
Summary of OsREG564 (All List)

OrganismOryza sativa  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count3451  

Entry Sequences (3451 entries)

LocusGene modelSequenceDescription
Os01g0132800AK068422TGCGGCCCACGTPeptidyl-tRNA hydrolase family protein. 
Os01g0164500AK068747GCGGCCCACCASimilar to ATP-dependent RNA helicase-like protein. 
AK061054GGTGGGCCGGCAllinase, C-terminal domain containing protein. 
AK058815TCCGGCCCACGASimilar to Acidic ribosomal protein P2a-4 (Fragment). 
Os01g0192550J065164G16GACGGCCCACGGConserved hypothetical protein. 
AK070838ACGTGGGCCGAAATetratricopeptide-like helical domain containing protein. 
Os01g0229200AK066024TTTCGGCCCACGTVHS domain containing protein. 
Os01g0239100Os01g0239100CACGGCCCACGCHeat shock protein DnaJ family protein. 
Os01g0246100AK120732CAAGTGGGCCGGCProtein of unknown function DUF902, CREBbp domain containing protein. 
J075061L04GACGGCCCAGGCCCACGGCCCACAConserved hypothetical protein. 
AK067610GTGTGGGCCGTASimilar to Rab proteins geranylgeranyltransferase component A 2 (Rab escort protein 2) (REP-2) (Choroideraemia-like protein). 
AK119511TGTGGGCCGCASimilar to Cysteine protease inhibitor. 
AK061002ACGTGGGCCGTASimilar to Histidine biosynthesis bifunctional protein hisIE, chloroplast precursor [Includes: Phosphoribosyl-AMP cyclohydrolase (EC (PRA-CH); Phosphoribosyl-ATP pyrophosphatase (EC (PRA-PH)]. 
AK103465CCCGGCCCACACSimilar to Pyruvate kinase, cytosolic isozyme (EC (PK). 
Os01g0286000AK109824AACGGGCCGTAAGTGGGCCGAGSnf7 family protein. 
J075157P20ACCGGCCCACGCMitochondrial import inner membrane translocase, subunit Tim17/22 family protein. 
Os01g0346400J100032G11GTGGTGGGCCGAAAConserved hypothetical protein. 
Os01g0346700AK071793CACGGCCCACGCConserved hypothetical protein. 
AK120842CAAGGCCCAATCGGCCCACAASimilar to 60S ribosomal protein L23a (L25). 
AK072081GTGGTGGGCCGGTTTGGGCTTTTTetratricopeptide-like helical domain containing protein. 
AK061826AAAAGCCCAAACCGGCCCACCACSimilar to 40S ribosomal protein S4. 
Os01g0508000AK069177TCCGGCCCACGCSimilar to Beta-glucosidase. 
AK063740CGGGTGGGCCGGGConserved hypothetical protein. 
Os01g0593700Os01g0593700GCGGCCCACCSulphate anion transporter family protein. 
AK069151TTTCGGCCCACACCyclin-like F-box domain containing protein. 
Os01g0606900AK065697ACCGGCCCACGGHeat shock protein DnaJ, N-terminal domain containing protein. 
Os01g0612800AK071035TGTGGGCCGAAConserved hypothetical protein. 
AK119181ACCGGCCCACAAProtein of unknown function UPF0052 and CofD family protein. 
AK067476GAGGCCCACTACGGCCCACCTSimilar to RNA helicase (Fragment). 
Os01g0679000AK058515CCGTGGGCCGTGRNA polymerase III subunit RPC82, C -terminal domain containing protein. 
Os01g0684800AK073525TCGGCCCACAProtein prenyltransferase domain containing protein. 
Os01g0705300AK102719AGATGGGCCGTGGGCCGTGConserved hypothetical protein. 
Os01g0705500AK063120CACGGCCCACGGCCCATCTConserved hypothetical protein. 
AK106541AGAGTGGGCCGGTStarch synthase IVa (Glycogen (Starch) synthase-like). 
Os01g0725900AK108128TCGGCCCACCTPollen Ole e 1 allergen and extensin domain containing protein. 
Os01g0730300AK101207GTCAGTGGGCCGTCCHAD-superfamily hydrolase subfamily IIB protein. 
AK059818GACGGCCCACCCACCAACSimilar to Glutathione S-transferase I (EC (GST-I) (GST-29) (GST class- phi). 
AK061585GTGCGGTGGGCCGGTCyclin-like F-box domain containing protein. 
Os01g0800800AK108093ACCGGCCCACAConserved hypothetical protein. 
AK103541TGGTGGGCCGCProteasome subunit alpha type 3 (EC (20S proteasome alpha subunit G) (20S proteasome subunit alpha-7). 
AK099776GGGCCCGGCCCACCCGSimilar to Hs1pro-1 protein. 
AK099677GGTGGGCCGTCBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
Os01g0867900AK061366CGGCCCACCCGProtein of unknown function DUF502 family protein. 
Os01g0886600AK070098GCGGCCCACASimilar to CLP protease regulatory subunit CLPX precursor. 
