version

Summary of OsREG564 (All List)

OrganismOryza sativa  
IDOsREG564  
SequenceCGGCCCAC  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count3451  

Entry Sequences (3451 entries)

LocusGene modelSequenceDescription
Os01g0132800AK068422TGCGGCCCACGTPeptidyl-tRNA hydrolase family protein. 
Os01g0164500AK068747GCGGCCCACCASimilar to ATP-dependent RNA helicase-like protein. 
AK103737GCGGCCCACCANONE 
Os01g0169800006-062-A02GGTGGGCCGGCNONE 
AK061054GGTGGGCCGGCAllinase, C-terminal domain containing protein. 
Os01g0191100009-011-A02TCCGGCCCACGANONE 
009-028-D05TCCGGCCCACGANONE 
009-058-B11TCCGGCCCACGANONE 
009-151-D09TCCGGCCCACGANONE 
013-026-G03TCCGGCCCACGANONE 
013-063-F04TCCGGCCCACGANONE 
013-069-B05TCCGGCCCACGANONE 
014-029-E04TCCGGCCCACGANONE 
014-072-H04TCCGGCCCACGANONE 
014-089-E09TCCGGCCCACGANONE 
015-047-G05TCCGGCCCACGANONE 
016-033-G06TCCGGCCCACGANONE 
AK058815TCCGGCCCACGASimilar to Acidic ribosomal protein P2a-4 (Fragment). 
J023069C08TCCGGCCCACGANONE 
J023077K21TCCGGCCCACGANONE 
J023081F19TCCGGCCCACGANONE 
J033052N11TCCGGCCCACGANONE 
J033058N11TCCGGCCCACGANONE 
J033114G05TCCGGCCCACGANONE 
J033114O17TCCGGCCCACGANONE 
J033129L14TCCGGCCCACGANONE 
J053029I12TCCGGCCCACGANONE 
J065067N19TCCGGCCCACGANONE 
J065084I19TCCGGCCCACGANONE 
J065099O03TCCGGCCCACGANONE 
J065201I08TCCGGCCCACGANONE 
J075035B08TCCGGCCCACGANONE 
J075037B22TCCGGCCCACGANONE 
J075054L16TCCGGCCCACGANONE 
J075059D15TCCGGCCCACGANONE 
J075164I08TCCGGCCCACGANONE 
J075185J01TCCGGCCCACGANONE 
J090042O06TCCGGCCCACGANONE 
J090044F12TCCGGCCCACGANONE 
J090063L02TCCGGCCCACGANONE 
J090073I10TCCGGCCCACGANONE 
J090078E18TCCGGCCCACGANONE 
J100072K16TCCGGCCCACGANONE 
Os01g0192550J065164G16GACGGCCCACGGConserved hypothetical protein. 
Os01g0229100006-113-G08ACGTGGGCCGAAANONE 
011-075-E08ACGTGGGCCGAAANONE 
AK061285ACGTGGGCCGAAANONE 
AK070838ACGTGGGCCGAAATetratricopeptide-like helical domain containing protein. 
J013059F08ACGTGGGCCGAAANONE 
J013059G08ACGTGGGCCGAAANONE 
J013059G09ACGTGGGCCGAAANONE 
J013069M12ACGTGGGCCGAAANONE 
J013105A19ACGTGGGCCGAAANONE 
J013149F07ACGTGGGCCGAAANONE 
J023073J07ACGTGGGCCGAAANONE 
J023130F24ACGTGGGCCGAAANONE 
J023147J08ACGTGGGCCGAAANONE 
J033028F13ACGTGGGCCGAAANONE 
J033115A16ACGTGGGCCGAAANONE 
J033135F02ACGTGGGCCGAAANONE 
J065031G16ACGTGGGCCGAAANONE 
J065058A09ACGTGGGCCGAAANONE 
J065089N15ACGTGGGCCGAAANONE 
J065130I09ACGTGGGCCGAAANONE 
J065191P09ACGTGGGCCGAAANONE 
J065197P14ACGTGGGCCGAAANONE 
J080306D15ACGTGGGCCGAAANONE 
J080308M06ACGTGGGCCGAAANONE 
J080315A03ACGTGGGCCGAAANONE 
J080315N11ACGTGGGCCGAAANONE 
J090046E14ACGTGGGCCGAAANONE 
J090058G09ACGTGGGCCGAAANONE 
J090077H05ACGTGGGCCGAAANONE 
J090087O20ACGTGGGCCGAAANONE 
Os01g0229200AK066024TTTCGGCCCACGTVHS domain containing protein. 
Os01g0239100Os01g0239100CACGGCCCACGCHeat shock protein DnaJ family protein. 
Os01g0246100AK120732CAAGTGGGCCGGCProtein of unknown function DUF902, CREBbp domain containing protein. 
Os01g0258600J075028F17GACGGCCCAGGCCCACGGCCCACANONE 
J075061L04GACGGCCCAGGCCCACGGCCCACAConserved hypothetical protein. 
J075071B09GACGGCCCAGGCCCACGGCCCACANONE 
J075093E04GACGGCCCAGGCCCACGGCCCACANONE 
J100033B11GACGGCCCAGGCCCACGGCCCACANONE 
Os01g0269100011-080-F08GTGTGGGCCGTANONE 
AK067610GTGTGGGCCGTASimilar to Rab proteins geranylgeranyltransferase component A 2 (Rab escort protein 2) (REP-2) (Choroideraemia-like protein). 
J013059P18GTGTGGGCCGTANONE 
J013112F12GTGTGGGCCGTANONE 
J023002M17GTGTGGGCCGTANONE 
J023022J24GTGTGGGCCGTANONE 
J033050A10GTGTGGGCCGTANONE 
J033091A17GTGTGGGCCGTANONE 
J033123E17GTGTGGGCCGTANONE 
J033143H04GTGTGGGCCGTANONE 
J043005H18GTGTGGGCCGTANONE 
J075038A05GTGTGGGCCGTANONE 
J075091K23GTGTGGGCCGTANONE 
J075118O05GTGTGGGCCGTANONE 
J075195P17GTGTGGGCCGTANONE 
J090027J21GTGTGGGCCGTANONE 
J100024I09GTGTGGGCCGTANONE 
J100032D15GTGTGGGCCGTANONE 
J100071I02GTGTGGGCCGTANONE 
J100080E01GTGTGGGCCGTANONE 
J100086A08GTGTGGGCCGTANONE 
Os01g0270100006-096-H09TGTGGGCCGCANONE 
009-009-C10TGTGGGCCGCANONE 
009-054-E06TGTGGGCCGCANONE 
014-085-F09TGTGGGCCGCANONE 
AK073275TGTGGGCCGCANONE 
AK104155TGTGGGCCGCANONE 
AK119511TGTGGGCCGCASimilar to Cysteine protease inhibitor. 
J033025K21TGTGGGCCGCANONE 
J075065H10TGTGGGCCGCANONE 
J075143G10TGTGGGCCGCANONE 
J100059J02TGTGGGCCGCANONE 
Os01g0276500006-030-E04ACGTGGGCCGTANONE 
AK061002ACGTGGGCCGTASimilar to Histidine biosynthesis bifunctional protein hisIE, chloroplast precursor [Includes: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) (PRA-CH); Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31) (PRA-PH)]. 
AK099335ACGTGGGCCGTANONE 
Os01g0276700011-014-A12CCCGGCCCACACNONE 
012-092-G12CCCGGCCCACACNONE 
AK103164CCCGGCCCACACNONE 
AK103465CCCGGCCCACACSimilar to Pyruvate kinase, cytosolic isozyme (EC 2.7.1.40) (PK). 
J023019H09CCCGGCCCACACNONE 
J023084I02CCCGGCCCACACNONE 
J033027F20CCCGGCCCACACNONE 
J033029M06CCCGGCCCACACNONE 
J033039K13CCCGGCCCACACNONE 
J033057C24CCCGGCCCACACNONE 
J033058G20CCCGGCCCACACNONE 
J033060A14CCCGGCCCACACNONE 
J033061M21CCCGGCCCACACNONE 
J033068M10CCCGGCCCACACNONE 
J033074K16CCCGGCCCACACNONE 
J033076C11CCCGGCCCACACNONE 
J033093O13CCCGGCCCACACNONE 
J033119H20CCCGGCCCACACNONE 
J033121D22CCCGGCCCACACNONE 
J033129N11CCCGGCCCACACNONE 
J033131E12CCCGGCCCACACNONE 
J033150L07CCCGGCCCACACNONE 
J053024N17CCCGGCCCACACNONE 
J053034G19CCCGGCCCACACNONE 
J053035E18CCCGGCCCACACNONE 
J053046M01CCCGGCCCACACNONE 
J053047P04CCCGGCCCACACNONE 
J053048B06CCCGGCCCACACNONE 
J053050M22CCCGGCCCACACNONE 
J053053E09CCCGGCCCACACNONE 
J053053I07CCCGGCCCACACNONE 
J053059K03CCCGGCCCACACNONE 
J053059P12CCCGGCCCACACNONE 
J053060C12CCCGGCCCACACNONE 
J053060H24CCCGGCCCACACNONE 
J053064D19CCCGGCCCACACNONE 
J053066L15CCCGGCCCACACNONE 
J053073I02CCCGGCCCACACNONE 
J053083E15CCCGGCCCACACNONE 
J053094D05CCCGGCCCACACNONE 
J053094P18CCCGGCCCACACNONE 
J053095C15CCCGGCCCACACNONE 
J053095C21CCCGGCCCACACNONE 
J053099N16CCCGGCCCACACNONE 
J090025O19CCCGGCCCACACNONE 
J090049N22CCCGGCCCACACNONE 
J090050F17CCCGGCCCACACNONE 
Os01g0286000AK109824AACGGGCCGTAAGTGGGCCGAGSnf7 family protein. 
Os01g0303300J053035N19ACCGGCCCACGCNONE 
J075042F02ACCGGCCCACGCNONE 
J075068E10ACCGGCCCACGCNONE 
J075116E19ACCGGCCCACGCNONE 
J075131C10ACCGGCCCACGCNONE 
J075145J11ACCGGCCCACGCNONE 
J075157P20ACCGGCCCACGCMitochondrial import inner membrane translocase, subunit Tim17/22 family protein. 
J075164G12ACCGGCCCACGCNONE 
Os01g0346400J100032G11GTGGTGGGCCGAAAConserved hypothetical protein. 
Os01g0346700AK071793CACGGCCCACGCConserved hypothetical protein. 
J023114F06CACGGCCCACGCNONE 
Os01g0348700009-125-H02CAAGGCCCAATCGGCCCACAANONE 
009-156-F08CAAGGCCCAATCGGCCCACAANONE 
009-177-A11CAAGGCCCAATCGGCCCACAANONE 
009-195-D02CAAGGCCCAATCGGCCCACAANONE 
013-040-B06CAAGGCCCAATCGGCCCACAANONE 
013-051-B09CAAGGCCCAATCGGCCCACAANONE 
AK120842CAAGGCCCAATCGGCCCACAASimilar to 60S ribosomal protein L23a (L25). 
J013071O22CAAGGCCCAATCGGCCCACAANONE 
J023022J07CAAGGCCCAATCGGCCCACAANONE 
J033028J08CAAGGCCCAATCGGCCCACAANONE 
J033109M11CAAGGCCCAATCGGCCCACAANONE 
J043022K15CAAGGCCCAATCGGCCCACAANONE 
J043031N11CAAGGCCCAATCGGCCCACAANONE 
J053023I10CAAGGCCCAATCGGCCCACAANONE 
J053045F16CAAGGCCCAATCGGCCCACAANONE 
J053054F22CAAGGCCCAATCGGCCCACAANONE 
J053094P15CAAGGCCCAATCGGCCCACAANONE 
J065048F01CAAGGCCCAATCGGCCCACAANONE 
J075012F16CAAGGCCCAATCGGCCCACAANONE 
J075089C09CAAGGCCCAATCGGCCCACAANONE 
J075179J20CAAGGCCCAATCGGCCCACAANONE 
J080305E19CAAGGCCCAATCGGCCCACAANONE 
J080309B21CAAGGCCCAATCGGCCCACAANONE 
J090017L05CAAGGCCCAATCGGCCCACAANONE 
J090058B11CAAGGCCCAATCGGCCCACAANONE 
Os01g0358300AK060388GTGGTGGGCCGGTTTGGGCTTTTNONE 
AK072081GTGGTGGGCCGGTTTGGGCTTTTTetratricopeptide-like helical domain containing protein. 
Os01g0358400006-031-B11AAAAGCCCAAACCGGCCCACCACNONE 
006-083-B11AAAAGCCCAAACCGGCCCACCACNONE 
006-083-C09AAAAGCCCAAACCGGCCCACCACNONE 
006-088-H03AAAAGCCCAAACCGGCCCACCACNONE 
006-102-H05AAAAGCCCAAACCGGCCCACCACNONE 
AK061826AAAAGCCCAAACCGGCCCACCACSimilar to 40S ribosomal protein S4. 
J013105M07AAAAGCCCAAACCGGCCCACCACNONE 
J013155A16AAAAGCCCAAACCGGCCCACCACNONE 
J033025C03AAAAGCCCAAACCGGCCCACCACNONE 
J033072L20AAAAGCCCAAACCGGCCCACCACNONE 
J033095I15AAAAGCCCAAACCGGCCCACCACNONE 
J033105E03AAAAGCCCAAACCGGCCCACCACNONE 
J033112G18AAAAGCCCAAACCGGCCCACCACNONE 
J033125D09AAAAGCCCAAACCGGCCCACCACNONE 
J065100L16AAAAGCCCAAACCGGCCCACCACNONE 
J065176I05AAAAGCCCAAACCGGCCCACCACNONE 
J090001C14AAAAGCCCAAACCGGCCCACCACNONE 
J090058E15AAAAGCCCAAACCGGCCCACCACNONE 
J090068F07AAAAGCCCAAACCGGCCCACCACNONE 
Os01g0508000AK069177TCCGGCCCACGCSimilar to Beta-glucosidase. 
Os01g0590300014-089-E04CGGGTGGGCCGGGNONE 
AK063740CGGGTGGGCCGGGConserved hypothetical protein. 
Os01g0593700Os01g0593700GCGGCCCACCSulphate anion transporter family protein. 
Os01g0596300016-083-D09TTTCGGCCCACACNONE 
AK069151TTTCGGCCCACACCyclin-like F-box domain containing protein. 
J023007D17TTTCGGCCCACACNONE 
J065141M02TTTCGGCCCACACNONE 
Os01g0606900AK065697ACCGGCCCACGGHeat shock protein DnaJ, N-terminal domain containing protein. 
Os01g0612800AK071035TGTGGGCCGAAConserved hypothetical protein. 
J090075K01TGTGGGCCGAANONE 
Os01g0613900014-018-D04ACCGGCCCACAANONE 
AK119181ACCGGCCCACAAProtein of unknown function UPF0052 and CofD family protein. 
J023119M14ACCGGCCCACAANONE 
J065019A15ACCGGCCCACAANONE 
J075090J10ACCGGCCCACAANONE 
J075195H12ACCGGCCCACAANONE 
Os01g0618500011-019-D03GAGGCCCACTACGGCCCACCTNONE 
AK067476GAGGCCCACTACGGCCCACCTSimilar to RNA helicase (Fragment). 
J013020E19GAGGCCCACTACGGCCCACCTNONE 
J033046J12GAGGCCCACTACGGCCCACCTNONE 
J033055D06GAGGCCCACTACGGCCCACCTNONE 
Os01g0679000AK058515CCGTGGGCCGTGRNA polymerase III subunit RPC82, C -terminal domain containing protein. 
J013149O08CCGTGGGCCGTGNONE 
J033064N24CCGTGGGCCGTGNONE 
J043022M20CCGTGGGCCGTGNONE 
J065075K20CCGTGGGCCGTGNONE 
J065081K04CCGTGGGCCGTGNONE 
J065128K13CCGTGGGCCGTGNONE 
J065131K12CCGTGGGCCGTGNONE 
J065137H20CCGTGGGCCGTGNONE 
J065205A09CCGTGGGCCGTGNONE 
J090030C13CCGTGGGCCGTGNONE 
J090053I08CCGTGGGCCGTGNONE 
J090054O22CCGTGGGCCGTGNONE 
J090082C15CCGTGGGCCGTGNONE 
J090097P12CCGTGGGCCGTGNONE 
Os01g0684800AK073525TCGGCCCACAProtein prenyltransferase domain containing protein. 
Os01g0705300AK102719AGATGGGCCGTGGGCCGTGConserved hypothetical protein. 
AK103903AGATGGGCCGTGGGCCGTGNONE 
J013146O16AGATGGGCCGTGGGCCGTGNONE 
J023024O09AGATGGGCCGTGGGCCGTGNONE 
J033105F22AGATGGGCCGTGGGCCGTGNONE 
J033150L19AGATGGGCCGTGGGCCGTGNONE 
J075008G14AGATGGGCCGTGGGCCGTGNONE 
J090089L03AGATGGGCCGTGGGCCGTGNONE 
J100040H18AGATGGGCCGTGGGCCGTGNONE 
Os01g0705500AK063120CACGGCCCACGGCCCATCTConserved hypothetical protein. 
J065063M12CACGGCCCACGGCCCATCTNONE 
J065165C11CACGGCCCACGGCCCATCTNONE 
Os01g0720600016-050-G11AGAGTGGGCCGGTNONE 
AK066808AGAGTGGGCCGGTNONE 
AK100976AGAGTGGGCCGGTNONE 
AK106541AGAGTGGGCCGGTStarch synthase IVa (Glycogen (Starch) synthase-like). 
AY373257AGAGTGGGCCGGTNONE 
J100039H11AGAGTGGGCCGGTNONE 
J100072K02AGAGTGGGCCGGTNONE 
Os01g0725900AK108128TCGGCCCACCTPollen Ole e 1 allergen and extensin domain containing protein. 
J075119G24TCGGCCCACCTNONE 
J075150F06TCGGCCCACCTNONE 
Os01g0730300AK101207GTCAGTGGGCCGTCCHAD-superfamily hydrolase subfamily IIB protein. 
AK109542GTCAGTGGGCCGTCCNONE 
Os01g0764000006-021-G03GACGGCCCACCCACCAACNONE 
006-025-C07GACGGCCCACCCACCAACNONE 
006-029-G11GACGGCCCACCCACCAACNONE 
006-030-C04GACGGCCCACCCACCAACNONE 
006-035-E05GACGGCCCACCCACCAACNONE 
006-037-G01GACGGCCCACCCACCAACNONE 
006-038-C01GACGGCCCACCCACCAACNONE 
006-039-G05GACGGCCCACCCACCAACNONE 
006-042-E11GACGGCCCACCCACCAACNONE 
006-044-H04GACGGCCCACCCACCAACNONE 
006-045-A10GACGGCCCACCCACCAACNONE 
006-045-C05GACGGCCCACCCACCAACNONE 
006-047-A11GACGGCCCACCCACCAACNONE 
006-048-H10GACGGCCCACCCACCAACNONE 
006-050-C01GACGGCCCACCCACCAACNONE 
006-050-H11GACGGCCCACCCACCAACNONE 
006-051-G10GACGGCCCACCCACCAACNONE 
006-051-G11GACGGCCCACCCACCAACNONE 
006-056-B04GACGGCCCACCCACCAACNONE 
006-063-F04GACGGCCCACCCACCAACNONE 
006-063-H12GACGGCCCACCCACCAACNONE 
006-065-G09GACGGCCCACCCACCAACNONE 
006-067-F11GACGGCCCACCCACCAACNONE 
006-073-D10GACGGCCCACCCACCAACNONE 
006-074-G09GACGGCCCACCCACCAACNONE 
006-075-D04GACGGCCCACCCACCAACNONE 
006-077-C10GACGGCCCACCCACCAACNONE 
006-082-A10GACGGCCCACCCACCAACNONE 
006-084-C12GACGGCCCACCCACCAACNONE 
006-085-F05GACGGCCCACCCACCAACNONE 
006-087-H12GACGGCCCACCCACCAACNONE 
006-092-E10GACGGCCCACCCACCAACNONE 
006-094-C06GACGGCCCACCCACCAACNONE 
006-096-G11GACGGCCCACCCACCAACNONE 
006-097-H11GACGGCCCACCCACCAACNONE 
006-101-A07GACGGCCCACCCACCAACNONE 
006-101-G08GACGGCCCACCCACCAACNONE 
006-110-E08GACGGCCCACCCACCAACNONE 
006-111-D04GACGGCCCACCCACCAACNONE 
006-116-H04GACGGCCCACCCACCAACNONE 
AK058894GACGGCCCACCCACCAACNONE 
AK059818GACGGCCCACCCACCAACSimilar to Glutathione S-transferase I (EC 2.5.1.18) (GST-I) (GST-29) (GST class- phi). 
AK099142GACGGCCCACCCACCAACNONE 
J013119N15GACGGCCCACCCACCAACNONE 
J013123P15GACGGCCCACCCACCAACNONE 
J023055F24GACGGCCCACCCACCAACNONE 
J023125K17GACGGCCCACCCACCAACNONE 
J053050A20GACGGCCCACCCACCAACNONE 
J053056P10GACGGCCCACCCACCAACNONE 
J053074D19GACGGCCCACCCACCAACNONE 
J053078A14GACGGCCCACCCACCAACNONE 
J053086P10GACGGCCCACCCACCAACNONE 
J053094N23GACGGCCCACCCACCAACNONE 
J053095M23GACGGCCCACCCACCAACNONE 
J065006D02GACGGCCCACCCACCAACNONE 
J065030A17GACGGCCCACCCACCAACNONE 
J065030K04GACGGCCCACCCACCAACNONE 
J065035L12GACGGCCCACCCACCAACNONE 
J065046E12GACGGCCCACCCACCAACNONE 
J065065H19GACGGCCCACCCACCAACNONE 
J065073C01GACGGCCCACCCACCAACNONE 
J065105F01GACGGCCCACCCACCAACNONE 
J065131N16GACGGCCCACCCACCAACNONE 
J065144O13GACGGCCCACCCACCAACNONE 
J065160E12GACGGCCCACCCACCAACNONE 
J065160K02GACGGCCCACCCACCAACNONE 
J065163F09GACGGCCCACCCACCAACNONE 
J065165E18GACGGCCCACCCACCAACNONE 
J065174E04GACGGCCCACCCACCAACNONE 
J065175O08GACGGCCCACCCACCAACNONE 
J065191N24GACGGCCCACCCACCAACNONE 
J065193D19GACGGCCCACCCACCAACNONE 
J065198D04GACGGCCCACCCACCAACNONE 
J065200G09GACGGCCCACCCACCAACNONE 
J075016L06GACGGCCCACCCACCAACNONE 
J075017J11GACGGCCCACCCACCAACNONE 
J075019L08GACGGCCCACCCACCAACNONE 
J075028M08GACGGCCCACCCACCAACNONE 
J075029K05GACGGCCCACCCACCAACNONE 
J075039K04GACGGCCCACCCACCAACNONE 
J075047J22GACGGCCCACCCACCAACNONE 
J075079H13GACGGCCCACCCACCAACNONE 
J075095K14GACGGCCCACCCACCAACNONE 
J075111D21GACGGCCCACCCACCAACNONE 
J075131A19GACGGCCCACCCACCAACNONE 
J075147G20GACGGCCCACCCACCAACNONE 
J075158F11GACGGCCCACCCACCAACNONE 
J075166N10GACGGCCCACCCACCAACNONE 
J075196G09GACGGCCCACCCACCAACNONE 
J075198I24GACGGCCCACCCACCAACNONE 
J090001L08GACGGCCCACCCACCAACNONE 
J090026G07GACGGCCCACCCACCAACNONE 
J090050M15GACGGCCCACCCACCAACNONE 
J090071A01GACGGCCCACCCACCAACNONE 
J090072P16GACGGCCCACCCACCAACNONE 
J090078D22GACGGCCCACCCACCAACNONE 
J090089C18GACGGCCCACCCACCAACNONE 
J100019B07GACGGCCCACCCACCAACNONE 
J100019H15GACGGCCCACCCACCAACNONE 
J100019P09GACGGCCCACCCACCAACNONE 
J100023A16GACGGCCCACCCACCAACNONE 
J100023B09GACGGCCCACCCACCAACNONE 
J100026O18GACGGCCCACCCACCAACNONE 
J100027E09GACGGCCCACCCACCAACNONE 
J100028F22GACGGCCCACCCACCAACNONE 
J100029P05GACGGCCCACCCACCAACNONE 
J100031M19GACGGCCCACCCACCAACNONE 
J100032A11GACGGCCCACCCACCAACNONE 
J100036G19GACGGCCCACCCACCAACNONE 
J100038E22GACGGCCCACCCACCAACNONE 
J100040A12GACGGCCCACCCACCAACNONE 
J100040L02GACGGCCCACCCACCAACNONE 
J100043O13GACGGCCCACCCACCAACNONE 
J100045E20GACGGCCCACCCACCAACNONE 
J100046H18GACGGCCCACCCACCAACNONE 
J100047E08GACGGCCCACCCACCAACNONE 
J100050E08GACGGCCCACCCACCAACNONE 
J100050P14GACGGCCCACCCACCAACNONE 
J100051G10GACGGCCCACCCACCAACNONE 
J100052L12GACGGCCCACCCACCAACNONE 
J100056G24GACGGCCCACCCACCAACNONE 
J100066B15GACGGCCCACCCACCAACNONE 
J100068O15GACGGCCCACCCACCAACNONE 
J100070J16GACGGCCCACCCACCAACNONE 
J100074I22GACGGCCCACCCACCAACNONE 
J100075M12GACGGCCCACCCACCAACNONE 
J100077M09GACGGCCCACCCACCAACNONE 
J100077O14GACGGCCCACCCACCAACNONE 
J100079J08GACGGCCCACCCACCAACNONE 
J100080I16GACGGCCCACCCACCAACNONE 
Os01g0770400006-112-B08GTGCGGTGGGCCGGTNONE 
AK061253GTGCGGTGGGCCGGTNONE 
AK061585GTGCGGTGGGCCGGTCyclin-like F-box domain containing protein. 
