version

Summary of OsREG565 (All List)

OrganismOryza sativa  
IDOsREG565  
SequenceCGGCCCAG  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count2952  

Entry Sequences (2952 entries)

LocusGene modelSequenceDescription
Os01g0100700006-066-G10CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
009-108-B10CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
AK059844CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
AK121523CCTGGGCCGGGCCCGGCCCAGCCCAACASimilar to 40S ribosomal protein S5-1. 
J023037D16CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J033028P14CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J033064M07CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J033123M01CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J065026O07CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J065082A05CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J075003I02CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J075170J15CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
J100040D18CCTGGGCCGGGCCCGGCCCAGCCCAACANONE 
Os01g0150000006-053-H07GTGGGTCCAACGGCCCAGCNONE 
006-081-C11GTGGGTCCAACGGCCCAGCNONE 
009-050-D04GTGGGTCCAACGGCCCAGCNONE 
AK060948GTGGGTCCAACGGCCCAGC3-oxo-5-alpha-steroid 4-dehydrogenase, C-terminal domain containing protein. 
J023058M18GTGGGTCCAACGGCCCAGCNONE 
J023112H22GTGGGTCCAACGGCCCAGCNONE 
J065048P05GTGGGTCCAACGGCCCAGCNONE 
J100068N20GTGGGTCCAACGGCCCAGCNONE 
J100073A02GTGGGTCCAACGGCCCAGCNONE 
Os01g0157900AK072658CTTGGGCTGGGCCGGCTGGGCCTTProtein of unknown function Cys-rich family protein. 
Os01g0158000AK058679TCCGGCCCAGTNONE 
AK103127TCCGGCCCAGTImportin alpha-2 subunit. 
D78504TCCGGCCCAGTNONE 
Os01g0172200AK100326TGTGGGCTGGGCCGGAWW/Rsp5/WWP domain containing protein. 
Os01g0184500AK060699GCTGGGCCGAAADEAD/DEAH box helicase, N-terminal domain containing protein. 
Os01g0191800AK061360TCTCGGCCCAGTANONE 
Os01g0193400AK069948ATCTGGGCCGGANONE 
AK069948TGCGGCCCAGANONE 
AK099271ATCTGGGCCGGANONE 
AK099271TGCGGCCCAGANONE 
AK107005ATCTGGGCCGGAConserved hypothetical protein. 
AK107005TGCGGCCCAGAConserved hypothetical protein. 
Os01g0226700014-020-B10TGCGGCCCAGCCNONE 
AK063653TGCGGCCCAGCCProtein of unknown function DUF623, plant domain containing protein. 
Os01g0258600J075028F17GACGGCCCAGGCCCACGGCCCACANONE 
J075061L04GACGGCCCAGGCCCACGGCCCACAConserved hypothetical protein. 
J075071B09GACGGCCCAGGCCCACGGCCCACANONE 
J075093E04GACGGCCCAGGCCCACGGCCCACANONE 
J100033B11GACGGCCCAGGCCCACGGCCCACANONE 
Os01g0283000AK073165CTGGCCCATTTGCGGCCCAGTConserved hypothetical protein. 
J033023G08CTGGCCCATTTGCGGCCCAGTNONE 
Os01g0283100004-018-B01ACTGGGCCGCAAATGGGCCAGNONE 
AK060908ACTGGGCCGCAAATGGGCCAGNONE 
AK071713ACTGGGCCGCAAATGGGCCAGSimilar to Ferripyochelin-binding protein-like. 
AK104205ACTGGGCCGCAAATGGGCCAGNONE 
AK122051ACTGGGCCGCAAATGGGCCAGNONE 
J023109L19ACTGGGCCGCAAATGGGCCAGNONE 
Os01g0525000015-038-B04CACGGCCCAGCNONE 
AK064104CACGGCCCAGCConserved hypothetical protein. 
Os01g0592500AK111253GCCGGCCCAGCProtein of unknown function DUF1070 family protein. 
Os01g0678600009-114-H06CTCGGCCCAGCNONE 
AK063019CTCGGCCCAGCNONE 
AK071536CTCGGCCCAGCNONE 
AK120629CTCGGCCCAGCRibosomal protein S20 family protein. 