Os01g0888700AK073376ACCGGCCCACGCCTCProtein of unknown function RIO1 family protein. 
Os01g0889000AK103621TTGTGGGCCGGTTetratricopeptide-like helical domain containing protein. 
AK120577CCACGGCCCACGGCCCACGGOvarian tumour, otubain domain containing protein. 
AK073805CGCCACGTGTGGGCCGCASimilar to Regulatory protein viviparous-1. 
AK062434GCGGCCCACASimilar to Ubiquitin-like protein SMT3. 
AK058869GCGGCCCACAUbiquitin-like protein SMT3. 
AK061690ACGTGGGCCGGASimilar to Chloroplast 50S ribosomal protein L27 (Fragment). 
Os01g0934500AK073211CCGTGGGCCGTAConserved hypothetical protein. 
Os01g0950900AK101121AGTGGGCCGAGProtein of unknown function DUF221 domain containing protein. 
AK068882AGTGGGCCGTAProtein of unknown function DUF594 family protein. 
Os01g0960400AK111512CCCGTGGGCCGTGGProtein kinase-like domain containing protein. 
Os01g0963300AK067544CTGGCCCACGGCCCACTSimilar to Syntaxin 61 (AtSYP61) (Osmotic stess-sensitive mutant 1). 
AK102186AACGGCCCACCASimilar to 60S ribosomal protein L9 (Gibberellin-regulated protein GA). 
AK102774GTTTGGGCCCGGCCCACCTSimilar to Syntaxin 52 (AtSYP52). 
Os02g0119700AK108777TTGGCCCAAATACGGCCCACTProtein prenyltransferase domain containing protein. 
Os02g0146700AK105609TTGGCCCACCAGGCCCGGCCCACCCGSimilar to PSMD2 subunit (Fragment). 
Os02g0186500AK068056AAACGGCCCACTSimilar to Protein kinase-like protein. 
AK061629CCCGTGGGCCGGCSimilar to Thioredoxin peroxidase. 
AK101237TGCGGCCCACGCGHypothetical protein. 
AK064096TGGTGGGCCGCMyb, DNA-binding domain containing protein. 
Os02g0198000AK067695TGTGGGCCGAGProtein of unknown function DUF1677, Oryza sativa family protein. 
Os02g0205400AK101434GCGGCCCACGTGTCAGTGGWD40-like domain containing protein. 
AK104393ATCGGACGGCCCACGTSimilar to Epstein-Barr nuclear antigen-1 (EBNA-1). 
Os02g0226900AK064279TTCGGCCCACTProtein prenyltransferase domain containing protein. 
AK103371TTCGTGGGCCGGGCCGGTCACTGACAProtein prenyltransferase domain containing protein. 
Os02g0496900AK059542AAGGCCCACACGGCCCACCTConserved hypothetical protein. 
Os02g0510300AK067961CTCGGCCCACAConserved hypothetical protein. 
Os02g0517531AK121247GGGTGGGCCGCRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os02g0537500AK068689GGCCCGGCCCACGGGSimilar to E2F homolog. 
AK121253TGTGGGCTCTGGGCCGTGGGCCGTCProtein of unknown function, ATP binding family protein. 
AK071800GCCGGCCCACGTCGGCCCATCASimilar to Gamma hydroxybutyrate dehydrogenase (EC 
Os02g0591800AK060611TGTGGGCCGCABrix domain containing protein. 
AK072362CCCGGCCCACGGConserved hypothetical protein. 
AK066929CCGTGGGCCGTGSimilar to Myelin transcription factor 1 (MYT1) (MYTI) (Proteolipid protein binding protein) (PLPB1). 
AK066929GCCCGGCCGGCCCACCTGSimilar to Myelin transcription factor 1 (MYT1) (MYTI) (Proteolipid protein binding protein) (PLPB1). 
AK066929GCCGGCCCACGTGSimilar to Myelin transcription factor 1 (MYT1) (MYTI) (Proteolipid protein binding protein) (PLPB1). 
AK066929GTGGTGGGCCGTGCCTGGGCCGCGCACGCGSimilar to Myelin transcription factor 1 (MYT1) (MYTI) (Proteolipid protein binding protein) (PLPB1). 
AK059205TTCGTGGGCCGGCConserved hypothetical protein. 
Os02g0616600AK106681CCGAGCCGGCCCAAATCGGCCCACACConserved hypothetical protein. 
AK108575CACGGCCCACAAConserved hypothetical protein. 
Os02g0636300AK100670CCGTGGGCCGTGGDEAD/DEAH box helicase, N-terminal domain containing protein. 
Os02g0643200AK106784TGCGGCCCACGCYABBY protein family protein. 
Os02g0643500AK068423TCTCGGCCCACAAPentapeptide repeat containing protein. 
Os02g0646400AK067828AGTGGGCCGTTSimilar to Glutaredoxin. 
Os02g0673700AB028130AACGGCCCACGCZinc finger, Dof-type family protein. 
AK106041GAGGCCCAGAGCGGCCCACTSimilar to CRT/DRE binding factor 1. 
AK106041GCGGCCCACGTSimilar to CRT/DRE binding factor 1. 
