCCGTCNONE 
J080052C23GTTTGGGCCGGGCCGTCNONE 
J080052D18GTTTGGGCCGGGCCGTCNONE 
J080052F20GTTTGGGCCGGGCCGTCNONE 
J080052F23GTTTGGGCCGGGCCGTCNONE 
J080053M03GTTTGGGCCGGGCCGTCNONE 
J080054G13GTTTGGGCCGGGCCGTCNONE 
J080054H12GTTTGGGCCGGGCCGTCNONE 
J080055N03GTTTGGGCCGGGCCGTCNONE 
J080056E07GTTTGGGCCGGGCCGTCNONE 
J080057L04GTTTGGGCCGGGCCGTCNONE 
J080063O19GTTTGGGCCGGGCCGTCNONE 
J080064E21GTTTGGGCCGGGCCGTCNONE 
J080065D18GTTTGGGCCGGGCCGTCNONE 
J080065F18GTTTGGGCCGGGCCGTCNONE 
J080065H14GTTTGGGCCGGGCCGTCNONE 
J080065K15GTTTGGGCCGGGCCGTCNONE 
J080065M24GTTTGGGCCGGGCCGTCNONE 
J080066B18GTTTGGGCCGGGCCGTCNONE 
J080066B19GTTTGGGCCGGGCCGTCNONE 
J080071H19GTTTGGGCCGGGCCGTCNONE 
J080072E18GTTTGGGCCGGGCCGTCNONE 
J080074K21GTTTGGGCCGGGCCGTCNONE 
J080075B06GTTTGGGCCGGGCCGTCNONE 
J080076H07GTTTGGGCCGGGCCGTCNONE 
J080079D16GTTTGGGCCGGGCCGTCNONE 
J080082B20GTTTGGGCCGGGCCGTCNONE 
J080084N16GTTTGGGCCGGGCCGTCNONE 
J080085L07GTTTGGGCCGGGCCGTCNONE 
J080086L04GTTTGGGCCGGGCCGTCNONE 
J080086M07GTTTGGGCCGGGCCGTCNONE 
J080087D02GTTTGGGCCGGGCCGTCNONE 
J080087D15GTTTGGGCCGGGCCGTCNONE 
J080087J19GTTTGGGCCGGGCCGTCNONE 
J080088G20GTTTGGGCCGGGCCGTCNONE 
J080092M15GTTTGGGCCGGGCCGTCNONE 
J080093O10GTTTGGGCCGGGCCGTCNONE 
J080095L09GTTTGGGCCGGGCCGTCNONE 
J080096A18GTTTGGGCCGGGCCGTCNONE 
J080097C03GTTTGGGCCGGGCCGTCNONE 
J090019J07GTTTGGGCCGGGCCGTCNONE 
J090024N12GTTTGGGCCGGGCCGTCNONE 
J090049I09GTTTGGGCCGGGCCGTCNONE 
Os03g0807800AK064984TATTGGGCCGAAGAGGCCCAGCCCACTTGSimilar to 40S ribosomal protein S2 (Fragment). 
J013001C14TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J065015J20TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J065122L11TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J065217E10TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J075023C02TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J075102O04TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J080024G24TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J080033F02TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J080047M13TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J080048A22TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J080056E06TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
J080064O11TATTGGGCCGAAGAGGCCCAGCCCACTTGNONE 
Os03g0820100011-030-A10TCGGCCCAATAGGCCCAAGNONE 
011-031-C01TCGGCCCAATAGGCCCAAGNONE 
AK111534TCGGCCCAATAGGCCCAAGSimilar to Auxin-resistance protein AXR1. 
J013033L14TCGGCCCAATAGGCCCAAGNONE 
J013034D14TCGGCCCAATAGGCCCAAGNONE 
J013065N20TCGGCCCAATAGGCCCAAGNONE 
J013127A04TCGGCCCAATAGGCCCAAGNONE 
J013146A11TCGGCCCAATAGGCCCAAGNONE 
J023025D19TCGGCCCAATAGGCCCAAGNONE 
J023083K15TCGGCCCAATAGGCCCAAGNONE 
J033037N01TCGGCCCAATAGGCCCAAGNONE 
J033041H02TCGGCCCAATAGGCCCAAGNONE 
J043009M22TCGGCCCAATAGGCCCAAGNONE 
J090039L03TCGGCCCAATAGGCCCAAGNONE 
J090050L08TCGGCCCAATAGGCCCAAGNONE 
J090053J21TCGGCCCAATAGGCCCAAGNONE 
J090088G07TCGGCCCAATAGGCCCAAGNONE 
Os03g0820400009-042-F06GCCGGCCCAAGNONE 
009-046-E08GCCGGCCCAAGNONE 
009-079-B08GCCGGCCCAAGNONE 
009-111-H09GCCGGCCCAAGNONE 
009-150-D10GCCGGCCCAAGNONE 
015-073-H11GCCGGCCCAAGNONE 
AK119690GCCGGCCCAAGSimilar to ZPT2-13. 
AY286473GCCGGCCCAAGNONE 
AY305864GCCGGCCCAAGNONE 
J100051O21GCCGGCCCAAGNONE 
Os03g0822200AK069405GCGGCCCAACANAD-dependent epimerase/dehydratase family protein. 
AK104151GCGGCCCAACANONE 
AK104209GCGGCCCAACANONE 
J065107D01GCGGCCCAACANONE 
J065191L23GCGGCCCAACANONE 
J065217B05GCGGCCCAACANONE 
Os03g0836200009-165-F07CTCGGCCCACAAGCGGCCCAACTNONE 
015-092-G01CTCGGCCCACAAGCGGCCCAACTNONE 
AK058443CTCGGCCCACAAGCGGCCCAACTNONE 
AK067084CTCGGCCCACAAGCGGCCCAACTSimilar to RNA-binding protein RZ-1. 
AK101225CTCGGCCCACAAGCGGCCCAACTNONE 
J013092A03CTCGGCCCACAAGCGGCCCAACTNONE 
J013095N17CTCGGCCCACAAGCGGCCCAACTNONE 
J013147J18CTCGGCCCACAAGCGGCCCAACTNONE 
J023019O10CTCGGCCCACAAGCGGCCCAACTNONE 
J023065N18CTCGGCCCACAAGCGGCCCAACTNONE 
J033113E18CTCGGCCCACAAGCGGCCCAACTNONE 
J033133E03CTCGGCCCACAAGCGGCCCAACTNONE 
J065059J15CTCGGCCCACAAGCGGCCCAACTNONE 
J065075O11CTCGGCCCACAAGCGGCCCAACTNONE 
J065119I07CTCGGCCCACAAGCGGCCCAACTNONE 
J065171J03CTCGGCCCACAAGCGGCCCAACTNONE 
J090016D21CTCGGCCCACAAGCGGCCCAACTNONE 
J090081O03CTCGGCCCACAAGCGGCCCAACTNONE 
J100040G18CTCGGCCCACAAGCGGCCCAACTNONE 
J100040L10CTCGGCCCACAAGCGGCCCAACTNONE 
J100055H13CTCGGCCCACAAGCGGCCCAACTNONE 
J100059I22CTCGGCCCACAAGCGGCCCAACTNONE 
J100078A08CTCGGCCCACAAGCGGCCCAACTNONE 
Os03g0841100AK120279TATTGGGCCGTGTCGGCCCACCTEGF domain containing protein. 
Os03g0843400009-195-F11CCCGGCCCAACANONE 
AK061198CCCGGCCCAACASimilar to 30S ribosomal protein S6, chloroplast precursor (Fragment). 
AK099076CCCGGCCCAACANONE 
Os03g0850600AK067191AGTTGGGCCGGGACGGCCACGTGGCGConserved hypothetical protein. 
AK067191TATTGGGCCGGAConserved hypothetical protein. 
AK067191TGCGGCCCAATConserved hypothetical protein. 
J013095N12AGTTGGGCCGGGACGGCCACGTGGCGNONE 
J013095N12TATTGGGCCGGANONE 
J013095N12TGCGGCCCAATNONE 
J065214L06AGTTGGGCCGGGACGGCCACGTGGCGNONE 
J065214L06TATTGGGCCGGANONE 
J065214L06TGCGGCCCAATNONE 
J075093J10AGTTGGGCCGGGACGGCCACGTGGCGNONE 
J075093J10TATTGGGCCGGANONE 
J075093J10TGCGGCCCAATNONE 
Os03g0851000006-098-C01TTTGGGCCGGCNONE 
AK060496TTTGGGCCGGCSimilar to Transcription factor homolog BTF3-like protein. 
AK102202TTTGGGCCGGCNONE 
AK104157TTTGGGCCGGCNONE 
J033087F19TTTGGGCCGGCNONE 
J065087I16TTTGGGCCGGCNONE 
J065113G04TTTGGGCCGGCNONE 
J090026M02TTTGGGCCGGCNONE 
J090027I04TTTGGGCCGGCNONE 
J100073E19TTTGGGCCGGCNONE 
Os03g0854000009-186-C03TGTTGGGCCGCANONE 
AK061374TGTTGGGCCGCAProtein of unknown function UPF0131 family protein. 
J065138B11TGTTGGGCCGCANONE 
Os04g0103200003-106-F06AATTGGGCCGAANONE 
015-058-G03AATTGGGCCGAANONE 
AK060850AATTGGGCCGAANONE 
AK066032AATTGGGCCGAAProteasome component region PCI domain containing protein. 
J013046D12AATTGGGCCGAANONE 
J013088L18AATTGGGCCGAANONE 
J013093J06AATTGGGCCGAANONE 
J013111I01AATTGGGCCGAANONE 
J013120B15AATTGGGCCGAANONE 
J013149K17AATTGGGCCGAANONE 
J023010J08AATTGGGCCGAANONE 
J023034J10AATTGGGCCGAANONE 
J023055D05AATTGGGCCGAANONE 
J033023L03AATTGGGCCGAANONE 
J033025N21AATTGGGCCGAANONE 
J033026A19AATTGGGCCGAANONE 
J033026M14AATTGGGCCGAANONE 
J033046J22AATTGGGCCGAANONE 
J033052H11AATTGGGCCGAANONE 
J033058P05AATTGGGCCGAANONE 
J033064A11AATTGGGCCGAANONE 
J033067K11AATTGGGCCGAANONE 
J033076H02AATTGGGCCGAANONE 
J033094E04AATTGGGCCGAANONE 
J033106A02AATTGGGCCGAANONE 
J033108N14AATTGGGCCGAANONE 
J033114I06AATTGGGCCGAANONE 
J033118H18AATTGGGCCGAANONE 
J033148C05AATTGGGCCGAANONE 
J043010I24AATTGGGCCGAANONE 
J043037C07AATTGGGCCGAANONE 
J053025M02AATTGGGCCGAANONE 
J053026N08AATTGGGCCGAANONE 
J053027O14AATTGGGCCGAANONE 
J065038N11AATTGGGCCGAANONE 
J065219C03AATTGGGCCGAANONE 
J090011F14AATTGGGCCGAANONE 
J090027C03AATTGGGCCGAANONE 
J090067M19AATTGGGCCGAANONE 
J090069C17AATTGGGCCGAANONE 
J090070P21AATTGGGCCGAANONE 
J090075N11AATTGGGCCGAANONE 
J090095C22AATTGGGCCGAANONE 
J100027O14AATTGGGCCGAANONE 
J100055E01AATTGGGCCGAANONE 
Os04g0115400015-048-B05TACGGCCCAATANONE 
AK070523TACGGCCCAATAD111/G-patch domain containing protein. 