J013045E23CTCGGCCCAGCNONE 
J013153D21CTCGGCCCAGCNONE 
J013157A14CTCGGCCCAGCNONE 
J023048M04CTCGGCCCAGCNONE 
J065006P11CTCGGCCCAGCNONE 
J065042O14CTCGGCCCAGCNONE 
J065080D15CTCGGCCCAGCNONE 
J065096M02CTCGGCCCAGCNONE 
J065109M14CTCGGCCCAGCNONE 
J065204H02CTCGGCCCAGCNONE 
J065207L21CTCGGCCCAGCNONE 
J075028D22CTCGGCCCAGCNONE 
J075040O12CTCGGCCCAGCNONE 
J075051O03CTCGGCCCAGCNONE 
J075071M13CTCGGCCCAGCNONE 
J075151H15CTCGGCCCAGCNONE 
J075153D16CTCGGCCCAGCNONE 
J075153I21CTCGGCCCAGCNONE 
J080311L16CTCGGCCCAGCNONE 
J100053A20CTCGGCCCAGCNONE 
J100071P19CTCGGCCCAGCNONE 
Os01g0680400AK067914TCGGCCCAGATAFII28-like protein family protein. 
J065039K13TCGGCCCAGANONE 
J065042K22TCGGCCCAGANONE 
J080016E23TCGGCCCAGANONE 
J080064E22TCGGCCCAGANONE 
Os01g0748100AK071261TCTGGGCCGGAHypothetical protein. 
J023084C08TCTGGGCCGGANONE 
J065058A07TCTGGGCCGGANONE 
Os01g0749900AK103588GCTGGGCCGCProtein of unknown function DUF250 domain containing protein. 
J033090O22GCTGGGCCGCNONE 
J033133C05GCTGGGCCGCNONE 
J065122N01GCTGGGCCGCNONE 
J065188K04GCTGGGCCGCNONE 
J090012D18GCTGGGCCGCNONE 
J100074N02GCTGGGCCGCNONE 
Os01g0764600AK060621ACCGGCCCAGCFosfomycin resistance kinase FomA family protein. 
J013111L18ACCGGCCCAGCNONE 
J013134N08ACCGGCCCAGCNONE 
Os01g0782200AK072068TCTGGGCCGCANONE 
AK107062TCTGGGCCGCADiacylglycerol kinase, catalytic region domain containing protein. 
Os01g0807000AK109751GACGGCCCAGAConserved hypothetical protein. 
Os01g0813400006-025-B06TGTTGGGCTGGGCCGGGNONE 
006-030-C07TGTTGGGCTGGGCCGGGNONE 
006-068-F06TGTTGGGCTGGGCCGGGNONE 
006-096-E09TGTTGGGCTGGGCCGGGNONE 
006-097-B11TGTTGGGCTGGGCCGGGNONE 
006-104-H02TGTTGGGCTGGGCCGGGNONE 
AK062251TGTTGGGCTGGGCCGGGNONE 
AK065370TGTTGGGCTGGGCCGGGSimilar to ADP-ribosylation factor 1. 
J013022G24TGTTGGGCTGGGCCGGGNONE 
J013104C07TGTTGGGCTGGGCCGGGNONE 
J023074M17TGTTGGGCTGGGCCGGGNONE 
J043027C07TGTTGGGCTGGGCCGGGNONE 
J065026K05TGTTGGGCTGGGCCGGGNONE 
J065103I01TGTTGGGCTGGGCCGGGNONE 
J090025M17TGTTGGGCTGGGCCGGGNONE 
J100027L03TGTTGGGCTGGGCCGGGNONE 
J100054I20TGTTGGGCTGGGCCGGGNONE 
Os01g0813800AK063065CCTGGGCCGGTNONE 
Os01g0816700AK100654GCCGGCCCAGASimilar to L-ascorbate oxidase homolog precursor (EC 1.10.3.3) (Ascorbase). 
Os01g0833000AK067226GCGGCCCAGCProtein prenyltransferase domain containing protein. 
J013098M23GCGGCCCAGCNONE 
Os01g0839300AK064685GAGGCCCACTGGGCCGAAASimilar to 50S ribosomal protein L17. 
J065060I21GAGGCCCACTGGGCCGAAANONE 
Os01g0841000009-005-A12ATCTGGGCCGTCCNONE 
AK059601ATCTGGGCCGTCCENTH/VHS domain containing protein. 
AK103342ATCTGGGCCGTCCNONE 
J023022C02ATCTGGGCCGTCCNONE 
J023030C09ATCTGGGCCGTCCNONE 
J033075D24ATCTGGGCCGTCCNONE 
J033123O16ATCTGGGCCGTCCNONE 
J033126C16ATCTGGGCCGTCCNONE 
J065120M23ATCTGGGCCGTCCNONE 
J065190I23ATCTGGGCCGTCCNONE 
J090090G01ATCTGGGCCGTCCNONE 
Os01g0842200003-126-E01TCTCGGCCCAGGNONE 
AK102593TCTCGGCCCAGGNONE 
AK119896TCTCGGCCCAGGSimilar to Scarecrow-like 9 (Fragment). 