Os02g0731500J065098J18GCCACACGGCCCACGGAWPM-19-like family protein. 
AK066823CCCGGCCCACGTConserved hypothetical protein. 
AK072308ACGTGGGCCGAGReplication protein A 70kDa. 
AK072308AGATGGGCCGGCCCACCCGReplication protein A 70kDa. 
Os02g0780700AK063558CCCGGCCCACCACCGCACLipase, class 3 family protein. 
Os02g0787100Os02g0787100GCGGCCCACGCProtein of unknown function DUF676, hydrolase-like domain containing protein. 
AK105305TGCGGCCCACGASimilar to DEAD box-like RNA helicase (Fragment). 
Os02g0803200AK063404GCTGGGCCGGCCCACCSimilar to 30S ribosomal protein S15. 
Os02g0805900AK073740AGCCCACGGCCCACCTDcp2, box A domain containing protein. 
Os02g0806000AK072745AGGTGGGCCGTGGGCTGCN5-related N-acetyltransferase domain containing protein. 
Os02g0819700AK067374TCGGCCCACAAZinc finger, Zim17-type family protein. 
Os02g0827300AK069159GGCCCGGCCCACGAGCCCAACCProtein of unknown function DUF382 domain containing protein. 
Os02g0827600AK068455TCCGACGGCCCACCTGConserved hypothetical protein. 
AK103779CTCGCGCGGCCCACCSimilar to Transcriptional activator Rb homolog (Fragment). 
Os03g0149400AK111396CCACGGCCCACAProtein prenyltransferase domain containing protein. 
Os03g0167000AK107307CCCGTGGGCCGTGGConserved hypothetical protein. 
Os03g0172700AK111307GCCGGCCCACTHypothetical protein. 
Os03g0181600AK067807AGCCCAAGCGGCCCACCASimilar to GATA transcription factor 25 (ZIM-like 2 protein). 
AY323478GCGGCCCACGGSimilar to Ethylene responsive element binding factor3 (OsERF3). 
Os03g0184600AK065264ATTTGGGCCCGGCCCACAANAD-dependent epimerase/dehydratase family protein. 
J065154C08CCGTGGGCCGTCCGATCTarget SNARE coiled-coil region domain containing protein. 
Os03g0195200AK068949TGATGGGCCGGCCCACCCPossible metal-binding region in RNase L inhibitor, RLI domain containing protein. 
AK069251AGTGGGCCGTCC40S ribosomal protein S3a (CYC07 protein). 
Os03g0205500Os03g0205500CCCGGGCCCGGCCCACTGGCCCAGTCytochrome b5 domain containing protein. 
Os03g0210400AK065966ACGTGGGCCGCProtein prenyltransferase domain containing protein. 
Os03g0218400AK069202TCCGGCCCGTGGGCCGCSimilar to Hexose transporter. 
Os03g0238700AK073387TCGTGGGCCGCAGGCCCGCASimilar to Acid phosphatase type 5. 
AB037151GGACGGACGTGGGCCGAASimilar to 26S proteasome non-ATPase regulatory subunit 4 (26S proteasome regulatory subunit S5A) (Multiubiquitin chain binding protein). 
J065046A15TTCGGCCCACGTCCGTCCHypothetical protein. 
AK120048CACGGCCCACCAGGCCCAGASimilar to Heat shock protein 26. 
Os03g0260100AK066143GTGGCCCACGGCCCACCAConserved hypothetical protein. 
AK102826TCGGCCCACGTSplicing factor PWI domain containing protein. 
AK060821TCCGGCCCACGASimilar to Sigma factor SIG2B. 
Os03g0277000AK100522GCCGGCCCACCACSimilar to GDP dissociation inhibitor protein OsGDI1. 
AK063650GTGTGGGCCGTGGlyoxalase/bleomycin resistance protein/dioxygenase domain containing protein. 
Os03g0284000Os03g0284000CACGTGGGCCGGAACGGCCCGConserved hypothetical protein. 
Os03g0288900AK100329GGCCCGGCCCACCConserved hypothetical protein. 
AK112010TCCGGCCCACGTZinc finger, RING-type domain containing protein. 
Os03g0309000AK070071GGCCGTGGGCCGTGVirulence factor, pectin lyase fold family protein. 
AK111447GGCCGTGGGCCGAGASimilar to WRKY transcription factor 55. 
Os03g0326600AK107632AGTGGGCCGGCRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
AK073228TGTGGGCCGGCSimilar to Eukaryotic translation initiation factor 2 beta subunit (eIF-2-beta) (P38). 
AK070859ACGTGGGCCGASimilar to Uroporphyrinogen decarboxylase (EC (URO-D) (UPD) (Fragment). 
Os03g0339100AK111641GCGGCCCACTTGSimilar to PRL1 protein. 
AK058567ATCGGACGGCCCACGTGProteasome subunit alpha type 2 (EC (20S proteasome alpha subunit B) (20S proteasome subunit alpha-2). 
Os03g0398900AK107457GCGGCCCACCConserved hypothetical protein. 