Os01g0800800AK108093ACCGGCCCACAConserved hypothetical protein. 
Os01g0811100006-061-F11TGGTGGGCCGCNONE 
AB026562TGGTGGGCCGCNONE 
AK061784TGGTGGGCCGCNONE 
AK103541TGGTGGGCCGCProteasome subunit alpha type 3 (EC 3.4.25.1) (20S proteasome alpha subunit G) (20S proteasome subunit alpha-7). 
J013020B12TGGTGGGCCGCNONE 
J013022J21TGGTGGGCCGCNONE 
J013056G19TGGTGGGCCGCNONE 
J013060O07TGGTGGGCCGCNONE 
J013110I07TGGTGGGCCGCNONE 
J013160D19TGGTGGGCCGCNONE 
J090035A13TGGTGGGCCGCNONE 
Os01g0838300J090017B22AGTGGGCCGTTGNONE 
J090061B04AGTGGGCCGTTGNONE 
Os01g0855600003-004-C02GGGCCCGGCCCACCCGNONE 
016-023-G11GGGCCCGGCCCACCCGNONE 
AK099776GGGCCCGGCCCACCCGSimilar to Hs1pro-1 protein. 
AY224522GGGCCCGGCCCACCCGNONE 
J013095E24GGGCCCGGCCCACCCGNONE 
J023041J04GGGCCCGGCCCACCCGNONE 
J065130B09GGGCCCGGCCCACCCGNONE 
J075031B02GGGCCCGGCCCACCCGNONE 
J075069H11GGGCCCGGCCCACCCGNONE 
J100026O10GGGCCCGGCCCACCCGNONE 
J100050J01GGGCCCGGCCCACCCGNONE 
J100052G04GGGCCCGGCCCACCCGNONE 
J100053D07GGGCCCGGCCCACCCGNONE 
J100054K16GGGCCCGGCCCACCCGNONE 
J100067A06GGGCCCGGCCCACCCGNONE 
J100067G01GGGCCCGGCCCACCCGNONE 
J100088C18GGGCCCGGCCCACCCGNONE 
Os01g0865600AK068033GGTGGGCCGTCNONE 
AK099677GGTGGGCCGTCBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
J090007G21GGTGGGCCGTCNONE 
J090023C20GGTGGGCCGTCNONE 
J090039J16GGTGGGCCGTCNONE 
J090054K15GGTGGGCCGTCNONE 
Os01g0867900AK061366CGGCCCACCCGProtein of unknown function DUF502 family protein. 
Os01g0886600AK070098GCGGCCCACASimilar to CLP protease regulatory subunit CLPX precursor. 
Os01g0888700AK073376ACCGGCCCACGCCTCProtein of unknown function RIO1 family protein. 
J033030B16ACCGGCCCACGCCTCNONE 
J033098D06ACCGGCCCACGCCTCNONE 
J033112A12ACCGGCCCACGCCTCNONE 
J043003L24ACCGGCCCACGCCTCNONE 
Os01g0889000AK103621TTGTGGGCCGGTTetratricopeptide-like helical domain containing protein. 
Os01g0900900009-066-B01CCACGGCCCACGGCCCACGGNONE 
009-137-A03CCACGGCCCACGGCCCACGGNONE 
AK120577CCACGGCCCACGGCCCACGGOvarian tumour, otubain domain containing protein. 
J023133N05CCACGGCCCACGGCCCACGGNONE 
Os01g0911700012-079-H01CGCCACGTGTGGGCCGCANONE 
012-088-G05CGCCACGTGTGGGCCGCANONE 
012-099-A01CGCCACGTGTGGGCCGCANONE 
015-009-H07CGCCACGTGTGGGCCGCANONE 
015-035-H12CGCCACGTGTGGGCCGCANONE 
016-054-G03CGCCACGTGTGGGCCGCANONE 
AK073805CGCCACGTGTGGGCCGCASimilar to Regulatory protein viviparous-1. 
AK105441CGCCACGTGTGGGCCGCANONE 
J033069I02CGCCACGTGTGGGCCGCANONE 
J033086K01CGCCACGTGTGGGCCGCANONE 
Os01g0918200009-034-H02GCGGCCCACANONE 
AK062434GCGGCCCACASimilar to Ubiquitin-like protein SMT3. 
AK103092GCGGCCCACANONE 
J065093P18GCGGCCCACANONE 
J065137C15GCGGCCCACANONE 
J065156G01GCGGCCCACANONE 
J065206H16GCGGCCCACANONE 
J065209D03GCGGCCCACANONE 
J075073K05GCGGCCCACANONE 
J075099B17GCGGCCCACANONE 
J075166N04GCGGCCCACANONE 
Os01g0918300009-036-G04GCGGCCCACANONE 
009-128-H04GCGGCCCACANONE 
009-189-D06GCGGCCCACANONE 
AB016030GCGGCCCACANONE 
AK058869GCGGCCCACAUbiquitin-like protein SMT3. 
AK069668GCGGCCCACANONE 
J023026B05GCGGCCCACANONE 
J053042E12GCGGCCCACANONE 
J053045P19GCGGCCCACANONE 
J053078C24GCGGCCCACANONE 
J065038J05GCGGCCCACANONE 
J065170B12GCGGCCCACANONE 
J065174C07GCGGCCCACANONE 
J075002G06GCGGCCCACANONE 
J075024O07GCGGCCCACANONE 
J075068H04GCGGCCCACANONE 
J075071H14GCGGCCCACANONE 
J075095G03GCGGCCCACANONE 
J075117O08GCGGCCCACANONE 
J075118J23GCGGCCCACANONE 
J075124P18GCGGCCCACANONE 
J100057D06GCGGCCCACANONE 
J100063L03GCGGCCCACANONE 
X99608GCGGCCCACANONE 
Os01g0924000004-020-C09ACGTGGGCCGGANONE 
005-014-A06ACGTGGGCCGGANONE 
009-085-G12ACGTGGGCCGGANONE 
009-123-A08ACGTGGGCCGGANONE 
009-134-A05ACGTGGGCCGGANONE 
009-137-F06ACGTGGGCCGGANONE 
016-016-B08ACGTGGGCCGGANONE 
AF050674ACGTGGGCCGGANONE 
AK061690ACGTGGGCCGGASimilar to Chloroplast 50S ribosomal protein L27 (Fragment). 
AK120797ACGTGGGCCGGANONE 
J013040A15ACGTGGGCCGGANONE 
J013104L20ACGTGGGCCGGANONE 
J013127E12ACGTGGGCCGGANONE 
J013158O05ACGTGGGCCGGANONE 
J023012E09ACGTGGGCCGGANONE 
J023126L23ACGTGGGCCGGANONE 
J023143B03ACGTGGGCCGGANONE 
J065005B16ACGTGGGCCGGANONE 
J065101J15ACGTGGGCCGGANONE 
J065105K16ACGTGGGCCGGANONE 
J065155K16ACGTGGGCCGGANONE 
J065171M17ACGTGGGCCGGANONE 
J065182F07ACGTGGGCCGGANONE 
J065187D10ACGTGGGCCGGANONE 
J065194I24ACGTGGGCCGGANONE 
J065207E24ACGTGGGCCGGANONE 
J075001C24ACGTGGGCCGGANONE 
J075090O10ACGTGGGCCGGANONE 
J075095H17ACGTGGGCCGGANONE 
J075109M24ACGTGGGCCGGANONE 
J075123C18ACGTGGGCCGGANONE 
J075148G22ACGTGGGCCGGANONE 
J090009B09ACGTGGGCCGGANONE 
J090075K17ACGTGGGCCGGANONE 
J090081H23ACGTGGGCCGGANONE 
J090097H21ACGTGGGCCGGANONE 
J100063P14ACGTGGGCCGGANONE 
Os01g0934500AK073211CCGTGGGCCGTAConserved hypothetical protein. 
Os01g0937300AK062872AGGTGGGCCGTCNONE 
J033136K12AGGTGGGCCGTCNONE 
J053048E20AGGTGGGCCGTCNONE 
J053088K08AGGTGGGCCGTCNONE 
J065011G23AGGTGGGCCGTCNONE 
J065202J09AGGTGGGCCGTCNONE 
Os01g0949200AK102412CGGACGGCCCACCANONE 
J033093A04CGGACGGCCCACCANONE 
J065053P06CGGACGGCCCACCANONE 
J100086D18CGGACGGCCCACCANONE 
Os01g0950900AK101121AGTGGGCCGAGProtein of unknown function DUF221 domain containing protein. 
J023036H24AGTGGGCCGAGNONE 
J023084G23AGTGGGCCGAGNONE 
J033025J04AGTGGGCCGAGNONE 
J033139J18AGTGGGCCGAGNONE 
J090006A09AGTGGGCCGAGNONE 
J090036D02AGTGGGCCGAGNONE 
Os01g0953100AK064981AGTGGGCCGTANONE 
AK068882AGTGGGCCGTAProtein of unknown function DUF594 family protein. 
J013001C07AGTGGGCCGTANONE 
J013169K14AGTGGGCCGTANONE 
J033114G07AGTGGGCCGTANONE 
J065035K15AGTGGGCCGTANONE 
J065082E12AGTGGGCCGTANONE 
Os01g0960400AK111512CCCGTGGGCCGTGGProtein kinase-like domain containing protein. 
Os01g0963300AK067544CTGGCCCACGGCCCACTSimilar to Syntaxin 61 (AtSYP61) (Osmotic stess-sensitive mutant 1). 
Os02g0103700009-031-C12AACGGCCCACCANONE 
AK062502AACGGCCCACCANONE 
AK102186AACGGCCCACCASimilar to 60S ribosomal protein L9 (Gibberellin-regulated protein GA). 
J033086N17AACGGCCCACCANONE 
J065161I07AACGGCCCACCANONE 
J065184G15AACGGCCCACCANONE 
J075123E02AACGGCCCACCANONE 
Os02g0119400AK060055GTTTGGGCCCGGCCCACCTNONE 
AK102774GTTTGGGCCCGGCCCACCTSimilar to Syntaxin 52 (AtSYP52). 
J033107H09GTTTGGGCCCGGCCCACCTNONE 
J075175F09GTTTGGGCCCGGCCCACCTNONE 
J090011H05GTTTGGGCCCGGCCCACCTNONE 
J090091O05GTTTGGGCCCGGCCCACCTNONE 
Os02g0119700AK108777TTGGCCCAAATACGGCCCACTProtein prenyltransferase domain containing protein. 
Os02g0146700AK105609TTGGCCCACCAGGCCCGGCCCACCCGSimilar to PSMD2 subunit (Fragment). 
AK119490TTGGCCCACCAGGCCCGGCCCACCCGNONE 
AK121963TTGGCCCACCAGGCCCGGCCCACCCGNONE 
Os02g0186500AK068056AAACGGCCCACTSimilar to Protein kinase-like protein. 
AK099031AAACGGCCCACTNONE 
J013111A12AAACGGCCCACTNONE 
J013127K13AAACGGCCCACTNONE 
J013132O11AAACGGCCCACTNONE 
J023056A11AAACGGCCCACTNONE 
J023078M08AAACGGCCCACTNONE 
J033081F07AAACGGCCCACTNONE 
J090079E24AAACGGCCCACTNONE 
J090097I02AAACGGCCCACTNONE 
Os02g0192700004-020-H12CCCGTGGGCCGGCNONE 
006-024-H06CCCGTGGGCCGGCNONE 
006-042-F06CCCGTGGGCCGGCNONE 
006-050-D04CCCGTGGGCCGGCNONE 
006-059-E10CCCGTGGGCCGGCNONE 
006-070-B02CCCGTGGGCCGGCNONE 
006-084-A09CCCGTGGGCCGGCNONE 
006-114-E11CCCGTGGGCCGGCNONE 
006-117-E05CCCGTGGGCCGGCNONE 
009-126-D11CCCGTGGGCCGGCNONE 
AK061629CCCGTGGGCCGGCSimilar to Thioredoxin peroxidase. 
AK065909CCCGTGGGCCGGCNONE 
J013043E11CCCGTGGGCCGGCNONE 
J065038I09CCCGTGGGCCGGCNONE 
J065078C12CCCGTGGGCCGGCNONE 
J065122O14CCCGTGGGCCGGCNONE 
J065198H04CCCGTGGGCCGGCNONE 
Os02g0193500009-092-G09TGCGGCCCACGCGNONE 
AK101237TGCGGCCCACGCGHypothetical protein. 
J033031K13TGCGGCCCACGCGNONE 
J033034P12TGCGGCCCACGCGNONE 
J080304L19TGCGGCCCACGCGNONE 
J100059N21TGCGGCCCACGCGNONE 
Os02g0194000015-020-A08TGGTGGGCCGCNONE 
AK064096TGGTGGGCCGCMyb, DNA-binding domain containing protein. 
J090092L06TGGTGGGCCGCNONE 
Os02g0198000AK067695TGTGGGCCGAGProtein of unknown function DUF1677, Oryza sativa family protein. 
Os02g0205400AK101434GCGGCCCACGTGTCAGTGGWD40-like domain containing protein. 
J043024M20GCGGCCCACGTGTCAGTGGNONE 
Os02g0208200J023104K09TCCGGCCCACGTNONE 
J033080L20TCCGGCCCACGTNONE 
J033105D08TCCGGCCCACGTNONE 
J090079N16TCCGGCCCACGTNONE 
Os02g0219900004-018-E11ATCGGACGGCCCACGTNONE 
AK060915ATCGGACGGCCCACGTNONE 
AK099194ATCGGACGGCCCACGTNONE 
AK104206ATCGGACGGCCCACGTNONE 
AK104393ATCGGACGGCCCACGTSimilar to Epstein-Barr nuclear antigen-1 (EBNA-1). 
J023109D07ATCGGACGGCCCACGTNONE 
Os02g0226900AK064279TTCGGCCCACTProtein prenyltransferase domain containing protein. 
Os02g0266200AK099647TTCGTGGGCCGGGCCGGTCACTGACANONE 
AK103371TTCGTGGGCCGGGCCGGTCACTGACAProtein prenyltransferase domain containing protein. 
Os02g0496900AK059542AAGGCCCACACGGCCCACCTConserved hypothetical protein. 
J053031E06AAGGCCCACACGGCCCACCTNONE 
J065195E11AAGGCCCACACGGCCCACCTNONE 
J090008P16AAGGCCCACACGGCCCACCTNONE 
Os02g0510300AK067961CTCGGCCCACAConserved hypothetical protein. 
AK104001CTCGGCCCACANONE 
J013123J20CTCGGCCCACANONE 
J065169H15CTCGGCCCACANONE 
Os02g0517531AK121247GGGTGGGCCGCRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os02g0537500AK068689GGCCCGGCCCACGGGSimilar to E2F homolog. 
Os02g0555000015-020-G02TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
AK065270TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
AK121253TGTGGGCTCTGGGCCGTGGGCCGTCProtein of unknown function, ATP binding family protein. 
J013002L01TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
J023060A02TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
J023101O11TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
J023140A15TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
J033042H19TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
J033046C02TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
J033080N19TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
J065026I02TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
J065040C18TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
J090004I16TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
Os02g0562700006-035-C05GCCGGCCCACGTCGGCCCATCANONE 
AB110167GCCGGCCCACGTCGGCCCATCANONE 
AK071800GCCGGCCCACGTCGGCCCATCASimilar to Gamma hydroxybutyrate dehydrogenase (EC 1.1.1.61). 
AK104168GCCGGCCCACGTCGGCCCATCANONE 
AK109435GCCGGCCCACGTCGGCCCATCANONE 
AY224558GCCGGCCCACGTCGGCCCATCANONE 
J023013M13GCCGGCCCACGTCGGCCCATCANONE 
J023059I08GCCGGCCCACGTCGGCCCATCANONE 
J023084C06GCCGGCCCACGTCGGCCCATCANONE 
J023114G06GCCGGCCCACGTCGGCCCATCANONE 
J023142A09GCCGGCCCACGTCGGCCCATCANONE 
J033026E14GCCGGCCCACGTCGGCCCATCANONE 
J053042M10GCCGGCCCACGTCGGCCCATCANONE 
J053082K21GCCGGCCCACGTCGGCCCATCANONE 
J065105J15GCCGGCCCACGTCGGCCCATCANONE 
J065150F02GCCGGCCCACGTCGGCCCATCANONE 
J075177H05GCCGGCCCACGTCGGCCCATCANONE 
J080040B16GCCGGCCCACGTCGGCCCATCANONE 
J090077J10GCCGGCCCACGTCGGCCCATCANONE 
Os02g0591800AK060611TGTGGGCCGCABrix domain containing protein. 
AK102534TGTGGGCCGCANONE 
J075057H08TGTGGGCCGCANONE 
J075179P18TGTGGGCCGCANONE 
J080011H01TGTGGGCCGCANONE 
J080018E14TGTGGGCCGCANONE 
J080026N17TGTGGGCCGCANONE 
J080047A13TGTGGGCCGCANONE 
J080049C17TGTGGGCCGCANONE 
J080050G07TGTGGGCCGCANONE 
J080064D10TGTGGGCCGCANONE 
J080080A03TGTGGGCCGCANONE 
J080080G20TGTGGGCCGCANONE 
J080080I03TGTGGGCCGCANONE 
J080081H12TGTGGGCCGCANONE 
J080090K07TGTGGGCCGCANONE 
J080092O06TGTGGGCCGCANONE 
J080096B07TGTGGGCCGCANONE 
J080097M08TGTGGGCCGCANONE 
Os02g0593400016-051-C08CCCGGCCCACGGNONE 
AK064226CCCGGCCCACGGNONE 
AK072362CCCGGCCCACGGConserved hypothetical protein. 
AK109015CCCGGCCCACGGNONE 
J023063B12CCCGGCCCACGGNONE 
J065192M02CCCGGCCCACGGNONE 
J075182N05CCCGGCCCACGGNONE 
Os02g0602300AK065609CCGTGGGCCGTGNONE 
AK065609GCCCGGCCGGCCCACCTGNONE 
AK065609GCCGGCCCACGTGNONE 
AK065609GTGGTGGGCCGTGCCTGGGCCGCGCACGCGNONE 
AK066929CCGTGGGCCGTGSimilar to Myelin transcription factor 1 (MYT1) (MYTI) (Proteolipid protein binding protein) (PLPB1). 
AK066929GCCCGGCCGGCCCACCTGSimilar to Myelin transcription factor 1 (MYT1) (MYTI) (Proteolipid protein binding protein) (PLPB1). 
AK066929GCCGGCCCACGTGSimilar to Myelin transcription factor 1 (MYT1) (MYTI) (Proteolipid protein binding protein) (PLPB1). 
AK066929GTGGTGGGCCGTGCCTGGGCCGCGCACGCGSimilar to Myelin transcription factor 1 (MYT1) (MYTI) (Proteolipid protein binding protein) (PLPB1). 
J013092L08CCGTGGGCCGTGNONE 
J013092L08GCCCGGCCGGCCCACCTGNONE 
J013092L08GCCGGCCCACGTGNONE 
J013092L08GTGGTGGGCCGTGCCTGGGCCGCGCACGCGNONE 
J090040I23CCGTGGGCCGTGNONE 
J090040I23GCCCGGCCGGCCCACCTGNONE 
J090040I23GCCGGCCCACGTGNONE 
J090040I23GTGGTGGGCCGTGCCTGGGCCGCGCACGCGNONE 
Os02g0610700014-008-A03TTCGTGGGCCGGCNONE 
AK059205TTCGTGGGCCGGCConserved hypothetical protein. 
AK100281TTCGTGGGCCGGCNONE 
J023074H03TTCGTGGGCCGGCNONE 
J065002J16TTCGTGGGCCGGCNONE 
J065032I20TTCGTGGGCCGGCNONE 
J065076A07TTCGTGGGCCGGCNONE 
J065142O21TTCGTGGGCCGGCNONE 
J065203A03TTCGTGGGCCGGCNONE 
J075017F24TTCGTGGGCCGGCNONE 
J075017G24TTCGTGGGCCGGCNONE 
Os02g0616600AK106681CCGAGCCGGCCCAAATCGGCCCACACConserved hypothetical protein. 
J065062G16CCGAGCCGGCCCAAATCGGCCCACACNONE 
Os02g0621600AK071074CACGGCCCACAANONE 
AK108575CACGGCCCACAAConserved hypothetical protein. 
J023078O20CACGGCCCACAANONE 
J075025M01CACGGCCCACAANONE 
J090047L11CACGGCCCACAANONE 
Os02g0636300AK100670CCGTGGGCCGTGGDEAD/DEAH box helicase, N-terminal domain containing protein. 
J013149P11CCGTGGGCCGTGGNONE 
J023022F15CCGTGGGCCGTGGNONE 
J023112J15CCGTGGGCCGTGGNONE 
J023145M22CCGTGGGCCGTGGNONE 
J043017P16CCGTGGGCCGTGGNONE 
Os02g0643200AK106784TGCGGCCCACGCYABBY protein family protein. 
J075048L13TGCGGCCCACGCNONE 
Os02g0643500AK068423TCTCGGCCCACAAPentapeptide repeat containing protein. 
Os02g0644000AB081464GTGGCGTGGGCCGTCGGATCNONE 
AK101360GTGGCGTGGGCCGTCGGATCNONE 
AY062178GTGGCGTGGGCCGTCGGATCNONE 
J023043E22GTGGCGTGGGCCGTCGGATCNONE 
J033024F05GTGGCGTGGGCCGTCGGATCNONE 
J033035H01GTGGCGTGGGCCGTCGGATCNONE 
J033042J19GTGGCGTGGGCCGTCGGATCNONE 
J033057G18GTGGCGTGGGCCGTCGGATCNONE 
J033111F09GTGGCGTGGGCCGTCGGATCNONE 
J033115L11GTGGCGTGGGCCGTCGGATCNONE 
J033143I16GTGGCGTGGGCCGTCGGATCNONE 
J033143M21GTGGCGTGGGCCGTCGGATCNONE 
J075072B10GTGGCGTGGGCCGTCGGATCNONE 
J075072L04GTGGCGTGGGCCGTCGGATCNONE 
J075088F01GTGGCGTGGGCCGTCGGATCNONE 
J075196H23GTGGCGTGGGCCGTCGGATCNONE 
Os02g0646400AK067828AGTGGGCCGTTSimilar to Glutaredoxin. 
J013120N01AGTGGGCCGTTNONE 
J065021N01AGTGGGCCGTTNONE 
J065021N02AGTGGGCCGTTNONE 
J065053O18AGTGGGCCGTTNONE 
J090067J17AGTGGGCCGTTNONE 
Os02g0672500AK109266ACCGGCCCACACNONE 
AK109266CCACGGCCCACCTNONE 
Os02g0673700AB028130AACGGCCCACGCZinc finger, Dof-type family protein. 
Os02g0677300006-102-D12GAGGCCCAGAGCGGCCCACTNONE 
006-102-D12GCGGCCCACGTNONE 
AK060550GAGGCCCAGAGCGGCCCACTNONE 
AK060550GCGGCCCACGTNONE 
AK106041GAGGCCCAGAGCGGCCCACTSimilar to CRT/DRE binding factor 1. 
AK106041GCGGCCCACGTSimilar to CRT/DRE binding factor 1. 
Os02g0731500J065098J18GCCACACGGCCCACGGAWPM-19-like family protein. 
J065123G07GCCACACGGCCCACGGNONE 
Os02g0768600006-034-F01AGGTGGGCCGGANONE 
006-046-G07AGGTGGGCCGGANONE 
006-054-C07AGGTGGGCCGGANONE 
006-056-F07AGGTGGGCCGGANONE 
006-100-C02AGGTGGGCCGGANONE 
AK059725AGGTGGGCCGGANONE 
AK098996AGGTGGGCCGGANONE 
AK099120AGGTGGGCCGGANONE 
AK104659AGGTGGGCCGGANONE 
J065043H04AGGTGGGCCGGANONE 
J075034N21AGGTGGGCCGGANONE 
J075145C18AGGTGGGCCGGANONE 
J080016H01AGGTGGGCCGGANONE 
J080040F01AGGTGGGCCGGANONE 
J080047L23AGGTGGGCCGGANONE 
J080049B22AGGTGGGCCGGANONE 
J080062J16AGGTGGGCCGGANONE 
J080064C23AGGTGGGCCGGANONE 
J080064L22AGGTGGGCCGGANONE 
J080077N01AGGTGGGCCGGANONE 
J080097G17AGGTGGGCCGGANONE 
J100065L15AGGTGGGCCGGANONE 
J100066K23AGGTGGGCCGGANONE 
J100088C07AGGTGGGCCGGANONE 
J100090H09AGGTGGGCCGGANONE 
Os02g0771200011-006-B07CCCGGCCCACGTNONE 
AK066823CCCGGCCCACGTConserved hypothetical protein. 
AK071059CCCGGCCCACGTNONE 
J013075K03CCCGGCCCACGTNONE 
Os02g0776800AB042415ACGTGGGCCGAGNONE 
AB042415AGATGGGCCGGCCCACCCGNONE 
AK072308ACGTGGGCCGAGReplication protein A 70kDa. 
AK072308AGATGGGCCGGCCCACCCGReplication protein A 70kDa. 