J013151G12TCTCGGCCCAGGNONE 
J033098G15TCTCGGCCCAGGNONE 
J090041L03TCTCGGCCCAGGNONE 
J090069J20TCTCGGCCCAGGNONE 
Os01g0844800AK099801ATCTGGGCCGTCSimilar to Pumilio RBD (Fragment). 
AK102882ATCTGGGCCGTCNONE 
AK103686ATCTGGGCCGTCNONE 
Os01g0861000AK058707CCTGGGCCGAConserved hypothetical protein. 
Os01g0867600AK102226CGGACGGCCCAGATSimilar to UDP-glucose:sterol glucosyltransferase (EC 2.4.1.173). 
Os01g0888700AK073376ACTGGGCCGGCCCAATProtein of unknown function RIO1 family protein. 
J033030B16ACTGGGCCGGCCCAATNONE 
J033098D06ACTGGGCCGGCCCAATNONE 
J033112A12ACTGGGCCGGCCCAATNONE 
J043003L24ACTGGGCCGGCCCAATNONE 
Os01g0889000AK103621TCGGCCCAGCTetratricopeptide-like helical domain containing protein. 
Os01g0908100AK072293GCTGGGCCGAAATTTCGGCCCAGTARabGAP/TBC domain containing protein. 
J065010B13GCTGGGCCGAAATTTCGGCCCAGTANONE 
J065010M12GCTGGGCCGAAATTTCGGCCCAGTANONE 
J065047C19GCTGGGCCGAAATTTCGGCCCAGTANONE 
J065069B18GCTGGGCCGAAATTTCGGCCCAGTANONE 
J065071K24GCTGGGCCGAAATTTCGGCCCAGTANONE 
J065142P04GCTGGGCCGAAATTTCGGCCCAGTANONE 
J065170E11GCTGGGCCGAAATTTCGGCCCAGTANONE 
Os01g0918200009-034-H02GCGGCCCAGGNONE 
AK062434GCGGCCCAGGSimilar to Ubiquitin-like protein SMT3. 
AK103092GCGGCCCAGGNONE 
J065093P18GCGGCCCAGGNONE 
J065137C15GCGGCCCAGGNONE 
J065156G01GCGGCCCAGGNONE 
J065206H16GCGGCCCAGGNONE 
J065209D03GCGGCCCAGGNONE 
J075073K05GCGGCCCAGGNONE 
J075099B17GCGGCCCAGGNONE 
J075166N04GCGGCCCAGGNONE 
Os01g0921600AK071344GGTGGGCTGGGCCGGGSimilar to Mitochondrial import receptor subunit TOM20 (Translocase of outer membrane 20 kDa subunit). 
J013039J22GGTGGGCTGGGCCGGGNONE 
J013109E03GGTGGGCTGGGCCGGGNONE 
J023081J12GGTGGGCTGGGCCGGGNONE 
J023091E24GGTGGGCTGGGCCGGGNONE 
J033022A01GGTGGGCTGGGCCGGGNONE 
J033074C13GGTGGGCTGGGCCGGGNONE 
J065199E03GGTGGGCTGGGCCGGGNONE 
J075172O04GGTGGGCTGGGCCGGGNONE 
J090007G18GGTGGGCTGGGCCGGGNONE 
J090052B17GGTGGGCTGGGCCGGGNONE 
J090074H01GGTGGGCTGGGCCGGGNONE 
J100043J09GGTGGGCTGGGCCGGGNONE 
J100059J05GGTGGGCTGGGCCGGGNONE 
Os01g0924000004-020-C09CCCACGTGCTGGGCCGGCNONE 
005-014-A06CCCACGTGCTGGGCCGGCNONE 
009-085-G12CCCACGTGCTGGGCCGGCNONE 
009-123-A08CCCACGTGCTGGGCCGGCNONE 
009-134-A05CCCACGTGCTGGGCCGGCNONE 
009-137-F06CCCACGTGCTGGGCCGGCNONE 
016-016-B08CCCACGTGCTGGGCCGGCNONE 
AF050674CCCACGTGCTGGGCCGGCNONE 
AK061690CCCACGTGCTGGGCCGGCSimilar to Chloroplast 50S ribosomal protein L27 (Fragment). 