J100029F12TCGTGGGCCGGGLike-Sm ribonucleoprotein, core family protein. 
Os03g0566800AK103270AGTGGGCCGAGSimilar to Eukaryotic initiation factor 4A-3 (eIF4A-3) (eIF-4A-3). 
Os03g0639800AK103237AGTGGGCCGTTSnf7 family protein. 
AK064308CTCGGCCCACAAConserved hypothetical protein. 
AK070243ACCGGCCCACCAACConserved hypothetical protein. 
AK059164GTGGTGGGCCGCSimilar to Glycine-rich RNA-binding, abscisic acid-inducible protein. 
AK062094GGGCCGGCCCACGASimilar to RGP-3 (Fragment). 
Os03g0690000AK062756GATCGGACGGCCCACGCConserved hypothetical protein. 
AK061228ACCGGCCCACTProteasome subunit beta type 2 (EC (20S proteasome alpha subunit D) (20S proteasome subunit beta-4). 
AK065161GGTGTGTGGGCCGTGTGGCSimilar to Ethylene receptor. 
Os03g0746000AK073682GCGGCCCACAConserved hypothetical protein. 
AK061252CTCGGCCCACCTAGGCCCATTTConserved hypothetical protein. 
AK120423CCGTGGGCCGGTGGGCCCGProtein of unknown function UPF0139 family protein. 
Os03g0758700AK106620TGCGGCCCACGGWD40-like domain containing protein. 
Os03g0760700AK060701TGTGGGCCGCSimilar to Aspartate-semialdehyde dehydrogenase (EC (Fragment). 
Os03g0776900AK107941GCGGCCCACGASimilar to DNAJ protein-like. 
AK060949TCCGGCCCACTConserved hypothetical protein. 
AK121620GACGGCCCACASimilar to Casein kinase-like protein. 
Os03g0793700AK121667CACGGCCCACACCupin 1 domain containing protein. 
AK067446GGACGGCCCACGTACAGCCCATCAAGGCCCATATSimilar to Helix-loop-helix protein homolog. 
Os03g0822900AK099787CACGGCCCACAAZinc finger, BED-type predicted domain containing protein. 
AK104298TACGGCCCACGCTGCGGCCCSimilar to Dolichol-phosphate mannosyltransferase (EC (Dolichol- phosphate mannose synthase) (Dolichyl-phosphate beta-D- mannosyltransferase) (Mannose-P-dolichol synthase) (MPD synthase) (DPM synthase). 
AK067084CTCGGCCCACAAGCGGCCCAACTSimilar to RNA-binding protein RZ-1. 
Os03g0841100AK120279TATTGGGCCGTGTCGGCCCACCTEGF domain containing protein. 
AK101661TACGGCCCACASimilar to Sarcoplasmic reticulum protein (With alternative splicing). 
AK070549TGGTGGGCCGTGGCTGGGCTGGPeptidase, trypsin-like serine and cysteine domain containing protein. 
AK060496TTGTGGGCCGGGCCCAAACSimilar to Transcription factor homolog BTF3-like protein. 
Os03g0861700AK066129CAAGTGGGCCGGCCCACCTRhodanese-like domain containing protein. 
AK068434AGGTGGGCCGGCCCACTTGCyclin-like F-box domain containing protein. 
AK070523ACGTGGGCCGAAD111/G-patch domain containing protein. 
AK070523AGTGGGCCGCAD111/G-patch domain containing protein. 
Os04g0122000AK065510CCGTGGGCCGCACGTGGGCTTTTLeucine rich repeat, N-terminal domain containing protein. 
Os04g0208400AK069629AGTGGGCCGTGCyclin-like F-box domain containing protein. 
AK069629CACGTGGGCCGGCCyclin-like F-box domain containing protein. 
AK103472GTGTGGGCCGTCConserved hypothetical protein. 
AK073668ACCGGCCCACCSimilar to Histone H1. 
AK103344GCGGCCCACCACSimilar to Thylakoid-bound ascorbate peroxidase (EC (Fragment). 
Os04g0486500AK111976TCCGGCCCACCTSimilar to Mitotic spindle checkpoint protein MAD2. 
Os04g0490000AK108365TTGTGGGCCGTASimilar to Glutamate synthase [NADH], chloroplast precursor (EC (NADH- GOGAT). 
AK120520TCAGGCCCATCTCGGCCCACTCTSimilar to 40S ribosomal protein S11. 
AK065957TACGGCCCACCCConserved hypothetical protein. 
AK066169TTCGGCCCACCAConserved hypothetical protein. 
AK063584CACGGCCCACGGC2 calcium/lipid-binding region, CaLB domain containing protein. 
AK063584CCACGGCCCACC2 calcium/lipid-binding region, CaLB domain containing protein. 
Os04g0563300AK100487CCCGGCCCACGCCyclin-like F-box domain containing protein. 
AK065648CCCGGCCCACAATatD-related deoxyribonuclease family protein. 
Os04g0640800AK065522TTTCGGCCCACGTTCCGTProgrammed cell death protein 2, C-terminal domain containing protein. 