AK101212ACGTGGGCCGAGNONE 
AK101212AGATGGGCCGGCCCACCCGNONE 
J033031B02ACGTGGGCCGAGNONE 
J033031B02AGATGGGCCGGCCCACCCGNONE 
J090004E18ACGTGGGCCGAGNONE 
J090004E18AGATGGGCCGGCCCACCCGNONE 
J090084C24ACGTGGGCCGAGNONE 
J090084C24AGATGGGCCGGCCCACCCGNONE 
Os02g0780700AK063558CCCGGCCCACCACCGCACLipase, class 3 family protein. 
Os02g0780800J090080O19ACGTGGGCCGTGGNONE 
J090091I06ACGTGGGCCGTGGNONE 
Os02g0787100Os02g0787100GCGGCCCACGCProtein of unknown function DUF676, hydrolase-like domain containing protein. 
Os02g0795900012-075-B04TGCGGCCCACGANONE 
AK105305TGCGGCCCACGASimilar to DEAD box-like RNA helicase (Fragment). 
J090031C21TGCGGCCCACGANONE 
Os02g0803200AK063404GCTGGGCCGGCCCACCSimilar to 30S ribosomal protein S15. 
Os02g0805900AK073740AGCCCACGGCCCACCTDcp2, box A domain containing protein. 
J013068E03AGCCCACGGCCCACCTNONE 
J033066K03AGCCCACGGCCCACCTNONE 
J033092C14AGCCCACGGCCCACCTNONE 
J065020G11AGCCCACGGCCCACCTNONE 
J065098E16AGCCCACGGCCCACCTNONE 
J065124L06AGCCCACGGCCCACCTNONE 
J065134M23AGCCCACGGCCCACCTNONE 
J065187M23AGCCCACGGCCCACCTNONE 
J065208G07AGCCCACGGCCCACCTNONE 
J075002G10AGCCCACGGCCCACCTNONE 
J075004L01AGCCCACGGCCCACCTNONE 
J075051K23AGCCCACGGCCCACCTNONE 
J090063C03AGCCCACGGCCCACCTNONE 
J090071J21AGCCCACGGCCCACCTNONE 
J100078K12AGCCCACGGCCCACCTNONE 
Os02g0806000AK072745AGGTGGGCCGTGGGCTGCN5-related N-acetyltransferase domain containing protein. 
J013130C06AGGTGGGCCGTGGGCTNONE 
J013154L12AGGTGGGCCGTGGGCTNONE 
J023135J07AGGTGGGCCGTGGGCTNONE 
J065038E23AGGTGGGCCGTGGGCTNONE 
J065042C10AGGTGGGCCGTGGGCTNONE 
J090075B11AGGTGGGCCGTGGGCTNONE 
J100033J17AGGTGGGCCGTGGGCTNONE 
Os02g0819700AK067374TCGGCCCACAAZinc finger, Zim17-type family protein. 
AK099160TCGGCCCACAANONE 
J100086K17TCGGCCCACAANONE 
Os02g0827300AK069159GGCCCGGCCCACGAGCCCAACCProtein of unknown function DUF382 domain containing protein. 
Os02g0827600AK068455TCCGACGGCCCACCTGConserved hypothetical protein. 
Os02g0828200AK071199TGCGGCCCACAGCCCAATANONE 
Os03g0135700AK060029CTCGCGCGGCCCACCNONE 
AK103779CTCGCGCGGCCCACCSimilar to Transcriptional activator Rb homolog (Fragment). 
J033145C17CTCGCGCGGCCCACCNONE 
J043021B17CTCGCGCGGCCCACCNONE 
Os03g0149400AK111396CCACGGCCCACAProtein prenyltransferase domain containing protein. 
Os03g0161000AK121425CAAGTGGGCCGGGNONE 
AK121425CACTGACAGGTGGGCCGGGGACGGCTNONE 
J023135K12CAAGTGGGCCGGGNONE 
J023135K12CACTGACAGGTGGGCCGGGGACGGCTNONE 
Os03g0167000AK107307CCCGTGGGCCGTGGConserved hypothetical protein. 
J100070K07CCCGTGGGCCGTGGNONE 
Os03g0172700AK111307GCCGGCCCACTHypothetical protein. 
Os03g0181600AK067807AGCCCAAGCGGCCCACCASimilar to GATA transcription factor 25 (ZIM-like 2 protein). 
AK101197AGCCCAAGCGGCCCACCANONE 
Os03g0182800003-126-E06GCGGCCCACGGNONE 
AJ304840GCGGCCCACGGNONE 
AK073133GCGGCCCACGGNONE 
AY323478GCGGCCCACGGSimilar to Ethylene responsive element binding factor3 (OsERF3). 
J033023E13GCGGCCCACGGNONE 
J033028C22GCGGCCCACGGNONE 
J033042J03GCGGCCCACGGNONE 
J065022E13GCGGCCCACGGNONE 
J065208N24GCGGCCCACGGNONE 
J100034B17GCGGCCCACGGNONE 
J100035J21GCGGCCCACGGNONE 
J100039L16GCGGCCCACGGNONE 
J100040A02GCGGCCCACGGNONE 
J100051L11GCGGCCCACGGNONE 
J100064F07GCGGCCCACGGNONE 
J100070J12GCGGCCCACGGNONE 
Os03g0184600AK065264ATTTGGGCCCGGCCCACAANAD-dependent epimerase/dehydratase family protein. 
Os03g0187700009-155-F05CCGTGGGCCGTCCGATCNONE 
J033140E21CCGTGGGCCGTCCGATCNONE 
J033142E21CCGTGGGCCGTCCGATCNONE 
J065014P17CCGTGGGCCGTCCGATCNONE 
J065083L20CCGTGGGCCGTCCGATCNONE 
J065092E08CCGTGGGCCGTCCGATCNONE 
J065154C08CCGTGGGCCGTCCGATCTarget SNARE coiled-coil region domain containing protein. 
J075142H08CCGTGGGCCGTCCGATCNONE 
J075175K21CCGTGGGCCGTCCGATCNONE 
J090070B20CCGTGGGCCGTCCGATCNONE 
J100071M06CCGTGGGCCGTCCGATCNONE 
Os03g0195200AK068949TGATGGGCCGGCCCACCCPossible metal-binding region in RNase L inhibitor, RLI domain containing protein. 
Os03g0195900J065063O15GGAGTGGGCCGGTNONE 
Os03g0200500005-016-A06AGTGGGCCGTCCNONE 
AK069251AGTGGGCCGTCC40S ribosomal protein S3a (CYC07 protein). 
AK104243AGTGGGCCGTCCNONE 
AK104699AGTGGGCCGTCCNONE 
D26060AGTGGGCCGTCCNONE 
J013024H20AGTGGGCCGTCCNONE 
J013029C14AGTGGGCCGTCCNONE 
J013035O17AGTGGGCCGTCCNONE 
J013066B11AGTGGGCCGTCCNONE 
J013066B12AGTGGGCCGTCCNONE 
J013066B13AGTGGGCCGTCCNONE 
J013152M04AGTGGGCCGTCCNONE 
J023001A03AGTGGGCCGTCCNONE 
J023013H23AGTGGGCCGTCCNONE 
J023042L07AGTGGGCCGTCCNONE 
J023081L11AGTGGGCCGTCCNONE 
J023088I23AGTGGGCCGTCCNONE 
J023092N22AGTGGGCCGTCCNONE 
J023126A20AGTGGGCCGTCCNONE 
J023139A17AGTGGGCCGTCCNONE 
J023150G12AGTGGGCCGTCCNONE 
J033026M10AGTGGGCCGTCCNONE 
J033031H24AGTGGGCCGTCCNONE 
J033036C22AGTGGGCCGTCCNONE 
J033037P08AGTGGGCCGTCCNONE 
J033045G14AGTGGGCCGTCCNONE 
J033048A13AGTGGGCCGTCCNONE 
J033048B13AGTGGGCCGTCCNONE 
J033048K11AGTGGGCCGTCCNONE 
J033066A06AGTGGGCCGTCCNONE 
J033072H01AGTGGGCCGTCCNONE 
J033082K07AGTGGGCCGTCCNONE 
J033091G20AGTGGGCCGTCCNONE 
J033095C14AGTGGGCCGTCCNONE 
J033101N24AGTGGGCCGTCCNONE 
J033105L15AGTGGGCCGTCCNONE 
J033107J18AGTGGGCCGTCCNONE 
J033112L02AGTGGGCCGTCCNONE 
J033117I17AGTGGGCCGTCCNONE 
J043003K06AGTGGGCCGTCCNONE 
J043016I20AGTGGGCCGTCCNONE 
J043021A10AGTGGGCCGTCCNONE 
J043034F14AGTGGGCCGTCCNONE 
J065002O17AGTGGGCCGTCCNONE 
J065014B14AGTGGGCCGTCCNONE 
J065054N19AGTGGGCCGTCCNONE 
J065112P18AGTGGGCCGTCCNONE 
J065121B20AGTGGGCCGTCCNONE 
J065170M08AGTGGGCCGTCCNONE 
J065194B05AGTGGGCCGTCCNONE 
J090040F01AGTGGGCCGTCCNONE 
J090078O20AGTGGGCCGTCCNONE 
J090078P21AGTGGGCCGTCCNONE 
J090084E11AGTGGGCCGTCCNONE 
J100080B11AGTGGGCCGTCCNONE 
Os03g0205500Os03g0205500CCCGGGCCCGGCCCACTGGCCCAGTCytochrome b5 domain containing protein. 
Os03g0210400AK065966ACGTGGGCCGCProtein prenyltransferase domain containing protein. 
Os03g0218400AK069202TCCGGCCCGTGGGCCGCSimilar to Hexose transporter. 
AK099306TCCGGCCCGTGGGCCGCNONE 
AY342321TCCGGCCCGTGGGCCGCNONE 
J023066K08TCCGGCCCGTGGGCCGCNONE 
J100032N19TCCGGCCCGTGGGCCGCNONE 
Os03g0220700J100064H16TCGGCCCACTNONE 
Os03g0238700AK073387TCGTGGGCCGCAGGCCCGCASimilar to Acid phosphatase type 5. 
J033043K11TCGTGGGCCGCAGGCCCGCANONE 
Os03g0243300013-024-B05GGACGGACGTGGGCCGAANONE 
AB010740GGACGGACGTGGGCCGAANONE 
AB037151GGACGGACGTGGGCCGAASimilar to 26S proteasome non-ATPase regulatory subunit 4 (26S proteasome regulatory subunit S5A) (Multiubiquitin chain binding protein). 
AK073601GGACGGACGTGGGCCGAANONE 
J023010M13GGACGGACGTGGGCCGAANONE 
J023030M11GGACGGACGTGGGCCGAANONE 
J023066I02GGACGGACGTGGGCCGAANONE 
J023080H21GGACGGACGTGGGCCGAANONE 
J023123O15GGACGGACGTGGGCCGAANONE 
J033029N24GGACGGACGTGGGCCGAANONE 
J033031G18GGACGGACGTGGGCCGAANONE 
J033046D23GGACGGACGTGGGCCGAANONE 
J033046P11GGACGGACGTGGGCCGAANONE 
J033079C14GGACGGACGTGGGCCGAANONE 
J033125G12GGACGGACGTGGGCCGAANONE 
J033133I21GGACGGACGTGGGCCGAANONE 
J033141F22GGACGGACGTGGGCCGAANONE 
J065035O21GGACGGACGTGGGCCGAANONE 
J090008P15GGACGGACGTGGGCCGAANONE 
J090033F15GGACGGACGTGGGCCGAANONE 
J090059A16GGACGGACGTGGGCCGAANONE 
J090080N01GGACGGACGTGGGCCGAANONE 
J100022C16GGACGGACGTGGGCCGAANONE 
J100023K05GGACGGACGTGGGCCGAANONE 
J100043B19GGACGGACGTGGGCCGAANONE 
J100046G11GGACGGACGTGGGCCGAANONE 
J100049L11GGACGGACGTGGGCCGAANONE 
J100054M01GGACGGACGTGGGCCGAANONE 
J100068G15GGACGGACGTGGGCCGAANONE 
J100085A18GGACGGACGTGGGCCGAANONE 
Os03g0243350J065025D24TTCGGCCCACGTCCGTCCNONE 
J065046A15TTCGGCCCACGTCCGTCCHypothetical protein. 
J065064E08TTCGGCCCACGTCCGTCCNONE 
Os03g0245800013-094-D06CACGGCCCACCAGGCCCAGANONE 
AB020973CACGGCCCACCAGGCCCAGANONE 
AK063618CACGGCCCACCAGGCCCAGANONE 
AK120045CACGGCCCACCAGGCCCAGANONE 
AK120048CACGGCCCACCAGGCCCAGASimilar to Heat shock protein 26. 
J075104O17CACGGCCCACCAGGCCCAGANONE 
Os03g0260100AK066143GTGGCCCACGGCCCACCAConserved hypothetical protein. 
Os03g0270200012-009-A03TCGGCCCACGTNONE 
AK066896TCGGCCCACGTNONE 
AK102826TCGGCCCACGTSplicing factor PWI domain containing protein. 
J013042L05TCGGCCCACGTNONE 
J013091L22TCGGCCCACGTNONE 
J013096P13TCGGCCCACGTNONE 
J013118M15TCGGCCCACGTNONE 
J013151N20TCGGCCCACGTNONE 
J033061D07TCGGCCCACGTNONE 
J033086L04TCGGCCCACGTNONE 
J033099J11TCGGCCCACGTNONE 
J033109C10TCGGCCCACGTNONE 
J033116F13TCGGCCCACGTNONE 
J065019F13TCGGCCCACGTNONE 
J065089O14TCGGCCCACGTNONE 
J065158D07TCGGCCCACGTNONE 
J065160G19TCGGCCCACGTNONE 
J065168N10TCGGCCCACGTNONE 
J065208E17TCGGCCCACGTNONE 
J075001A15TCGGCCCACGTNONE 
J075010G15TCGGCCCACGTNONE 
J075016L23TCGGCCCACGTNONE 
J075019A06TCGGCCCACGTNONE 
J075023B13TCGGCCCACGTNONE 
J075032P15TCGGCCCACGTNONE 
J075045F05TCGGCCCACGTNONE 
J075053O13TCGGCCCACGTNONE 
J075057P06TCGGCCCACGTNONE 
J075061C19TCGGCCCACGTNONE 
J075078B10TCGGCCCACGTNONE 
J075086A20TCGGCCCACGTNONE 
J075127A16TCGGCCCACGTNONE 
J075128E07TCGGCCCACGTNONE 
J075129C06TCGGCCCACGTNONE 
J075130M14TCGGCCCACGTNONE 
J075136H13TCGGCCCACGTNONE 
J075149M17TCGGCCCACGTNONE 
J075156L08TCGGCCCACGTNONE 
J075160P12TCGGCCCACGTNONE 
J075164J01TCGGCCCACGTNONE 
J075173N05TCGGCCCACGTNONE 
J075177O03TCGGCCCACGTNONE 
J075188K11TCGGCCCACGTNONE 
J090009A02TCGGCCCACGTNONE 
J090019O12TCGGCCCACGTNONE 
J090065H05TCGGCCCACGTNONE 
J090067E24TCGGCCCACGTNONE 
J090080C03TCGGCCCACGTNONE 
J090090A04TCGGCCCACGTNONE 
J090098D13TCGGCCCACGTNONE 
J100060D03TCGGCCCACGTNONE 
J100062D05TCGGCCCACGTNONE 
J100074A08TCGGCCCACGTNONE 
Os03g0271100AB095095TCCGGCCCACGANONE 
AK060821TCCGGCCCACGASimilar to Sigma factor SIG2B. 
AK067693TCCGGCCCACGANONE 
AK099036TCCGGCCCACGANONE 
Os03g0277000AK100522GCCGGCCCACCACSimilar to GDP dissociation inhibitor protein OsGDI1. 
Os03g0277500014-019-A09GTGTGGGCCGTGNONE 
AK063650GTGTGGGCCGTGGlyoxalase/bleomycin resistance protein/dioxygenase domain containing protein. 
J065043F18GTGTGGGCCGTGNONE 
J065092A08GTGTGGGCCGTGNONE 
J065122E17GTGTGGGCCGTGNONE 
J065182K12GTGTGGGCCGTGNONE 
J065197H15GTGTGGGCCGTGNONE 
J075115A05GTGTGGGCCGTGNONE 
Os03g0284000Os03g0284000CACGTGGGCCGGAACGGCCCGConserved hypothetical protein. 
Os03g0288900AK100329GGCCCGGCCCACCConserved hypothetical protein. 
J023080H15GGCCCGGCCCACCNONE 
J033136I21GGCCCGGCCCACCNONE 
J065036A16GGCCCGGCCCACCNONE 
J065186A16GGCCCGGCCCACCNONE 
J065187B08GGCCCGGCCCACCNONE 
J065202E24GGCCCGGCCCACCNONE 
Os03g0302700006-099-F12TCCGGCCCACGTNONE 
AK112010TCCGGCCCACGTZinc finger, RING-type domain containing protein. 
AK121656TCCGGCCCACGTNONE 
J075090A19TCCGGCCCACGTNONE 
J075148M06TCCGGCCCACGTNONE 
Os03g0309000AK070071GGCCGTGGGCCGTGVirulence factor, pectin lyase fold family protein. 
Os03g0321800006-065-G02GGCCGTGGGCCGAGANONE 
AK061075GGCCGTGGGCCGAGANONE 
AK111447GGCCGTGGGCCGAGASimilar to WRKY transcription factor 55. 
J065122E07GGCCGTGGGCCGAGANONE 
J065187N05GGCCGTGGGCCGAGANONE 
J065214K09GGCCGTGGGCCGAGANONE 
J090050M01GGCCGTGGGCCGAGANONE 
Os03g0326600AK107632AGTGGGCCGGCRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os03g0333300015-069-B02TGTGGGCCGGCNONE 
AK063858TGTGGGCCGGCNONE 
AK073228TGTGGGCCGGCSimilar to Eukaryotic translation initiation factor 2 beta subunit (eIF-2-beta) (P38). 
Os03g0337600AF119232ACGTGGGCCGANONE 
AK070859ACGTGGGCCGASimilar to Uroporphyrinogen decarboxylase (EC 4.1.1.37) (URO-D) (UPD) (Fragment). 
J013110I18ACGTGGGCCGANONE 
J013147M17ACGTGGGCCGANONE 
J065083M01ACGTGGGCCGANONE 
J065199H24ACGTGGGCCGANONE 
Os03g0339100AK111641GCGGCCCACTTGSimilar to PRL1 protein. 
Os03g0387100AB026559ATCGGACGGCCCACGTGNONE 
AF022735ATCGGACGGCCCACGTGNONE 
AK058567ATCGGACGGCCCACGTGProteasome subunit alpha type 2 (EC 3.4.25.1) (20S proteasome alpha subunit B) (20S proteasome subunit alpha-2). 
AK101195ATCGGACGGCCCACGTGNONE 
J033030J15ATCGGACGGCCCACGTGNONE 
J033102N16ATCGGACGGCCCACGTGNONE 
J065056E08ATCGGACGGCCCACGTGNONE 
J065112M11ATCGGACGGCCCACGTGNONE 
J065170H07ATCGGACGGCCCACGTGNONE 
J075003P17ATCGGACGGCCCACGTGNONE 
J075074D06ATCGGACGGCCCACGTGNONE 
J075127F20ATCGGACGGCCCACGTGNONE 
J075129I01ATCGGACGGCCCACGTGNONE 
J075178A10ATCGGACGGCCCACGTGNONE 
J090071P12ATCGGACGGCCCACGTGNONE 
J100090D18ATCGGACGGCCCACGTGNONE 
Os03g0398900AK107457GCGGCCCACCConserved hypothetical protein. 
Os03g0410700J065102A22CCCGGCCCACGANONE 
Os03g0410900J065067F10TCGTGGGCCGGGNONE 
J065073D08TCGTGGGCCGGGNONE 
J065176C06TCGTGGGCCGGGNONE 
J065189O13TCGTGGGCCGGGNONE 
J065214E05TCGTGGGCCGGGNONE 
J080007H09TCGTGGGCCGGGNONE 
J080012B19TCGTGGGCCGGGNONE 
J080020J16TCGTGGGCCGGGNONE 
J080038J22TCGTGGGCCGGGNONE 
J080045I09TCGTGGGCCGGGNONE 
J080059M16TCGTGGGCCGGGNONE 
J080060C19TCGTGGGCCGGGNONE 
J080080P22TCGTGGGCCGGGNONE 
J080083C03TCGTGGGCCGGGNONE 
J080093M17TCGTGGGCCGGGNONE 
J100029F12TCGTGGGCCGGGLike-Sm ribonucleoprotein, core family protein. 
Os03g0566800AK103270AGTGGGCCGAGSimilar to Eukaryotic initiation factor 4A-3 (eIF4A-3) (eIF-4A-3). 
J023063L18AGTGGGCCGAGNONE 
J023136P06AGTGGGCCGAGNONE 
J033081A22AGTGGGCCGAGNONE 
J033109N12AGTGGGCCGAGNONE 
J033124H10AGTGGGCCGAGNONE 
J033141B09AGTGGGCCGAGNONE 
J090026G23AGTGGGCCGAGNONE 
J090077J20AGTGGGCCGAGNONE 
Os03g0639800AK103237AGTGGGCCGTTSnf7 family protein. 
J023036L02AGTGGGCCGTTNONE 
J033108L13AGTGGGCCGTTNONE 
Os03g0643300AK099445GCCCACGCCCACGCCCACGCCCACGGCCCACGGSimilar to AER123Wp. 
AK108010GCCCACGCCCACGCCCACGCCCACGGCCCACGGNONE 
Os03g0647500015-025-E10CTCGGCCCACAANONE 
AK064308CTCGGCCCACAAConserved hypothetical protein. 
AK103649CTCGGCCCACAANONE 
J033135D01CTCGGCCCACAANONE 
Os03g0647800003-103-H03ACCGGCCCACCAACNONE 
006-104-G09ACCGGCCCACCAACNONE 
AK070243ACCGGCCCACCAACConserved hypothetical protein. 
J100056F22ACCGGCCCACCAACNONE 
Os03g0670700009-028-B03GTGGTGGGCCGCNONE 
009-036-H12GTGGTGGGCCGCNONE 
009-053-H05GTGGTGGGCCGCNONE 
009-126-B02GTGGTGGGCCGCNONE 
009-135-D07GTGGTGGGCCGCNONE 
009-148-A03GTGGTGGGCCGCNONE 
009-148-A12GTGGTGGGCCGCNONE 
009-152-B02GTGGTGGGCCGCNONE 
009-153-B06GTGGTGGGCCGCNONE 
009-166-G05GTGGTGGGCCGCNONE 
009-181-A09GTGGTGGGCCGCNONE 
011-061-D07GTGGTGGGCCGCNONE 
012-043-C04GTGGTGGGCCGCNONE 
013-001-A02GTGGTGGGCCGCNONE 
013-004-F05GTGGTGGGCCGCNONE 
013-008-C08GTGGTGGGCCGCNONE 
013-015-B09GTGGTGGGCCGCNONE 
013-016-G05GTGGTGGGCCGCNONE 
013-023-A06GTGGTGGGCCGCNONE 
013-023-B06GTGGTGGGCCGCNONE 
013-032-F09GTGGTGGGCCGCNONE 
013-059-C07GTGGTGGGCCGCNONE 
013-071-E09GTGGTGGGCCGCNONE 
013-073-D06GTGGTGGGCCGCNONE 
013-077-C02GTGGTGGGCCGCNONE 
013-078-B12GTGGTGGGCCGCNONE 
013-093-A01GTGGTGGGCCGCNONE 
014-002-B12GTGGTGGGCCGCNONE 
014-003-E08GTGGTGGGCCGCNONE 
014-004-D06GTGGTGGGCCGCNONE 
014-007-C11GTGGTGGGCCGCNONE 
014-007-G10GTGGTGGGCCGCNONE 
014-019-C04GTGGTGGGCCGCNONE 
014-021-F05GTGGTGGGCCGCNONE 
014-024-G06GTGGTGGGCCGCNONE 
014-027-C07GTGGTGGGCCGCNONE 
014-027-D03GTGGTGGGCCGCNONE 
014-029-E07GTGGTGGGCCGCNONE 
014-031-B04GTGGTGGGCCGCNONE 
014-033-B05GTGGTGGGCCGCNONE 
014-033-C03GTGGTGGGCCGCNONE 
014-033-C12GTGGTGGGCCGCNONE 
014-036-F01GTGGTGGGCCGCNONE 
014-037-C04GTGGTGGGCCGCNONE 
014-040-H02GTGGTGGGCCGCNONE 
014-045-H04GTGGTGGGCCGCNONE 
014-045-H06GTGGTGGGCCGCNONE 
014-052-A08GTGGTGGGCCGCNONE 
014-076-G01GTGGTGGGCCGCNONE 
014-083-F04GTGGTGGGCCGCNONE 
014-086-E01GTGGTGGGCCGCNONE 
014-091-D02GTGGTGGGCCGCNONE 
014-091-F05GTGGTGGGCCGCNONE 
014-093-E10GTGGTGGGCCGCNONE 
014-100-C10GTGGTGGGCCGCNONE 
015-011-H02GTGGTGGGCCGCNONE 
015-073-B03GTGGTGGGCCGCNONE 
AF010579GTGGTGGGCCGCNONE 
AK059164GTGGTGGGCCGCSimilar to Glycine-rich RNA-binding, abscisic acid-inducible protein. 