AK120797CCCACGTGCTGGGCCGGCNONE 
J013040A15CCCACGTGCTGGGCCGGCNONE 
J013104L20CCCACGTGCTGGGCCGGCNONE 
J013127E12CCCACGTGCTGGGCCGGCNONE 
J013158O05CCCACGTGCTGGGCCGGCNONE 
J023012E09CCCACGTGCTGGGCCGGCNONE 
J023126L23CCCACGTGCTGGGCCGGCNONE 
J023143B03CCCACGTGCTGGGCCGGCNONE 
J065005B16CCCACGTGCTGGGCCGGCNONE 
J065101J15CCCACGTGCTGGGCCGGCNONE 
J065105K16CCCACGTGCTGGGCCGGCNONE 
J065155K16CCCACGTGCTGGGCCGGCNONE 
J065171M17CCCACGTGCTGGGCCGGCNONE 
J065182F07CCCACGTGCTGGGCCGGCNONE 
J065187D10CCCACGTGCTGGGCCGGCNONE 
J065194I24CCCACGTGCTGGGCCGGCNONE 
J065207E24CCCACGTGCTGGGCCGGCNONE 
J075001C24CCCACGTGCTGGGCCGGCNONE 
J075090O10CCCACGTGCTGGGCCGGCNONE 
J075095H17CCCACGTGCTGGGCCGGCNONE 
J075109M24CCCACGTGCTGGGCCGGCNONE 
J075123C18CCCACGTGCTGGGCCGGCNONE 
J075148G22CCCACGTGCTGGGCCGGCNONE 
J090009B09CCCACGTGCTGGGCCGGCNONE 
J090075K17CCCACGTGCTGGGCCGGCNONE 
J090081H23CCCACGTGCTGGGCCGGCNONE 
J090097H21CCCACGTGCTGGGCCGGCNONE 
J100063P14CCCACGTGCTGGGCCGGCNONE 
Os01g0929500AK111399AGTTGGGCCTTACTGGGCCGGTSimilar to Carbonyl reductase-like protein. 
AK120263AGTTGGGCCTTACTGGGCCGGTNONE 
Os01g0938900006-059-H02GACGGCCCAGCCCATTTNONE 
009-074-D12GACGGCCCAGCCCATTTNONE 
AK059437GACGGCCCAGCCCATTTNONE 
AK101971GACGGCCCAGCCCATTTSimilar to Nascent polypeptide-associated complex alpha subunit-like protein 3 (NAC-alpha-like protein 3) (Alpha-NAC-like protein 3). 
AK109341GACGGCCCAGCCCATTTNONE 
J023121P08GACGGCCCAGCCCATTTNONE 
J033046G24GACGGCCCAGCCCATTTNONE 
J033048E04GACGGCCCAGCCCATTTNONE 
J033048F04GACGGCCCAGCCCATTTNONE 
J033076L24GACGGCCCAGCCCATTTNONE 
J065173H07GACGGCCCAGCCCATTTNONE 
J065184H09GACGGCCCAGCCCATTTNONE 
Os01g0959100009-163-G12ATCTGGGCCGGCNONE 
AK063053ATCTGGGCCGGCSimilar to Abscisic stress ripening protein 1. 
Os01g0960300AK100099TCTGGGCCGTASimilar to Glucose inhibited division protein A. 
Os01g0971900AK067739ATCCGACGGCCCAGASimilar to BPM. 
Os01g0973400AK060011TCGGCCCAGGNONE 
AK068879TCGGCCCAGGConserved hypothetical protein 48 family protein. 
AK099210TCGGCCCAGGNONE 
AK104863TCGGCCCAGGNONE 
J013170C09TCGGCCCAGGNONE 
J033106K13TCGGCCCAGGNONE 
J075018P18TCGGCCCAGGNONE 
J075039C18TCGGCCCAGGNONE 
J075104L18TCGGCCCAGGNONE 
Os01g0976200006-044-A09ATCTGGGCCGGCNONE 
AK061022ATCTGGGCCGGC11-S plant seed storage protein family protein. 
J023012H20ATCTGGGCCGGCNONE 
J023025O07ATCTGGGCCGGCNONE 
J023082A14ATCTGGGCCGGCNONE 
J023115H15ATCTGGGCCGGCNONE 
J023133H14ATCTGGGCCGGCNONE 
J023133L21ATCTGGGCCGGCNONE 
J023136B16ATCTGGGCCGGCNONE 
J023145P17ATCTGGGCCGGCNONE 
J023146N03ATCTGGGCCGGCNONE 
Os02g0121100012-035-F06CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
013-031-H05CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
013-058-E11CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
014-010-D01CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
AK070711CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGConserved hypothetical protein. 