Os04g0117100009-025-D02CCCGGCCCAACANONE 
009-025-D02GGGACCCACCCCACCCGGCCCAAGNONE 
009-056-D03CCCGGCCCAACANONE 
009-056-D03GGGACCCACCCCACCCGGCCCAAGNONE 
009-145-F01CCCGGCCCAACANONE 
009-145-F01GGGACCCACCCCACCCGGCCCAAGNONE 
009-146-C06CCCGGCCCAACANONE 
009-146-C06GGGACCCACCCCACCCGGCCCAAGNONE 
009-186-C05CCCGGCCCAACANONE 
009-186-C05GGGACCCACCCCACCCGGCCCAAGNONE 
AK060395CCCGGCCCAACANONE 
AK060395GGGACCCACCCCACCCGGCCCAAGNONE 
AK121763CCCGGCCCAACAConserved hypothetical protein. 
AK121763GGGACCCACCCCACCCGGCCCAAGConserved hypothetical protein. 
J033090J17CCCGGCCCAACANONE 
J033090J17GGGACCCACCCCACCCGGCCCAAGNONE 
J065058O06CCCGGCCCAACANONE 
J065058O06GGGACCCACCCCACCCGGCCCAAGNONE 
J065058P05CCCGGCCCAACANONE 
J065058P05GGGACCCACCCCACCCGGCCCAAGNONE 
J065141C14CCCGGCCCAACANONE 
J065141C14GGGACCCACCCCACCCGGCCCAAGNONE 
J065162F07CCCGGCCCAACANONE 
J065162F07GGGACCCACCCCACCCGGCCCAAGNONE 
J065199N16CCCGGCCCAACANONE 
J065199N16GGGACCCACCCCACCCGGCCCAAGNONE 
J065214I05CCCGGCCCAACANONE 
J065214I05GGGACCCACCCCACCCGGCCCAAGNONE 
J075003L04CCCGGCCCAACANONE 
J075003L04GGGACCCACCCCACCCGGCCCAAGNONE 
J075014C14CCCGGCCCAACANONE 
J075014C14GGGACCCACCCCACCCGGCCCAAGNONE 
J075063K14CCCGGCCCAACANONE 
J075063K14GGGACCCACCCCACCCGGCCCAAGNONE 
J075111N19CCCGGCCCAACANONE 
J075111N19GGGACCCACCCCACCCGGCCCAAGNONE 
J075138E13CCCGGCCCAACANONE 
J075138E13GGGACCCACCCCACCCGGCCCAAGNONE 
J075189E23CCCGGCCCAACANONE 
J075189E23GGGACCCACCCCACCCGGCCCAAGNONE 
J080304J23CCCGGCCCAACANONE 
J080304J23GGGACCCACCCCACCCGGCCCAAGNONE 
J080310L07CCCGGCCCAACANONE 
J080310L07GGGACCCACCCCACCCGGCCCAAGNONE 
J080318A16CCCGGCCCAACANONE 
J080318A16GGGACCCACCCCACCCGGCCCAAGNONE 
J100054P14CCCGGCCCAACANONE 
J100054P14GGGACCCACCCCACCCGGCCCAAGNONE 
Os04g0206500AK110892TCGGCCCAAGUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
Os04g0208400AK069629CTTGGGCCGTGCTTGGGCCGTGGCyclin-like F-box domain containing protein. 
Os04g0346800AK101242AAATGGGCCTATCGTGGGCCCGCGCGGCCCAATTNONE 
AK109486AAATGGGCCTATCGTGGGCCCGCGCGGCCCAATTEAR repeat containing protein. 
J080306O15AAATGGGCCTATCGTGGGCCCGCGCGGCCCAATTNONE 
J080317H19AAATGGGCCTATCGTGGGCCCGCGCGGCCCAATTNONE 
Os04g0378200AK103076ACCGGCCCAAACSterile alpha motif SAM domain containing protein. 
J033118E02ACCGGCCCAAACNONE 
J065065F15ACCGGCCCAAACNONE 
J090080I24ACCGGCCCAAACNONE 
Os04g0413600009-142-B05CTCGGCCCAATANONE 
AK121192CTCGGCCCAATASimilar to 40S ribosomal protein S14 (Clone MCH2). 
J023086F11CTCGGCCCAATANONE 
J065085D06CTCGGCCCAATANONE 
J075062H12CTCGGCCCAATANONE 
J075072I22CTCGGCCCAATANONE 
J075074H21CTCGGCCCAATANONE 
J075087L16CTCGGCCCAATANONE 
J075088D11CTCGGCCCAATANONE 
J075115N15CTCGGCCCAATANONE 
J100064G10CTCGGCCCAATANONE 
J100080E09CTCGGCCCAATANONE 
Os04g0418000006-025-C05ATTGGGCCGCANONE 
006-025-D11ATTGGGCCGCANONE 
006-045-F02ATTGGGCCGCANONE 
006-060-B04ATTGGGCCGCANONE 
006-063-E03ATTGGGCCGCANONE 
006-070-G08ATTGGGCCGCANONE 
006-072-H05ATTGGGCCGCANONE 
AK061030ATTGGGCCGCANONE 
AK099124ATTGGGCCGCANONE 
AK106155ATTGGGCCGCAConserved hypothetical protein. 
AK119714ATTGGGCCGCANONE 
J023039I07ATTGGGCCGCANONE 
J065025N03ATTGGGCCGCANONE 
Os04g0440100AK101324ATTGGGCCGGCNONE 
AK105415ATTGGGCCGGCNonsense-mediated decay UPF3 domain containing protein. 
Os04g0444900AK063657TACGGCCCAAGSimilar to Alfin-1. 
AK098960TACGGCCCAAGNONE 
J065037L14TACGGCCCAAGNONE 
J065037P22TACGGCCCAAGNONE 
J065173O15TACGGCCCAAGNONE 
Os04g0449000AK064234ATTTGGGCCGNONE 
AK105976ATTTGGGCCGNONE 
Os04g0477900006-046-B01ATTGGGCCGAAANONE 
006-046-B01ATTTGGGCCGCANONE 
006-103-C03ATTGGGCCGAAANONE 
006-103-C03ATTTGGGCCGCANONE 
006-106-F09ATTGGGCCGAAANONE 
006-106-F09ATTTGGGCCGCANONE 
009-093-B07ATTGGGCCGAAANONE 
009-093-B07ATTTGGGCCGCANONE 
AK059948ATTGGGCCGAAASimilar to Cysteine proteinase EP-B 1 precursor (EC 3.4.22.-). 
AK059948ATTTGGGCCGCASimilar to Cysteine proteinase EP-B 1 precursor (EC 3.4.22.-). 
AK104268ATTGGGCCGAAANONE 
AK104268ATTTGGGCCGCANONE 
J013158A11ATTGGGCCGAAANONE 
J013158A11ATTTGGGCCGCANONE 
J023050E17ATTGGGCCGAAANONE 
J023050E17ATTTGGGCCGCANONE 
J023078J03ATTGGGCCGAAANONE 
J023078J03ATTTGGGCCGCANONE 
J033027G18ATTGGGCCGAAANONE 
J033027G18ATTTGGGCCGCANONE 
J033086G10ATTGGGCCGAAANONE 
J033086G10ATTTGGGCCGCANONE 
J090060G14ATTGGGCCGAAANONE 
J090060G14ATTTGGGCCGCANONE 
Os04g0491500AK068089TTTCGGCCCGGCCCAACCNONE 
AK101116TTTCGGCCCGGCCCAACCTGF-beta receptor, type I/II extracellular region family protein. 
Os04g0495900AK061559TACGGCCCAAAAConserved hypothetical protein. 
Os04g0504600J065162K24GACGGCCCAACANONE 
Os04g0508000AK071432ATTGGGCCGAGATProtein of unknown function DUF231, plant domain containing protein. 
Os04g0508100009-180-A02ATCTCGGCCCAATNONE 
AK121759ATCTCGGCCCAATConserved hypothetical protein. 
J023007G10ATCTCGGCCCAATNONE 
J033089A17ATCTCGGCCCAATNONE 
J065193E13ATCTCGGCCCAATNONE 
J075025M02ATCTCGGCCCAATNONE 
J075027J10ATCTCGGCCCAATNONE 
J075030N03ATCTCGGCCCAATNONE 
J075045I20ATCTCGGCCCAATNONE 
J075065E04ATCTCGGCCCAATNONE 
J075134M16ATCTCGGCCCAATNONE 
J075140B10ATCTCGGCCCAATNONE 
Os04g0520900AK068793TCTCGGCCCAAATProtein prenyltransferase domain containing protein. 
AK105606TCTCGGCCCAAATNONE 
Os04g0530000009-106-E11CACGGCCCAAAANONE 
011-012-E12CACGGCCCAAAANONE 
AK066169CACGGCCCAAAAConserved hypothetical protein. 
J013052P20CACGGCCCAAAANONE 
J090060G12CACGGCCCAAAANONE 
J100073H10CACGGCCCAAAANONE 
Os04g0551300AK103502CTTGGGCCGTCSimilar to Growth regulator like protein. 
Os04g0551800016-049-G12GTTTGGGCCGGTNONE 
AK121568GTTTGGGCCGGTSimilar to T-complex protein 1, alpha subunit (TCP-1-alpha) (CCT-alpha). 
J013073O06GTTTGGGCCGGTNONE 
J013111B11GTTTGGGCCGGTNONE 
J013121H23GTTTGGGCCGGTNONE 
J023012A17GTTTGGGCCGGTNONE 
J023092M05GTTTGGGCCGGTNONE 
J033026P14GTTTGGGCCGGTNONE 
J033033C10GTTTGGGCCGGTNONE 
J033033M10GTTTGGGCCGGTNONE 
J033035C24GTTTGGGCCGGTNONE 
J033052E19GTTTGGGCCGGTNONE 
J033140K19GTTTGGGCCGGTNONE 
J065036F18GTTTGGGCCGGTNONE 
J065067L12GTTTGGGCCGGTNONE 
J065095G09GTTTGGGCCGGTNONE 
J065115B08GTTTGGGCCGGTNONE 
J065218E24GTTTGGGCCGGTNONE 
J090002N13GTTTGGGCCGGTNONE 
J090008B12GTTTGGGCCGGTNONE 
J090016F24GTTTGGGCCGGTNONE 
J090019H14GTTTGGGCCGGTNONE 
J090020G20GTTTGGGCCGGTNONE 
J090029L18GTTTGGGCCGGTNONE 
J090057C23GTTTGGGCCGGTNONE 
J090073H23GTTTGGGCCGGTNONE 
J090081C16GTTTGGGCCGGTNONE 
J090081E21GTTTGGGCCGGTNONE 
J090084L14GTTTGGGCCGGTNONE 
J090086M01GTTTGGGCCGGTNONE 
J090089E16GTTTGGGCCGGTNONE 
J100031P12GTTTGGGCCGGTNONE 
J100090N23GTTTGGGCCGGTNONE 
Os04g0592500AK066893TACGGCCCAAAAPhosphoenolpyruvate carboxykinase (ATP) family protein. 
J013090K18TACGGCCCAAAANONE 
Os04g0595000AK106907TTTTGGGCCGTGGGCTPeptidase A1, pepsin family protein. 
Os04g0610500006-115-C07TACGGCCCAAATNONE 
AK066289TACGGCCCAAATPeptidase M24A, methionine aminopeptidase, subfamily 1 protein. 