AK070016GTGGTGGGCCGCNONE 
AK119238GTGGTGGGCCGCNONE 
AK119242GTGGTGGGCCGCNONE 
J023037K17GTGGTGGGCCGCNONE 
J033136F11GTGGTGGGCCGCNONE 
J065008C13GTGGTGGGCCGCNONE 
J065032K18GTGGTGGGCCGCNONE 
J065043N10GTGGTGGGCCGCNONE 
J065045E06GTGGTGGGCCGCNONE 
J065046P21GTGGTGGGCCGCNONE 
J065048J17GTGGTGGGCCGCNONE 
J065053I23GTGGTGGGCCGCNONE 
J065053P03GTGGTGGGCCGCNONE 
J065054C13GTGGTGGGCCGCNONE 
J065058I17GTGGTGGGCCGCNONE 
J065061I12GTGGTGGGCCGCNONE 
J065062E09GTGGTGGGCCGCNONE 
J065063P04GTGGTGGGCCGCNONE 
J065068J07GTGGTGGGCCGCNONE 
J065076D02GTGGTGGGCCGCNONE 
J065083O07GTGGTGGGCCGCNONE 
J065090J02GTGGTGGGCCGCNONE 
J065093N08GTGGTGGGCCGCNONE 
J065097F02GTGGTGGGCCGCNONE 
J065112H17GTGGTGGGCCGCNONE 
J065121B01GTGGTGGGCCGCNONE 
J065124F12GTGGTGGGCCGCNONE 
J065130L03GTGGTGGGCCGCNONE 
J065131K05GTGGTGGGCCGCNONE 
J065132C06GTGGTGGGCCGCNONE 
J065135J18GTGGTGGGCCGCNONE 
J065138J22GTGGTGGGCCGCNONE 
J065140G21GTGGTGGGCCGCNONE 
J065161B19GTGGTGGGCCGCNONE 
J065162F22GTGGTGGGCCGCNONE 
J065162M09GTGGTGGGCCGCNONE 
J065163D03GTGGTGGGCCGCNONE 
J065163O21GTGGTGGGCCGCNONE 
J065165H11GTGGTGGGCCGCNONE 
J065165O16GTGGTGGGCCGCNONE 
J065167N06GTGGTGGGCCGCNONE 
J065168I08GTGGTGGGCCGCNONE 
J065170A14GTGGTGGGCCGCNONE 
J065170L03GTGGTGGGCCGCNONE 
J065171C08GTGGTGGGCCGCNONE 
J065173G11GTGGTGGGCCGCNONE 
J065173M09GTGGTGGGCCGCNONE 
J065176P07GTGGTGGGCCGCNONE 
J065178K24GTGGTGGGCCGCNONE 
J065185O12GTGGTGGGCCGCNONE 
J065191E02GTGGTGGGCCGCNONE 
J065204H10GTGGTGGGCCGCNONE 
J075033C23GTGGTGGGCCGCNONE 
J075041M21GTGGTGGGCCGCNONE 
J075043F13GTGGTGGGCCGCNONE 
J075044D02GTGGTGGGCCGCNONE 
J075044J15GTGGTGGGCCGCNONE 
J075048L07GTGGTGGGCCGCNONE 
J075054G12GTGGTGGGCCGCNONE 
J075055J10GTGGTGGGCCGCNONE 
J075059F09GTGGTGGGCCGCNONE 
J075066M23GTGGTGGGCCGCNONE 
J075071O09GTGGTGGGCCGCNONE 
J075085G23GTGGTGGGCCGCNONE 
J075086B21GTGGTGGGCCGCNONE 
J075087L18GTGGTGGGCCGCNONE 
J075087L21GTGGTGGGCCGCNONE 
J075087N14GTGGTGGGCCGCNONE 
J075088O13GTGGTGGGCCGCNONE 
J075089B06GTGGTGGGCCGCNONE 
J075089E20GTGGTGGGCCGCNONE 
J075090J01GTGGTGGGCCGCNONE 
J075090L05GTGGTGGGCCGCNONE 
J075091G05GTGGTGGGCCGCNONE 
J075091N06GTGGTGGGCCGCNONE 
J075093G08GTGGTGGGCCGCNONE 
J075094C13GTGGTGGGCCGCNONE 
J075095K01GTGGTGGGCCGCNONE 
J075096C02GTGGTGGGCCGCNONE 
J075097L16GTGGTGGGCCGCNONE 
J075097O10GTGGTGGGCCGCNONE 
J075098H24GTGGTGGGCCGCNONE 
J075099H02GTGGTGGGCCGCNONE 
J075099J11GTGGTGGGCCGCNONE 
J075099L08GTGGTGGGCCGCNONE 
J075109I11GTGGTGGGCCGCNONE 
J075114F03GTGGTGGGCCGCNONE 
J075121G07GTGGTGGGCCGCNONE 
J075122D23GTGGTGGGCCGCNONE 
J075132O07GTGGTGGGCCGCNONE 
J075141L21GTGGTGGGCCGCNONE 
J075142I08GTGGTGGGCCGCNONE 
J075145A06GTGGTGGGCCGCNONE 
J075147J15GTGGTGGGCCGCNONE 
J075150B09GTGGTGGGCCGCNONE 
J075151E07GTGGTGGGCCGCNONE 
J075161M16GTGGTGGGCCGCNONE 
J075190I16GTGGTGGGCCGCNONE 
J075192L05GTGGTGGGCCGCNONE 
J075192O03GTGGTGGGCCGCNONE 
J075192O08GTGGTGGGCCGCNONE 
J075193L12GTGGTGGGCCGCNONE 
J080001M24GTGGTGGGCCGCNONE 
J080004E20GTGGTGGGCCGCNONE 
J080005K15GTGGTGGGCCGCNONE 
J080005L05GTGGTGGGCCGCNONE 
J080014P20GTGGTGGGCCGCNONE 
J080029D12GTGGTGGGCCGCNONE 
J080030H09GTGGTGGGCCGCNONE 
J080039G05GTGGTGGGCCGCNONE 
J080040E18GTGGTGGGCCGCNONE 
J080041B02GTGGTGGGCCGCNONE 
J080041E06GTGGTGGGCCGCNONE 
J080041G05GTGGTGGGCCGCNONE 
J080041G24GTGGTGGGCCGCNONE 
J080041H07GTGGTGGGCCGCNONE 
J080041K03GTGGTGGGCCGCNONE 
J080047G01GTGGTGGGCCGCNONE 
J080052E07GTGGTGGGCCGCNONE 
J080053B15GTGGTGGGCCGCNONE 
J080053N01GTGGTGGGCCGCNONE 
J080054I01GTGGTGGGCCGCNONE 
J080054N02GTGGTGGGCCGCNONE 
J080063P03GTGGTGGGCCGCNONE 
J080064E13GTGGTGGGCCGCNONE 
J080064G13GTGGTGGGCCGCNONE 
J080065F02GTGGTGGGCCGCNONE 
J080065G03GTGGTGGGCCGCNONE 
J080065K17GTGGTGGGCCGCNONE 
J080067D06GTGGTGGGCCGCNONE 
J080067H23GTGGTGGGCCGCNONE 
J080067M15GTGGTGGGCCGCNONE 
J080068B20GTGGTGGGCCGCNONE 
J080068G24GTGGTGGGCCGCNONE 
J080072K19GTGGTGGGCCGCNONE 
J080076I24GTGGTGGGCCGCNONE 
J080092F05GTGGTGGGCCGCNONE 
J080092K14GTGGTGGGCCGCNONE 
J080092N22GTGGTGGGCCGCNONE 
J080093K02GTGGTGGGCCGCNONE 
J080094C08GTGGTGGGCCGCNONE 
J080094E09GTGGTGGGCCGCNONE 
J080094E20GTGGTGGGCCGCNONE 
J080094G08GTGGTGGGCCGCNONE 
J080094H18GTGGTGGGCCGCNONE 
J080094P22GTGGTGGGCCGCNONE 
J080095J23GTGGTGGGCCGCNONE 
J080096F14GTGGTGGGCCGCNONE 
J080097A21GTGGTGGGCCGCNONE 
J080097I07GTGGTGGGCCGCNONE 
J080097J02GTGGTGGGCCGCNONE 
J080097K01GTGGTGGGCCGCNONE 
J080097K03GTGGTGGGCCGCNONE 
J080305H18GTGGTGGGCCGCNONE 
J080306G01GTGGTGGGCCGCNONE 
J080306O08GTGGTGGGCCGCNONE 
J080311I01GTGGTGGGCCGCNONE 
J080315N24GTGGTGGGCCGCNONE 
J090003K21GTGGTGGGCCGCNONE 
J090008C20GTGGTGGGCCGCNONE 
J090008K19GTGGTGGGCCGCNONE 
J090008P13GTGGTGGGCCGCNONE 
J090015H22GTGGTGGGCCGCNONE 
J090016M01GTGGTGGGCCGCNONE 
J090018E13GTGGTGGGCCGCNONE 
J090018G03GTGGTGGGCCGCNONE 
J090018L17GTGGTGGGCCGCNONE 
J090019H11GTGGTGGGCCGCNONE 
J090021B19GTGGTGGGCCGCNONE 
J090021K02GTGGTGGGCCGCNONE 
J090023H15GTGGTGGGCCGCNONE 
J090034E03GTGGTGGGCCGCNONE 
J090045D16GTGGTGGGCCGCNONE 
J090045I06GTGGTGGGCCGCNONE 
J090047L09GTGGTGGGCCGCNONE 
J090048B05GTGGTGGGCCGCNONE 
J090048D11GTGGTGGGCCGCNONE 
J090048N11GTGGTGGGCCGCNONE 
J090050F20GTGGTGGGCCGCNONE 
J090052M20GTGGTGGGCCGCNONE 
J090083H03GTGGTGGGCCGCNONE 
J090084C12GTGGTGGGCCGCNONE 
J090095B05GTGGTGGGCCGCNONE 
J090095M18GTGGTGGGCCGCNONE 
J100024I22GTGGTGGGCCGCNONE 
J100024J12GTGGTGGGCCGCNONE 
J100024J22GTGGTGGGCCGCNONE 
J100025F07GTGGTGGGCCGCNONE 
J100026B13GTGGTGGGCCGCNONE 
J100027N03GTGGTGGGCCGCNONE 
J100029F14GTGGTGGGCCGCNONE 
J100029L20GTGGTGGGCCGCNONE 
J100032C22GTGGTGGGCCGCNONE 
J100032I08GTGGTGGGCCGCNONE 
J100032O05GTGGTGGGCCGCNONE 
J100033J24GTGGTGGGCCGCNONE 
J100033L12GTGGTGGGCCGCNONE 
J100034K06GTGGTGGGCCGCNONE 
J100037D09GTGGTGGGCCGCNONE 
J100038H02GTGGTGGGCCGCNONE 
J100039A12GTGGTGGGCCGCNONE 
J100039N12GTGGTGGGCCGCNONE 
J100039O21GTGGTGGGCCGCNONE 
J100040K05GTGGTGGGCCGCNONE 
J100042A02GTGGTGGGCCGCNONE 
J100042A17GTGGTGGGCCGCNONE 
J100043C15GTGGTGGGCCGCNONE 
J100044A17GTGGTGGGCCGCNONE 
J100044E18GTGGTGGGCCGCNONE 
J100044I11GTGGTGGGCCGCNONE 
J100044J15GTGGTGGGCCGCNONE 
J100045E23GTGGTGGGCCGCNONE 
J100049B18GTGGTGGGCCGCNONE 
J100050G04GTGGTGGGCCGCNONE 
J100051D06GTGGTGGGCCGCNONE 
J100051H20GTGGTGGGCCGCNONE 
J100052J01GTGGTGGGCCGCNONE 
J100052K07GTGGTGGGCCGCNONE 
J100055I01GTGGTGGGCCGCNONE 
J100057D02GTGGTGGGCCGCNONE 
J100059G14GTGGTGGGCCGCNONE 
J100059G21GTGGTGGGCCGCNONE 
J100059H03GTGGTGGGCCGCNONE 
J100059H15GTGGTGGGCCGCNONE 
J100063E13GTGGTGGGCCGCNONE 
J100063M02GTGGTGGGCCGCNONE 
J100064B17GTGGTGGGCCGCNONE 
J100064F11GTGGTGGGCCGCNONE 
J100066G12GTGGTGGGCCGCNONE 
J100066H09GTGGTGGGCCGCNONE 
J100068B12GTGGTGGGCCGCNONE 
J100068L16GTGGTGGGCCGCNONE 
J100068M23GTGGTGGGCCGCNONE 
J100069A02GTGGTGGGCCGCNONE 
J100069D07GTGGTGGGCCGCNONE 
J100069M13GTGGTGGGCCGCNONE 
J100070C07GTGGTGGGCCGCNONE 
J100070J11GTGGTGGGCCGCNONE 
J100070L20GTGGTGGGCCGCNONE 
J100071H10GTGGTGGGCCGCNONE 
J100072L14GTGGTGGGCCGCNONE 
J100072N12GTGGTGGGCCGCNONE 
J100073A21GTGGTGGGCCGCNONE 
J100074K17GTGGTGGGCCGCNONE 
J100074M04GTGGTGGGCCGCNONE 
J100075F11GTGGTGGGCCGCNONE 
J100076E23GTGGTGGGCCGCNONE 
J100076G03GTGGTGGGCCGCNONE 
J100077K01GTGGTGGGCCGCNONE 
J100077N23GTGGTGGGCCGCNONE 
J100079H17GTGGTGGGCCGCNONE 
J100081N01GTGGTGGGCCGCNONE 
J100082E04GTGGTGGGCCGCNONE 
J100082K11GTGGTGGGCCGCNONE 
J100085H23GTGGTGGGCCGCNONE 
J100086O18GTGGTGGGCCGCNONE 
J100087F21GTGGTGGGCCGCNONE 
J100088E02GTGGTGGGCCGCNONE 
J100088F08GTGGTGGGCCGCNONE 
J100088G24GTGGTGGGCCGCNONE 
J100088K20GTGGTGGGCCGCNONE 
J100089B19GTGGTGGGCCGCNONE 
J100089K22GTGGTGGGCCGCNONE 
J100089N22GTGGTGGGCCGCNONE 
J100089O17GTGGTGGGCCGCNONE 
J100090N05GTGGTGGGCCGCNONE 
Os03g0681900006-042-F08GGGCCGGCCCACGANONE 
009-043-F12GGGCCGGCCCACGANONE 
AK061750GGGCCGGCCCACGANONE 
AK062094GGGCCGGCCCACGASimilar to RGP-3 (Fragment). 
J033034F01GGGCCGGCCCACGANONE 
J033131F11GGGCCGGCCCACGANONE 
J033143N03GGGCCGGCCCACGANONE 
Os03g0690000AK062756GATCGGACGGCCCACGCConserved hypothetical protein. 
J080302F19GATCGGACGGCCCACGCNONE 
J080303J23GATCGGACGGCCCACGCNONE 
J080303K16GATCGGACGGCCCACGCNONE 
J080306B15GATCGGACGGCCCACGCNONE 
J080309C02GATCGGACGGCCCACGCNONE 
J080312F13GATCGGACGGCCCACGCNONE 
J080312M04GATCGGACGGCCCACGCNONE 
J080315L20GATCGGACGGCCCACGCNONE 
Os03g0695600006-103-C09ACCGGCCCACTNONE 
014-029-B11ACCGGCCCACTNONE 
AB026566ACCGGCCCACTNONE 
AK061228ACCGGCCCACTProteasome subunit beta type 2 (EC 3.4.25.1) (20S proteasome alpha subunit D) (20S proteasome subunit beta-4). 
AK099128ACCGGCCCACTNONE 
J023041C17ACCGGCCCACTNONE 
J043030L19ACCGGCCCACTNONE 
J065002E17ACCGGCCCACTNONE 
J065042H23ACCGGCCCACTNONE 
J065110P10ACCGGCCCACTNONE 
J065112D10ACCGGCCCACTNONE 
J065114B21ACCGGCCCACTNONE 
J065124B02ACCGGCCCACTNONE 
J065138P08ACCGGCCCACTNONE 
J065182O20ACCGGCCCACTNONE 
J065216N05ACCGGCCCACTNONE 
J075060D19ACCGGCCCACTNONE 
J075097M03ACCGGCCCACTNONE 
J075098I11ACCGGCCCACTNONE 
J075142I15ACCGGCCCACTNONE 
J090018B21ACCGGCCCACTNONE 
J090034E12ACCGGCCCACTNONE 
J090042N01ACCGGCCCACTNONE 
Os03g0701700011-034-E06GGTGTGTGGGCCGTGTGGCNONE 
AF013979GGTGTGTGGGCCGTGTGGCNONE 
AK065161GGTGTGTGGGCCGTGTGGCSimilar to Ethylene receptor. 
AK067813GGTGTGTGGGCCGTGTGGCNONE 
J013002C04GGTGTGTGGGCCGTGTGGCNONE 
J013035M07GGTGTGTGGGCCGTGTGGCNONE 
J013049B10GGTGTGTGGGCCGTGTGGCNONE 
J013065F11GGTGTGTGGGCCGTGTGGCNONE 
J013072K18GGTGTGTGGGCCGTGTGGCNONE 
J013073P08GGTGTGTGGGCCGTGTGGCNONE 
J013098F08GGTGTGTGGGCCGTGTGGCNONE 
J013154M13GGTGTGTGGGCCGTGTGGCNONE 
J023001H02GGTGTGTGGGCCGTGTGGCNONE 
J023003D16GGTGTGTGGGCCGTGTGGCNONE 
J023014P17GGTGTGTGGGCCGTGTGGCNONE 
J023036A22GGTGTGTGGGCCGTGTGGCNONE 
J023038N01GGTGTGTGGGCCGTGTGGCNONE 
J023042E11GGTGTGTGGGCCGTGTGGCNONE 
J023058O05GGTGTGTGGGCCGTGTGGCNONE 
J023084D05GGTGTGTGGGCCGTGTGGCNONE 
J023088O17GGTGTGTGGGCCGTGTGGCNONE 
J023138O11GGTGTGTGGGCCGTGTGGCNONE 
J023147A10GGTGTGTGGGCCGTGTGGCNONE 
J033029G18GGTGTGTGGGCCGTGTGGCNONE 
J033031N13GGTGTGTGGGCCGTGTGGCNONE 
J033090D09GGTGTGTGGGCCGTGTGGCNONE 
J033091I06GGTGTGTGGGCCGTGTGGCNONE 
J033096B20GGTGTGTGGGCCGTGTGGCNONE 
J033101A19GGTGTGTGGGCCGTGTGGCNONE 
J033135D03GGTGTGTGGGCCGTGTGGCNONE 
J043001L13GGTGTGTGGGCCGTGTGGCNONE 
J043020A13GGTGTGTGGGCCGTGTGGCNONE 
J053071K24GGTGTGTGGGCCGTGTGGCNONE 
J053092L14GGTGTGTGGGCCGTGTGGCNONE 
J053099F19GGTGTGTGGGCCGTGTGGCNONE 
J065009P22GGTGTGTGGGCCGTGTGGCNONE 
J065046A22GGTGTGTGGGCCGTGTGGCNONE 
J065099K22GGTGTGTGGGCCGTGTGGCNONE 
J065112O22GGTGTGTGGGCCGTGTGGCNONE 
J065119K11GGTGTGTGGGCCGTGTGGCNONE 
J065212B11GGTGTGTGGGCCGTGTGGCNONE 
J090022A11GGTGTGTGGGCCGTGTGGCNONE 
J090054F15GGTGTGTGGGCCGTGTGGCNONE 
J090076B20GGTGTGTGGGCCGTGTGGCNONE 
J090099M22GGTGTGTGGGCCGTGTGGCNONE 
J100032L01GGTGTGTGGGCCGTGTGGCNONE 
J100065H13GGTGTGTGGGCCGTGTGGCNONE 
Os03g0746000AK073682GCGGCCCACAConserved hypothetical protein. 
AK111472GCGGCCCACANONE 
J090083F05GCGGCCCACANONE 
Os03g0749900006-112-A05CTCGGCCCACCTAGGCCCATTTNONE 
AK061252CTCGGCCCACCTAGGCCCATTTConserved hypothetical protein. 
J023020I01CTCGGCCCACCTAGGCCCATTTNONE 
J033060N21CTCGGCCCACCTAGGCCCATTTNONE 
Os03g0756800009-100-H11CCGTGGGCCGGTGGGCCCGNONE 
AK120423CCGTGGGCCGGTGGGCCCGProtein of unknown function UPF0139 family protein. 
J013095D02CCGTGGGCCGGTGGGCCCGNONE 
J023091G12CCGTGGGCCGGTGGGCCCGNONE 
J065207J17CCGTGGGCCGGTGGGCCCGNONE 
J100067G13CCGTGGGCCGGTGGGCCCGNONE 
J100089L11CCGTGGGCCGGTGGGCCCGNONE 
Os03g0758700AK106620TGCGGCCCACGGWD40-like domain containing protein. 
Os03g0760700AK060701TGTGGGCCGCSimilar to Aspartate-semialdehyde dehydrogenase (EC 1.2.1.11) (Fragment). 
Os03g0776900AK107941GCGGCCCACGASimilar to DNAJ protein-like. 
J053100E14GCGGCCCACGANONE 
J075111A12GCGGCCCACGANONE 
Os03g0784900006-053-H11TCCGGCCCACTNONE 
009-165-F11TCCGGCCCACTNONE 
AK060949TCCGGCCCACTConserved hypothetical protein. 
AK099097TCCGGCCCACTNONE 
J023019M19TCCGGCCCACTNONE 
J065024O11TCCGGCCCACTNONE 
J065106D20TCCGGCCCACTNONE 
J065201L15TCCGGCCCACTNONE 
J075031B04TCCGGCCCACTNONE 
J075033C19TCCGGCCCACTNONE 
J075035F11TCCGGCCCACTNONE 
J075074K14TCCGGCCCACTNONE 
J075083A22TCCGGCCCACTNONE 
J075120O10TCCGGCCCACTNONE 
J075153L20TCCGGCCCACTNONE 
J075159G02TCCGGCCCACTNONE 
J080001J18TCCGGCCCACTNONE 
J080015I03TCCGGCCCACTNONE 
J080027E23TCCGGCCCACTNONE 
J080046D24TCCGGCCCACTNONE 
J080053B17TCCGGCCCACTNONE 
J080070P07TCCGGCCCACTNONE 
J080076D18TCCGGCCCACTNONE 
J080078E13TCCGGCCCACTNONE 
J080090H03TCCGGCCCACTNONE 
J100024F19TCCGGCCCACTNONE 
J100052D15TCCGGCCCACTNONE 
J100079B14TCCGGCCCACTNONE 
Os03g0793500AK103407GACGGCCCACANONE 
AK121620GACGGCCCACASimilar to Casein kinase-like protein. 
Os03g0793700AK121667CACGGCCCACACCupin 1 domain containing protein. 
AY098743CACGGCCCACACNONE 
Os03g0797600006-034-B06GGACGGCCCACGTACAGCCCATCAAGGCCCATATNONE 
009-066-A01GGACGGCCCACGTACAGCCCATCAAGGCCCATATNONE 
014-035-H08GGACGGCCCACGTACAGCCCATCAAGGCCCATATNONE 
AK067446GGACGGCCCACGTACAGCCCATCAAGGCCCATATSimilar to Helix-loop-helix protein homolog. 
AK068388GGACGGCCCACGTACAGCCCATCAAGGCCCATATNONE 
AK104412GGACGGCCCACGTACAGCCCATCAAGGCCCATATNONE 
Os03g0822900AK099787CACGGCCCACAAZinc finger, BED-type predicted domain containing protein. 
J013042C24CACGGCCCACAANONE 
J013096O21CACGGCCCACAANONE 
J023109I23CACGGCCCACAANONE 
J033106N09CACGGCCCACAANONE 
J033107H03CACGGCCCACAANONE 
J033118G03CACGGCCCACAANONE 
J033145I24CACGGCCCACAANONE 
J065138D15CACGGCCCACAANONE 
J065140L13CACGGCCCACAANONE 
J065179M13CACGGCCCACAANONE 
J065200F05CACGGCCCACAANONE 
J075104F20CACGGCCCACAANONE 
J075143A15CACGGCCCACAANONE 
J075197J11CACGGCCCACAANONE 
Os03g0824400AK070153TACGGCCCACGCTGCGGCCCNONE 
AK104298TACGGCCCACGCTGCGGCCCSimilar to Dolichol-phosphate mannosyltransferase (EC 2.4.1.83) (Dolichol- phosphate mannose synthase) (Dolichyl-phosphate beta-D- mannosyltransferase) (Mannose-P-dolichol synthase) (MPD synthase) (DPM synthase). 
Os03g0836200009-165-F07CTCGGCCCACAAGCGGCCCAACTNONE 
015-092-G01CTCGGCCCACAAGCGGCCCAACTNONE 
AK058443CTCGGCCCACAAGCGGCCCAACTNONE 
AK067084CTCGGCCCACAAGCGGCCCAACTSimilar to RNA-binding protein RZ-1. 
AK101225CTCGGCCCACAAGCGGCCCAACTNONE 
J013092A03CTCGGCCCACAAGCGGCCCAACTNONE 
J013095N17CTCGGCCCACAAGCGGCCCAACTNONE 
J013147J18CTCGGCCCACAAGCGGCCCAACTNONE 
J023019O10CTCGGCCCACAAGCGGCCCAACTNONE 
J023065N18CTCGGCCCACAAGCGGCCCAACTNONE 
J033113E18CTCGGCCCACAAGCGGCCCAACTNONE 
J033133E03CTCGGCCCACAAGCGGCCCAACTNONE 
J065059J15CTCGGCCCACAAGCGGCCCAACTNONE 
J065075O11CTCGGCCCACAAGCGGCCCAACTNONE 
J065119I07CTCGGCCCACAAGCGGCCCAACTNONE 
J065171J03CTCGGCCCACAAGCGGCCCAACTNONE 
J090016D21CTCGGCCCACAAGCGGCCCAACTNONE 
J090081O03CTCGGCCCACAAGCGGCCCAACTNONE 
J100040G18CTCGGCCCACAAGCGGCCCAACTNONE 
J100040L10CTCGGCCCACAAGCGGCCCAACTNONE 
J100055H13CTCGGCCCACAAGCGGCCCAACTNONE 
J100059I22CTCGGCCCACAAGCGGCCCAACTNONE 
J100078A08CTCGGCCCACAAGCGGCCCAACTNONE 
Os03g0841100AK120279TATTGGGCCGTGTCGGCCCACCTEGF domain containing protein. 