AK119758CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J013033G12CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J023007M16CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J023020K20CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J023061H10CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J033027H20CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J033051E18CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J090005F12CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J090017A20CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J090018G11CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J090062C18CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100027N10CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100032L14CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100045C14CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100061M09CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100062K11CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100064H11CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100074H16CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100082N01CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
Os02g0135600AK069843GCCGGCCCAGTTAGGCCCACAConserved hypothetical protein. 
J023034H09GCCGGCCCAGTTAGGCCCACANONE 
J033090D08GCCGGCCCAGTTAGGCCCACANONE 
J100025N07GCCGGCCCAGTTAGGCCCACANONE 
J100075G18GCCGGCCCAGTTAGGCCCACANONE 
Os02g0135700AK100570TGTGGGCCTAACTGGGCCGGCDNA polymerase V family protein. 
Os02g0138600AK071778GGGCCGGCGGCCCAGAProtein of unknown function DUF1677, Oryza sativa family protein. 
J023113L07GGGCCGGCGGCCCAGANONE 
Os02g0148600AK059287GACGGCCCAGAConserved hypothetical protein. 
Os02g0162500009-181-F03CCTGGGCCGTCNONE 
AK058907CCTGGGCCGTCNONE 
AK121223CCTGGGCCGTCSimilar to 40S ribosomal protein S14. 
J023090I10CCTGGGCCGTCNONE 
J023136J11CCTGGGCCGTCNONE 
J053097J20CCTGGGCCGTCNONE 
J053098F01CCTGGGCCGTCNONE 
J065065B09CCTGGGCCGTCNONE 
J065082M04CCTGGGCCGTCNONE 
J065188O05CCTGGGCCGTCNONE 
J075057P15CCTGGGCCGTCNONE 
J075061J08CCTGGGCCGTCNONE 
J075061N15CCTGGGCCGTCNONE 
J075131I08CCTGGGCCGTCNONE 
J075141H13CCTGGGCCGTCNONE 
J080062E14CCTGGGCCGTCNONE 
J080062P15CCTGGGCCGTCNONE 
J080318G17CCTGGGCCGTCNONE 
J080319G19CCTGGGCCGTCNONE 
J090001L10CCTGGGCCGTCNONE 
J090024I18CCTGGGCCGTCNONE 
J090033F24CCTGGGCCGTCNONE 
J090036M16CCTGGGCCGTCNONE 
J090040I24CCTGGGCCGTCNONE 
J090048P06CCTGGGCCGTCNONE 
J090049B12CCTGGGCCGTCNONE 
J090068C02CCTGGGCCGTCNONE 
J090069O04CCTGGGCCGTCNONE 
J090084H22CCTGGGCCGTCNONE 
J100022L03CCTGGGCCGTCNONE 
J100028O14CCTGGGCCGTCNONE 
J100028O18CCTGGGCCGTCNONE 
J100032A15CCTGGGCCGTCNONE 
J100033D21CCTGGGCCGTCNONE 
J100034J23CCTGGGCCGTCNONE 
J100043K22CCTGGGCCGTCNONE 
J100052M22CCTGGGCCGTCNONE 
J100053N03CCTGGGCCGTCNONE 
J100074N24CCTGGGCCGTCNONE 
J100082J10CCTGGGCCGTCNONE 
Os02g0175100AB053473ACTGGGCCGGCSimilar to Transcriptional activator protein. 
AK069575ACTGGGCCGGCNONE 
J023025A18ACTGGGCCGGCNONE 
J065001E07ACTGGGCCGGCNONE 
J065171A13ACTGGGCCGGCNONE 
J065208N04ACTGGGCCGGCNONE 
J075098H14ACTGGGCCGGCNONE 
J090026G03ACTGGGCCGGCNONE 
J100031K15ACTGGGCCGGCNONE 
J100032K19ACTGGGCCGGCNONE 
J100041D18ACTGGGCCGGCNONE 
J100061K06ACTGGGCCGGCNONE 
Os02g0175800009-083-C02TCGGCCCAGCCNONE 
009-184-H07TCGGCCCAGCCNONE 
009-199-D07TCGGCCCAGCCNONE 
AK058292TCGGCCCAGCCNONE 
AK120215TCGGCCCAGCCConserved hypothetical protein. 