AK104817TACGGCCCAAATNONE 
J013096N09TACGGCCCAAATNONE 
J023054I11TACGGCCCAAATNONE 
J023121P20TACGGCCCAAATNONE 
J053039O20TACGGCCCAAATNONE 
J053071L20TACGGCCCAAATNONE 
J053088H23TACGGCCCAAATNONE 
J053096J03TACGGCCCAAATNONE 
Os04g0611300009-006-G08GCCCGGCCCAAGNONE 
009-011-C01GCCCGGCCCAAGNONE 
009-036-B09GCCCGGCCCAAGNONE 
009-116-G09GCCCGGCCCAAGNONE 
009-126-E09GCCCGGCCCAAGNONE 
009-132-F09GCCCGGCCCAAGNONE 
009-151-G07GCCCGGCCCAAGNONE 
009-155-C07GCCCGGCCCAAGNONE 
009-163-G01GCCCGGCCCAAGNONE 
009-169-G08GCCCGGCCCAAGNONE 
009-191-B02GCCCGGCCCAAGNONE 
009-196-A08GCCCGGCCCAAGNONE 
009-198-E07GCCCGGCCCAAGNONE 
014-015-F04GCCCGGCCCAAGNONE 
015-087-H04GCCCGGCCCAAGNONE 
AK062605GCCCGGCCCAAGNONE 
AK063022GCCCGGCCCAAGConserved hypothetical protein. 
AK066749GCCCGGCCCAAGNONE 
AK104924GCCCGGCCCAAGNONE 
J065002M20GCCCGGCCCAAGNONE 
J065045L23GCCCGGCCCAAGNONE 
J065101E05GCCCGGCCCAAGNONE 
J065140J23GCCCGGCCCAAGNONE 
J065179G11GCCCGGCCCAAGNONE 
J065191B18GCCCGGCCCAAGNONE 
J065192E03GCCCGGCCCAAGNONE 
J065199H21GCCCGGCCCAAGNONE 
J075067F01GCCCGGCCCAAGNONE 
J075089L01GCCCGGCCCAAGNONE 
J075147K22GCCCGGCCCAAGNONE 
J080069G23GCCCGGCCCAAGNONE 
J100053D10GCCCGGCCCAAGNONE 
J100078C10GCCCGGCCCAAGNONE 
Os04g0612800016-010-G05CGATGGGCCTTGTAATGGGCCACGGCCCAACANONE 
016-010-G05TGGATGGGCCGAGCACGGCCCAAANONE 
AK071230CGATGGGCCTTGTAATGGGCCACGGCCCAACAProtein prenyltransferase domain containing protein. 
AK071230TGGATGGGCCGAGCACGGCCCAAAProtein prenyltransferase domain containing protein. 
Os04g0625600AK070994AGTTGGGCCGCTRAF-like domain containing protein. 
AK070994TTTTGGGCCGGATRAF-like domain containing protein. 
J023080H04AGTTGGGCCGCNONE 
J023080H04TTTTGGGCCGGANONE 
J023086H15AGTTGGGCCGCNONE 
J023086H15TTTTGGGCCGGANONE 
J033037L21AGTTGGGCCGCNONE 
J033037L21TTTTGGGCCGGANONE 
J033044P14AGTTGGGCCGCNONE 
J033044P14TTTTGGGCCGGANONE 
J065075C23AGTTGGGCCGCNONE 
J065075C23TTTTGGGCCGGANONE 
J065167C18AGTTGGGCCGCNONE 
J065167C18TTTTGGGCCGGANONE 
J100024E02AGTTGGGCCGCNONE 
J100024E02TTTTGGGCCGGANONE 
J100068N24AGTTGGGCCGCNONE 
J100068N24TTTTGGGCCGGANONE 
J100070G20AGTTGGGCCGCNONE 
J100070G20TTTTGGGCCGGANONE 
Os04g0640800AK065522GTTTGGGCCGTCProgrammed cell death protein 2, C-terminal domain containing protein. 
AK065522TATTGGGCCGGAProgrammed cell death protein 2, C-terminal domain containing protein. 
Os04g0654700006-097-D06AATTGGGCCGTCCNONE 
013-016-H01AATTGGGCCGTCCNONE 
AB055495AATTGGGCCGTCCNONE 
AF072849AATTGGGCCGTCCNONE 
AK062107AATTGGGCCGTCCNONE 
AK099088AATTGGGCCGTCCSimilar to COP9 signalosome complex subunit 5b (EC 3.4.-.-) (Signalosome subunit 5b) (Jun activation domain-binding homolog 1). 
J013038I16AATTGGGCCGTCCNONE 
J013038J23AATTGGGCCGTCCNONE 
J013038L17AATTGGGCCGTCCNONE 
J013038N18AATTGGGCCGTCCNONE 
J013038O18AATTGGGCCGTCCNONE 
J013124A09AATTGGGCCGTCCNONE 
J023007N04AATTGGGCCGTCCNONE 
J033023C02AATTGGGCCGTCCNONE 
J033030M18AATTGGGCCGTCCNONE 
J033068I09AATTGGGCCGTCCNONE 
J033100E04AATTGGGCCGTCCNONE 
J065153E19AATTGGGCCGTCCNONE 
J065207I02AATTGGGCCGTCCNONE 
J075007A07AATTGGGCCGTCCNONE 
J075036M04AATTGGGCCGTCCNONE 
J075147I03AATTGGGCCGTCCNONE 
J075197L11AATTGGGCCGTCCNONE 
Os04g0658100AK065495CAACGGCCCAAAAHistone-fold domain containing protein. 
J013021B22CAACGGCCCAAAANONE 
J065054D12CAACGGCCCAAAANONE 
J065135I05CAACGGCCCAAAANONE 
J065198F14CAACGGCCCAAAANONE 
J090027O06CAACGGCCCAAAANONE 
Os04g0665000009-149-A12CACGGCCCAACNONE 
009-149-A12TCCGGCCCAAAANONE 
AK062995CACGGCCCAACCHCH domain containing protein. 
AK062995TCCGGCCCAAAACHCH domain containing protein. 
J065017G19CACGGCCCAACNONE 
J065017G19TCCGGCCCAAAANONE 
J080301G12CACGGCCCAACNONE 
J080301G12TCCGGCCCAAAANONE 
Os04g0692500AK101528GCGGCCCAACANONE 
Os05g0101400009-126-G06AGTTGGGCTTGGGCCGCNONE 
AK067481AGTTGGGCTTGGGCCGCSimilar to 50S ribosomal protein L28, chloroplast precursor. 
J065124O10AGTTGGGCTTGGGCCGCNONE 
J065186D05AGTTGGGCTTGGGCCGCNONE 
J065193A14AGTTGGGCTTGGGCCGCNONE 
J075082A02AGTTGGGCTTGGGCCGCNONE 
J075100F11AGTTGGGCTTGGGCCGCNONE 
J075111O16AGTTGGGCTTGGGCCGCNONE 
J075172I24AGTTGGGCTTGGGCCGCNONE 
Os05g0110500AK060179TACGGCCCAAATNONE 
AK066175TACGGCCCAAATSimilar to RNA helicase (Fragment). 
J013055E22TACGGCCCAAATNONE 
J090056E03TACGGCCCAAATNONE 
Os05g0120800AK066865TCCGGCCCAACAConserved hypothetical protein. 
Os05g0121500006-117-B10GACGGCCCAATNONE 
009-059-D04GACGGCCCAATNONE 
J065066C12GACGGCCCAATConserved hypothetical protein. 
J075013I12GACGGCCCAATNONE 
J090046D18GACGGCCCAATNONE 
Os05g0122900009-052-C11CCACGGCCCAAATNONE 
009-132-C12CCACGGCCCAAATNONE 
014-091-G03CCACGGCCCAAATNONE 
AB072977CCACGGCCCAAATNONE 
AK071296CCACGGCCCAAATNONE 
AK099375CCACGGCCCAAATNONE 
AK104970CCACGGCCCAAATBLE1 protein. 
J065007I09CCACGGCCCAAATNONE 
J065081H07CCACGGCCCAAATNONE 
J065122B18CCACGGCCCAAATNONE 
J065181G15CCACGGCCCAAATNONE 
J065182J07CCACGGCCCAAATNONE 
J065197D23CCACGGCCCAAATNONE 
J065197G08CCACGGCCCAAATNONE 
J065201H20CCACGGCCCAAATNONE 
J090034E11CCACGGCCCAAATNONE 
J100077M04CCACGGCCCAAATNONE 
Os05g0126200AK059554GCGGCCCAACAConserved hypothetical protein. 
AK059554GTCGAGTCATTGGGCCGGGCCCATATConserved hypothetical protein. 
AK121734GCGGCCCAACANONE 
AK121734GTCGAGTCATTGGGCCGGGCCCATATNONE 
J033084B09GCGGCCCAACANONE 
J033084B09GTCGAGTCATTGGGCCGGGCCCATATNONE 
J090010I10GCGGCCCAACANONE 
J090010I10GTCGAGTCATTGGGCCGGGCCCATATNONE 
Os05g0128100009-051-B07CTTGGGCCGCCGGCCCATCTNONE 
009-127-B08CTTGGGCCGCCGGCCCATCTNONE 
009-144-H03CTTGGGCCGCCGGCCCATCTNONE 
009-176-B05CTTGGGCCGCCGGCCCATCTNONE 
AK108556CTTGGGCCGCCGGCCCATCTNONE 
AK119308CTTGGGCCGCCGGCCCATCTNONE 
AK120934CTTGGGCCGCCGGCCCATCTConserved hypothetical protein. 
J023036J15CTTGGGCCGCCGGCCCATCTNONE 
J065122L01CTTGGGCCGCCGGCCCATCTNONE 
J075104P10CTTGGGCCGCCGGCCCATCTNONE 
Os05g0148300009-031-A08TGTTGGGCCGTTNONE 
AK062421TGTTGGGCCGTTRibosomal protein S27, mitochondrial family protein. 
Os05g0156200AK071622GCCGGCCCAATTConserved hypothetical protein. 
J023099E19GCCGGCCCAATTNONE 
J090025C09GCCGGCCCAATTNONE 
J090071K23GCCGGCCCAATTNONE 
Os05g0169400AK073439TCCGGCCCAACProtein of unknown function DUF1421 family protein. 
J013110E15TCCGGCCCAACNONE 
J033044H02TCCGGCCCAACNONE 
Os05g0194600AK102487AATGGGCTATTGGGCCGAPeptidase M22, O-sialoglycoprotein endopeptidase family protein. 
J100032M01AATGGGCTATTGGGCCGANONE 
J100041A08AATGGGCTATTGGGCCGANONE 
Os05g0219800AK102822CACGGCCCAATASimilar to Clone ZZD1128 mRNA sequence. 
Os05g0223200015-037-E09CACGGCCCAAANONE 
AK106308CACGGCCCAAASimilar to Glycine-rich RNA-binding protein GRP2A. 
J065013L17CACGGCCCAAANONE 
J065056N06CACGGCCCAAANONE 
J065080I11CACGGCCCAAANONE 
J065104F11CACGGCCCAAANONE 
J065183L10CACGGCCCAAANONE 
J065185H12CACGGCCCAAANONE 
J065186N17CACGGCCCAAANONE 
Os05g0227700AK067567AATTGGGCCGGCCCATTAGGTGGATGGGCCCACTConserved hypothetical protein. 
AK068760AATTGGGCCGGCCCATTAGGTGGATGGGCCCACTNONE 
J013108C14AATTGGGCCGGCCCATTAGGTGGATGGGCCCACTNONE 
Os05g0227800AK110997AGTGGGCCCATCCACCTAATGGGCCGGCCCAATTHomeodomain-like containing protein. 
Os05g0241400AK107803ATATGGGCCTATTGGGCCGGGCConserved hypothetical protein. 
Os05g0256000AK104927TATTGGGCCAGGACGGCCCAACASimilar to TGF-beta receptor-interacting protein 1. 