AK061488TACGGCCCACTTGProtein of unknown function DUF579, plant family protein. 
AK109786TTCGGCCCACALipolytic enzyme, G-D-S-L family protein. 
AK119253CCACGGCCCACGGNucleolar, Nop52 family protein. 
AK119253TGTGGGCCGGCNucleolar, Nop52 family protein. 
Os04g0667000AK069874CCATGGGCGGCCCACATafazzin family protein. 
AK067891ACCGGCCCACCSimilar to Plastid terminal oxidase. 
Os04g0675400AK068186CCGTGGGCCGTGSimilar to Chaperone protein dnaJ. 
Os04g0682300AK061384TTGTGGGCCGGTSimilar to Phosphomannomutase 2 (EC (PMM 2). 
AK106642AGTGGGCCGASimilar to Adenosine deaminase acting on tRNA 1. 
AK106642TGGTGGGCCGAASimilar to Adenosine deaminase acting on tRNA 1. 
Os04g0684500AK066014TCCGGCCCACCCGGGCCRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os04g0685100AK065262CCGTGGGCCGTCRibosomal biogenesis regulatory protein family protein. 
Os04g0685600AK067506GCGGCCCACGCGExo70 exocyst complex subunit family protein. 
AK071038TCCGGCCCACANAD-dependent epimerase/dehydratase family protein. 
AK066175TCCGGCCCACTSimilar to RNA helicase (Fragment). 
Os05g0116600AK109828AGGTGGGCCGCATGGGCTTTF-box associated type 1 domain containing protein. 
J065066C12TTTCGGCCCACTConserved hypothetical protein. 
AK104970TCCGGCCCACTBLE1 protein. 
Os05g0139200AK108058TGCGGCCCACATGGGTCCCACCyclin-like F-box domain containing protein. 
AK121187CCACGGCCCACGCCCACTCCConserved hypothetical protein. 
AK120877CCCACCACTCCGGCCCACGAGGCCCACCACSimilar to 60S ribosomal protein L18. 
AK120877CCGTGGGCCGGASimilar to 60S ribosomal protein L18. 
Os05g0158200AK060561TTCGGCCCACCACPeptidase, trypsin-like serine and cysteine domain containing protein. 
AK065911TTGTGGGCCGAGATProtein of unknown function DUF1664 family protein. 
Os05g0184901Os05g0184901CGCGTGGGCCGTASigma factor, regions 3 and 4 domain containing protein. 
Os05g0283600AK100359GCGTGGGCCGGTConserved hypothetical protein. 
AK066255CGCGTGGGCCGCSimilar to WRKY transcription factor 45. 
Os05g0331200AK100884CCACGGCCCACGCSimilar to External rotenone-insensitive NADPH dehydrogenase. 
AK060678CCGTGGGCCGTGGGCCGTGTwin-arginine translocation pathway signal domain containing protein. 
AK106328CCAGGCCCGGCCCACAConserved hypothetical protein. 
AK059951GCGGCCCACCCSimilar to Soluble inorganic pyrophosphatase (EC (Pyrophosphate phospho- hydrolase) (PPase). 
AK102786CTCGGCCCACTHistone deacetylase superfamily protein. 
AK102786TACGGCCCACGCHistone deacetylase superfamily protein. 
Os05g0451200AK073037ACCGGCCCACGTConserved hypothetical protein. 
AK101652AGTGGGCCGTGSimilar to FK506-binding protein 4 (EC (Peptidyl-prolyl cis-trans isomerase) (PPIase) (Rotamase) (p59 protein) (HSP binding immunophilin) (HBI) (FKBP52 protein) (52 kDa FK506 binding protein) (FKBP59). 
AK061873GCGGCCCACCTGTCAGTGSelT/selW/selH selenoprotein family protein. 
Os05g0469900AK109700AGGTGGGCCGAGConserved hypothetical protein. 
Os05g0480700AK100850AGTGGGCCGGCSimilar to Vacuolar ATP synthase subunit E (EC (V-ATPase E subunit) (Vacuolar proton pump E subunit). 
Os05g0488900AK071883TGCGGCCCACACSimilar to Cytochrome b5 reductase. 
Os05g0500500AK110627GCGGCCCACGGHSP20-like chaperone domain containing protein. 
Os05g0503000AK068335GCCGGCCCACACSimilar to Secretory carrier membrane protein. 
AK062441GTGGTGGGCCGGTCT20 family protein. 
AK061451TACGGCCCACTGGCCCATTAThioredoxin-related domain containing protein. 
Os05g0533600AK067577CACTGACATGTGGGCCGCSimilar to Starch synthase IVa (Glycogen (Starch) synthase-like). 
Os05g0535200AK070696TCTCGGCCCACGGCGTGGACyclin-like F-box domain containing protein. 
Os05g0537200AK121713GGCCGTGGGCCGTGGSimilar to Myosin XI (Fragment). 
AK103819CACGTGGGCCGCAFlap endonuclease-1a (EC 3.-.-.-) (OsFEN-1a). 
Os05g0542900AK102925GTGGCCCACGGCCCACGGCCCACGTGTVirulence factor, pectin lyase fold family protein. 