Os03g0843500AK067985TACGGCCCACANONE 
AK101661TACGGCCCACASimilar to Sarcoplasmic reticulum protein (With alternative splicing). 
AY224454TACGGCCCACANONE 
J080302L23TACGGCCCACANONE 
Os03g0846400AK067706TGGTGGGCCGTGGCTGGGCTGGNONE 
AK070549TGGTGGGCCGTGGCTGGGCTGGPeptidase, trypsin-like serine and cysteine domain containing protein. 
Os03g0851000006-098-C01TTGTGGGCCGGGCCCAAACNONE 
AK060496TTGTGGGCCGGGCCCAAACSimilar to Transcription factor homolog BTF3-like protein. 
AK102202TTGTGGGCCGGGCCCAAACNONE 
AK104157TTGTGGGCCGGGCCCAAACNONE 
J033087F19TTGTGGGCCGGGCCCAAACNONE 
J065087I16TTGTGGGCCGGGCCCAAACNONE 
J065113G04TTGTGGGCCGGGCCCAAACNONE 
J090026M02TTGTGGGCCGGGCCCAAACNONE 
J090027I04TTGTGGGCCGGGCCCAAACNONE 
J100073E19TTGTGGGCCGGGCCCAAACNONE 
Os03g0851100AF303468GGAGTGGGCCTATGGGCCCTAGTGGGCCTATGGGCCCTAGTGGGCCGTACGGCCCATTTNONE 
AK102069GGAGTGGGCCTATGGGCCCTAGTGGGCCTATGGGCCCTAGTGGGCCGTACGGCCCATTTSimilar to Translational elongation factor EF-TuM. 
J033082G06GGAGTGGGCCTATGGGCCCTAGTGGGCCTATGGGCCCTAGTGGGCCGTACGGCCCATTTNONE 
J043036M21GGAGTGGGCCTATGGGCCCTAGTGGGCCTATGGGCCCTAGTGGGCCGTACGGCCCATTTNONE 
J065158H05GGAGTGGGCCTATGGGCCCTAGTGGGCCTATGGGCCCTAGTGGGCCGTACGGCCCATTTNONE 
J065192A04GGAGTGGGCCTATGGGCCCTAGTGGGCCTATGGGCCCTAGTGGGCCGTACGGCCCATTTNONE 
Os03g0851200009-035-B01AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
009-134-F10AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
009-154-H05AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
AK059425AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCSimilar to CAXIP1 protein. 
J065065D24AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
J075046G20AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
J075046O19AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
J075048O04AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
J075181I09AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
J080303G20AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
J090086F12AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
J090088E07AAATGGGCCGTACGGCCCACTAGGGCCCATAGGCCCACTAGGGCCCATAGGCCCACTCCNONE 
Os03g0854800J090007D13GCCGGCCCACGGGNONE 
J090085N22GCCGGCCCACGGGNONE 
Os03g0861700AK066129CAAGTGGGCCGGCCCACCTRhodanese-like domain containing protein. 
J013051M12CAAGTGGGCCGGCCCACCTNONE 
J013104N13CAAGTGGGCCGGCCCACCTNONE 
J065052E12CAAGTGGGCCGGCCCACCTNONE 
Os03g0861800AF358762AGGTGGGCCGGCCCACTTGNONE 
AK068434AGGTGGGCCGGCCCACTTGCyclin-like F-box domain containing protein. 
AK109388AGGTGGGCCGGCCCACTTGNONE 
J013154L15AGGTGGGCCGGCCCACTTGNONE 
J013170I23AGGTGGGCCGGCCCACTTGNONE 
J023031D05AGGTGGGCCGGCCCACTTGNONE 
J023082E07AGGTGGGCCGGCCCACTTGNONE 
J023095M10AGGTGGGCCGGCCCACTTGNONE 
J023127D14AGGTGGGCCGGCCCACTTGNONE 
J023138M15AGGTGGGCCGGCCCACTTGNONE 
J023138M16AGGTGGGCCGGCCCACTTGNONE 
J033060B18AGGTGGGCCGGCCCACTTGNONE 
J033060F13AGGTGGGCCGGCCCACTTGNONE 
J033096J11AGGTGGGCCGGCCCACTTGNONE 
J033122C07AGGTGGGCCGGCCCACTTGNONE 
J053029A10AGGTGGGCCGGCCCACTTGNONE 
J053062O16AGGTGGGCCGGCCCACTTGNONE 
J053064J08AGGTGGGCCGGCCCACTTGNONE 
J053086F22AGGTGGGCCGGCCCACTTGNONE 
J065036C04AGGTGGGCCGGCCCACTTGNONE 
J065072J23AGGTGGGCCGGCCCACTTGNONE 
J065120D04AGGTGGGCCGGCCCACTTGNONE 
J065161D04AGGTGGGCCGGCCCACTTGNONE 
J065172H02AGGTGGGCCGGCCCACTTGNONE 
J065207B01AGGTGGGCCGGCCCACTTGNONE 
J075019H18AGGTGGGCCGGCCCACTTGNONE 
J075082E16AGGTGGGCCGGCCCACTTGNONE 
J075089A10AGGTGGGCCGGCCCACTTGNONE 
J075099G02AGGTGGGCCGGCCCACTTGNONE 
J075134M04AGGTGGGCCGGCCCACTTGNONE 
J075144K19AGGTGGGCCGGCCCACTTGNONE 
J075147F17AGGTGGGCCGGCCCACTTGNONE 
J090004O14AGGTGGGCCGGCCCACTTGNONE 
J090013A07AGGTGGGCCGGCCCACTTGNONE 
J090047K14AGGTGGGCCGGCCCACTTGNONE 
Os04g0115400015-048-B05ACGTGGGCCGAANONE 
015-048-B05AGTGGGCCGCANONE 
AK070523ACGTGGGCCGAAD111/G-patch domain containing protein. 
AK070523AGTGGGCCGCAD111/G-patch domain containing protein. 
Os04g0122000AK065510CCGTGGGCCGCACGTGGGCTTTTLeucine rich repeat, N-terminal domain containing protein. 
AK072577CCGTGGGCCGCACGTGGGCTTTTNONE 
AK099773CCGTGGGCCGCACGTGGGCTTTTNONE 
J013030L03CCGTGGGCCGCACGTGGGCTTTTNONE 
J013042D23CCGTGGGCCGCACGTGGGCTTTTNONE 
J013050E17CCGTGGGCCGCACGTGGGCTTTTNONE 
J013051J21CCGTGGGCCGCACGTGGGCTTTTNONE 
J013055L09CCGTGGGCCGCACGTGGGCTTTTNONE 
J013064A03CCGTGGGCCGCACGTGGGCTTTTNONE 
J013095E06CCGTGGGCCGCACGTGGGCTTTTNONE 
J013111A06CCGTGGGCCGCACGTGGGCTTTTNONE 
J013118K01CCGTGGGCCGCACGTGGGCTTTTNONE 
J013119A03CCGTGGGCCGCACGTGGGCTTTTNONE 
J013134F07CCGTGGGCCGCACGTGGGCTTTTNONE 
J033132N23CCGTGGGCCGCACGTGGGCTTTTNONE 
Os04g0208400AK069629AGTGGGCCGTGCyclin-like F-box domain containing protein. 
AK069629CACGTGGGCCGGCCyclin-like F-box domain containing protein. 
Os04g0218600009-123-A05GTGTGGGCCGTCNONE 
AK062873GTGTGGGCCGTCNONE 
AK103472GTGTGGGCCGTCConserved hypothetical protein. 
J090077A20GTGTGGGCCGTCNONE 
Os04g0253000005-012-H08ACCGGCCCACCNONE 
009-095-D01ACCGGCCCACCNONE 
016-090-D11ACCGGCCCACCNONE 
AK073668ACCGGCCCACCSimilar to Histone H1. 
J013088G23ACCGGCCCACCNONE 
J013162C07ACCGGCCCACCNONE 
J023031N06ACCGGCCCACCNONE 
J023039N07ACCGGCCCACCNONE 
J023083I01ACCGGCCCACCNONE 
J023083O14ACCGGCCCACCNONE 
J023122B19ACCGGCCCACCNONE 
J023133L08ACCGGCCCACCNONE 
J033052L06ACCGGCCCACCNONE 
J033080E10ACCGGCCCACCNONE 
J090032L14ACCGGCCCACCNONE 
J100022N05ACCGGCCCACCNONE 
J100029A08ACCGGCCCACCNONE 
J100029H18ACCGGCCCACCNONE 
J100066D09ACCGGCCCACCNONE 
J100077M22ACCGGCCCACCNONE 
Os04g0303950J065204E07GGGTGGGCCGAANONE 
J075044A07GGGTGGGCCGAANONE 
Os04g0434800011-033-F12GCGGCCCACCACNONE 
011-049-F07GCGGCCCACCACNONE 
AB114855GCGGCCCACCACNONE 
AK063934GCGGCCCACCACNONE 
AK103344GCGGCCCACCACSimilar to Thylakoid-bound ascorbate peroxidase (EC 1.11.1.11) (Fragment). 
Os04g0486500AK111976TCCGGCCCACCTSimilar to Mitotic spindle checkpoint protein MAD2. 
Os04g0490000AK108365TTGTGGGCCGTASimilar to Glutamate synthase [NADH], chloroplast precursor (EC 1.4.1.14) (NADH- GOGAT). 
Os04g0502300009-116-F02TCAGGCCCATCTCGGCCCACTCTNONE 
009-130-H06TCAGGCCCATCTCGGCCCACTCTNONE 
AK120520TCAGGCCCATCTCGGCCCACTCTSimilar to 40S ribosomal protein S11. 
J013124K01TCAGGCCCATCTCGGCCCACTCTNONE 
J023102F03TCAGGCCCATCTCGGCCCACTCTNONE 
J033094F17TCAGGCCCATCTCGGCCCACTCTNONE 
J053054C22TCAGGCCCATCTCGGCCCACTCTNONE 
J065024N13TCAGGCCCATCTCGGCCCACTCTNONE 
J065083J18TCAGGCCCATCTCGGCCCACTCTNONE 
J065132O14TCAGGCCCATCTCGGCCCACTCTNONE 
J065156M09TCAGGCCCATCTCGGCCCACTCTNONE 
J065176N15TCAGGCCCATCTCGGCCCACTCTNONE 
J065208H08TCAGGCCCATCTCGGCCCACTCTNONE 
J075054B03TCAGGCCCATCTCGGCCCACTCTNONE 
J090053E20TCAGGCCCATCTCGGCCCACTCTNONE 
J100075B09TCAGGCCCATCTCGGCCCACTCTNONE 
J100089H12TCAGGCCCATCTCGGCCCACTCTNONE 
Os04g0528100009-090-G06TACGGCCCACCCNONE 
009-168-C11TACGGCCCACCCNONE 
AK065957TACGGCCCACCCConserved hypothetical protein. 
J013039G20TACGGCCCACCCNONE 
J013044D08TACGGCCCACCCNONE 
J065013L14TACGGCCCACCCNONE 
J065143H08TACGGCCCACCCNONE 
J065146C14TACGGCCCACCCNONE 
J065149K22TACGGCCCACCCNONE 
J065156B18TACGGCCCACCCNONE 
J065201A04TACGGCCCACCCNONE 
J065209A04TACGGCCCACCCNONE 
Os04g0530000009-106-E11TTCGGCCCACCANONE 
011-012-E12TTCGGCCCACCANONE 
AK066169TTCGGCCCACCAConserved hypothetical protein. 
J013052P20TTCGGCCCACCANONE 
J090060G12TTCGGCCCACCANONE 
J100073H10TTCGGCCCACCANONE 
Os04g0531100013-046-D02CACGGCCCACGGNONE 
013-046-D02CCACGGCCCACNONE 
AF090698CACGGCCCACGGNONE 
AF090698CCACGGCCCACNONE 
AK063584CACGGCCCACGGC2 calcium/lipid-binding region, CaLB domain containing protein. 
AK063584CCACGGCCCACC2 calcium/lipid-binding region, CaLB domain containing protein. 
J065025M20CACGGCCCACGGNONE 
J065025M20CCACGGCCCACNONE 
J065028L15CACGGCCCACGGNONE 
J065028L15CCACGGCCCACNONE 
J065048O03CACGGCCCACGGNONE 
J065048O03CCACGGCCCACNONE 
J065053K10CACGGCCCACGGNONE 
J065053K10CCACGGCCCACNONE 
J065072H10CACGGCCCACGGNONE 
J065072H10CCACGGCCCACNONE 
J065081H10CACGGCCCACGGNONE 
J065081H10CCACGGCCCACNONE 
J065082N17CACGGCCCACGGNONE 
J065082N17CCACGGCCCACNONE 
J065104K08CACGGCCCACGGNONE 
J065104K08CCACGGCCCACNONE 
J065106M03CACGGCCCACGGNONE 
J065106M03CCACGGCCCACNONE 
J065119I05CACGGCCCACGGNONE 
J065119I05CCACGGCCCACNONE 
J065122F04CACGGCCCACGGNONE 
J065122F04CCACGGCCCACNONE 
J065140N24CACGGCCCACGGNONE 
J065140N24CCACGGCCCACNONE 
J065153G09CACGGCCCACGGNONE 
J065153G09CCACGGCCCACNONE 
J065171H07CACGGCCCACGGNONE 
J065171H07CCACGGCCCACNONE 
J065172M23CACGGCCCACGGNONE 
J065172M23CCACGGCCCACNONE 
J065173K13CACGGCCCACGGNONE 
J065173K13CCACGGCCCACNONE 
J065177D22CACGGCCCACGGNONE 
J065177D22CCACGGCCCACNONE 
J065189H10CACGGCCCACGGNONE 
J065189H10CCACGGCCCACNONE 
J065198H24CACGGCCCACGGNONE 
J065198H24CCACGGCCCACNONE 
J065204D19CACGGCCCACGGNONE 
J065204D19CCACGGCCCACNONE 
J075006C08CACGGCCCACGGNONE 
J075006C08CCACGGCCCACNONE 
J075029I08CACGGCCCACGGNONE 
J075029I08CCACGGCCCACNONE 
J075039A16CACGGCCCACGGNONE 
J075039A16CCACGGCCCACNONE 
J075107I24CACGGCCCACGGNONE 
J075107I24CCACGGCCCACNONE 
J075135M22CACGGCCCACGGNONE 
J075135M22CCACGGCCCACNONE 
J075181P06CACGGCCCACGGNONE 
J075181P06CCACGGCCCACNONE 
J075190O11CACGGCCCACGGNONE 
J075190O11CCACGGCCCACNONE 
J075193F04CACGGCCCACGGNONE 
J075193F04CCACGGCCCACNONE 
Os04g0563300AK100487CCCGGCCCACGCCyclin-like F-box domain containing protein. 
J023097O18CCCGGCCCACGCNONE 
J065100E16CCCGGCCCACGCNONE 
J075022C23CCCGGCCCACGCNONE 
J075023L18CCCGGCCCACGCNONE 
J075040N10CCCGGCCCACGCNONE 
J075061L14CCCGGCCCACGCNONE 
J075069B15CCCGGCCCACGCNONE 
J075106C16CCCGGCCCACGCNONE 
J075138P13CCCGGCCCACGCNONE 
J075139H18CCCGGCCCACGCNONE 
J075139L06CCCGGCCCACGCNONE 
J075149B07CCCGGCCCACGCNONE 
J075177N21CCCGGCCCACGCNONE 
Os04g0577500006-039-C03CCCGGCCCACAANONE 
006-043-H01CCCGGCCCACAANONE 
AK061538CCCGGCCCACAANONE 
AK065648CCCGGCCCACAATatD-related deoxyribonuclease family protein. 
AK104763CCCGGCCCACAANONE 
J013035E21CCCGGCCCACAANONE 
J013066M11CCCGGCCCACAANONE 
J100026B02CCCGGCCCACAANONE 
Os04g0640800AK065522TTTCGGCCCACGTTCCGTProgrammed cell death protein 2, C-terminal domain containing protein. 
Os04g0649900006-036-D07TACGGCCCACTTGNONE 
013-084-F02TACGGCCCACTTGNONE 
AK061488TACGGCCCACTTGProtein of unknown function DUF579, plant family protein. 
J100036B10TACGGCCCACTTGNONE 
J100058F04TACGGCCCACTTGNONE 
J100065C02TACGGCCCACTTGNONE 
Os04g0650200AK072573TTCGGCCCACANONE 
AK109786TTCGGCCCACALipolytic enzyme, G-D-S-L family protein. 
Os04g0658600AK064729CCACGGCCCACGGNONE 
AK064729TGTGGGCCGGCNONE 
AK119253CCACGGCCCACGGNucleolar, Nop52 family protein. 
AK119253TGTGGGCCGGCNucleolar, Nop52 family protein. 
J075132J07CCACGGCCCACGGNONE 
J075132J07TGTGGGCCGGCNONE 
J075157N21CCACGGCCCACGGNONE 
J075157N21TGTGGGCCGGCNONE 
Os04g0667000AK069874CCATGGGCGGCCCACATafazzin family protein. 
J100055P09CCATGGGCGGCCCACANONE 
J100057O12CCATGGGCGGCCCACANONE 
J100067H07CCATGGGCGGCCCACANONE 
J100070D06CCATGGGCGGCCCACANONE 
J100071J16CCATGGGCGGCCCACANONE 
J100072C15CCATGGGCGGCCCACANONE 
Os04g0668900AF085174ACCGGCCCACCNONE 
AK067891ACCGGCCCACCSimilar to Plastid terminal oxidase. 
Os04g0675400AK068186CCGTGGGCCGTGSimilar to Chaperone protein dnaJ. 
J013029J20CCGTGGGCCGTGNONE 
J013072I16CCGTGGGCCGTGNONE 
J013134H18CCGTGGGCCGTGNONE 
J013159H06CCGTGGGCCGTGNONE 
Os04g0682300AK061384TTGTGGGCCGGTSimilar to Phosphomannomutase 2 (EC 5.4.2.8) (PMM 2). 
AK104004TTGTGGGCCGGTNONE 
J033102P12TTGTGGGCCGGTNONE 
J100038F01TTGTGGGCCGGTNONE 
Os04g0683500AK071538AGTGGGCCGANONE 
AK071538TGGTGGGCCGAANONE 
AK105871AGTGGGCCGANONE 
AK105871TGGTGGGCCGAANONE 
AK106642AGTGGGCCGASimilar to Adenosine deaminase acting on tRNA 1. 
AK106642TGGTGGGCCGAASimilar to Adenosine deaminase acting on tRNA 1. 
J023095A13AGTGGGCCGANONE 
J023095A13TGGTGGGCCGAANONE 
J023099G11AGTGGGCCGANONE 
J023099G11TGGTGGGCCGAANONE 
J075125A03AGTGGGCCGANONE 
J075125A03TGGTGGGCCGAANONE 
Os04g0684500AK066014TCCGGCCCACCCGGGCCRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os04g0685100AK065262CCGTGGGCCGTCRibosomal biogenesis regulatory protein family protein. 
J013002J24CCGTGGGCCGTCNONE 
J013030M11CCGTGGGCCGTCNONE 
J033139J12CCGTGGGCCGTCNONE 
J065013D12CCGTGGGCCGTCNONE 
J065117J01CCGTGGGCCGTCNONE 
J065143K20CCGTGGGCCGTCNONE 
J065181E12CCGTGGGCCGTCNONE 
J065184A17CCGTGGGCCGTCNONE 
J065193B13CCGTGGGCCGTCNONE 
J065196H01CCGTGGGCCGTCNONE 
J075072G17CCGTGGGCCGTCNONE 
J075077B02CCGTGGGCCGTCNONE 
J075088A06CCGTGGGCCGTCNONE 
J075099H13CCGTGGGCCGTCNONE 
J075111O04CCGTGGGCCGTCNONE 
J075131F20CCGTGGGCCGTCNONE 
J075139K01CCGTGGGCCGTCNONE 
J075194I16CCGTGGGCCGTCNONE 
Os04g0685600AK067506GCGGCCCACGCGExo70 exocyst complex subunit family protein. 
J013108D21GCGGCCCACGCGNONE 
J023041E19GCGGCCCACGCGNONE 
J065006M21GCGGCCCACGCGNONE 
J065060B21GCGGCCCACGCGNONE 
J065086K07GCGGCCCACGCGNONE 
J065121N03GCGGCCCACGCGNONE 
J065201M22GCGGCCCACGCGNONE 
J075004H05GCGGCCCACGCGNONE 
J075005G06GCGGCCCACGCGNONE 
J075032N07GCGGCCCACGCGNONE 
J075055M01GCGGCCCACGCGNONE 
J075057A20GCGGCCCACGCGNONE 
J075078L23GCGGCCCACGCGNONE 
J075137G04GCGGCCCACGCGNONE 
J090026N09GCGGCCCACGCGNONE 
J090044L05GCGGCCCACGCGNONE 
Os05g0110300AK067116TCCGGCCCACANONE 
AK071038TCCGGCCCACANAD-dependent epimerase/dehydratase family protein. 
J065060E20TCCGGCCCACANONE 
J065093K05TCCGGCCCACANONE 
Os05g0110500AK060179TCCGGCCCACTNONE 
AK066175TCCGGCCCACTSimilar to RNA helicase (Fragment). 
J013055E22TCCGGCCCACTNONE 
J090056E03TCCGGCCCACTNONE 
Os05g0116600AK109828AGGTGGGCCGCATGGGCTTTF-box associated type 1 domain containing protein. 
Os05g0121500006-117-B10TTTCGGCCCACTNONE 
009-059-D04TTTCGGCCCACTNONE 
J065066C12TTTCGGCCCACTConserved hypothetical protein. 
J075013I12TTTCGGCCCACTNONE 
J090046D18TTTCGGCCCACTNONE 
Os05g0122900009-052-C11TCCGGCCCACTNONE 
009-132-C12TCCGGCCCACTNONE 
014-091-G03TCCGGCCCACTNONE 
AB072977TCCGGCCCACTNONE 
AK071296TCCGGCCCACTNONE 
AK099375TCCGGCCCACTNONE 
AK104970TCCGGCCCACTBLE1 protein. 
J065007I09TCCGGCCCACTNONE 
J065081H07TCCGGCCCACTNONE 
J065122B18TCCGGCCCACTNONE 
J065181G15TCCGGCCCACTNONE 
J065182J07TCCGGCCCACTNONE 
J065197D23TCCGGCCCACTNONE 
J065197G08TCCGGCCCACTNONE 
J065201H20TCCGGCCCACTNONE 
J090034E11TCCGGCCCACTNONE 
J100077M04TCCGGCCCACTNONE 
Os05g0139200AK108058TGCGGCCCACATGGGTCCCACCyclin-like F-box domain containing protein. 
Os05g0145900006-095-D04CCACGGCCCACGCCCACTCCNONE 
006-104-B04CCACGGCCCACGCCCACTCCNONE 
AK121187CCACGGCCCACGCCCACTCCConserved hypothetical protein. 
J043034M11CCACGGCCCACGCCCACTCCNONE 
J053032K19CCACGGCCCACGCCCACTCCNONE 
J090096F20CCACGGCCCACGCCCACTCCNONE 
Os05g0155100006-075-B02CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
006-075-B02CCGTGGGCCGGANONE 
AK061929CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
AK061929CCGTGGGCCGGANONE 
AK102810CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
AK102810CCGTGGGCCGGANONE 
AK120877CCCACCACTCCGGCCCACGAGGCCCACCACSimilar to 60S ribosomal protein L18. 
AK120877CCGTGGGCCGGASimilar to 60S ribosomal protein L18. 
J013023E03CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J013023E03CCGTGGGCCGGANONE 
J013038C16CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J013038C16CCGTGGGCCGGANONE 
J013120M14CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J013120M14CCGTGGGCCGGANONE 
J013153B04CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J013153B04CCGTGGGCCGGANONE 
J013159B07CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J013159B07CCGTGGGCCGGANONE 
J023012A02CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J023012A02CCGTGGGCCGGANONE 
J023027F08CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J023027F08CCGTGGGCCGGANONE 
J023027I12CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J023027I12CCGTGGGCCGGANONE 
J023120F05CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J023120F05CCGTGGGCCGGANONE 
J023138O03CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J023138O03CCGTGGGCCGGANONE 
J023142H13CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J023142H13CCGTGGGCCGGANONE 
J023143P06CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J023143P06CCGTGGGCCGGANONE 
J033023P09CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033023P09CCGTGGGCCGGANONE 
J033035O14CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033035O14CCGTGGGCCGGANONE 
J033042N19CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033042N19CCGTGGGCCGGANONE 
J033043B12CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033043B12CCGTGGGCCGGANONE 
J033065D10CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033065D10CCGTGGGCCGGANONE 
J033081A12CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033081A12CCGTGGGCCGGANONE 
J033084N05CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033084N05CCGTGGGCCGGANONE 
J033085M03CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033085M03CCGTGGGCCGGANONE 
J033112D15CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033112D15CCGTGGGCCGGANONE 
J033114O07CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033114O07CCGTGGGCCGGANONE 
J033119D15CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033119D15CCGTGGGCCGGANONE 
J033140E06CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033140E06CCGTGGGCCGGANONE 
J033141K23CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033141K23CCGTGGGCCGGANONE 
J043040I22CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J043040I22CCGTGGGCCGGANONE 
J053050B21CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J053050B21CCGTGGGCCGGANONE 
J053065I18CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J053065I18CCGTGGGCCGGANONE 
J053074O16CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J053074O16CCGTGGGCCGGANONE 
J065072K13CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J065072K13CCGTGGGCCGGANONE 
J065211I09CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J065211I09CCGTGGGCCGGANONE 
J090004K04CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J090004K04CCGTGGGCCGGANONE 
J090016L06CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J090016L06CCGTGGGCCGGANONE 
J090040F22CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J090040F22CCGTGGGCCGGANONE 
J090063F22CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J090063F22CCGTGGGCCGGANONE 
J090081J09CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J090081J09CCGTGGGCCGGANONE 
J100032A10CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J100032A10CCGTGGGCCGGANONE 
J100037G20CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J100037G20CCGTGGGCCGGANONE 
J100056O10CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J100056O10CCGTGGGCCGGANONE 
J100071D10CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J100071D10CCGTGGGCCGGANONE 
J100075K13CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J100075K13CCGTGGGCCGGANONE 
J100079F16CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J100079F16CCGTGGGCCGGANONE 
J100080O16CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J100080O16CCGTGGGCCGGANONE 
J100086N05CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J100086N05CCGTGGGCCGGANONE 
Os05g0158200AK060561TTCGGCCCACCACPeptidase, trypsin-like serine and cysteine domain containing protein. 