AK111524TATTGGGCCAGGACGGCCCAACANONE 
J023025D23TATTGGGCCAGGACGGCCCAACANONE 
J033086I23TATTGGGCCAGGACGGCCCAACANONE 
J033087F17TATTGGGCCAGGACGGCCCAACANONE 
J033091C01TATTGGGCCAGGACGGCCCAACANONE 
J090048L01TATTGGGCCAGGACGGCCCAACANONE 
J090087G08TATTGGGCCAGGACGGCCCAACANONE 
J100040G23TATTGGGCCAGGACGGCCCAACANONE 
Os05g0347000009-013-E04AGTTGGGCCGGANONE 
AK109444AGTTGGGCCGGATAFII55 protein conserved region domain containing protein. 
J065049M12AGTTGGGCCGGANONE 
J065190K18AGTTGGGCCGGANONE 
J075169G13AGTTGGGCCGGANONE 
Os05g0365500AK072352GACGGCCCAACProtein prenyltransferase domain containing protein. 
J043027P13GACGGCCCAACNONE 
Os05g0378800AK058210TGCGGCCCAATNONE 
Os05g0393800AK069074TCGGCCCAACProtein of unknown function DUF221 domain containing protein. 
Os05g0400600AK072045TCCGGCCCAACTCobalt transport protein family protein. 
Os05g0412800AF402803GCCCGGCCGGCCCAAATSimilar to Glutathione S-transferase GST 41 (EC 2.5.1.18). 
Os05g0415600AK065818GCGGCCCAAAANONE 
J013042K21GCGGCCCAAAANONE 
J013114E15GCGGCCCAAAANONE 
J013131H02GCGGCCCAAAANONE 
J023041G06GCGGCCCAAAANONE 
J100037M21GCGGCCCAAAANONE 
Os05g0437200014-036-D04GCGGCCCAAAANONE 
AK059283GCGGCCCAAAANONE 
AK121867GCGGCCCAAAAProtein of unknown function DUF502 family protein. 
Os05g0443300Os05g0443300AGTTGGGCCGCSec23/Sec24 trunk region domain containing protein. 
Os05g0451300AK108341AGTGGGCCACCTCGCCCGGCCCAACCConserved hypothetical protein. 
Os05g0456000AK058420TCCGGCCCAACATGGATGGGCCTAMitochondrial glycoprotein family protein. 
AK102036TCCGGCCCAACATGGATGGGCCTANONE 
J065066F02TCCGGCCCAACATGGATGGGCCTANONE 
Os05g0458400AK069936GATCCGACGGCCCAAACSimilar to AAA-metalloprotease FtsH. 
Os05g0461000006-113-A06TCCGGCCCAATTNONE 
AB042259TCCGGCCCAATTNONE 
AK059189TCCGGCCCAATTNONE 
AK066739TCCGGCCCAATTClathrin adaptor complex, small chain family protein. 
AK099044TCCGGCCCAATTNONE 
AK104166TCCGGCCCAATTNONE 
Os05g0481000AK059369GCGGCCCAATGCN5-related N-acetyltransferase domain containing protein. 
AK068619GCGGCCCAATNONE 
Os05g0490000011-076-C07CTTGGGCCGTANONE 
015-026-D07CTTGGGCCGTANONE 
015-074-A08CTTGGGCCGTANONE 
AK064335CTTGGGCCGTANONE 
AK101340CTTGGGCCGTAKrr1 family protein. 
J033034J18CTTGGGCCGTANONE 
Os05g0490800J065037L19TCCGGCCCAACTNONE 
Os05g0506900AK106697AATTGGGCCGAGBrix domain containing protein. 
Os05g0509200AK061566TATTGGGCCGANADH dehydrogenase (ubiquinone), 24 kDa subunit family protein. 
AK099007TATTGGGCCGANONE 
AK100226TATTGGGCCGANONE 
J013114B12TATTGGGCCGANONE 
J023048D09TATTGGGCCGANONE 
Os05g0518300003-113-E09CTCGGCCCAATNONE 
006-088-A08CTCGGCCCAATNONE 
011-046-H04CTCGGCCCAATNONE 
013-059-A09CTCGGCCCAATNONE 
014-094-H08CTCGGCCCAATNONE 
015-008-B01CTCGGCCCAATNONE 
015-062-H06CTCGGCCCAATNONE 
016-057-H02CTCGGCCCAATNONE 
AK061147CTCGGCCCAATLipolytic enzyme, G-D-S-L family protein. 
J065171N11CTCGGCCCAATNONE 
J065186B12CTCGGCCCAATNONE 
Os05g0531500AK120867CTTGGGCCGCProtein of unknown function DUF616 family protein. 
Os05g0539300Os05g0539300AATTGGGCCGCAProtein of unknown function DUF295 family protein. 
Os05g0540100AB021666AATTGGGCCGAAANONE 
AK060623AATTGGGCCGAAANONE 
AK103819AATTGGGCCGAAAFlap endonuclease-1a (EC 3.-.-.-) (OsFEN-1a). 
Os05g0540800AK060731AGTTGGGCCGGCCCAATANONE 
AK071090AGTTGGGCCGGCCCAATAHomeodomain-like containing protein. 
J013095F03AGTTGGGCCGGCCCAATANONE 
J023079C11AGTTGGGCCGGCCCAATANONE 
J033080E08AGTTGGGCCGGCCCAATANONE 
Os05g0542300009-050-C12ATTTGGGCCGGCNONE 
009-185-D06ATTTGGGCCGGCNONE 
AK062488ATTTGGGCCGGCConserved hypothetical protein. 
Os05g0547850009-102-F03AGATGGGCCTTGGGCCGAAANONE 
013-076-H08AGATGGGCCTTGGGCCGAAANONE 
AK058330AGATGGGCCTTGGGCCGAAANONE 
AK122158AGATGGGCCTTGGGCCGAAADNA-binding TFAR19-related protein family protein. 
AY626826AGATGGGCCTTGGGCCGAAANONE 
J043012O19AGATGGGCCTTGGGCCGAAANONE 
J043038O15AGATGGGCCTTGGGCCGAAANONE 
J053094L06AGATGGGCCTTGGGCCGAAANONE 
Os05g0548100AK060333CTCGGCCCAAGConserved hypothetical protein. 
AK060333TTTCGGCCCAAGGCCCATATConserved hypothetical protein. 
AK100682CTCGGCCCAAGNONE 
AK100682TTTCGGCCCAAGGCCCATATNONE 
J013151E01CTCGGCCCAAGNONE 
J013151E01TTTCGGCCCAAGGCCCATATNONE 
J023113L22CTCGGCCCAAGNONE 
J023113L22TTTCGGCCCAAGGCCCATATNONE 
J043027A19CTCGGCCCAAGNONE 
J043027A19TTTCGGCCCAAGGCCCATATNONE 
J075093E06CTCGGCCCAAGNONE 
J075093E06TTTCGGCCCAAGGCCCATATNONE 
J090060D15CTCGGCCCAAGNONE 
J090060D15TTTCGGCCCAAGGCCCATATNONE 
J090082J03CTCGGCCCAAGNONE 
J090082J03TTTCGGCCCAAGGCCCATATNONE 
J100050E01CTCGGCCCAAGNONE 
J100050E01TTTCGGCCCAAGGCCCATATNONE 
Os05g0555300009-032-C03GCGGCCCAACANONE 
009-125-E08GCGGCCCAACANONE 
009-149-C12GCGGCCCAACANONE 
009-172-C01GCGGCCCAACANONE 
AK062890GCGGCCCAACAFerredoxin domain containing protein. 
AK062997GCGGCCCAACANONE 
Os05g0557200AK062090CTTGGGCTCGGCCCAACANONE 
AK102111CTTGGGCTCGGCCCAACAArmadillo-like helical domain containing protein. 
J013047E13CTTGGGCTCGGCCCAACANONE 
J013089P04CTTGGGCTCGGCCCAACANONE 
J013130H17CTTGGGCTCGGCCCAACANONE 
J013132C20CTTGGGCTCGGCCCAACANONE 
J023001E06CTTGGGCTCGGCCCAACANONE 
J023108C09CTTGGGCTCGGCCCAACANONE 
J023125C12CTTGGGCTCGGCCCAACANONE 
J033023O10CTTGGGCTCGGCCCAACANONE 
J033033K16CTTGGGCTCGGCCCAACANONE 
J033064C11CTTGGGCTCGGCCCAACANONE 
J033071P07CTTGGGCTCGGCCCAACANONE 
J033072H14CTTGGGCTCGGCCCAACANONE 
J033084F06CTTGGGCTCGGCCCAACANONE 
J033084H11CTTGGGCTCGGCCCAACANONE 
J033097C05CTTGGGCTCGGCCCAACANONE 
J043009E20CTTGGGCTCGGCCCAACANONE 
J053035M10CTTGGGCTCGGCCCAACANONE 
J053043J22CTTGGGCTCGGCCCAACANONE 
J053082K10CTTGGGCTCGGCCCAACANONE 
J053094N13CTTGGGCTCGGCCCAACANONE 
Os05g0565000AK102673TACGGCCCAACTSimilar to 60S ribosomal protein L18a-1. 
AK102673TCCGGCCCAAACSimilar to 60S ribosomal protein L18a-1. 
J033102C12TACGGCCCAACTNONE 
J033102C12TCCGGCCCAAACNONE 
J033124C13TACGGCCCAACTNONE 
J033124C13TCCGGCCCAAACNONE 
J043003L04TACGGCCCAACTNONE 
J043003L04TCCGGCCCAAACNONE 
J043006N08TACGGCCCAACTNONE 
J043006N08TCCGGCCCAAACNONE 
Os05g0565200004-015-E06TATTGGGCCGCANONE 
004-015-E06TCCGGCCCAACCNONE 
AK067090TATTGGGCCGCASimilar to Urease accessory protein G. 
AK067090TCCGGCCCAACCSimilar to Urease accessory protein G. 
AK104200TATTGGGCCGCANONE 
AK104200TCCGGCCCAACCNONE 
AK104368TATTGGGCCGCANONE 
AK104368TCCGGCCCAACCNONE 
Os05g0567300013-039-F11CCATGGGCTTTGTTGGGCCGGTNONE 
013-039-F11TATTGGGCCGGCCCAAGNONE 
AK112068CCATGGGCTTTGTTGGGCCGGTGTP-binding protein, HSR1-related domain containing protein. 
AK112068TATTGGGCCGGCCCAAGGTP-binding protein, HSR1-related domain containing protein. 
Os05g0568800006-084-D04CAGGTGGGCTTGGGCCGCANONE 
009-009-B11CAGGTGGGCTTGGGCCGCANONE 
009-014-E10CAGGTGGGCTTGGGCCGCANONE 
009-107-C04CAGGTGGGCTTGGGCCGCANONE 
009-133-H08CAGGTGGGCTTGGGCCGCANONE 
AK059883CAGGTGGGCTTGGGCCGCAProtein of unknown function DUF1645 family protein. 
Os05g0571400009-019-B04AGCCCATGCGGCCCAAAANONE 
009-043-H02AGCCCATGCGGCCCAAAANONE 
AK062369AGCCCATGCGGCCCAAAAConserved hypothetical protein. 
Os05g0571600Os05g0571600TTTCGGCCCAACCConserved hypothetical protein. 
Os05g0589000AK061980GACGGCCCAAACGCGGAGAGNONE 
AK099181GACGGCCCAAACGCGGAGAGConserved hypothetical protein. 
Os06g0113600016-067-E03ATTTGGGCCGGANONE 
AK062095ATTTGGGCCGGANONE 
AK101235ATTTGGGCCGGACyclin-like F-box domain containing protein. 