AK103396TGCGGCCCACASimilar to Syntaxin 71 (AtSYP71). 
AK099052TGTGGGCCGGGCSimilar to Initiation factor 3d (Fragment). 
Os05g0566800AK065748GGTGGGCCGTGCold acclimation protein COR413-TM1. 
AK065748TCGTGGGCCGTCCold acclimation protein COR413-TM1. 
Os05g0577200AK069756GCCCGGCCCACTCarboxylesterase, type B family protein. 
Os05g0592300AK068520TTCGGCCCACAProtein of unknown function DUF1637 family protein. 
AK111784TGTGGGCCGGCCwf15/Cwc15 cell cycle control protein family protein. 
AK101235TGTGGGCCGAAACyclin-like F-box domain containing protein. 
Os06g0115400AK111656GCGGCCCACTSimilar to Superoxide dismutase [Fe], chloroplast (EC (Fragment). 
Os06g0122200AK109712CCCGTGGGCCGAACGGCCCATGTConserved hypothetical protein. 
Os06g0131100AK112079CCAGGCCCAGCCCTCCGGCCCACTWD40-like domain containing protein. 
Os06g0136700AK065081TCGGCCCACTSteroid nuclear receptor, ligand-binding domain containing protein. 
Os06g0137500AK072896CCCGGCCCACTBrix domain containing protein. 
AK099356TGTGGGCCGGAGlutathione S-transferase, C-terminal-like domain containing protein. 
Os06g0174350J043034B05CCCGGCCCACTConserved hypothetical protein. 
Os06g0194200AK111269TGTGGGCCGCAConserved hypothetical protein. 
Os06g0219600AK060429CAACGGCCCACAGCCCACGGSimilar to Poly(A)-binding protein II-like. 
AK071776ACCGGCCCACCConserved hypothetical protein. 
Os06g0236200J075111M01ACCGGCCCACACConserved hypothetical protein. 
Os06g0246500AK105105TTCGGCCCACTSimilar to Pyruvate dehydrogenase E1 alpha subunit (EC 
Os06g0332600AK121615GCCGGCCCACCAConserved hypothetical protein. 
Os06g0334600AK064993CCCGGCCCACGCGHypothetical protein. 
AK103794TACGGCCCACTNucleolar complex-associated family protein. 
AK066548CCCACCCGGCCCGGCCCACARas-related protein RIC2. 
Os06g0562700AK109753GACGGCCCACGTConserved hypothetical protein. 
AK121337ATCCAACGGCCCACGGGProtein of unknown function UPF0197 family protein. 
AK106549AACGGCCCGTGGGCCGCAConserved hypothetical protein. 
Os06g0592500AK119729CTGGGCTTGGTGGGCCGGTSimilar to Ethylene-responsive transcriptional coactivator. 
Os06g0598900AK100386GCGGCCCACACSimilar to Serine-threonine kinase receptor-associated protein (UNR-interacting protein) (WD-40 repeat protein PT-WD) (MAP activator with WD repeats). 
Os06g0642900AK073896GCCCACCCGGCCCACGCUbiquitin system component Cue domain containing protein. 
Os06g0643000AK067701GCCGGCCCACCACCAACPhox-like domain containing protein. 
AK066837CACGGCCCACCTSimilar to 50S ribosomal protein L35, chloroplast precursor (CL35). 
AK066837GCGGCCCACASimilar to 50S ribosomal protein L35, chloroplast precursor (CL35). 
Os06g0649500AK072591CTCGGCCCACAWD40-like domain containing protein. 
AK062354ACCGGCCCACCTSimilar to Polyubiquitin gene (Fragment). 
Os06g0687200AK058749TGCGGCCCACCAZinc finger, RING-type domain containing protein. 
Os06g0704300AK107008TCGTGGGCCGAAZinc finger, CCCH-type domain containing protein. 
AK071749GCCGGCCCACGASimilar to Sterol 4-alpha-methyl-oxidase (Fragment). 
Os07g0105300AK107419GCCGGCCCACGGGConserved hypothetical protein. 
Os07g0136300AK064609GTCGCGCGTGGGCCGAGAConserved hypothetical protein. 
Os07g0187300AK103069CCCGTGGGCCGGARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J075134C14GACGGCCCACTRibosomal protein L24E family protein. 
Os07g0256200AK072904GCCCGGCCCACAARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
S81897CTCGGCCCGGCCCACCTOsNramp1 (Integral membrane protein). 
Os07g0289800J080305A01GTGTGGGCCGGGConserved hypothetical protein. 
AK073463AGTGGGCCGTGSimilar to RNA helicase (Fragment). 
AK073463CACGTGGGCCGGCSimilar to RNA helicase (Fragment). 
Os07g0423000AK109714GGTGGGCCGAAMitochodrial transcription termination factor-related family protein. 
Os07g0490300AK068288GCGGCCCACAGCCCAACCSimilar to Preproacrosin. 
Os07g0490400AK067941GGTTGGGCTGTGGGCCGCPeptidylprolyl isomerase, FKBP-type domain containing protein. 