AK101218TTCGGCCCACCACNONE 
J065061E13TTCGGCCCACCACNONE 
J090089F18TTCGGCCCACCACNONE 
Os05g0182700003-102-E07TTGTGGGCCGAGATNONE 
011-019-D04TTGTGGGCCGAGATNONE 
013-068-D09TTGTGGGCCGAGATNONE 
014-032-G03TTGTGGGCCGAGATNONE 
AK065911TTGTGGGCCGAGATProtein of unknown function DUF1664 family protein. 
AK104343TTGTGGGCCGAGATNONE 
J013045E01TTGTGGGCCGAGATNONE 
J013156L15TTGTGGGCCGAGATNONE 
J023029P17TTGTGGGCCGAGATNONE 
J023134I24TTGTGGGCCGAGATNONE 
J033099A10TTGTGGGCCGAGATNONE 
J033115L16TTGTGGGCCGAGATNONE 
J090007M24TTGTGGGCCGAGATNONE 
J090019F02TTGTGGGCCGAGATNONE 
Os05g0184901Os05g0184901CGCGTGGGCCGTASigma factor, regions 3 and 4 domain containing protein. 
Os05g0283600AK100359GCGTGGGCCGGTConserved hypothetical protein. 
AK106958GCGTGGGCCGGTNONE 
AK109539GCGTGGGCCGGTNONE 
J023083K23GCGTGGGCCGGTNONE 
Os05g0322900006-057-H12CGCGTGGGCCGCNONE 
014-051-A08CGCGTGGGCCGCNONE 
AK063697CGCGTGGGCCGCNONE 
AK066255CGCGTGGGCCGCSimilar to WRKY transcription factor 45. 
AK103959CGCGTGGGCCGCNONE 
AY870611CGCGTGGGCCGCNONE 
J100068H13CGCGTGGGCCGCNONE 
Os05g0331200AK100884CCACGGCCCACGCSimilar to External rotenone-insensitive NADPH dehydrogenase. 
Os05g0395600Os05g0395600TGTGGGCCGGANONE 
Os05g0401300009-111-H03CCGTGGGCCGTGGGCCGTGNONE 
AK060678CCGTGGGCCGTGGGCCGTGTwin-arginine translocation pathway signal domain containing protein. 
Os05g0437800015-045-B10CCAGGCCCGGCCCACANONE 
AK106328CCAGGCCCGGCCCACAConserved hypothetical protein. 
Os05g0438500006-102-F01GCGGCCCACCCNONE 
AK059951GCGGCCCACCCSimilar to Soluble inorganic pyrophosphatase (EC 3.6.1.1) (Pyrophosphate phospho- hydrolase) (PPase). 
Os05g0440100015-006-F06CTCGGCCCACTNONE 
015-006-F06TACGGCCCACGCNONE 
015-076-D04CTCGGCCCACTNONE 
015-076-D04TACGGCCCACGCNONE 
AK073094CTCGGCCCACTNONE 
AK073094TACGGCCCACGCNONE 
AK102786CTCGGCCCACTHistone deacetylase superfamily protein. 
AK102786TACGGCCCACGCHistone deacetylase superfamily protein. 
J033107M16CTCGGCCCACTNONE 
J033107M16TACGGCCCACGCNONE 
Os05g0451200AK073037ACCGGCCCACGTConserved hypothetical protein. 
Os05g0458100006-084-A05AGTGGGCCGTGNONE 
009-091-H05AGTGGGCCGTGNONE 
AJ557547AGTGGGCCGTGNONE 
AK059467AGTGGGCCGTGNONE 
AK061127AGTGGGCCGTGNONE 
AK101652AGTGGGCCGTGSimilar to FK506-binding protein 4 (EC 5.2.1.8) (Peptidyl-prolyl cis-trans isomerase) (PPIase) (Rotamase) (p59 protein) (HSP binding immunophilin) (HBI) (FKBP52 protein) (52 kDa FK506 binding protein) (FKBP59). 
J033044K06AGTGGGCCGTGNONE 
J033057B20AGTGGGCCGTGNONE 
J033087A05AGTGGGCCGTGNONE 
J043009C05AGTGGGCCGTGNONE 
J090009E10AGTGGGCCGTGNONE 
Os05g0467300006-113-H02GCGGCCCACCTGTCAGTGNONE 
AK061873GCGGCCCACCTGTCAGTGSelT/selW/selH selenoprotein family protein. 
AK098945GCGGCCCACCTGTCAGTGNONE 
J013050H09GCGGCCCACCTGTCAGTGNONE 
J023108B17GCGGCCCACCTGTCAGTGNONE 
J065189J01GCGGCCCACCTGTCAGTGNONE 
J075011H05GCGGCCCACCTGTCAGTGNONE 
J075019G20GCGGCCCACCTGTCAGTGNONE 
Os05g0469900AK109700AGGTGGGCCGAGConserved hypothetical protein. 
Os05g0480700AK100850AGTGGGCCGGCSimilar to Vacuolar ATP synthase subunit E (EC 3.6.3.14) (V-ATPase E subunit) (Vacuolar proton pump E subunit). 
J023123I11AGTGGGCCGGCNONE 
Os05g0488900AK071883TGCGGCCCACACSimilar to Cytochrome b5 reductase. 
AK073699TGCGGCCCACACNONE 
AK105459TGCGGCCCACACNONE 
J080009C06TGCGGCCCACACNONE 
J080021N09TGCGGCCCACACNONE 
J080041K24TGCGGCCCACACNONE 
J080058H15TGCGGCCCACACNONE 
J080064P06TGCGGCCCACACNONE 
J080077B16TGCGGCCCACACNONE 
Os05g0490800J065037L19CCAGCCCACGGCCCGGCCCACCTNONE 
Os05g0500500AK110627GCGGCCCACGGHSP20-like chaperone domain containing protein. 
Os05g0503000AK068335GCCGGCCCACACSimilar to Secretory carrier membrane protein. 
AK104049GCCGGCCCACACNONE 
J013149D04GCCGGCCCACACNONE 
J075085A06GCCGGCCCACACNONE 
Os05g0512500009-036-D05GTGGTGGGCCGGTNONE 
AK062441GTGGTGGGCCGGTCT20 family protein. 
J080003C10GTGGTGGGCCGGTNONE 
J080046G11GTGGTGGGCCGGTNONE 
Os05g0520200006-031-F07TACGGCCCACTGGCCCATTANONE 
AK061451TACGGCCCACTGGCCCATTAThioredoxin-related domain containing protein. 
AK099433TACGGCCCACTGGCCCATTANONE 
Os05g0533600AK067577CACTGACATGTGGGCCGCSimilar to Starch synthase IVa (Glycogen (Starch) synthase-like). 
AY224560CACTGACATGTGGGCCGCNONE 
AY373258CACTGACATGTGGGCCGCNONE 
Os05g0535200AK070696TCTCGGCCCACGGCGTGGACyclin-like F-box domain containing protein. 
J023057L12TCTCGGCCCACGGCGTGGANONE 
Os05g0537200AK121713GGCCGTGGGCCGTGGSimilar to Myosin XI (Fragment). 
Os05g0540100AB021666CACGTGGGCCGCANONE 
AK060623CACGTGGGCCGCANONE 
AK103819CACGTGGGCCGCAFlap endonuclease-1a (EC 3.-.-.-) (OsFEN-1a). 
Os05g0541900009-130-F05AACTGGGCTGGGCCTCCGTGGGCCGCNONE 
009-200-E07AACTGGGCTGGGCCTCCGTGGGCCGCNONE 
013-057-G09AACTGGGCTGGGCCTCCGTGGGCCGCNONE 
Os05g0542900AK102925GTGGCCCACGGCCCACGGCCCACGTGTVirulence factor, pectin lyase fold family protein. 
Os05g0553700006-100-D08TGCGGCCCACANONE 
AK099747TGCGGCCCACANONE 
AK101606TGCGGCCCACANONE 
AK103396TGCGGCCCACASimilar to Syntaxin 71 (AtSYP71). 
J033022M23TGCGGCCCACANONE 
J090086G01TGCGGCCCACANONE 
Os05g0566500AK073468TGTGGGCCGGGCNONE 
AK099052TGTGGGCCGGGCSimilar to Initiation factor 3d (Fragment). 
AK104093TGTGGGCCGGGCNONE 
J090025I18TGTGGGCCGGGCNONE 
Os05g0566800AK065748GGTGGGCCGTGCold acclimation protein COR413-TM1. 
AK065748TCGTGGGCCGTCCold acclimation protein COR413-TM1. 
AY181210GGTGGGCCGTGNONE 
AY181210TCGTGGGCCGTCNONE 
Os05g0577200AK069756GCCCGGCCCACTCarboxylesterase, type B family protein. 
Os05g0592300AK068520TTCGGCCCACAProtein of unknown function DUF1637 family protein. 
Os06g0106100009-197-E09TGTGGGCCGGCNONE 
AK111784TGTGGGCCGGCCwf15/Cwc15 cell cycle control protein family protein. 
AK112060TGTGGGCCGGCNONE 
Os06g0113600016-067-E03TGTGGGCCGAAANONE 
AK062095TGTGGGCCGAAANONE 
AK101235TGTGGGCCGAAACyclin-like F-box domain containing protein. 
AK122025TGTGGGCCGAAANONE 
J013022O19TGTGGGCCGAAANONE 
J023045P05TGTGGGCCGAAANONE 
J033031K01TGTGGGCCGAAANONE 
J033034I09TGTGGGCCGAAANONE 
J033041O04TGTGGGCCGAAANONE 
J033071K03TGTGGGCCGAAANONE 
J033075K16TGTGGGCCGAAANONE 
J033097M01TGTGGGCCGAAANONE 
J033099M22TGTGGGCCGAAANONE 
J033108N15TGTGGGCCGAAANONE 
J033121D18TGTGGGCCGAAANONE 
J033125O06TGTGGGCCGAAANONE 
J033139M16TGTGGGCCGAAANONE 
J033145P18TGTGGGCCGAAANONE 
J033149D05TGTGGGCCGAAANONE 
Os06g0115400AK111656GCGGCCCACTSimilar to Superoxide dismutase [Fe], chloroplast (EC 1.15.1.1) (Fragment). 
Os06g0122200AK109712CCCGTGGGCCGAACGGCCCATGTConserved hypothetical protein. 
Os06g0131100AK112079CCAGGCCCAGCCCTCCGGCCCACTWD40-like domain containing protein. 
J033066L01CCAGGCCCAGCCCTCCGGCCCACTNONE 
J100044P22CCAGGCCCAGCCCTCCGGCCCACTNONE 
Os06g0134000AK102796TCCGGCCCAACCGGCCCACCCNONE 
Os06g0136700AK065081TCGGCCCACTSteroid nuclear receptor, ligand-binding domain containing protein. 
J013001L08TCGGCCCACTNONE 
J013039I03TCGGCCCACTNONE 
Os06g0137500AK072896CCCGGCCCACTBrix domain containing protein. 
AK121945CCCGGCCCACTNONE 
Os06g0168000AK059250TGTGGGCCGGANONE 
AK099356TGTGGGCCGGAGlutathione S-transferase, C-terminal-like domain containing protein. 
J033040E19TGTGGGCCGGANONE 
J033097H04TGTGGGCCGGANONE 
J075087M11TGTGGGCCGGANONE 
J075146H06TGTGGGCCGGANONE 
J075188H11TGTGGGCCGGANONE 
J090071D03TGTGGGCCGGANONE 
J090097L20TGTGGGCCGGANONE 
J100051M05TGTGGGCCGGANONE 
J100082H13TGTGGGCCGGANONE 
Os06g0174350J043034B05CCCGGCCCACTConserved hypothetical protein. 
Os06g0194200AK111269TGTGGGCCGCAConserved hypothetical protein. 
J090084F15TGTGGGCCGCANONE 
Os06g0219600AK060429CAACGGCCCACAGCCCACGGSimilar to Poly(A)-binding protein II-like. 
AK099019CAACGGCCCACAGCCCACGGNONE 
J013118A14CAACGGCCCACAGCCCACGGNONE 
Os06g0232000006-109-B11ACCGGCCCACCNONE 
011-080-C04ACCGGCCCACCNONE 
016-019-G01ACCGGCCCACCNONE 
AB110192ACCGGCCCACCNONE 
AK068966ACCGGCCCACCNONE 
AK071776ACCGGCCCACCConserved hypothetical protein. 
AK106053ACCGGCCCACCNONE 
J013146K14ACCGGCCCACCNONE 
J023013A10ACCGGCCCACCNONE 
J023029O20ACCGGCCCACCNONE 
J023110G05ACCGGCCCACCNONE 
J023135H04ACCGGCCCACCNONE 
J033125H14ACCGGCCCACCNONE 
J043009N01ACCGGCCCACCNONE 
J090096E06ACCGGCCCACCNONE 
J100070G19ACCGGCCCACCNONE 
Os06g0236200J075111M01ACCGGCCCACACConserved hypothetical protein. 
J075171D01ACCGGCCCACACNONE 
Os06g0246500AK105105TTCGGCCCACTSimilar to Pyruvate dehydrogenase E1 alpha subunit (EC 1.2.4.1). 
Os06g0332600AK121615GCCGGCCCACCAConserved hypothetical protein. 
J033044B19GCCGGCCCACCANONE 
Os06g0334600AK064993CCCGGCCCACGCGHypothetical protein. 
J013001D16CCCGGCCCACGCGNONE 
J043009I09CCCGGCCCACGCGNONE 
Os06g0498500AK099764TACGGCCCACTNONE 
AK103794TACGGCCCACTNucleolar complex-associated family protein. 
AK121899TACGGCCCACTNONE 
Os06g0551400009-003-D11CCCACCCGGCCCGGCCCACANONE 
011-025-C09CCCACCCGGCCCGGCCCACANONE 
AK066548CCCACCCGGCCCGGCCCACARas-related protein RIC2. 
D13758CCCACCCGGCCCGGCCCACANONE 
J013069H14CCCACCCGGCCCGGCCCACANONE 
J053037J07CCCACCCGGCCCGGCCCACANONE 
J065011J03CCCACCCGGCCCGGCCCACANONE 
J065078L15CCCACCCGGCCCGGCCCACANONE 
J065103H24CCCACCCGGCCCGGCCCACANONE 
J065157A07CCCACCCGGCCCGGCCCACANONE 
J065213P12CCCACCCGGCCCGGCCCACANONE 
J090007P04CCCACCCGGCCCGGCCCACANONE 
J090052N23CCCACCCGGCCCGGCCCACANONE 
Os06g0562700AK109753GACGGCCCACGTConserved hypothetical protein. 
Os06g0567000009-166-G12ATCCAACGGCCCACGGGNONE 
AK121337ATCCAACGGCCCACGGGProtein of unknown function UPF0197 family protein. 
J013122F01ATCCAACGGCCCACGGGNONE 
J023080N12ATCCAACGGCCCACGGGNONE 
J023120F03ATCCAACGGCCCACGGGNONE 
J065013B18ATCCAACGGCCCACGGGNONE 
J065039P21ATCCAACGGCCCACGGGNONE 
J065089E06ATCCAACGGCCCACGGGNONE 
J065095N19ATCCAACGGCCCACGGGNONE 
J065119H03ATCCAACGGCCCACGGGNONE 
J065121D18ATCCAACGGCCCACGGGNONE 
J065149G04ATCCAACGGCCCACGGGNONE 
J075012J04ATCCAACGGCCCACGGGNONE 
J075021G13ATCCAACGGCCCACGGGNONE 
J075106I23ATCCAACGGCCCACGGGNONE 
J075107F19ATCCAACGGCCCACGGGNONE 
J075152J22ATCCAACGGCCCACGGGNONE 
J075186J20ATCCAACGGCCCACGGGNONE 
J075188F16ATCCAACGGCCCACGGGNONE 
J080001G06ATCCAACGGCCCACGGGNONE 
J080002O09ATCCAACGGCCCACGGGNONE 
J080006E10ATCCAACGGCCCACGGGNONE 
J080006F24ATCCAACGGCCCACGGGNONE 
J080012L07ATCCAACGGCCCACGGGNONE 
J080016A10ATCCAACGGCCCACGGGNONE 
J080017D11ATCCAACGGCCCACGGGNONE 
J080017I04ATCCAACGGCCCACGGGNONE 
J080017I10ATCCAACGGCCCACGGGNONE 
J080020P06ATCCAACGGCCCACGGGNONE 
J080024A20ATCCAACGGCCCACGGGNONE 
J080027B10ATCCAACGGCCCACGGGNONE 
J080027E03ATCCAACGGCCCACGGGNONE 
J080027I01ATCCAACGGCCCACGGGNONE 
J080027K20ATCCAACGGCCCACGGGNONE 
J080041L12ATCCAACGGCCCACGGGNONE 
J080043D21ATCCAACGGCCCACGGGNONE 
J080044K11ATCCAACGGCCCACGGGNONE 
J080048I08ATCCAACGGCCCACGGGNONE 
J080049M12ATCCAACGGCCCACGGGNONE 
J080050C14ATCCAACGGCCCACGGGNONE 
J080050N21ATCCAACGGCCCACGGGNONE 
J080053F04ATCCAACGGCCCACGGGNONE 
J080054O16ATCCAACGGCCCACGGGNONE 
J080058O21ATCCAACGGCCCACGGGNONE 
J080059M11ATCCAACGGCCCACGGGNONE 
J080061A11ATCCAACGGCCCACGGGNONE 
J080063B15ATCCAACGGCCCACGGGNONE 
J080063F22ATCCAACGGCCCACGGGNONE 
J080066M18ATCCAACGGCCCACGGGNONE 
J080068D12ATCCAACGGCCCACGGGNONE 
J080070D22ATCCAACGGCCCACGGGNONE 
J080071B06ATCCAACGGCCCACGGGNONE 
J080072B17ATCCAACGGCCCACGGGNONE 
J080081O04ATCCAACGGCCCACGGGNONE 
J080089H05ATCCAACGGCCCACGGGNONE 
J080093K13ATCCAACGGCCCACGGGNONE 
J080095I05ATCCAACGGCCCACGGGNONE 
J080097F19ATCCAACGGCCCACGGGNONE 
J080304C03ATCCAACGGCCCACGGGNONE 
J080304H11ATCCAACGGCCCACGGGNONE 
J080308M21ATCCAACGGCCCACGGGNONE 
J080313O15ATCCAACGGCCCACGGGNONE 
J090020N23ATCCAACGGCCCACGGGNONE 
J100023C12ATCCAACGGCCCACGGGNONE 
Os06g0585200016-065-C02AACGGCCCGTGGGCCGCANONE 
016-065-C02CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCNONE 
AK068592AACGGCCCGTGGGCCGCANONE 
AK068592CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCNONE 
AK073844AACGGCCCGTGGGCCGCANONE 
AK073844CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCNONE 
AK106549AACGGCCCGTGGGCCGCAConserved hypothetical protein. 
AK106549CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCConserved hypothetical protein. 
J013154A14AACGGCCCGTGGGCCGCANONE 
J013154A14CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCNONE 
J100049K24AACGGCCCGTGGGCCGCANONE 
J100049K24CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCNONE 
J100059C18AACGGCCCGTGGGCCGCANONE 
J100059C18CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCNONE 
J100082N13AACGGCCCGTGGGCCGCANONE 
J100082N13CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCNONE 
Os06g0592500AK119729CTGGGCTTGGTGGGCCGGTSimilar to Ethylene-responsive transcriptional coactivator. 
AK122052CTGGGCTTGGTGGGCCGGTNONE 
Os06g0598900AK100386GCGGCCCACACSimilar to Serine-threonine kinase receptor-associated protein (UNR-interacting protein) (WD-40 repeat protein PT-WD) (MAP activator with WD repeats). 
J013088O05GCGGCCCACACNONE 
J090043L20GCGGCCCACACNONE 
Os06g0642900AK073896GCCCACCCGGCCCACGCUbiquitin system component Cue domain containing protein. 
J033042P11GCCCACCCGGCCCACGCNONE 
J033072G12GCCCACCCGGCCCACGCNONE 
J090050C02GCCCACCCGGCCCACGCNONE 
Os06g0643000AK067701GCCGGCCCACCACCAACPhox-like domain containing protein. 
J013032G04GCCGGCCCACCACCAACNONE 
J013044B17GCCGGCCCACCACCAACNONE 
J013114M13GCCGGCCCACCACCAACNONE 
J023133A02GCCGGCCCACCACCAACNONE 
J043022A07GCCGGCCCACCACCAACNONE 
J075046O21GCCGGCCCACCACCAACNONE 
J075142L01GCCGGCCCACCACCAACNONE 
J090076I16GCCGGCCCACCACCAACNONE 
J100056O17GCCGGCCCACCACCAACNONE 
Os06g0647100009-005-F12CACGGCCCACCTNONE 
009-005-F12GCGGCCCACANONE 
009-113-D11CACGGCCCACCTNONE 
009-113-D11GCGGCCCACANONE 
009-132-D09CACGGCCCACCTNONE 
009-132-D09GCGGCCCACANONE 
009-147-G06CACGGCCCACCTNONE 
009-147-G06GCGGCCCACANONE 
AK066837CACGGCCCACCTSimilar to 50S ribosomal protein L35, chloroplast precursor (CL35). 
AK066837GCGGCCCACASimilar to 50S ribosomal protein L35, chloroplast precursor (CL35). 
J065073M03CACGGCCCACCTNONE 
J065073M03GCGGCCCACANONE 
Os06g0649500AK072591CTCGGCCCACAWD40-like domain containing protein. 
Os06g0650100009-016-C02ACCGGCCCACCTNONE 
AK062354ACCGGCCCACCTSimilar to Polyubiquitin gene (Fragment). 
Os06g0687200AK058749TGCGGCCCACCAZinc finger, RING-type domain containing protein. 
Os06g0704300AK107008TCGTGGGCCGAAZinc finger, CCCH-type domain containing protein. 
J065038I12TCGTGGGCCGAANONE 
J065079E03TCGTGGGCCGAANONE 
J075035B15TCGTGGGCCGAANONE 
J090072D21TCGTGGGCCGAANONE 
Os07g0101500AK059667GCCGGCCCACGANONE 
AK071749GCCGGCCCACGASimilar to Sterol 4-alpha-methyl-oxidase (Fragment). 
J023112L07GCCGGCCCACGANONE 
J065050F03GCCGGCCCACGANONE 
J090015C05GCCGGCCCACGANONE 
J090045C11GCCGGCCCACGANONE 
Os07g0105300AK107419GCCGGCCCACGGGConserved hypothetical protein. 
AK109521GCCGGCCCACGGGNONE 
Os07g0136300AK064609GTCGCGCGTGGGCCGAGAConserved hypothetical protein. 
Os07g0184900AK102066TCGGCCCGTGGGCCGTGTTGGGCCGAGGCCCACGTGGGAGTGGGAAGGCCCACGCACCGCSimilar to Ku70-like protein. 
Os07g0187300AK103069CCCGTGGGCCGGARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J013042I12CCCGTGGGCCGGANONE 
J033117P16CCCGTGGGCCGGANONE 
Os07g0224000009-060-E01GACGGCCCACTNONE 
J065042D20GACGGCCCACTNONE 
J065127D14GACGGCCCACTNONE 
J065176C24GACGGCCCACTNONE 
J065188M12GACGGCCCACTNONE 
J065194L14GACGGCCCACTNONE 
J075060P09GACGGCCCACTNONE 
J075134C14GACGGCCCACTRibosomal protein L24E family protein. 
J075192M12GACGGCCCACTNONE 
J100032N01GACGGCCCACTNONE 
Os07g0256200AK072904GCCCGGCCCACAARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J023148I23GCCCGGCCCACAANONE 
Os07g0258400AK121534CTCGGCCCGGCCCACCTNONE 
L41217CTCGGCCCGGCCCACCTNONE 
S81897CTCGGCCCGGCCCACCTOsNramp1 (Integral membrane protein). 