AK122025ATTTGGGCCGGANONE 
J013022O19ATTTGGGCCGGANONE 
J023045P05ATTTGGGCCGGANONE 
J033031K01ATTTGGGCCGGANONE 
J033034I09ATTTGGGCCGGANONE 
J033041O04ATTTGGGCCGGANONE 
J033071K03ATTTGGGCCGGANONE 
J033075K16ATTTGGGCCGGANONE 
J033097M01ATTTGGGCCGGANONE 
J033099M22ATTTGGGCCGGANONE 
J033108N15ATTTGGGCCGGANONE 
J033121D18ATTTGGGCCGGANONE 
J033125O06ATTTGGGCCGGANONE 
J033139M16ATTTGGGCCGGANONE 
J033145P18ATTTGGGCCGGANONE 
J033149D05ATTTGGGCCGGANONE 
Os06g0116400006-082-G06ACATGGGCTCGGCCCAAGCCACGTCNONE 
AK058327ACATGGGCTCGGCCCAAGCCACGTCNONE 
AK105979ACATGGGCTCGGCCCAAGCCACGTCHigh-affinity nickel-transporter family protein. 
J065083I24ACATGGGCTCGGCCCAAGCCACGTCNONE 
J100072O18ACATGGGCTCGGCCCAAGCCACGTCNONE 
Os06g0116800AK058985CACGGCCCAATASimilar to GFA2. 
AK120746CACGGCCCAATANONE 
Os06g0134000AK102796TCCGGCCCAACCGGCCCACCCNONE 
Os06g0136000AK060303ACCGGCCCAATSimilar to Hypersensitive-induced reaction protein 4. 
AK102678ACCGGCCCAATNONE 
J075185K19ACCGGCCCAATNONE 
J090028C16ACCGGCCCAATNONE 
J090099N12ACCGGCCCAATNONE 
J100070O10ACCGGCCCAATNONE 
Os06g0136700AK065081TTTCGGCCCAATSteroid nuclear receptor, ligand-binding domain containing protein. 
J013001L08TTTCGGCCCAATNONE 
J013039I03TTTCGGCCCAATNONE 
Os06g0140100011-063-A02TGTTGGGCCGGGCCGTGNONE 
AK063371TGTTGGGCCGGGCCGTGLeucine carboxyl methyltransferase family protein. 
Os06g0144000AK068998TGTTGGGCCGCBRCT domain containing protein. 
J023001F16TGTTGGGCCGCNONE 
Os06g0152800003-125-D04ATTTGGGCCGGCCCAGGNONE 
AK099578ATTTGGGCCGGCCCAGGConserved hypothetical protein. 
Os06g0157800AK121504TATTGGGCCGATTTGGGCTGTSimilar to CG7224 (Fragment). 
AK121504TATTGGGCCGGCCCSimilar to CG7224 (Fragment). 
J033022L20TATTGGGCCGATTTGGGCTGTNONE 
J033022L20TATTGGGCCGGCCCNONE 
J075033D09TATTGGGCCGATTTGGGCTGTNONE 
J075033D09TATTGGGCCGGCCCNONE 
Os06g0168000AK059250CTTGGGCCGGGCCNONE 
AK099356CTTGGGCCGGGCCGlutathione S-transferase, C-terminal-like domain containing protein. 
J033040E19CTTGGGCCGGGCCNONE 
J033097H04CTTGGGCCGGGCCNONE 
J075087M11CTTGGGCCGGGCCNONE 
J075146H06CTTGGGCCGGGCCNONE 
J075188H11CTTGGGCCGGGCCNONE 
J090071D03CTTGGGCCGGGCCNONE 
J090097L20CTTGGGCCGGGCCNONE 
J100051M05CTTGGGCCGGGCCNONE 
J100082H13CTTGGGCCGGGCCNONE 
Os06g0174350J043034B05AGTGGGCCTAGTTGGGCCGGAConserved hypothetical protein. 
Os06g0214300AK108107TACGGCCCAACTEsterase/lipase/thioesterase domain containing protein. 
Os06g0247800AK102187GGCCCGGCCCAACCSimilar to Dynamin-like protein (Fragment). 
AY224491GGCCCGGCCCAACCNONE 
Os06g0257200J053059P05GCGGCCCAAATAAATGGGCCCCNONE 
J053059P05TCGGCCCAAGNONE 
J075006K03GCGGCCCAAATAAATGGGCCCCNONE 
J075006K03TCGGCCCAAGNONE 
J075067F07GCGGCCCAAATAAATGGGCCCCNONE 
J075067F07TCGGCCCAAGNONE 
J075068F14GCGGCCCAAATAAATGGGCCCCNONE 
J075068F14TCGGCCCAAGNONE 
J075068H14GCGGCCCAAATAAATGGGCCCCNONE 
J075068H14TCGGCCCAAGNONE 
J075098N06GCGGCCCAAATAAATGGGCCCCNONE 
J075098N06TCGGCCCAAGNONE 
J075099F08GCGGCCCAAATAAATGGGCCCCNONE 
J075099F08TCGGCCCAAGNONE 
J075154G24GCGGCCCAAATAAATGGGCCCCNONE 
J075154G24TCGGCCCAAGNONE 
J075195H09GCGGCCCAAATAAATGGGCCCCNONE 
J075195H09TCGGCCCAAGNONE 
Os06g0291100J043017O10CCGAGCCGGCCCAAGTCAGCCCACAAHypothetical protein. 
Os06g0319700AK120884GGCCCGGCCCAACGCCCAGCCCSimilar to 60S ribosomal protein L31. 
J013089A14GGCCCGGCCCAACGCCCAGCCCNONE 
J023028N24GGCCCGGCCCAACGCCCAGCCCNONE 
J033098H21GGCCCGGCCCAACGCCCAGCCCNONE 
J033118G04GGCCCGGCCCAACGCCCAGCCCNONE 
J090056P15GGCCCGGCCCAACGCCCAGCCCNONE 
J090062B02GGCCCGGCCCAACGCCCAGCCCNONE 
J100024B09GGCCCGGCCCAACGCCCAGCCCNONE 
J100060I04GGCCCGGCCCAACGCCCAGCCCNONE 
J100078H11GGCCCGGCCCAACGCCCAGCCCNONE 
J100080A14GGCCCGGCCCAACGCCCAGCCCNONE 
J100086F18GGCCCGGCCCAACGCCCAGCCCNONE 
Os06g0332600AK121615CTCGGCCCAATAConserved hypothetical protein. 
J033044B19CTCGGCCCAATANONE 
Os06g0482200AK119703TGTTGGGCCGCAThioredoxin fold domain containing protein. 
J065014B11TGTTGGGCCGCANONE 
J065055E22TGTTGGGCCGCANONE 
J065092L13TGTTGGGCCGCANONE 
J065113E21TGTTGGGCCGCANONE 
J065191D11TGTTGGGCCGCANONE 
J065214F18TGTTGGGCCGCANONE 
J075104E18TGTTGGGCCGCANONE 
J075149O19TGTTGGGCCGCANONE 
J075170I11TGTTGGGCCGCANONE 
Os06g0530200009-042-B02TGTTGGGCCGGGCCNONE 
009-050-E10TGTTGGGCCGGGCCNONE 
009-060-F07TGTTGGGCCGGGCCNONE 
009-117-H08TGTTGGGCCGGGCCNONE 
009-129-C10TGTTGGGCCGGGCCNONE 
AK073116TGTTGGGCCGGGCCConserved hypothetical protein. 
AK104077TGTTGGGCCGGGCCNONE 
J065032N16TGTTGGGCCGGGCCNONE 
J065153K07TGTTGGGCCGGGCCNONE 
J065169N18TGTTGGGCCGGGCCNONE 
J065190H18TGTTGGGCCGGGCCNONE 
J075127E14TGTTGGGCCGGGCCNONE 
J090008F20TGTTGGGCCGGGCCNONE 
Os06g0560400AK103575TACGGCCCAAANONE 
AK108074TACGGCCCAAAProtein of unknown function DUF862, eukaryotic domain containing protein. 
Os06g0567000009-166-G12CCCACCTGTTGGGCCGGGCCCACTNONE 
AK121337CCCACCTGTTGGGCCGGGCCCACTProtein of unknown function UPF0197 family protein. 
J013122F01CCCACCTGTTGGGCCGGGCCCACTNONE 
J023080N12CCCACCTGTTGGGCCGGGCCCACTNONE 
J023120F03CCCACCTGTTGGGCCGGGCCCACTNONE 
J065013B18CCCACCTGTTGGGCCGGGCCCACTNONE 
J065039P21CCCACCTGTTGGGCCGGGCCCACTNONE 
J065089E06CCCACCTGTTGGGCCGGGCCCACTNONE 
J065095N19CCCACCTGTTGGGCCGGGCCCACTNONE 
J065119H03CCCACCTGTTGGGCCGGGCCCACTNONE 
J065121D18CCCACCTGTTGGGCCGGGCCCACTNONE 
J065149G04CCCACCTGTTGGGCCGGGCCCACTNONE 
J075012J04CCCACCTGTTGGGCCGGGCCCACTNONE 
J075021G13CCCACCTGTTGGGCCGGGCCCACTNONE 
J075106I23CCCACCTGTTGGGCCGGGCCCACTNONE 
J075107F19CCCACCTGTTGGGCCGGGCCCACTNONE 
J075152J22CCCACCTGTTGGGCCGGGCCCACTNONE 
J075186J20CCCACCTGTTGGGCCGGGCCCACTNONE 
J075188F16CCCACCTGTTGGGCCGGGCCCACTNONE 
J080001G06CCCACCTGTTGGGCCGGGCCCACTNONE 
J080002O09CCCACCTGTTGGGCCGGGCCCACTNONE 
J080006E10CCCACCTGTTGGGCCGGGCCCACTNONE 
J080006F24CCCACCTGTTGGGCCGGGCCCACTNONE 
J080012L07CCCACCTGTTGGGCCGGGCCCACTNONE 
J080016A10CCCACCTGTTGGGCCGGGCCCACTNONE 
J080017D11CCCACCTGTTGGGCCGGGCCCACTNONE 
J080017I04CCCACCTGTTGGGCCGGGCCCACTNONE 
J080017I10CCCACCTGTTGGGCCGGGCCCACTNONE 
J080020P06CCCACCTGTTGGGCCGGGCCCACTNONE 
J080024A20CCCACCTGTTGGGCCGGGCCCACTNONE 
J080027B10CCCACCTGTTGGGCCGGGCCCACTNONE 
J080027E03CCCACCTGTTGGGCCGGGCCCACTNONE 
J080027I01CCCACCTGTTGGGCCGGGCCCACTNONE 
J080027K20CCCACCTGTTGGGCCGGGCCCACTNONE 
J080041L12CCCACCTGTTGGGCCGGGCCCACTNONE 
J080043D21CCCACCTGTTGGGCCGGGCCCACTNONE 
J080044K11CCCACCTGTTGGGCCGGGCCCACTNONE 
J080048I08CCCACCTGTTGGGCCGGGCCCACTNONE 
J080049M12CCCACCTGTTGGGCCGGGCCCACTNONE 
J080050C14CCCACCTGTTGGGCCGGGCCCACTNONE 
J080050N21CCCACCTGTTGGGCCGGGCCCACTNONE 
J080053F04CCCACCTGTTGGGCCGGGCCCACTNONE 
J080054O16CCCACCTGTTGGGCCGGGCCCACTNONE 
J080058O21CCCACCTGTTGGGCCGGGCCCACTNONE 
J080059M11CCCACCTGTTGGGCCGGGCCCACTNONE 
J080061A11CCCACCTGTTGGGCCGGGCCCACTNONE 
J080063B15CCCACCTGTTGGGCCGGGCCCACTNONE 
J080063F22CCCACCTGTTGGGCCGGGCCCACTNONE 
J080066M18CCCACCTGTTGGGCCGGGCCCACTNONE 
J080068D12CCCACCTGTTGGGCCGGGCCCACTNONE 
J080070D22CCCACCTGTTGGGCCGGGCCCACTNONE 
J080071B06CCCACCTGTTGGGCCGGGCCCACTNONE 
J080072B17CCCACCTGTTGGGCCGGGCCCACTNONE 
J080081O04CCCACCTGTTGGGCCGGGCCCACTNONE 
J080089H05CCCACCTGTTGGGCCGGGCCCACTNONE 
J080093K13CCCACCTGTTGGGCCGGGCCCACTNONE 
J080095I05CCCACCTGTTGGGCCGGGCCCACTNONE 
J080097F19CCCACCTGTTGGGCCGGGCCCACTNONE 
J080304C03CCCACCTGTTGGGCCGGGCCCACTNONE 
J080304H11CCCACCTGTTGGGCCGGGCCCACTNONE 
J080308M21CCCACCTGTTGGGCCGGGCCCACTNONE 
J080313O15CCCACCTGTTGGGCCGGGCCCACTNONE 
J090020N23CCCACCTGTTGGGCCGGGCCCACTNONE 
J100023C12CCCACCTGTTGGGCCGGGCCCACTNONE 
Os06g0585200016-065-C02CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCNONE 
AK068592CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCNONE 
AK073844CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCNONE 
AK106549CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCConserved hypothetical protein. 