J013040G12TCGGCCCAGCCNONE 
J065050N21TCGGCCCAGCCNONE 
J065077O07TCGGCCCAGCCNONE 
J065102G05TCGGCCCAGCCNONE 
J065197A04TCGGCCCAGCCNONE 
J075024L24TCGGCCCAGCCNONE 
J075038K01TCGGCCCAGCCNONE 
J075044L04TCGGCCCAGCCNONE 
J075063D23TCGGCCCAGCCNONE 
J075079P13TCGGCCCAGCCNONE 
J075084G03TCGGCCCAGCCNONE 
J075135G07TCGGCCCAGCCNONE 
J075148D17TCGGCCCAGCCNONE 
J075150F13TCGGCCCAGCCNONE 
J075157F06TCGGCCCAGCCNONE 
J090054A05TCGGCCCAGCCNONE 
J090085O04TCGGCCCAGCCNONE 
J100023C04TCGGCCCAGCCNONE 
J100023H23TCGGCCCAGCCNONE 
J100026A16TCGGCCCAGCCNONE 
J100035K13TCGGCCCAGCCNONE 
Os02g0176300AK066588TGTTGGGCTTGGGCCTCGGCCCAGGConserved hypothetical protein. 
J013072N24TGTTGGGCTTGGGCCTCGGCCCAGGNONE 
Os02g0178400009-151-B08AACTGGGCCGCNONE 
AK063815AACTGGGCCGCProtein transport protein SEC61 gamma subunit. 
AK121516AACTGGGCCGCNONE 
J033026A17AACTGGGCCGCNONE 
J065011K14AACTGGGCCGCNONE 
J065056D01AACTGGGCCGCNONE 
J065061L22AACTGGGCCGCNONE 
J065076M01AACTGGGCCGCNONE 
J075092E14AACTGGGCCGCNONE 
Os02g0192700004-020-H12CCTGGGCCGTCNONE 
006-024-H06CCTGGGCCGTCNONE 
006-042-F06CCTGGGCCGTCNONE 
006-050-D04CCTGGGCCGTCNONE 
006-059-E10CCTGGGCCGTCNONE 
006-070-B02CCTGGGCCGTCNONE 
006-084-A09CCTGGGCCGTCNONE 
006-114-E11CCTGGGCCGTCNONE 
006-117-E05CCTGGGCCGTCNONE 
009-126-D11CCTGGGCCGTCNONE 
AK061629CCTGGGCCGTCSimilar to Thioredoxin peroxidase. 
AK065909CCTGGGCCGTCNONE 
J013043E11CCTGGGCCGTCNONE 
J065038I09CCTGGGCCGTCNONE 
J065078C12CCTGGGCCGTCNONE 
J065122O14CCTGGGCCGTCNONE 
J065198H04CCTGGGCCGTCNONE 
Os02g0321800AK067188GGGCTGGGCCGTANONE 
AK070852GGGCTGGGCCGTAB-cell receptor-associated 31-like family protein. 
J013094K24GGGCTGGGCCGTANONE 
Os02g0326000006-099-D01GCCGGCCCAGCCNONE 
AK059937GCCGGCCCAGCCNONE 
AK102973GCCGGCCCAGCCConserved hypothetical protein. 
J033115K18GCCGGCCCAGCCNONE 
J075069J04GCCGGCCCAGCCNONE 
Os02g0478700AK099723GACGGCCCAGATRibosomal protein S27. 
J013089A06GACGGCCCAGATNONE 
J065068E01GACGGCCCAGATNONE 
J065217F15GACGGCCCAGATNONE 
Os02g0485000016-062-B12CCTGGGCCGCNONE 
AK064246CCTGGGCCGCTransferase family protein. 
Os02g0522000AK101294GCTGGGCCGGTGGACGCGTCGCRetrotransposon gag protein family protein. 
Os02g0555000015-020-G02TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
AK065270TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
AK121253TGTGGGCTCTGGGCCGTGGGCCGTCProtein of unknown function, ATP binding family protein. 
J013002L01TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
J023060A02TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
J023101O11TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
J023140A15TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
J033042H19TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
J033046C02TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
J033080N19TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
J065026I02TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
J065040C18TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
J090004I16TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
Os02g0602300AK065609GTGGTGGGCCGTGCCTGGGCCGCGCACGCGNONE 
AK066929GTGGTGGGCCGTGCCTGGGCCGCGCACGCGSimilar to Myelin transcription factor 1 (MYT1) (MYTI) (Proteolipid protein binding protein) (PLPB1). 
J013092L08GTGGTGGGCCGTGCCTGGGCCGCGCACGCGNONE 
J090040I23GTGGTGGGCCGTGCCTGGGCCGCGCACGCGNONE 
Os02g0616600AK106681CTTGGGCTGCCGGCCCAGCConserved hypothetical protein. 