Os07g0274700J065002G18TCTCGGCCCACCCGNONE 
J065092L19TCTCGGCCCACCCGNONE 
J065099K11TCTCGGCCCACCCGNONE 
J065103L08TCTCGGCCCACCCGNONE 
J065185I19TCTCGGCCCACCCGNONE 
J075004L22TCTCGGCCCACCCGNONE 
J075007G03TCTCGGCCCACCCGNONE 
J075020E09TCTCGGCCCACCCGNONE 
J075046B02TCTCGGCCCACCCGNONE 
J075070D08TCTCGGCCCACCCGNONE 
J075118L24TCTCGGCCCACCCGNONE 
J075140C15TCTCGGCCCACCCGNONE 
J075157A21TCTCGGCCCACCCGNONE 
J075165J01TCTCGGCCCACCCGNONE 
J075172J18TCTCGGCCCACCCGNONE 
J075177P10TCTCGGCCCACCCGNONE 
J100042D15TCTCGGCCCACCCGNONE 
J100053M21TCTCGGCCCACCCGNONE 
J100067M12TCTCGGCCCACCCGNONE 
Os07g0289800J080305A01GTGTGGGCCGGGConserved hypothetical protein. 
Os07g0301200AB110202AGTGGGCCGTGNONE 
AB110202CACGTGGGCCGGCNONE 
AK073463AGTGGGCCGTGSimilar to RNA helicase (Fragment). 
AK073463CACGTGGGCCGGCSimilar to RNA helicase (Fragment). 
Os07g0423000AK109714GGTGGGCCGAAMitochodrial transcription termination factor-related family protein. 
J065007I23GGTGGGCCGAANONE 
Os07g0490300AK068288GCGGCCCACAGCCCAACCSimilar to Preproacrosin. 
J013149P03GCGGCCCACAGCCCAACCNONE 
J065039L14GCGGCCCACAGCCCAACCNONE 
J100024A06GCGGCCCACAGCCCAACCNONE 
Os07g0490400AK067941GGTTGGGCTGTGGGCCGCPeptidylprolyl isomerase, FKBP-type domain containing protein. 
J013121F22GGTTGGGCTGTGGGCCGCNONE 
Os07g0516200AK061373GGCCCGTTCAGGCCCGGCCCACGCSimilar to Endoribonuclease, L-PSP family. 
Os07g0546000AF188065GGCCCGGCCCGGCCGGCCCACCNONE 
AK061800GGCCCGGCCCGGCCGGCCCACCNONE 
AK065871GGCCCGGCCCGGCCGGCCCACCSimilar to Isopentenyl pyrophosphate:dimethyllallyl pyrophosphate isomerase (EC 5.3.3.2) (Fragment). 
J013024C02GGCCCGGCCCGGCCGGCCCACCNONE 
J013035F03GGCCCGGCCCGGCCGGCCCACCNONE 
J013044J20GGCCCGGCCCGGCCGGCCCACCNONE 
Os07g0555400AK070977CACGTGGGCCGGAConserved hypothetical protein. 
Os07g0569800AK108637GGTGGGCCGAGConcanavalin A-like lectin/glucanase domain containing protein. 
Os07g0578600AK067155TTCGGCCCGGCCCACTCCSimilar to 5-formyltetrahydrofolate cycloligase (EC 6.3.3.2). 
AK106065TTCGGCCCGGCCCACTCCNONE 
Os07g0589400AK072501CACGGCCCACGCGQuinonprotein alcohol dehydrogenase-like domain containing protein. 
AK072501CACGTGGGCCGGTQuinonprotein alcohol dehydrogenase-like domain containing protein. 
AK104617CACGGCCCACGCGNONE 
AK104617CACGTGGGCCGGTNONE 
AK104756CACGGCCCACGCGNONE 
AK104756CACGTGGGCCGGTNONE 
Os07g0606600AK111621CCCGGCCCACACNONE 
AK112118CCCGGCCCACACSimilar to Nuclear factor Y transcription factor subunit B homolog. 
J080301F22CCCGGCCCACACNONE 
Os07g0606900011-039-F09GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
011-058-E11GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
012-014-C08GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
012-062-H02GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
012-067-G01GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
015-029-A08GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
015-039-H09GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
015-044-A09GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
015-047-G10GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
015-065-C04GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
015-067-C10GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
015-078-H10GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
015-084-A06GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
016-050-F01GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
016-059-E11GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
016-059-F04GGTGGGCCCCACCTGTCGGTGGGCCGTGGHeavy metal transport/detoxification protein domain containing protein. 
016-062-C02GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
J065170E01GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
J075122G11GGTGGGCCCCACCTGTCGGTGGGCCGTGGNONE 
Os07g0622700AK107120AGTGGGCCGCEpoxide hydrolase family protein. 
Os07g0623300AK070292GACGGCCCACASimilar to Splicing factor SC35. 
J023050C05GACGGCCCACANONE 
J090025O12GACGGCCCACANONE 
Os07g0633200AK061338GCGGCCCACACSimilar to SC35-like splicing factor SCL30a, 30a kD. 
AK073451GCGGCCCACACNONE 
J033096E22GCGGCCCACACNONE 
J033125D06GCGGCCCACACNONE 
J075048C23GCGGCCCACACNONE 
J075050G02GCGGCCCACACNONE 
J075104J04GCGGCCCACACNONE 
J075144N04GCGGCCCACACNONE 
Os07g0639900J080305F09CAGGTGGGCCGGGCCCATAANONE 
J080305F09TCGTGGGCCGGGCCGGGCCGGGCCGAANONE 
J080305J22CAGGTGGGCCGGGCCCATAAThymidylate kinase domain containing protein. 
J080305J22TCGTGGGCCGGGCCGGGCCGGGCCGAAThymidylate kinase domain containing protein. 
J080311G07CAGGTGGGCCGGGCCCATAANONE 
J080311G07TCGTGGGCCGGGCCGGGCCGGGCCGAANONE 
J080315B14CAGGTGGGCCGGGCCCATAANONE 
J080315B14TCGTGGGCCGGGCCGGGCCGGGCCGAANONE 
J080317C02CAGGTGGGCCGGGCCCATAANONE 
J080317C02TCGTGGGCCGGGCCGGGCCGGGCCGAANONE 
Os07g0641700009-030-F09AAATGGGCCGTGGAGGTGGGCCGGTNONE 
014-030-D10AAATGGGCCGTGGAGGTGGGCCGGTNONE 
AF009413AAATGGGCCGTGGAGGTGGGCCGGTSimilar to 10 kDa chaperonin (Protein CPN10) (Protein groES). 
AK059154AAATGGGCCGTGGAGGTGGGCCGGTNONE 
AK119728AAATGGGCCGTGGAGGTGGGCCGGTNONE 
AK122129AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J023057A19AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J023143P09AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J033132M21AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J065039D07AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J065062M22AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J065071L10AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J065088N13AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J065115D21AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J065187D07AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J075011B03AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J075011K23AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J075029J17AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J075038J07AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J075065A18AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J075083P05AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J075101G24AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J075127E19AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J075161K23AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J075175D23AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J090044M07AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J090065G16AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J090065J11AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J090097M02AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J090099D02AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J100056A20AAATGGGCCGTGGAGGTGGGCCGGTNONE 
J100063M21AAATGGGCCGTGGAGGTGGGCCGGTNONE 
Os07g0669000AK099431GCGGCCCACTSimilar to Catalytic subunit of polymerase zeta. 
J065073M09GCGGCCCACTNONE 
Os07g0674100AB183706AACGGCCCACGGUDP-glucuronic acid decarboxylase. 
AK099614AACGGCCCACGGNONE 
J013050E02AACGGCCCACGGNONE 
J065162F06AACGGCCCACGGNONE 
J065180F10AACGGCCCACGGNONE 
J090049F09AACGGCCCACGGNONE 
J100064L11AACGGCCCACGGNONE 
Os07g0680300009-195-E06TCGGCCCACTTAGGCCCATATNONE 
AK063800TCGGCCCACTTAGGCCCATATSimilar to Ubiquinol-cytochrome c reductase complex 6.7 kDa protein (EC 1.10.2.2) (CR6). 
J065093F19TCGGCCCACTTAGGCCCATATNONE 
J075066A20TCGGCCCACTTAGGCCCATATNONE 
J075088I17TCGGCCCACTTAGGCCCATATNONE 
J075147M19TCGGCCCACTTAGGCCCATATNONE 
J075153L02TCGGCCCACTTAGGCCCATATNONE 
J080013A21TCGGCCCACTTAGGCCCATATNONE 
J080051B13TCGGCCCACTTAGGCCCATATNONE 
J080077I24TCGGCCCACTTAGGCCCATATNONE 
J080302B14TCGGCCCACTTAGGCCCATATNONE 
J080309D22TCGGCCCACTTAGGCCCATATNONE 
J100083B16TCGGCCCACTTAGGCCCATATNONE 
Os07g0681700AK103213GCGGCCCACGCGlycosyl transferase, family 8 protein. 
Os07g0686500AK119424CCCGTGGGCCGTGGProtein of unknown function DUF630 domain containing protein. 
J065064P13CCCGTGGGCCGTGGNONE 
J065070L21CCCGTGGGCCGTGGNONE 
J065196A06CCCGTGGGCCGTGGNONE 
J065216M14CCCGTGGGCCGTGGNONE 
Os07g0693100AB111050CCGTGGGCCGTANONE 
AK100433CCGTGGGCCGTASimilar to Pyruvate decarboxylase isozyme 3 (EC 4.1.1.1) (PDC). 
J023054O07CCGTGGGCCGTANONE 
J023088C24CCGTGGGCCGTANONE 
J023088I11CCGTGGGCCGTANONE 
Os08g0107500013-094-H02TCCGGCCCACGAACCAGCCCAATTNONE 
013-095-E07TCCGGCCCACGAACCAGCCCAATTNONE 
AK064053TCCGGCCCACGAACCAGCCCAATTShwachman-Bodian-Diamond syndrome proteins family protein. 
AK101418TCCGGCCCACGAACCAGCCCAATTNONE 
J033037P14TCCGGCCCACGAACCAGCCCAATTNONE 
J090025I15TCCGGCCCACGAACCAGCCCAATTNONE 
J100022F23TCCGGCCCACGAACCAGCCCAATTNONE 
Os08g0116500009-007-E05CACGGCCCACCNONE 
009-074-C07CACGGCCCACCNONE 
009-098-A07CACGGCCCACCNONE 
009-100-C03CACGGCCCACCNONE 
009-136-E04CACGGCCCACCNONE 
009-138-B08CACGGCCCACCNONE 
009-144-B06CACGGCCCACCNONE 
009-184-E04CACGGCCCACCNONE 
009-189-F01CACGGCCCACCNONE 
013-006-E05CACGGCCCACCNONE 
013-015-C10CACGGCCCACCNONE 
013-019-F09CACGGCCCACCNONE 
013-020-C01CACGGCCCACCNONE 
013-021-F05CACGGCCCACCNONE 
013-035-D08CACGGCCCACCNONE 
013-038-C09CACGGCCCACCNONE 
013-054-B07CACGGCCCACCNONE 
013-061-G10CACGGCCCACCNONE 
013-074-B01CACGGCCCACCNONE 
013-079-B06CACGGCCCACCNONE 
013-099-B09CACGGCCCACCNONE 
013-099-G11CACGGCCCACCNONE 
014-023-F04CACGGCCCACCNONE 
014-032-C07CACGGCCCACCNONE 
014-045-E02CACGGCCCACCNONE 
014-085-C02CACGGCCCACCNONE 
014-087-F04CACGGCCCACCNONE 
014-089-C04CACGGCCCACCNONE 
014-090-E01CACGGCCCACCNONE 
014-094-G11CACGGCCCACCNONE 
014-097-B07CACGGCCCACCNONE 
015-024-A12CACGGCCCACCNONE 
015-032-C06CACGGCCCACCNONE 
016-053-E09CACGGCCCACCNONE 
016-081-F10CACGGCCCACCNONE 
AK058240CACGGCCCACCSimilar to 60S acidic ribosomal protein P1 (L12). 
J023079C09CACGGCCCACCNONE 
J023107O19CACGGCCCACCNONE 
J053029K21CACGGCCCACCNONE 
J053073P11CACGGCCCACCNONE 
J053074B04CACGGCCCACCNONE 
J053078M14CACGGCCCACCNONE 
J065001E12CACGGCCCACCNONE 
J065006J12CACGGCCCACCNONE 
J065015C06CACGGCCCACCNONE 
J065025D13CACGGCCCACCNONE 
J065029A04CACGGCCCACCNONE 
J065031D23CACGGCCCACCNONE 
J065032E24CACGGCCCACCNONE 
J065034P16CACGGCCCACCNONE 
J065043B04CACGGCCCACCNONE 
J065044A15CACGGCCCACCNONE 
J065062D18CACGGCCCACCNONE 
J065079G13CACGGCCCACCNONE 
J065080A19CACGGCCCACCNONE 
J065080A20CACGGCCCACCNONE 
J065089N19CACGGCCCACCNONE 
J065111O07CACGGCCCACCNONE 
J065115N15CACGGCCCACCNONE 
J065131A04CACGGCCCACCNONE 
J065138H02CACGGCCCACCNONE 
J065139K10CACGGCCCACCNONE 
J065144A02CACGGCCCACCNONE 
J065155J17CACGGCCCACCNONE 
J065159D18CACGGCCCACCNONE 
J065159I18CACGGCCCACCNONE 
J065167H12CACGGCCCACCNONE 
J065174C22CACGGCCCACCNONE 
J065184A05CACGGCCCACCNONE 
J065188M15CACGGCCCACCNONE 
J065191D23CACGGCCCACCNONE 
J065203C07CACGGCCCACCNONE 
J065207C23CACGGCCCACCNONE 
J065207L16CACGGCCCACCNONE 
J065212F01CACGGCCCACCNONE 
J065212F05CACGGCCCACCNONE 
J075037B07CACGGCCCACCNONE 
J075042F15CACGGCCCACCNONE 
J075059J03CACGGCCCACCNONE 
J075068M18CACGGCCCACCNONE 
J075079E13CACGGCCCACCNONE 
J075081F12CACGGCCCACCNONE 
J075083I05CACGGCCCACCNONE 
J075123K23CACGGCCCACCNONE 
J075142F16CACGGCCCACCNONE 
J075156N03CACGGCCCACCNONE 
J075162K05CACGGCCCACCNONE 
J075171E08CACGGCCCACCNONE 
J075177N03CACGGCCCACCNONE 
J075182K17CACGGCCCACCNONE 
J075186K02CACGGCCCACCNONE 
J075191K05CACGGCCCACCNONE 
J080011E10CACGGCCCACCNONE 
J080016M21CACGGCCCACCNONE 
J080017A17CACGGCCCACCNONE 
J080031O09CACGGCCCACCNONE 
J080039G21CACGGCCCACCNONE 
J080041B01CACGGCCCACCNONE 
J080050G20CACGGCCCACCNONE 
J080054A12CACGGCCCACCNONE 
J080058O08CACGGCCCACCNONE 
J080061N04CACGGCCCACCNONE 
J080064L23CACGGCCCACCNONE 
J080064P05CACGGCCCACCNONE 
J080069I17CACGGCCCACCNONE 
J080070E07CACGGCCCACCNONE 
J080071B20CACGGCCCACCNONE 
J080074L08CACGGCCCACCNONE 
J080076N08CACGGCCCACCNONE 
J080081A14CACGGCCCACCNONE 
J080081J17CACGGCCCACCNONE 
J080085N14CACGGCCCACCNONE 
J080090B09CACGGCCCACCNONE 
J080097L11CACGGCCCACCNONE 
J080306H13CACGGCCCACCNONE 
J080307H13CACGGCCCACCNONE 
J080311F12CACGGCCCACCNONE 
J080316L23CACGGCCCACCNONE 
J080318H02CACGGCCCACCNONE 
J090016L15CACGGCCCACCNONE 
J090019I02CACGGCCCACCNONE 
J090031G21CACGGCCCACCNONE 
J090066C15CACGGCCCACCNONE 
J100032I02CACGGCCCACCNONE 
J100032N07CACGGCCCACCNONE 
J100032N16CACGGCCCACCNONE 
J100041P21CACGGCCCACCNONE 
J100048M04CACGGCCCACCNONE 
J100048M14CACGGCCCACCNONE 
J100063B08CACGGCCCACCNONE 
J100088E20CACGGCCCACCNONE 
J100090I08CACGGCCCACCNONE 
Os08g0117400006-086-A09GACGGCCCACCANONE 
006-103-C02GACGGCCCACCANONE 
AK059891GACGGCCCACCASimilar to Calmodulin 1 (Fragment). 
AK103863GACGGCCCACCANONE 
AY224521GACGGCCCACCANONE 
J033149E23GACGGCCCACCANONE 
J065062E05GACGGCCCACCANONE 
J065083O05GACGGCCCACCANONE 
J065116D14GACGGCCCACCANONE 
J065158F16GACGGCCCACCANONE 
J065179N16GACGGCCCACCANONE 
J065206N23GACGGCCCACCANONE 
Os08g0129200014-040-E08AGTGGGCCGAGATNONE 
AK070034AGTGGGCCGAGATNONE 
AK101577AGTGGGCCGAGATSimilar to Cold shock protein-1. 
J065137A09AGTGGGCCGAGATNONE 
J100062K14AGTGGGCCGAGATNONE 
Os08g0133000006-050-B01AAGGCCCATATTGGGCCCACACGGCCCACGNONE 
006-068-G03AAGGCCCATATTGGGCCCACACGGCCCACGNONE 
AK061574AAGGCCCATATTGGGCCCACACGGCCCACGNONE 
AK099391AAGGCCCATATTGGGCCCACACGGCCCACGProtein of unknown function DUF1637 family protein. 
J065108C24AAGGCCCATATTGGGCCCACACGGCCCACGNONE 
J075075K24AAGGCCCATATTGGGCCCACACGGCCCACGNONE 
J075092A19AAGGCCCATATTGGGCCCACACGGCCCACGNONE 
J100061O19AAGGCCCATATTGGGCCCACACGGCCCACGNONE 
Os08g0135900AK072535AGTGGGCCGGCCCATGSimilar to Tryptophan synthase beta chain 1 (EC 4.2.1.20) (Orange pericarp 1) (Fragment). 
Os08g0139100006-027-E12GGCCCGGCCCGGCCCGGCCCACTNONE 
006-089-E06GGCCCGGCCCGGCCCGGCCCACTNONE 
006-113-G02GGCCCGGCCCGGCCCGGCCCACTNONE 
AK061429GGCCCGGCCCGGCCCGGCCCACTNONE 
AK099590GGCCCGGCCCGGCCCGGCCCACTSimilar to DAG protein, chloroplast precursor. 
AK104727GGCCCGGCCCGGCCCGGCCCACTNONE 
J013043H11GGCCCGGCCCGGCCCGGCCCACTNONE 
J013049N13GGCCCGGCCCGGCCCGGCCCACTNONE 
J065079F01GGCCCGGCCCGGCCCGGCCCACTNONE 
J065122N24GGCCCGGCCCGGCCCGGCCCACTNONE 
J065142J24GGCCCGGCCCGGCCCGGCCCACTNONE 
J065193N03GGCCCGGCCCGGCCCGGCCCACTNONE 
J075041I21GGCCCGGCCCGGCCCGGCCCACTNONE 
J075145E04GGCCCGGCCCGGCCCGGCCCACTNONE 
Os08g0150800AK101530AAATGGGCTCGGCCCACASimilar to Tyrosyl-tRNA synthetase (Tyrosyl-tRNA ligase; TyrRS). class-I aaRS. 
Os08g0156900AJ605583TCCGGCCCACCANONE 
AK073344TCCGGCCCACCASpo11/DNA topoisomerase VI, subunit A family protein. 
AK106397TCCGGCCCACCANONE 
Os08g0162500AK121633GACGGCCCACCTGTConserved hypothetical protein. 
J033105E19GACGGCCCACCTGTNONE 
J080012K11GACGGCCCACCTGTNONE 
J080041I12GACGGCCCACCTGTNONE 
J080049G05GACGGCCCACCTGTNONE 
J080050P09GACGGCCCACCTGTNONE 
J080051A10GACGGCCCACCTGTNONE 
J080054G05GACGGCCCACCTGTNONE 
J080058M08GACGGCCCACCTGTNONE 
J080064N23GACGGCCCACCTGTNONE 
J080072L15GACGGCCCACCTGTNONE 
J080096H09GACGGCCCACCTGTNONE 
J100079I08GACGGCCCACCTGTNONE 
Os08g0195400006-057-E04GCGGCCCACANONE 
006-060-B10GCGGCCCACANONE 
AK070464GCGGCCCACAConserved hypothetical protein. 
AK104389GCGGCCCACANONE 
AK106140GCGGCCCACANONE 
J023013G08GCGGCCCACANONE 
J023054K19GCGGCCCACANONE 
J023089D18GCGGCCCACANONE 
J023092K05GCGGCCCACANONE 
J033025A08GCGGCCCACANONE 
J033067P12GCGGCCCACANONE 
J033098A10GCGGCCCACANONE 
J065219L04GCGGCCCACANONE 
J090021P06GCGGCCCACANONE 
J090062M05GCGGCCCACANONE 
J090079F15GCGGCCCACANONE 
J100041H19GCGGCCCACANONE 
Os08g0224200AK101331GCGGCCCACASimilar to Ythdf2-prov protein. 
Os08g0230000014-096-F01CCGTGGGCCGGGCCGTCGGGCCGTANONE 
AK067127CCGTGGGCCGGGCCGTCGGGCCGTAConserved hypothetical protein. 
J013096C05CCGTGGGCCGGGCCGTCGGGCCGTANONE 
J100032D12CCGTGGGCCGGGCCGTCGGGCCGTANONE 
Os08g0387050J043038F21GAAGCCCAGCCGAGCCGGCCCACAGCCCAGCCConserved hypothetical protein. 
Os08g0389733J065044M19GTGTGGGCCGGCCGTCGGATNONE 
J065104D10GTGTGGGCCGGCCGTCGGATNONE 
J065110F18GTGTGGGCCGGCCGTCGGATNONE 
Os08g0411200AK120890AGGTGGGCCGAASAM (and some other nucleotide) binding motif domain containing protein. 
Os08g0414200AK102789TGCGGCCCACCAGCCCACCACBRCT domain containing protein. 
J033048B10TGCGGCCCACCAGCCCACCACNONE 
J033071G24TGCGGCCCACCAGCCCACCACNONE 
J033107O17TGCGGCCCACCAGCCCACCACNONE 
Os08g0427900AK103217ACCGGCCCACASimilar to Hin19 (Fragment). 
AK109208ACCGGCCCACANONE 
J080005C08ACCGGCCCACANONE 
J080010B10ACCGGCCCACANONE 
J080013C21ACCGGCCCACANONE 
J080022L12ACCGGCCCACANONE 
J080029C08ACCGGCCCACANONE 
J080029G09ACCGGCCCACANONE 
J080035L14ACCGGCCCACANONE 
J080040M20ACCGGCCCACANONE 
J080043M18ACCGGCCCACANONE 
J080045K15ACCGGCCCACANONE 
J080048I17ACCGGCCCACANONE 
J080051P16ACCGGCCCACANONE 
J080053L16ACCGGCCCACANONE 
J080059P14ACCGGCCCACANONE 
J080063E13ACCGGCCCACANONE 
J080075N18ACCGGCCCACANONE 
J080077E05ACCGGCCCACANONE 
J080080H23ACCGGCCCACANONE 
J080081L16ACCGGCCCACANONE 
J080083F17ACCGGCCCACANONE 
J080085C23ACCGGCCCACANONE 
J080086A12ACCGGCCCACANONE 
J080088N06ACCGGCCCACANONE 
J080092G10ACCGGCCCACANONE 
J080093F04ACCGGCCCACANONE 
J080094C03ACCGGCCCACANONE 
J090032L12ACCGGCCCACANONE 
Os08g0461300AK065651TTCGGCCCACGGGCyclin-like F-box domain containing protein. 
Os08g0463900AK120178TTCGTGGGCCGTTTConserved hypothetical protein. 
J013033H06TTCGTGGGCCGTTTNONE 
J075006G17TTCGTGGGCCGTTTNONE 
Os08g0465300AK108076CACGGCCCACAConserved hypothetical protein. 
Os08g0485700AK068131TCGGCCCACGTNONE 
AK069097TCGGCCCACGTMethyl-CpG binding domain containing protein. 
J013130L03TCGGCCCACGTNONE 
Os08g0490300011-064-F08AGATGGGCCGGCCCACGAANONE 
015-050-C06AGATGGGCCGGCCCACGAANONE 
AK066895AGATGGGCCGGCCCACGAARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J013090I22AGATGGGCCGGCCCACGAANONE 
J090060F02AGATGGGCCGGCCCACGAANONE 
Os08g0493900AK101284CCCGGCCCACCACNONE 
AK101284CCCGGCCCACCCACGGGNONE 
AK111820CCCGGCCCACCACWD40-like domain containing protein. 
AK111820CCCGGCCCACCCACGGGWD40-like domain containing protein. 
Os08g0504400014-015-C10CGGGTGGGCCGAGNONE 
AK069190CGGGTGGGCCGAGSimilar to Uncharacterized enzyme involved in pigment biosynthesis. 
AK072089CGGGTGGGCCGAGNONE 
J023006O19CGGGTGGGCCGAGNONE 
J033041C11CGGGTGGGCCGAGNONE 
Os08g0511000AK107578TGGTGGGCCGTAProtein prenyltransferase domain containing protein. 
Os08g0517600009-066-H05GCGGCCCACCTNONE 
AK073374GCGGCCCACCTNONE 
AK105385GCGGCCCACCTSAM (and some other nucleotide) binding motif domain containing protein. 
J065165P07GCGGCCCACCTNONE 
J075004A12GCGGCCCACCTNONE 
J075062F16GCGGCCCACCTNONE 
J075115K05GCGGCCCACCTNONE 
J075116H09GCGGCCCACCTNONE 
Os08g0517900015-019-D06AAAAGCCCATTACGGCCCACACNONE 
AK064304AAAAGCCCATTACGGCCCACACSimilar to 30S ribosomal protein S16. 