J013154A14CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCNONE 
J100049K24CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCNONE 
J100059C18CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCNONE 
J100082N13CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCNONE 
Os06g0590301J033139K16TTCGGCCCAACNONE 
J065011M13TTCGGCCCAACNONE 
J065027D20TTCGGCCCAACNONE 
J065039O05TTCGGCCCAACGlucose/ribitol dehydrogenase family protein. 
J065051O10TTCGGCCCAACNONE 
J065128I21TTCGGCCCAACNONE 
J065163P10TTCGGCCCAACNONE 
J065169H02TTCGGCCCAACNONE 
Os06g0592500AK119729CAACGGCCCAAAASimilar to Ethylene-responsive transcriptional coactivator. 
AK122052CAACGGCCCAAAANONE 
Os06g0622700AK107021TCTCGGCCCAATTEukaryotic transcription factor, DNA-binding domain containing protein. 
J065053P05TCTCGGCCCAATTNONE 
J065100L18TCTCGGCCCAATTNONE 
J065129N15TCTCGGCCCAATTNONE 
J065152M08TCTCGGCCCAATTNONE 
J065198M12TCTCGGCCCAATTNONE 
J090077J22TCTCGGCCCAATTNONE 
J100024G23TCTCGGCCCAATTNONE 
J100027L01TCTCGGCCCAATTNONE 
J100047C06TCTCGGCCCAATTNONE 
J100055D01TCTCGGCCCAATTNONE 
J100067M05TCTCGGCCCAATTNONE 
J100077M16TCTCGGCCCAATTNONE 
J100078M22TCTCGGCCCAATTNONE 
Os06g0634600011-029-F10TTTCGGCCCAAATNONE 
011-057-B11TTTCGGCCCAAATNONE 
AK122074TTTCGGCCCAAATProtein of unknown function FAF1 domain containing protein. 
J033118C24TTTCGGCCCAAATNONE 
J033132A01TTTCGGCCCAAATNONE 
J065059I05TTTCGGCCCAAATNONE 
J100069I04TTTCGGCCCAAATNONE 
Os06g0646900AY222862GCGGCCCAATGGGCTGANONE 
Os06g0647900AK073750GCGGCCCAACAConserved hypothetical protein. 
AK073750GCGGCCCAACAConserved hypothetical protein. 
J033029K17GCGGCCCAACANONE 
J033029K17GCGGCCCAACANONE 
J033070L21GCGGCCCAACANONE 
J033070L21GCGGCCCAACANONE 
Os06g0673800AK066054TACGGCCCAAATHypothetical protein. 
Os06g0677600009-200-F02GGTTGGGCCGGANONE 
AK063252GGTTGGGCCGGALike-Sm ribonucleoprotein, core family protein. 
J075028G10GGTTGGGCCGGANONE 
J075189D08GGTTGGGCCGGANONE 
J090045C02GGTTGGGCCGGANONE 
Os06g0682800011-092-E01GGTTGGGCCGCNONE 
AK064816GGTTGGGCCGCZinc finger, CCCH-type domain containing protein. 
J013000E13GGTTGGGCCGCNONE 
J013035J22GGTTGGGCCGCNONE 
J013045M06GGTTGGGCCGCNONE 
J013120A07GGTTGGGCCGCNONE 
J033144H15GGTTGGGCCGCNONE 
J033145H15GGTTGGGCCGCNONE 
J033145N16GGTTGGGCCGCNONE 
J090019J02GGTTGGGCCGCNONE 
Os06g0683200AK060024CTTGGGCCGTASimilar to 50S ribosomal protein L24, chloroplast precursor (CL24). 
AK070432CTTGGGCCGTANONE 
J023002B12CTTGGGCCGTANONE 
J023054E10CTTGGGCCGTANONE 
J023123F19CTTGGGCCGTANONE 
J065035K13CTTGGGCCGTANONE 
J065129P09CTTGGGCCGTANONE 
J065184B14CTTGGGCCGTANONE 
Os06g0683800AK110639CGGCTCGGCCCAAATConserved hypothetical protein. 
Os06g0688100AK063450AATTGGGCCGCNONE 
AK101144AATTGGGCCGCRNA polymerase I specific transcription initiation factor RRN3 family protein. 
Os06g0690600AK107925GACGGCCCAACTConserved hypothetical protein. 
Os06g0710300AK121344CTTGGGCCGAAUncharacterized protein UPF0114 family protein. 
J043016B12CTTGGGCCGAANONE 
J065104H21CTTGGGCCGAANONE 
Os06g0715000AK107114TTCGGCCCAATTConserved hypothetical protein. 
Os07g0105300AK107419TCGGCCCAAACConserved hypothetical protein. 
AK109521TCGGCCCAAACNONE 
Os07g0110100009-059-D11TATTGGGCCGGANONE 
AK071499TATTGGGCCGGAConserved hypothetical protein. 
J065064P17TATTGGGCCGGANONE 
J065111B09TATTGGGCCGGANONE 
J075099A14TATTGGGCCGGANONE 
J075139C23TATTGGGCCGGANONE 
Os07g0142900003-001-H01ATTTGGGCCGTCCNONE 
AK060737ATTTGGGCCGTCCAldo/keto reductase family protein. 
AK064848ATTTGGGCCGTCCNONE 
Os07g0146600J075074M15CACGGCCCAACAConserved hypothetical protein. 
J075120F11CACGGCCCAACANONE 
J075170L13CACGGCCCAACANONE 
J080302A21CACGGCCCAACANONE 
J080304J04CACGGCCCAACANONE 
J080308I12CACGGCCCAACANONE 
J080312F11CACGGCCCAACANONE 
J080315M22CACGGCCCAACANONE 
Os07g0158900AK064980GCGGCCCAAGCyclin-like F-box domain containing protein. 
Os07g0164500J013094M18CTCGGCCCAAATNONE 
J013153L05CTCGGCCCAAATNONE 
J023011J18CTCGGCCCAAATNONE 
J023106H21CTCGGCCCAAATNONE 
J033105F10CTCGGCCCAAATNONE 
J065210M20CTCGGCCCAAATSimilar to Dolichyl pyrophosphate Man9GlcNAc2 alpha-1,3-glucosyltransferase (EC 2.4.1.-) (Dolichyl-P-Glc:Man9GlcNAc2-PP-dolichyl glucosyltransferase). 
J090060F05CTCGGCCCAAATNONE 
J090061C13CTCGGCCCAAATNONE 
J090074K15CTCGGCCCAAATNONE 
Os07g0184900AK102066TCGGCCCGTGGGCCGTGTTGGGCCGAGGCCCACGTGGGAGTGGGAAGGCCCACGCACCGCSimilar to Ku70-like protein. 
Os07g0190900012-063-F11TCTGGGCCGTTTGGGCCGAANONE 
AK073533TCTGGGCCGTTTGGGCCGAASMAD/FHA domain containing protein. 
J013110O09TCTGGGCCGTTTGGGCCGAANONE 
J033041I12TCTGGGCCGTTTGGGCCGAANONE 
J033046D05TCTGGGCCGTTTGGGCCGAANONE 
J033101K24TCTGGGCCGTTTGGGCCGAANONE 
J090009F10TCTGGGCCGTTTGGGCCGAANONE 
J090095B17TCTGGGCCGTTTGGGCCGAANONE 
Os07g0191000AK071379TTCGGCCCAAACGGCCCAGAInositol monophosphatase family protein. 
AK103440TTCGGCCCAAACGGCCCAGANONE 
Os07g0205000009-018-A12GCGGCCCAANONE 
AK103963GCGGCCCAANONE 
AK121368GCGGCCCAANONE 
J023001M20GCGGCCCAANONE 
J023125I03GCGGCCCAANONE 
J053034L22GCGGCCCAANONE 
J065078A21GCGGCCCAANONE 
J065089G24GCGGCCCAANONE 
J065096G23GCGGCCCAANONE 
J065103N06GCGGCCCAANONE 
J065146J22GCGGCCCAANONE 
J065159K18GCGGCCCAANONE 
J065204L04GCGGCCCAANONE 
J065207N07GCGGCCCAANONE 
J065208E24GCGGCCCAANONE 
J075057F19GCGGCCCAANONE 
J075058K01GCGGCCCAANONE 
J075072H13GCGGCCCAANONE 
J080003D08GCGGCCCAANONE 
J080025F02GCGGCCCAANONE 
Os07g0270900015-039-A02ATTTGGGCCGCNONE 
AK058966ATTTGGGCCGCMak16 protein family protein. 
AK068904ATTTGGGCCGCNONE 
J013169N21ATTTGGGCCGCNONE 
J065039I11ATTTGGGCCGCNONE 
J065081J11ATTTGGGCCGCNONE 
J065162P04ATTTGGGCCGCNONE 
Os07g0301200AB110202CTTGGGCCGTGCTTGGGCCGTGGNONE 
AK073463CTTGGGCCGTGCTTGGGCCGTGGSimilar to RNA helicase (Fragment). 
Os07g0450000009-033-A08ATTTGGGCCGANONE 
AK063789ATTTGGGCCGANONE 
AK121702ATTTGGGCCGASimilar to 60S ribosomal protein L44. 
J033073H17ATTTGGGCCGANONE 
J065006A02ATTTGGGCCGANONE 
J065009C05ATTTGGGCCGANONE 
J065028M04ATTTGGGCCGANONE 
J065070D07ATTTGGGCCGANONE 
J065072H17ATTTGGGCCGANONE 
J065114J23ATTTGGGCCGANONE 
J065127A02ATTTGGGCCGANONE 
J065146L07ATTTGGGCCGANONE 
J065213H17ATTTGGGCCGANONE 
J065214B07ATTTGGGCCGANONE 
J100045B16ATTTGGGCCGANONE 
Os07g0462700009-033-D05ATTGGGCCGGTNONE 
AK073834ATTGGGCCGGTNONE 
AK104968ATTGGGCCGGTThioesterase superfamily domain containing protein. 
J065104G16ATTGGGCCGGTNONE 
J065197C14ATTGGGCCGGTNONE 
J065213E17ATTGGGCCGGTNONE 
J065215D11ATTGGGCCGGTNONE 
J075001J15ATTGGGCCGGTNONE 
J075026M11ATTGGGCCGGTNONE 
J075142G03ATTGGGCCGGTNONE 
J075178H04ATTGGGCCGGTNONE 
J100069P18ATTGGGCCGGTNONE 
Os07g0463100009-138-B06GCGGCCCAAATNONE 
AK121807GCGGCCCAAATDNA-directed RNA polymerase, 14 to 18 kDa subunit family protein. 