Os07g0516200AK061373GGCCCGTTCAGGCCCGGCCCACGCSimilar to Endoribonuclease, L-PSP family. 
AK065871GGCCCGGCCCGGCCGGCCCACCSimilar to Isopentenyl pyrophosphate:dimethyllallyl pyrophosphate isomerase (EC (Fragment). 
Os07g0555400AK070977CACGTGGGCCGGAConserved hypothetical protein. 
Os07g0569800AK108637GGTGGGCCGAGConcanavalin A-like lectin/glucanase domain containing protein. 
Os07g0578600AK067155TTCGGCCCGGCCCACTCCSimilar to 5-formyltetrahydrofolate cycloligase (EC 
Os07g0589400AK072501CACGGCCCACGCGQuinonprotein alcohol dehydrogenase-like domain containing protein. 
AK072501CACGTGGGCCGGTQuinonprotein alcohol dehydrogenase-like domain containing protein. 
AK112118CCCGGCCCACACSimilar to Nuclear factor Y transcription factor subunit B homolog. 
016-059-F04GGTGGGCCCCACCTGTCGGTGGGCCGTGGHeavy metal transport/detoxification protein domain containing protein. 
Os07g0622700AK107120AGTGGGCCGCEpoxide hydrolase family protein. 
Os07g0623300AK070292GACGGCCCACASimilar to Splicing factor SC35. 
Os07g0633200AK061338GCGGCCCACACSimilar to SC35-like splicing factor SCL30a, 30a kD. 
J080305J22CAGGTGGGCCGGGCCCATAAThymidylate kinase domain containing protein. 
J080305J22TCGTGGGCCGGGCCGGGCCGGGCCGAAThymidylate kinase domain containing protein. 
AF009413AAATGGGCCGTGGAGGTGGGCCGGTSimilar to 10 kDa chaperonin (Protein CPN10) (Protein groES). 
Os07g0669000AK099431GCGGCCCACTSimilar to Catalytic subunit of polymerase zeta. 
Os07g0674100AB183706AACGGCCCACGGUDP-glucuronic acid decarboxylase. 
AK063800TCGGCCCACTTAGGCCCATATSimilar to Ubiquinol-cytochrome c reductase complex 6.7 kDa protein (EC (CR6). 
Os07g0681700AK103213GCGGCCCACGCGlycosyl transferase, family 8 protein. 
Os07g0686500AK119424CCCGTGGGCCGTGGProtein of unknown function DUF630 domain containing protein. 
AK100433CCGTGGGCCGTASimilar to Pyruvate decarboxylase isozyme 3 (EC (PDC). 
AK064053TCCGGCCCACGAACCAGCCCAATTShwachman-Bodian-Diamond syndrome proteins family protein. 
AK058240CACGGCCCACCSimilar to 60S acidic ribosomal protein P1 (L12). 
AK059891GACGGCCCACCASimilar to Calmodulin 1 (Fragment). 
AK101577AGTGGGCCGAGATSimilar to Cold shock protein-1. 
AK099391AAGGCCCATATTGGGCCCACACGGCCCACGProtein of unknown function DUF1637 family protein. 
Os08g0135900AK072535AGTGGGCCGGCCCATGSimilar to Tryptophan synthase beta chain 1 (EC (Orange pericarp 1) (Fragment). 
AK099590GGCCCGGCCCGGCCCGGCCCACTSimilar to DAG protein, chloroplast precursor. 
Os08g0150800AK101530AAATGGGCTCGGCCCACASimilar to Tyrosyl-tRNA synthetase (Tyrosyl-tRNA ligase; TyrRS). class-I aaRS. 
AK073344TCCGGCCCACCASpo11/DNA topoisomerase VI, subunit A family protein. 
Os08g0162500AK121633GACGGCCCACCTGTConserved hypothetical protein. 
AK070464GCGGCCCACAConserved hypothetical protein. 
Os08g0224200AK101331GCGGCCCACASimilar to Ythdf2-prov protein. 
AK067127CCGTGGGCCGGGCCGTCGGGCCGTAConserved hypothetical protein. 
Os08g0387050J043038F21GAAGCCCAGCCGAGCCGGCCCACAGCCCAGCCConserved hypothetical protein. 
Os08g0411200AK120890AGGTGGGCCGAASAM (and some other nucleotide) binding motif domain containing protein. 
Os08g0414200AK102789TGCGGCCCACCAGCCCACCACBRCT domain containing protein. 
Os08g0427900AK103217ACCGGCCCACASimilar to Hin19 (Fragment). 
Os08g0461300AK065651TTCGGCCCACGGGCyclin-like F-box domain containing protein. 
Os08g0463900AK120178TTCGTGGGCCGTTTConserved hypothetical protein. 
Os08g0465300AK108076CACGGCCCACAConserved hypothetical protein. 
AK069097TCGGCCCACGTMethyl-CpG binding domain containing protein. 
AK066895AGATGGGCCGGCCCACGAARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
AK111820CCCGGCCCACCACWD40-like domain containing protein. 