Os08g0544500AK071354CTCGGCCCACTSimilar to ARP2/3 regulatory protein subunit NAPP. 
Os08g0553450Os08g0553450TCCGGCCCACAHypothetical protein. 
Os08g0553800006-058-A04TATTGGGCCGTGTGGGCCGGCGCGTGCGNONE 
006-061-F09TATTGGGCCGTGTGGGCCGGCGCGTGCGNONE 
AK065711TATTGGGCCGTGTGGGCCGGCGCGTGCGNONE 
AK066697TATTGGGCCGTGTGGGCCGGCGCGTGCGNmrA-like family protein. 
AK073638TATTGGGCCGTGTGGGCCGGCGCGTGCGNONE 
AK104428TATTGGGCCGTGTGGGCCGGCGCGTGCGNONE 
AK105897TATTGGGCCGTGTGGGCCGGCGCGTGCGNONE 
J075001A06TATTGGGCCGTGTGGGCCGGCGCGTGCGNONE 
J075041H20TATTGGGCCGTGTGGGCCGGCGCGTGCGNONE 
J075123J24TATTGGGCCGTGTGGGCCGGCGCGTGCGNONE 
Os08g0557000AK059917TCGGCCCACAANONE 
AK100496TCGGCCCACAASimilar to Protein-L-isoaspartate O-methyltransferase. 
Os09g0319800AK066759AGTGGGCCGATerpenoid cylases/protein prenyltransferase alpha-alpha toroid domain containing protein. 
Os09g0321300AK122141AGAGTGGGCCGGGNONE 
Os09g0332700AK067899CACGGCCCACGTSimilar to PDR-type ABC transporter 2 (Fragment). 
Os09g0348800AK063411CCACGGCCCACCTGTGGGCCCAAACConserved hypothetical protein. 
Os09g0375700AK068295CGCGTGGGCCGGCCCAGCHypothetical protein. 
Os09g0416400J075067A16GTCAGTGGGCCGGAConserved hypothetical protein. 
J075104N21GTCAGTGGGCCGGANONE 
J075106F04GTCAGTGGGCCGGANONE 
J075131F08GTCAGTGGGCCGGANONE 
Os09g0453900AK107054CCCGGCCCACCCGNONE 
Os09g0482860006-045-G12GCGTGGGCCGCCCAACTNONE 
AK071910GCGTGGGCCGCCCAACTNONE 
AK099026GCGTGGGCCGCCCAACTNONE 
AK105917GCGTGGGCCGCCCAACTUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
J013127L05GCGTGGGCCGCCCAACTNONE 
J065102M20GCGTGGGCCGCCCAACTNONE 
J065119M08GCGTGGGCCGCCCAACTNONE 
Os09g0498100015-046-G11AGTGGGCCGGANONE 
AK064108AGTGGGCCGGASimilar to 30S ribosomal protein S16. 
J065040H21AGTGGGCCGGANONE 
J065062F05AGTGGGCCGGANONE 
J065147B17AGTGGGCCGGANONE 
J075098J22AGTGGGCCGGANONE 
Os09g0511700AK101420TAGGCCCACGGCCCACCCSimilar to Prunasin hydrolase isoform PH C precursor (EC 3.2.1.118). 
J013022L19TAGGCCCACGGCCCACCCNONE 
J013036D23TAGGCCCACGGCCCACCCNONE 
J013037F22TAGGCCCACGGCCCACCCNONE 
J013111M23TAGGCCCACGGCCCACCCNONE 
J023109F14TAGGCCCACGGCCCACCCNONE 
J023119H17TAGGCCCACGGCCCACCCNONE 
J023133H23TAGGCCCACGGCCCACCCNONE 
J033032G17TAGGCCCACGGCCCACCCNONE 
J033038B10TAGGCCCACGGCCCACCCNONE 
J033071M16TAGGCCCACGGCCCACCCNONE 
J033096G04TAGGCCCACGGCCCACCCNONE 
J033109D06TAGGCCCACGGCCCACCCNONE 
J043016E22TAGGCCCACGGCCCACCCNONE 
J043022O09TAGGCCCACGGCCCACCCNONE 
J100023N11TAGGCCCACGGCCCACCCNONE 
J100046I21TAGGCCCACGGCCCACCCNONE 
Os09g0516800009-017-A01TCCGGCCCACCCConserved hypothetical protein. 
Os09g0532700AK069946GCCCCACCGGCCCACGGAlpha/beta hydrolase family protein. 
Os09g0535000AK058712CCGTGGGCCGASimilar to Triosephosphate isomerase, chloroplast precursor (EC 5.3.1.1) (TIM) (Triose-phosphate isomerase). 
AK069488CCGTGGGCCGANONE 
AK069832CCGTGGGCCGANONE 
J100065D20CCGTGGGCCGANONE 
Os09g0538700Os09g0538700GCGGCCCACGCCCAATAGlutelin family protein. 
Os09g0559900AK111842TAATGGGCCGTGTTGGGCCGGCCCACTGACAGProtein kinase-like domain containing protein. 
Os09g0573200J013027J02AGTGGGCCGTGGNONE 
J013034M08AGTGGGCCGTGGNONE 
J013037L03AGTGGGCCGTGGNONE 
J013041D10AGTGGGCCGTGGNONE 
J013042D15AGTGGGCCGTGGNONE 
J013109H17AGTGGGCCGTGGNONE 
J013132A18AGTGGGCCGTGGNONE 
J013160N13AGTGGGCCGTGGNONE 
J013169I09AGTGGGCCGTGGNONE 
J023029F18AGTGGGCCGTGGNONE 
J023041A02AGTGGGCCGTGGNONE 
J023097B14AGTGGGCCGTGGNONE 
J023142I04AGTGGGCCGTGGNONE 
J023142N06AGTGGGCCGTGGNONE 
J033023I21AGTGGGCCGTGGNONE 
J033032G15AGTGGGCCGTGGNONE 
J033042M17AGTGGGCCGTGGNONE 
J033070F09AGTGGGCCGTGGNONE 
J053063L09AGTGGGCCGTGGNONE 
J053064A09AGTGGGCCGTGGNONE 
J065073M19AGTGGGCCGTGGNONE 
J075005H11AGTGGGCCGTGGNONE 
J075026D12AGTGGGCCGTGGNONE 
J075043G07AGTGGGCCGTGGNONE 
J075084N05AGTGGGCCGTGGNONE 
J075092D05AGTGGGCCGTGGNONE 
J075110E24AGTGGGCCGTGGNONE 
J075176I05AGTGGGCCGTGGNONE 
J090009H19AGTGGGCCGTGGNONE 
J090025K11AGTGGGCCGTGGNONE 
J090049E20AGTGGGCCGTGGNONE 
J090070G02AGTGGGCCGTGGNONE 
Os11g0114700AK065865AGTGGGCCGTGGNONE 
AK066583AGTGGGCCGTGGNONE 
AK070834AGTGGGCCGTGGPAP/25A core domain containing protein. 
AK072543AGTGGGCCGTGGNONE 
Os11g0119200016-068-E03TGGTGGGCCGTANONE 
AK103124TGGTGGGCCGTAZinc finger, RING-type domain containing protein. 
J033119L05TGGTGGGCCGTANONE 
J065036I18TGGTGGGCCGTANONE 
J065160A20TGGTGGGCCGTANONE 
J065183G16TGGTGGGCCGTANONE 
J065205L01TGGTGGGCCGTANONE 
J065211I07TGGTGGGCCGTANONE 
J065219B08TGGTGGGCCGTANONE 
Os11g0127700AK103742CTGGGCTTGGGCCGGCCCACTHypothetical protein. 
J090083M11CTGGGCTTGGGCCGGCCCACTNONE 
Os11g0139100009-099-H06TCTCGGCCCACTNONE 
AK121443TCTCGGCCCACTSimilar to 50S ribosomal protein L24. 
J023140O18TCTCGGCCCACTNONE 
J023143M23TCTCGGCCCACTNONE 
J033079G04TCTCGGCCCACTNONE 
J043004D20TCTCGGCCCACTNONE 
J065097F05TCTCGGCCCACTNONE 
Os11g0199600AK101774TCATGGGCCCATCACCGGCCCACAZinc finger, CCHC-type domain containing protein. 
AK101774TCGGCCCATTAACGGCCCACGTZinc finger, CCHC-type domain containing protein. 
AK120040TCATGGGCCCATCACCGGCCCACANONE 
AK120040TCGGCCCATTAACGGCCCACGTNONE 
J023047I06TCATGGGCCCATCACCGGCCCACANONE 
J023047I06TCGGCCCATTAACGGCCCACGTNONE 
J033064L23TCATGGGCCCATCACCGGCCCACANONE 
J033064L23TCGGCCCATTAACGGCCCACGTNONE 
J033117I01TCATGGGCCCATCACCGGCCCACANONE 
J033117I01TCGGCCCATTAACGGCCCACGTNONE 
J033123I18TCATGGGCCCATCACCGGCCCACANONE 
J033123I18TCGGCCCATTAACGGCCCACGTNONE 
J053026H17TCATGGGCCCATCACCGGCCCACANONE 
J053026H17TCGGCCCATTAACGGCCCACGTNONE 
J053078G05TCATGGGCCCATCACCGGCCCACANONE 
J053078G05TCGGCCCATTAACGGCCCACGTNONE 
J065102A09TCATGGGCCCATCACCGGCCCACANONE 
J065102A09TCGGCCCATTAACGGCCCACGTNONE 
J065113G11TCATGGGCCCATCACCGGCCCACANONE 
J065113G11TCGGCCCATTAACGGCCCACGTNONE 
J065207F20TCATGGGCCCATCACCGGCCCACANONE 
J065207F20TCGGCCCATTAACGGCCCACGTNONE 
J075027K21TCATGGGCCCATCACCGGCCCACANONE 
J075027K21TCGGCCCATTAACGGCCCACGTNONE 
Os11g0227600AK101375TAATGGGCTTAGCGTGGGCCGGAConserved hypothetical protein. 
AK101375TTGTGGGCCGCAConserved hypothetical protein. 
AK102193TAATGGGCTTAGCGTGGGCCGGANONE 
AK102193TTGTGGGCCGCANONE 
J033087C03TAATGGGCTTAGCGTGGGCCGGANONE 
J033087C03TTGTGGGCCGCANONE 
Os11g0414000012-012-F01TCGGCCCACANONE 
AK071277TCGGCCCACAeIF4-gamma/eIF5/eIF2-epsilon domain containing protein. 
J023082M08TCGGCCCACANONE 
J023083E17TCGGCCCACANONE 
J023128I07TCGGCCCACANONE 
J033098J04TCGGCCCACANONE 
J033135G10TCGGCCCACANONE 
J043007L23TCGGCCCACANONE 
J065011N07TCGGCCCACANONE 
J065016E01TCGGCCCACANONE 
J065162N12TCGGCCCACANONE 
J065164O22TCGGCCCACANONE 
J065173J06TCGGCCCACANONE 
J065200E24TCGGCCCACANONE 
J065203K20TCGGCCCACANONE 
J075033N16TCGGCCCACANONE 
J075047L06TCGGCCCACANONE 
J075064J24TCGGCCCACANONE 
J075100O07TCGGCCCACANONE 
J075121G11TCGGCCCACANONE 
J075134A13TCGGCCCACANONE 
J075190F20TCGGCCCACANONE 
J075190H08TCGGCCCACANONE 
J080033L04TCGGCCCACANONE 
J080045O09TCGGCCCACANONE 
J080064J07TCGGCCCACANONE 
J080066N22TCGGCCCACANONE 
J080075C09TCGGCCCACANONE 
J090002C08TCGGCCCACANONE 
J090058G21TCGGCCCACANONE 
J090074M07TCGGCCCACANONE 
J100090G06TCGGCCCACANONE 
Os11g0448400AB095094GCCGGCCCAAACGGCCCACGAASimilar to Sigma factor SIG2A. 
J075053H03GCCGGCCCAAACGGCCCACGAANONE 
J075062F23GCCGGCCCAAACGGCCCACGAANONE 
J090029D08GCCGGCCCAAACGGCCCACGAANONE 
Os11g0545800AK073687CCACGGCCCACCAAGCCCATCCARegulator of chromosome condensation/beta-lactamase-inhibitor protein II domain containing protein. 
J090050C14CCACGGCCCACCAAGCCCATCCANONE 
Os11g0549690J065085G07AGTGGGCCGGGCCCAACTConserved hypothetical protein. 
J065218B08AGTGGGCCGGGCCCAACTNONE 
J090036H16AGTGGGCCGGGCCCAACTNONE 
Os11g0586300AK072257TCGGCCCGGCCCACGTConserved hypothetical protein. 
Os11g0606300J075039E08CTGGCCCAACGGCCCACGANONE 
J075044E18CTGGCCCAACGGCCCACGANONE 
J075053G16CTGGCCCAACGGCCCACGAConserved hypothetical protein. 
Os11g0620400AK068224ATCGGACGGCCCACGTNONE 
AK120270ATCGGACGGCCCACGTConserved hypothetical protein. 
Os11g0703900011-004-D05GACGGCCCACTTGNONE 
011-014-C03GACGGCCCACTTGNONE 
011-016-C01GACGGCCCACTTGNONE 
011-017-B04GACGGCCCACTTGNONE 
011-017-E09GACGGCCCACTTGNONE 
011-019-E12GACGGCCCACTTGNONE 
011-021-H12GACGGCCCACTTGNONE 
011-025-H02GACGGCCCACTTGNONE 
011-027-B09GACGGCCCACTTGNONE 
011-039-G07GACGGCCCACTTGNONE 
011-044-G07GACGGCCCACTTGNONE 
011-046-F11GACGGCCCACTTGNONE 
011-070-F02GACGGCCCACTTGNONE 
011-071-A07GACGGCCCACTTGNONE 
011-082-A03GACGGCCCACTTGNONE 
011-086-B09GACGGCCCACTTGNONE 
011-092-C04GACGGCCCACTTGNONE 
012-006-F02GACGGCCCACTTGNONE 
012-011-G08GACGGCCCACTTGNONE 
012-026-C06GACGGCCCACTTGNONE 
012-026-G06GACGGCCCACTTGNONE 
012-028-E05GACGGCCCACTTGNONE 
012-040-A05GACGGCCCACTTGNONE 
012-045-C01GACGGCCCACTTGNONE 
012-046-A10GACGGCCCACTTGNONE 
012-047-H09GACGGCCCACTTGNONE 
012-059-A12GACGGCCCACTTGNONE 
012-072-D06GACGGCCCACTTGNONE 
012-073-D05GACGGCCCACTTGNONE 
012-076-D08GACGGCCCACTTGNONE 
012-079-G05GACGGCCCACTTGNONE 
012-080-A04GACGGCCCACTTGNONE 
012-080-E01GACGGCCCACTTGNONE 
012-083-C03GACGGCCCACTTGNONE 
012-083-G06GACGGCCCACTTGNONE 
012-086-G02GACGGCCCACTTGNONE 
012-091-A07GACGGCCCACTTGNONE 
012-094-G10GACGGCCCACTTGNONE 
012-098-A07GACGGCCCACTTGNONE 
012-100-G04GACGGCCCACTTGNONE 
015-001-A11GACGGCCCACTTGNONE 
015-033-E01GACGGCCCACTTGNONE 
015-047-F12GACGGCCCACTTGNONE 
015-054-E05GACGGCCCACTTGNONE 
015-063-H02GACGGCCCACTTGNONE 
015-075-E10GACGGCCCACTTGNONE 
015-086-F05GACGGCCCACTTGNONE 
016-031-A08GACGGCCCACTTGNONE 
016-053-A03GACGGCCCACTTGNONE 
016-054-C09GACGGCCCACTTGNONE 
016-079-C08GACGGCCCACTTGNONE 
AK065431GACGGCCCACTTGHeat shock protein 70. 
AK119255GACGGCCCACTTGNONE 
J013021C12GACGGCCCACTTGNONE 
J013021C17GACGGCCCACTTGNONE 
J023027B08GACGGCCCACTTGNONE 
J023078A21GACGGCCCACTTGNONE 
J023097M06GACGGCCCACTTGNONE 
J023100O04GACGGCCCACTTGNONE 
J023107B17GACGGCCCACTTGNONE 
J023108L24GACGGCCCACTTGNONE 
J023109L05GACGGCCCACTTGNONE 
J033022M22GACGGCCCACTTGNONE 
J033023K21GACGGCCCACTTGNONE 
J033031L11GACGGCCCACTTGNONE 
J033034H10GACGGCCCACTTGNONE 
J033037B16GACGGCCCACTTGNONE 
J033037F16GACGGCCCACTTGNONE 
J033037H07GACGGCCCACTTGNONE 
J033046E22GACGGCCCACTTGNONE 
J033050N12GACGGCCCACTTGNONE 
J033064F10GACGGCCCACTTGNONE 
J033064N10GACGGCCCACTTGNONE 
J033066O09GACGGCCCACTTGNONE 
J033068H01GACGGCCCACTTGNONE 
J033068J07GACGGCCCACTTGNONE 
J033070B10GACGGCCCACTTGNONE 
J033070G13GACGGCCCACTTGNONE 
J033073O13GACGGCCCACTTGNONE 
J033075B07GACGGCCCACTTGNONE 
J033079L15GACGGCCCACTTGNONE 
J033081J06GACGGCCCACTTGNONE 
J033086G13GACGGCCCACTTGNONE 
J033086N07GACGGCCCACTTGNONE 
J033086O05GACGGCCCACTTGNONE 
J033091A15GACGGCCCACTTGNONE 
J033091D05GACGGCCCACTTGNONE 
J033094C12GACGGCCCACTTGNONE 
J033099P03GACGGCCCACTTGNONE 
J033107L09GACGGCCCACTTGNONE 
J033108D16GACGGCCCACTTGNONE 
J033109E12GACGGCCCACTTGNONE 
J033109K14GACGGCCCACTTGNONE 
J033112P22GACGGCCCACTTGNONE 
J033116F12GACGGCCCACTTGNONE 
J033116K01GACGGCCCACTTGNONE 
J033118F19GACGGCCCACTTGNONE 
J033121J10GACGGCCCACTTGNONE 
J033126H04GACGGCCCACTTGNONE 
J033131G17GACGGCCCACTTGNONE 
J033131L05GACGGCCCACTTGNONE 
J033136A08GACGGCCCACTTGNONE 
J033136H22GACGGCCCACTTGNONE 
J033143F01GACGGCCCACTTGNONE 
J065040M10GACGGCCCACTTGNONE 
J065046F17GACGGCCCACTTGNONE 
J065048G20GACGGCCCACTTGNONE 
J065071N06GACGGCCCACTTGNONE 
J065084I24GACGGCCCACTTGNONE 
J065171B01GACGGCCCACTTGNONE 
J065191J21GACGGCCCACTTGNONE 
J065199I20GACGGCCCACTTGNONE 
J075076C02GACGGCCCACTTGNONE 
J090002P12GACGGCCCACTTGNONE 
J090003A11GACGGCCCACTTGNONE 
J090003H11GACGGCCCACTTGNONE 
J090009M22GACGGCCCACTTGNONE 
J090009O11GACGGCCCACTTGNONE 
J090014N09GACGGCCCACTTGNONE 
J090015A18GACGGCCCACTTGNONE 
J090016E16GACGGCCCACTTGNONE 
J090016I07GACGGCCCACTTGNONE 
J090017O07GACGGCCCACTTGNONE 
J090019E10GACGGCCCACTTGNONE 
J090020D24GACGGCCCACTTGNONE 
J090021M16GACGGCCCACTTGNONE 
J090022F13GACGGCCCACTTGNONE 
J090023H03GACGGCCCACTTGNONE 
J090024E15GACGGCCCACTTGNONE 
J090024G19GACGGCCCACTTGNONE 
J090026J19GACGGCCCACTTGNONE 
J090030E20GACGGCCCACTTGNONE 
J090030I15GACGGCCCACTTGNONE 
J090032F04GACGGCCCACTTGNONE 
J090033N22GACGGCCCACTTGNONE 
J090033O19GACGGCCCACTTGNONE 
J090036F08GACGGCCCACTTGNONE 
J090039A13GACGGCCCACTTGNONE 
J090042N07GACGGCCCACTTGNONE 
J090043C15GACGGCCCACTTGNONE 
J090043N09GACGGCCCACTTGNONE 
J090053J10GACGGCCCACTTGNONE 
J090054F14GACGGCCCACTTGNONE 
J090057N12GACGGCCCACTTGNONE 
J090061P13GACGGCCCACTTGNONE 
J090062F17GACGGCCCACTTGNONE 
J090065H15GACGGCCCACTTGNONE 
J090067P11GACGGCCCACTTGNONE 
J090068M09GACGGCCCACTTGNONE 
J090069E24GACGGCCCACTTGNONE 
J090069K16GACGGCCCACTTGNONE 
J090070N07GACGGCCCACTTGNONE 
J090072M09GACGGCCCACTTGNONE 
J090075I24GACGGCCCACTTGNONE 
J090075M04GACGGCCCACTTGNONE 
J090077D24GACGGCCCACTTGNONE 
J090080M17GACGGCCCACTTGNONE 
J090080O14GACGGCCCACTTGNONE 
J090081C12GACGGCCCACTTGNONE 
J090084N21GACGGCCCACTTGNONE 
J090084O21GACGGCCCACTTGNONE 
J090087J18GACGGCCCACTTGNONE 
J090092L17GACGGCCCACTTGNONE 
J090097A08GACGGCCCACTTGNONE 
J100017E24GACGGCCCACTTGNONE 
J100018K11GACGGCCCACTTGNONE 
J100019A16GACGGCCCACTTGNONE 
J100023I23GACGGCCCACTTGNONE 
J100024D07GACGGCCCACTTGNONE 
J100025H12GACGGCCCACTTGNONE 
J100027K19GACGGCCCACTTGNONE 
J100028C23GACGGCCCACTTGNONE 
J100029A14GACGGCCCACTTGNONE 
J100029O19GACGGCCCACTTGNONE 
J100030I09GACGGCCCACTTGNONE 
J100030J16GACGGCCCACTTGNONE 
J100031C01GACGGCCCACTTGNONE 
J100031N06GACGGCCCACTTGNONE 
J100033H04GACGGCCCACTTGNONE 
J100034L20GACGGCCCACTTGNONE 
J100036K13GACGGCCCACTTGNONE 
J100039M02GACGGCCCACTTGNONE 
J100040J01GACGGCCCACTTGNONE 
J100042O21GACGGCCCACTTGNONE 
J100042P20GACGGCCCACTTGNONE 
J100047K22GACGGCCCACTTGNONE 
J100049B16GACGGCCCACTTGNONE 
J100052M10GACGGCCCACTTGNONE 
J100053B05GACGGCCCACTTGNONE 
J100053B20GACGGCCCACTTGNONE 
J100055I11GACGGCCCACTTGNONE 
J100056A13GACGGCCCACTTGNONE 
J100057C08GACGGCCCACTTGNONE 
J100057N11GACGGCCCACTTGNONE 
J100057P07GACGGCCCACTTGNONE 
J100059E16GACGGCCCACTTGNONE 
J100063N14GACGGCCCACTTGNONE 
J100069H01GACGGCCCACTTGNONE 
J100071C17GACGGCCCACTTGNONE 
J100071K09GACGGCCCACTTGNONE 
J100077D07GACGGCCCACTTGNONE 
J100078P22GACGGCCCACTTGNONE 
J100080F11GACGGCCCACTTGNONE 
J100081L07GACGGCCCACTTGNONE 
J100083B10GACGGCCCACTTGNONE 
J100083K17GACGGCCCACTTGNONE 
J100085B22GACGGCCCACTTGNONE 
J100085L21GACGGCCCACTTGNONE 
J100086B11GACGGCCCACTTGNONE 
J100087E06GACGGCCCACTTGNONE 
J100087P07GACGGCCCACTTGNONE 
J100089H24GACGGCCCACTTGNONE 
Os12g0111600009-151-A07GCGGCCCACAANONE 
AK119685GCGGCCCACAANONE 
AK120264GCGGCCCACAAHypoxia induced protein conserved region family protein. 
J013047D01GCGGCCCACAANONE 
J023111D22GCGGCCCACAANONE 
J023128C07GCGGCCCACAANONE 
J065170J03GCGGCCCACAANONE 
J065198L01GCGGCCCACAANONE 
J100037I18GCGGCCCACAANONE 
J100073O19GCGGCCCACAANONE 
Os12g0112250J013069O10AGTGGGCCGGCSaposin B domain containing protein. 
J065206G04AGTGGGCCGGCNONE 
J080302C06AGTGGGCCGGCNONE 
J080306K06AGTGGGCCGGCNONE 
J080307O09AGTGGGCCGGCNONE 
J080310J07AGTGGGCCGGCNONE 
J080311G18AGTGGGCCGGCNONE 
J080318C07AGTGGGCCGGCNONE 
Os12g0123900016-031-A06CTTGGGCCGGCCCACTNONE 
AK061862CTTGGGCCGGCCCACTHypothetical protein. 
J013031P10CTTGGGCCGGCCCACTNONE 
J053034P22CTTGGGCCGGCCCACTNONE 
J053046O16CTTGGGCCGGCCCACTNONE 
J053048D20CTTGGGCCGGCCCACTNONE 
J090031I07CTTGGGCCGGCCCACTNONE 
J100025B02CTTGGGCCGGCCCACTNONE 
Os12g0145700AK071391CGGCTCGGCCCACCACPyruvate kinase family protein. 
J023013N02CGGCTCGGCCCACCACNONE 
J033085D15CGGCTCGGCCCACCACNONE 
J043021I09CGGCTCGGCCCACCACNONE 
J100055L05CGGCTCGGCCCACCACNONE 
Os12g0189300