J013162G21GCGGCCCAAATNONE 
J065061H22GCGGCCCAAATNONE 
J075091J19GCGGCCCAAATNONE 
J075107E13GCGGCCCAAATNONE 
J075141I11GCGGCCCAAATNONE 
J075172E07GCGGCCCAAATNONE 
J080305N05GCGGCCCAAATNONE 
J080311B17GCGGCCCAAATNONE 
J080316I07GCGGCCCAAATNONE 
Os07g0479200005-017-H08TTCGGCCCAACACGTCACNONE 
AK058326TTCGGCCCAACACGTCACSimilar to SL15-like (Fragment). 
J013092A08TTCGGCCCAACACGTCACNONE 
J033139E04TTCGGCCCAACACGTCACNONE 
J043016M16TTCGGCCCAACACGTCACNONE 
J053050O18TTCGGCCCAACACGTCACNONE 
J053098B03TTCGGCCCAACACGTCACNONE 
J065068G10TTCGGCCCAACACGTCACNONE 
J065091I17TTCGGCCCAACACGTCACNONE 
J065109A03TTCGGCCCAACACGTCACNONE 
J065168B17TTCGGCCCAACACGTCACNONE 
J065177A05TTCGGCCCAACACGTCACNONE 
J065180J01TTCGGCCCAACACGTCACNONE 
J075006F13TTCGGCCCAACACGTCACNONE 
J075022J03TTCGGCCCAACACGTCACNONE 
J075024N09TTCGGCCCAACACGTCACNONE 
J075114B12TTCGGCCCAACACGTCACNONE 
J080023M06TTCGGCCCAACACGTCACNONE 
J080081N24TTCGGCCCAACACGTCACNONE 
J090060N07TTCGGCCCAACACGTCACNONE 
Os07g0490300AK068288GCCGGCCCAAGSimilar to Preproacrosin. 
J013149P03GCCGGCCCAAGNONE 
J065039L14GCCGGCCCAAGNONE 
J100024A06GCCGGCCCAAGNONE 
Os07g0490400AK067941CTTGGGCCGGCPeptidylprolyl isomerase, FKBP-type domain containing protein. 
J013121F22CTTGGGCCGGCNONE 
Os07g0555400AK070977CTTGGGCCGTGCTTGGGCTGAConserved hypothetical protein. 
Os07g0562700003-111-G08GCCCGGCCCAAAANONE 
004-013-E07GCCCGGCCCAAAANONE 
006-021-D03GCCCGGCCCAAAANONE 
006-021-D07GCCCGGCCCAAAANONE 
006-021-F09GCCCGGCCCAAAANONE 
006-023-D01GCCCGGCCCAAAANONE 
006-024-F04GCCCGGCCCAAAANONE 
006-024-G09GCCCGGCCCAAAANONE 
006-024-G11GCCCGGCCCAAAANONE 
006-025-A10GCCCGGCCCAAAANONE 
006-025-B08GCCCGGCCCAAAANONE 
006-025-E10GCCCGGCCCAAAANONE 
006-025-F10GCCCGGCCCAAAANONE 
006-026-B04GCCCGGCCCAAAANONE 
006-026-C08GCCCGGCCCAAAANONE 
006-026-D03GCCCGGCCCAAAANONE 
006-026-F03GCCCGGCCCAAAANONE 
006-026-F08GCCCGGCCCAAAANONE 
006-026-F12GCCCGGCCCAAAANONE 
006-027-A10GCCCGGCCCAAAANONE 
006-027-C03GCCCGGCCCAAAANONE 
006-028-C03GCCCGGCCCAAAANONE 
006-029-E02GCCCGGCCCAAAANONE 
006-029-G05GCCCGGCCCAAAANONE 
006-030-A10GCCCGGCCCAAAANONE 
006-030-C06GCCCGGCCCAAAANONE 
006-030-D03GCCCGGCCCAAAANONE 
006-030-D06GCCCGGCCCAAAANONE 
006-030-G05GCCCGGCCCAAAANONE 
006-031-B10GCCCGGCCCAAAANONE 
006-031-D04GCCCGGCCCAAAANONE 
006-031-D11GCCCGGCCCAAAANONE 
006-031-H09GCCCGGCCCAAAANONE 
006-032-C09GCCCGGCCCAAAANONE 
006-032-H09GCCCGGCCCAAAANONE 
006-033-B02GCCCGGCCCAAAANONE 
006-033-B09GCCCGGCCCAAAANONE 
006-033-E01GCCCGGCCCAAAANONE 
006-033-F06GCCCGGCCCAAAANONE 
006-033-G03GCCCGGCCCAAAANONE 
006-034-A08GCCCGGCCCAAAANONE 
006-034-C09GCCCGGCCCAAAANONE 
006-034-F06GCCCGGCCCAAAANONE 
006-035-B12GCCCGGCCCAAAANONE 
006-035-C12GCCCGGCCCAAAANONE 
006-035-H04GCCCGGCCCAAAANONE 
006-035-H12GCCCGGCCCAAAANONE 
006-036-A05GCCCGGCCCAAAANONE 
006-036-A09GCCCGGCCCAAAANONE 
006-036-B10GCCCGGCCCAAAANONE 
006-036-C03GCCCGGCCCAAAANONE 
006-036-E06GCCCGGCCCAAAANONE 
006-037-H11GCCCGGCCCAAAANONE 
006-038-G01GCCCGGCCCAAAANONE 
006-039-B01GCCCGGCCCAAAANONE 
006-039-B12GCCCGGCCCAAAANONE 
006-039-C02GCCCGGCCCAAAANONE 
006-039-E06GCCCGGCCCAAAANONE 
006-039-G12GCCCGGCCCAAAANONE 
006-040-G07GCCCGGCCCAAAANONE 
006-041-H04GCCCGGCCCAAAANONE 
006-042-A11GCCCGGCCCAAAANONE 
006-042-E07GCCCGGCCCAAAANONE 
006-042-F12GCCCGGCCCAAAANONE 
006-043-C01GCCCGGCCCAAAANONE 
006-045-H12GCCCGGCCCAAAANONE 
006-046-A12GCCCGGCCCAAAANONE 
006-046-F03GCCCGGCCCAAAANONE 
006-047-A07GCCCGGCCCAAAANONE 
006-047-A09GCCCGGCCCAAAANONE 
006-047-E10GCCCGGCCCAAAANONE 
006-047-G12GCCCGGCCCAAAANONE 
006-048-B04GCCCGGCCCAAAANONE 
006-049-D01GCCCGGCCCAAAANONE 
006-049-G02GCCCGGCCCAAAANONE 
006-049-G10GCCCGGCCCAAAANONE 
006-049-H04GCCCGGCCCAAAANONE 
006-050-D05GCCCGGCCCAAAANONE 
006-050-F05GCCCGGCCCAAAANONE 
006-051-B05GCCCGGCCCAAAANONE 
006-051-G12GCCCGGCCCAAAANONE 
006-052-D12GCCCGGCCCAAAANONE 
006-053-D06GCCCGGCCCAAAANONE 
006-054-H02GCCCGGCCCAAAANONE 
006-055-A03GCCCGGCCCAAAANONE 
006-055-C01GCCCGGCCCAAAANONE 
006-055-E07GCCCGGCCCAAAANONE 
006-055-H06GCCCGGCCCAAAANONE 
006-056-F06GCCCGGCCCAAAANONE 
006-057-D03GCCCGGCCCAAAANONE 
006-057-D05GCCCGGCCCAAAANONE 
006-057-G01GCCCGGCCCAAAANONE 
006-058-A03GCCCGGCCCAAAANONE 
006-058-B06GCCCGGCCCAAAANONE 
006-059-A09GCCCGGCCCAAAANONE 
006-059-H11GCCCGGCCCAAAANONE 
006-060-A04GCCCGGCCCAAAANONE 
006-060-A09GCCCGGCCCAAAANONE 
006-060-C11GCCCGGCCCAAAANONE 
006-060-D08GCCCGGCCCAAAANONE 
006-061-A04GCCCGGCCCAAAANONE 
006-061-E01GCCCGGCCCAAAANONE 
006-061-G10GCCCGGCCCAAAANONE 
006-061-H12GCCCGGCCCAAAANONE 
006-062-B07GCCCGGCCCAAAANONE 
006-062-G03GCCCGGCCCAAAANONE 
006-062-H12GCCCGGCCCAAAANONE 
006-063-D05GCCCGGCCCAAAANONE 
006-063-E04GCCCGGCCCAAAANONE 
006-063-F05GCCCGGCCCAAAANONE 
006-063-G05GCCCGGCCCAAAANONE 
006-064-B07GCCCGGCCCAAAANONE 
006-065-C11GCCCGGCCCAAAANONE 
006-065-H02GCCCGGCCCAAAANONE 
006-067-C12GCCCGGCCCAAAANONE 
006-067-F10GCCCGGCCCAAAANONE 
006-068-E02GCCCGGCCCAAAANONE 
006-068-G04GCCCGGCCCAAAANONE 
006-069-A02GCCCGGCCCAAAANONE 
006-071-A07GCCCGGCCCAAAANONE 
006-072-F11GCCCGGCCCAAAANONE 
006-072-F12GCCCGGCCCAAAANONE 
006-073-E12GCCCGGCCCAAAANONE 
006-073-F08GCCCGGCCCAAAANONE 
006-073-H07GCCCGGCCCAAAANONE 
006-074-A07GCCCGGCCCAAAANONE 
006-075-A12GCCCGGCCCAAAANONE 
006-075-B01GCCCGGCCCAAAANONE 
006-075-H10GCCCGGCCCAAAANONE 
006-075-H12GCCCGGCCCAAAANONE 
006-076-B06GCCCGGCCCAAAANONE 
006-077-A09GCCCGGCCCAAAANONE 
006-077-D05GCCCGGCCCAAAANONE 
006-078-C11GCCCGGCCCAAAANONE 
006-078-D12GCCCGGCCCAAAANONE 
006-078-E02GCCCGGCCCAAAANONE 
006-079-A01GCCCGGCCCAAAANONE 
006-079-E02GCCCGGCCCAAAANONE 
006-079-F03GCCCGGCCCAAAANONE 
006-080-G11GCCCGGCCCAAAANONE 
006-081-C02GCCCGGCCCAAAANONE 
006-081-C08GCCCGGCCCAAAANONE 
006-082-B06GCCCGGCCCAAAANONE 
006-082-C11GCCCGGCCCAAAANONE 
006-082-H04GCCCGGCCCAAAANONE 
006-083-E04GCCCGGCCCAAAANONE 
006-083-H12GCCCGGCCCAAAANONE 
006-084-C08GCCCGGCCCAAAANONE 
006-084-E07GCCCGGCCCAAAANONE 
006-084-E10GCCCGGCCCAAAANONE 
006-085-E06GCCCGGCCCAAAANONE 
006-085-E10GCCCGGCCCAAAANONE 
006-086-F06GCCCGGCCCAAAANONE 
006-087-D08GCCCGGCCCAAAANONE 
006-087-F03GCCCGGCCCAAAANONE 
006-087-F10GCCCGGCCCAAAANONE 
006-087-G07GCCCGGCCCAAAANONE 
006-088-A02GCCCGGCCCAAAANONE 
006-089-A04GCCCGGCCCAAAANONE 
006-089-B12GCCCGGCCCAAAANONE 
006-089-D06GCCCGGCCCAAAANONE 
006-089-D10GCCCGGCCCAAAANONE 
006-089-H05GCCCGGCCCAAAANONE 
006-090-C06GCCCGGCCCAAAANONE 
006-091-A03GCCCGGCCCAAAANONE 
006-091-E04GCCCGGCCCAAAANONE 
006-091-H12GCCCGGCCCAAAANONE 
006-092-A08GCCCGGCCCAAAANONE 
006-092-F01GCCCGGCCCAAAANONE 
006-092-G08GCCCGGCCCAAAANONE 
006-093-B12GCCCGGCCCAAAANONE 