J065062G16CTTGGGCTGCCGGCCCAGCNONE 
Os02g0618400AK099283CCTGGGCCGTGGNONE 
AK111807CCTGGGCCGTGGSimilar to Snapdragon myb protein 305 homolog. 
J090053M16CCTGGGCCGTGGNONE 
J090067D02CCTGGGCCGTGGNONE 
Os02g0631000AK068667ATCTGGGCCGTGConserved hypothetical protein. 
J013159L03ATCTGGGCCGTGNONE 
J023119O20ATCTGGGCCGTGNONE 
J090098N20ATCTGGGCCGTGNONE 
Os02g0632500AK101701GCCGGCCCAGCCArf GTPase activating protein family protein. 
Os02g0636300AK100670TAATGGGCTGGGCCGGGCCGGCDEAD/DEAH box helicase, N-terminal domain containing protein. 
J013149P11TAATGGGCTGGGCCGGGCCGGCNONE 
J023022F15TAATGGGCTGGGCCGGGCCGGCNONE 
J023112J15TAATGGGCTGGGCCGGGCCGGCNONE 
J023145M22TAATGGGCTGGGCCGGGCCGGCNONE 
J043017P16TAATGGGCTGGGCCGGGCCGGCNONE 
Os02g0641800AK066504CCCGGCCCAGCCSimilar to RNA helicase (Fragment). 
AK072124CCCGGCCCAGCCNONE 
Os02g0668500006-056-A05CCAACGGCCCAGGNONE 
AK060958CCAACGGCCCAGGNONE 
AK071867CCAACGGCCCAGGCellular retinaldehyde-binding/triple function, C-terminal domain containing protein. 
J023117I15CCAACGGCCCAGGNONE 
J065013J03CCAACGGCCCAGGNONE 
J065021P16CCAACGGCCCAGGNONE 
J065044B07CCAACGGCCCAGGNONE 
J065059E23CCAACGGCCCAGGNONE 
J065087N20CCAACGGCCCAGGNONE 
J065185I04CCAACGGCCCAGGNONE 
J065190G19CCAACGGCCCAGGNONE 
J065199C15CCAACGGCCCAGGNONE 
J065213L12CCAACGGCCCAGGNONE 
J080305C01CCAACGGCCCAGGNONE 
J080308C07CCAACGGCCCAGGNONE 
J080310F02CCAACGGCCCAGGNONE 
Os02g0670400009-189-H11TGTTGGGCCATCCCACACGGCCCAGCCCNONE 
AB079636TGTTGGGCCATCCCACACGGCCCAGCCCSimilar to HMGc1 protein. 
J090001B08TGTTGGGCCATCCCACACGGCCCAGCCCNONE 
Os02g0705100012-046-E01GCCGGCCCAGCCNONE 
AK063491GCCGGCCCAGCCEpoxide hydrolase family protein. 
J065184H07GCCGGCCCAGCCNONE 
Os02g0725300AK120054GCCGGCCCAGTNONE 
J013000L05GCCGGCCCAGTNONE 
J065194M19GCCGGCCCAGTNONE 
Os02g0751300J033055P08CGGACGGCCCAGATProtein of unknown function DUF581 family protein. 
Os02g0759800012-036-G11TCGGCCCAGCCCAAATNONE 
AK067153TCGGCCCAGCCCAAATSimilar to GAMYB-binding protein (Fragment). 
AK071666TCGGCCCAGCCCAAATNONE 
J013098N03TCGGCCCAGCCCAAATNONE 
J023100L02TCGGCCCAGCCCAAATNONE 
J023106G20TCGGCCCAGCCCAAATNONE 
J033057G09TCGGCCCAGCCCAAATNONE 
J100043H19TCGGCCCAGCCCAAATNONE 
J100061H16TCGGCCCAGCCCAAATNONE 
J100079O17TCGGCCCAGCCCAAATNONE 
Os02g0760300009-137-D04ATCCAACGGCCCAGGNONE 
AK063850ATCCAACGGCCCAGGSimilar to Immunophilin. 
AK121481ATCCAACGGCCCAGGNONE 
J023149K16ATCCAACGGCCCAGGNONE 
J033098A18ATCCAACGGCCCAGGNONE 
J065017E05ATCCAACGGCCCAGGNONE 
J065088E24ATCCAACGGCCCAGGNONE 
J080305N16ATCCAACGGCCCAGGNONE 
J080306F22ATCCAACGGCCCAGGNONE 
J080306P07ATCCAACGGCCCAGGNONE 
J080318H06ATCCAACGGCCCAGGNONE 
J090013M21ATCCAACGGCCCAGGNONE 
J100029G11ATCCAACGGCCCAGGNONE 
Os02g0767900009-154-G01TGCGGCCCAGCCCNONE 
009-172-H09TGCGGCCCAGCCCNONE 
AK099885TGCGGCCCAGCCCGlutaredoxin 2 family protein. 