AK111820CCCGGCCCACCCACGGGWD40-like domain containing protein. 
AK069190CGGGTGGGCCGAGSimilar to Uncharacterized enzyme involved in pigment biosynthesis. 
Os08g0511000AK107578TGGTGGGCCGTAProtein prenyltransferase domain containing protein. 
AK105385GCGGCCCACCTSAM (and some other nucleotide) binding motif domain containing protein. 
AK064304AAAAGCCCATTACGGCCCACACSimilar to 30S ribosomal protein S16. 
Os08g0544500AK071354CTCGGCCCACTSimilar to ARP2/3 regulatory protein subunit NAPP. 
Os08g0553450Os08g0553450TCCGGCCCACAHypothetical protein. 
AK100496TCGGCCCACAASimilar to Protein-L-isoaspartate O-methyltransferase. 
Os09g0319800AK066759AGTGGGCCGATerpenoid cylases/protein prenyltransferase alpha-alpha toroid domain containing protein. 
Os09g0332700AK067899CACGGCCCACGTSimilar to PDR-type ABC transporter 2 (Fragment). 
Os09g0348800AK063411CCACGGCCCACCTGTGGGCCCAAACConserved hypothetical protein. 
Os09g0375700AK068295CGCGTGGGCCGGCCCAGCHypothetical protein. 
Os09g0416400J075067A16GTCAGTGGGCCGGAConserved hypothetical protein. 
AK105917GCGTGGGCCGCCCAACTUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
AK064108AGTGGGCCGGASimilar to 30S ribosomal protein S16. 
Os09g0511700AK101420TAGGCCCACGGCCCACCCSimilar to Prunasin hydrolase isoform PH C precursor (EC 
Os09g0516800009-017-A01TCCGGCCCACCCConserved hypothetical protein. 
Os09g0532700AK069946GCCCCACCGGCCCACGGAlpha/beta hydrolase family protein. 
Os09g0535000AK058712CCGTGGGCCGASimilar to Triosephosphate isomerase, chloroplast precursor (EC (TIM) (Triose-phosphate isomerase). 
Os09g0538700Os09g0538700GCGGCCCACGCCCAATAGlutelin family protein. 
Os09g0559900AK111842TAATGGGCCGTGTTGGGCCGGCCCACTGACAGProtein kinase-like domain containing protein. 
AK070834AGTGGGCCGTGGPAP/25A core domain containing protein. 
AK103124TGGTGGGCCGTAZinc finger, RING-type domain containing protein. 
Os11g0127700AK103742CTGGGCTTGGGCCGGCCCACTHypothetical protein. 
AK121443TCTCGGCCCACTSimilar to 50S ribosomal protein L24. 
Os11g0199600AK101774TCATGGGCCCATCACCGGCCCACAZinc finger, CCHC-type domain containing protein. 
AK101774TCGGCCCATTAACGGCCCACGTZinc finger, CCHC-type domain containing protein. 
Os11g0227600AK101375TAATGGGCTTAGCGTGGGCCGGAConserved hypothetical protein. 
AK101375TTGTGGGCCGCAConserved hypothetical protein. 
AK071277TCGGCCCACAeIF4-gamma/eIF5/eIF2-epsilon domain containing protein. 
Os11g0448400AB095094GCCGGCCCAAACGGCCCACGAASimilar to Sigma factor SIG2A. 
Os11g0545800AK073687CCACGGCCCACCAAGCCCATCCARegulator of chromosome condensation/beta-lactamase-inhibitor protein II domain containing protein. 
Os11g0549690J065085G07AGTGGGCCGGGCCCAACTConserved hypothetical protein. 
Os11g0586300AK072257TCGGCCCGGCCCACGTConserved hypothetical protein. 
J075053G16CTGGCCCAACGGCCCACGAConserved hypothetical protein. 
AK120270ATCGGACGGCCCACGTConserved hypothetical protein. 
AK065431GACGGCCCACTTGHeat shock protein 70. 
AK120264GCGGCCCACAAHypoxia induced protein conserved region family protein. 
Os12g0112250J013069O10AGTGGGCCGGCSaposin B domain containing protein. 
AK061862CTTGGGCCGGCCCACTHypothetical protein. 
Os12g0145700AK071391CGGCTCGGCCCACCACPyruvate kinase family protein. 
Os12g0189300AK068710GTGGCGTGGGCCCCACTCCCGGCCCACCAGGCCCAGCCCIsocitrate lyase and phosphorylmutase family protein. 
Os12g0211000AK101792TCCAACGGCCCACGAAConserved hypothetical protein. 
Os12g0235800AK071066CAACGGCCCACCCSimilar to Argininosuccinate synthase (Fragment). 
Os12g0241000AK068925CCCGTGGGCCGGGIojap-related protein family protein. 
Os12g0278900AK106816CACGGCCCACAPeptidase C1A, papain family protein. 
Os12g0481100AK073151GACGGCCCACGAAAGCCCATCASimilar to RNA helicase. 
AK064347GGCCCGGCCCGTGGGCCGTGGRNA polymerase II, RPB4 domain containing protein.