006-093-D04GCCCGGCCCAAAANONE 
006-093-F01GCCCGGCCCAAAANONE 
006-094-A08GCCCGGCCCAAAANONE 
006-094-F01GCCCGGCCCAAAANONE 
006-094-F03GCCCGGCCCAAAANONE 
006-095-C12GCCCGGCCCAAAANONE 
006-095-E10GCCCGGCCCAAAANONE 
006-095-E12GCCCGGCCCAAAANONE 
006-095-G06GCCCGGCCCAAAANONE 
006-096-B12GCCCGGCCCAAAANONE 
006-096-C12GCCCGGCCCAAAANONE 
006-096-G02GCCCGGCCCAAAANONE 
006-097-D01GCCCGGCCCAAAANONE 
006-097-D07GCCCGGCCCAAAANONE 
006-097-F04GCCCGGCCCAAAANONE 
006-098-C07GCCCGGCCCAAAANONE 
006-098-D04GCCCGGCCCAAAANONE 
006-099-E06GCCCGGCCCAAAANONE 
006-099-F02GCCCGGCCCAAAANONE 
006-099-F10GCCCGGCCCAAAANONE 
006-100-A07GCCCGGCCCAAAANONE 
006-100-B10GCCCGGCCCAAAANONE 
006-100-G01GCCCGGCCCAAAANONE 
006-100-H06GCCCGGCCCAAAANONE 
006-101-D01GCCCGGCCCAAAANONE 
006-101-F03GCCCGGCCCAAAANONE 
006-102-A12GCCCGGCCCAAAANONE 
006-102-B11GCCCGGCCCAAAANONE 
006-102-C03GCCCGGCCCAAAANONE 
006-102-F11GCCCGGCCCAAAANONE 
006-103-A08GCCCGGCCCAAAANONE 
006-103-B06GCCCGGCCCAAAANONE 
006-103-D01GCCCGGCCCAAAANONE 
006-103-F02GCCCGGCCCAAAANONE 
006-104-B02GCCCGGCCCAAAANONE 
006-104-C01GCCCGGCCCAAAANONE 
006-104-F09GCCCGGCCCAAAANONE 
006-104-H11GCCCGGCCCAAAANONE 
006-105-A03GCCCGGCCCAAAANONE 
006-105-D09GCCCGGCCCAAAANONE 
006-106-B10GCCCGGCCCAAAANONE 
006-107-A06GCCCGGCCCAAAANONE 
006-107-C04GCCCGGCCCAAAANONE 
006-107-E03GCCCGGCCCAAAANONE 
006-107-F05GCCCGGCCCAAAANONE 
006-108-C09GCCCGGCCCAAAANONE 
006-109-C09GCCCGGCCCAAAANONE 
006-109-D10GCCCGGCCCAAAANONE 
006-109-E06GCCCGGCCCAAAANONE 
006-109-E10GCCCGGCCCAAAANONE 
006-110-A06GCCCGGCCCAAAANONE 
006-110-C11GCCCGGCCCAAAANONE 
006-111-A02GCCCGGCCCAAAANONE 
006-111-F02GCCCGGCCCAAAANONE 
006-112-A08GCCCGGCCCAAAANONE 
006-112-H06GCCCGGCCCAAAANONE 
006-113-A08GCCCGGCCCAAAANONE 
006-113-B01GCCCGGCCCAAAANONE 
006-113-C05GCCCGGCCCAAAANONE 
006-113-D01GCCCGGCCCAAAANONE 
006-113-D04GCCCGGCCCAAAANONE 
006-113-D06GCCCGGCCCAAAANONE 
006-113-E09GCCCGGCCCAAAANONE 
006-114-F06GCCCGGCCCAAAANONE 
006-116-B02GCCCGGCCCAAAANONE 
006-117-B07GCCCGGCCCAAAANONE 
006-117-G04GCCCGGCCCAAAANONE 
006-118-D01GCCCGGCCCAAAANONE 
006-118-D12GCCCGGCCCAAAANONE 
006-118-F12GCCCGGCCCAAAANONE 
006-118-G12GCCCGGCCCAAAANONE 
006-119-B08GCCCGGCCCAAAANONE 
006-120-E09GCCCGGCCCAAAANONE 
006-120-G05GCCCGGCCCAAAANONE 
006-120-G10GCCCGGCCCAAAANONE 
009-022-D12GCCCGGCCCAAAANONE 
009-051-H08GCCCGGCCCAAAANONE 
009-065-F05GCCCGGCCCAAAANONE 
009-070-A06GCCCGGCCCAAAANONE 
009-073-B07GCCCGGCCCAAAANONE 
009-092-C10GCCCGGCCCAAAANONE 
009-093-D03GCCCGGCCCAAAANONE 
009-103-B04GCCCGGCCCAAAANONE 
009-106-H08GCCCGGCCCAAAANONE 
009-120-B05GCCCGGCCCAAAANONE 
009-121-F05GCCCGGCCCAAAANONE 
009-122-B04GCCCGGCCCAAAANONE 
009-122-D08GCCCGGCCCAAAANONE 
009-123-F07GCCCGGCCCAAAANONE 
009-125-G02GCCCGGCCCAAAANONE 
009-128-F02GCCCGGCCCAAAANONE 
009-128-H07GCCCGGCCCAAAANONE 
009-131-C06GCCCGGCCCAAAANONE 
009-132-F08GCCCGGCCCAAAANONE 
009-133-G08GCCCGGCCCAAAANONE 
009-134-D09GCCCGGCCCAAAANONE 
009-135-F01GCCCGGCCCAAAANONE 
009-149-E11GCCCGGCCCAAAANONE 
009-153-H04GCCCGGCCCAAAANONE 
009-161-E04GCCCGGCCCAAAANONE 
009-163-A09GCCCGGCCCAAAANONE 
009-163-C05GCCCGGCCCAAAANONE 
009-163-E10GCCCGGCCCAAAANONE 
009-165-F04GCCCGGCCCAAAANONE 
009-166-A07GCCCGGCCCAAAANONE 
009-169-G12GCCCGGCCCAAAANONE 
009-172-G08GCCCGGCCCAAAANONE 
009-179-E06GCCCGGCCCAAAANONE 
009-181-F09GCCCGGCCCAAAANONE 
009-190-G07GCCCGGCCCAAAANONE 
009-191-D01GCCCGGCCCAAAANONE 
009-195-G02GCCCGGCCCAAAANONE 
AF022738GCCCGGCCCAAAANONE 
AK061512GCCCGGCCCAAAANONE 
AK068972GCCCGGCCCAAAANONE 
AK103926GCCCGGCCCAAAANONE 
AK103999GCCCGGCCCAAAANONE 
AK104224GCCCGGCCCAAAANONE 
AK104465GCCCGGCCCAAAANONE 
AK104495GCCCGGCCCAAAANONE 
AK109399GCCCGGCCCAAAASimilar to Type III chlorophyll a/b-binding protein (Fragment). 
AK119533GCCCGGCCCAAAANONE 
AK119545GCCCGGCCCAAAANONE 
J013043L10GCCCGGCCCAAAANONE 
J013050A09GCCCGGCCCAAAANONE 
J023001G03GCCCGGCCCAAAANONE 
J023024D14GCCCGGCCCAAAANONE 
J023072E11GCCCGGCCCAAAANONE 
J023149E18GCCCGGCCCAAAANONE 
J033029B16GCCCGGCCCAAAANONE 
J065001O21GCCCGGCCCAAAANONE 
J065035B04GCCCGGCCCAAAANONE 
J065044D18GCCCGGCCCAAAANONE 
J065057F12GCCCGGCCCAAAANONE 
J065060A11GCCCGGCCCAAAANONE 
J065062G15GCCCGGCCCAAAANONE 
J065080F13GCCCGGCCCAAAANONE 
J065084N12GCCCGGCCCAAAANONE 
J065101D02GCCCGGCCCAAAANONE 
J065107C07GCCCGGCCCAAAANONE 
J065112N24GCCCGGCCCAAAANONE 
J065141I16GCCCGGCCCAAAANONE 
J065147D05GCCCGGCCCAAAANONE 
J065167H02GCCCGGCCCAAAANONE 
J065207K23GCCCGGCCCAAAANONE 
J075008E16GCCCGGCCCAAAANONE 
J075014F03GCCCGGCCCAAAANONE 
J075015O17GCCCGGCCCAAAANONE 
J075020H20GCCCGGCCCAAAANONE 
J075021E22GCCCGGCCCAAAANONE 
J075023N13GCCCGGCCCAAAANONE 
J075028H10GCCCGGCCCAAAANONE 
J075040F20GCCCGGCCCAAAANONE 
J075051L23GCCCGGCCCAAAANONE 
J075069G16GCCCGGCCCAAAANONE 
J075084F24GCCCGGCCCAAAANONE 
J075090H09GCCCGGCCCAAAANONE 
J075092M21GCCCGGCCCAAAANONE 
J075110C10GCCCGGCCCAAAANONE 
J075111J12GCCCGGCCCAAAANONE 
J075114L04GCCCGGCCCAAAANONE 
J075139E02GCCCGGCCCAAAANONE 
J075160M10GCCCGGCCCAAAANONE 
J075176J03GCCCGGCCCAAAANONE 
J075183I17GCCCGGCCCAAAANONE 
J075191N10GCCCGGCCCAAAANONE 
J075193D07GCCCGGCCCAAAANONE 
J075194M16GCCCGGCCCAAAANONE 
J075197K04GCCCGGCCCAAAANONE 
J080032I11GCCCGGCCCAAAANONE 
J080076M11GCCCGGCCCAAAANONE 
J080311J08GCCCGGCCCAAAANONE 
J080317E05GCCCGGCCCAAAANONE 
J090034L08GCCCGGCCCAAAANONE 
J100040D19GCCCGGCCCAAAANONE 
J100074C11GCCCGGCCCAAAANONE 
Os07g0564000AK069806AGTTGGGCCGAGAConserved hypothetical protein. 
Os07g0565000AK121056GTTTGGGCCTTCTTGGGCCGASimilar to 40S ribosomal protein S11. 
J023056G18GTTTGGGCCTTCTTGGGCCGANONE 
J065131K04GTTTGGGCCTTCTTGGGCCGANONE 
J065190L19GTTTGGGCCTTCTTGGGCCGANONE 
J065209B06GTTTGGGCCTTCTTGGGCCGANONE 
J065216P11GTTTGGGCCTTCTTGGGCCGANONE 
J090088F06GTTTGGGCCTTCTTGGGCCGANONE 
Os07g0570700AK065242TTCGGCCCAACTRibosome recycling factor family protein. 
J013002I12TTCGGCCCAACTNONE 
Os07g0572500AK108612ACCGGCCCAACCConserved hypothetical protein. 
Os07g0573600AK073925GTTTGGGCCGGGCCGAAAREX1 DNA Repair family protein. 
J033072E11GTTTGGGCCGGGCCGAAANONE 
Os07g0586700AK102792CACGGCCCAAACCCAGCCCAAAAConserved hypothetical protein. 
Os07g0595700003-103-G05AGTTGGGCCGCNONE 
AK108488AGTTGGGCCGCConserved hypothetical protein. 
J065136O05AGTTGGGCCGCNONE 
Os07g0595800011-069-G09GCGGCCCAACTNONE 
AK066349GCGGCCCAACTPrefoldin related, ubiquitously expressed transcript family protein. 
J013062C05GCGGCCCAACTNONE 
Os07g0607200AK065746CCAAGCCCACGGCCCAACCProtein of unknown function DUF751 family protein. 
AK065746CTCGGCCCAACAProtein of unknown function DUF751 family protein. 
AK065746TTCGGCCCAACA