Os02g0778600AK100098TCTGGGCCGAANONE 
AK100190TCTGGGCCGAANONE 
AK106971TCTGGGCCGAASimilar to CEL5=CELLULASE 5 (Fragment). 
J065021O09TCTGGGCCGAANONE 
Os02g0780500AK072784GCTGGGCCGGCCCAACNONE 
AK121143GCTGGGCCGGCCCAACConserved hypothetical protein. 
J023075M13GCTGGGCCGGCCCAACNONE 
J023077P14GCTGGGCCGGCCCAACNONE 
J023123C16GCTGGGCCGGCCCAACNONE 
J023142P06GCTGGGCCGGCCCAACNONE 
Os02g0782200AK070439TACGGCCCAGANONE 
AK101869TACGGCCCAGANOT2/NOT3/NOT5 domain containing protein. 
Os02g0791300J100026B09TCTCGGCCCAGANONE 
J100039D05TCTCGGCCCAGAHelix-loop-helix DNA-binding domain containing protein. 
Os02g0791800AK066282TACTGGGCCGTCCNONE 
AK099697TACTGGGCCGTCCWD-40 repeat containing protein. 
AY445625TACTGGGCCGTCCNONE 
J053065H07TACTGGGCCGTCCNONE 
J065108P05TACTGGGCCGTCCNONE 
J065154P22TACTGGGCCGTCCNONE 
J100037P04TACTGGGCCGTCCNONE 
J100068K05TACTGGGCCGTCCNONE 
Os02g0798700AK101070GCTGGGCCGGANeurochondrin family protein. 
AK103079GCTGGGCCGGANONE 
J090045L09GCTGGGCCGGANONE 
Os02g0803200AK063404GCTGGGCCGGCCCACCSimilar to 30S ribosomal protein S15. 
Os02g0804300006-046-D12GCTGGGCCGGGNONE 
AK060165GCTGGGCCGGGNONE 
AK067584GCTGGGCCGGGSAM (and some other nucleotide) binding motif domain containing protein. 
J013112C12GCTGGGCCGGGNONE 
J023098C22GCTGGGCCGGGNONE 
J033123P06GCTGGGCCGGGNONE 
J065060N24GCTGGGCCGGGNONE 
J065069H22GCTGGGCCGGGNONE 
J065155N20GCTGGGCCGGGNONE 
J065170K07GCTGGGCCGGGNONE 
J090033D12GCTGGGCCGGGNONE 
Os02g0819700AK067374CTCGGCCCAGTTZinc finger, Zim17-type family protein. 
AK099160CTCGGCCCAGTTNONE 
J100086K17CTCGGCCCAGTTNONE 
Os02g0824900AK073217GCGGCCCAGCNONE 
AK103528GCGGCCCAGCConserved hypothetical protein. 
J090069J01GCGGCCCAGCNONE 
J090081B04GCGGCCCAGCNONE 
Os02g0828200AK071199TACGGCCCAGANONE 
Os02g0829900009-044-G07AACTGGGCCGAANONE 
009-044-G07GCCGGCCCAGCCCAACANONE 
AK120917AACTGGGCCGAASimilar to BRICK1. 
AK120917GCCGGCCCAGCCCAACASimilar to BRICK1. 
AY224582AACTGGGCCGAANONE 
AY224582GCCGGCCCAGCCCAACANONE 
J023034L01AACTGGGCCGAANONE 
J023034L01GCCGGCCCAGCCCAACANONE 
J023034M01AACTGGGCCGAANONE 
J023034M01GCCGGCCCAGCCCAACANONE 
J090010G06AACTGGGCCGAANONE 
J090010G06GCCGGCCCAGCCCAACANONE 
J090020D07AACTGGGCCGAANONE 
J090020D07GCCGGCCCAGCCCAACANONE 
J100041L04AACTGGGCCGAANONE 
J100041L04GCCGGCCCAGCCCAACANONE 
J100061D05AACTGGGCCGAANONE 
J100061D05GCCGGCCCAGCCCAACANONE 
J100070L18AACTGGGCCGAANONE 
J100070L18GCCGGCCCAGCCCAACANONE 
Os02g0830000011-075-D11TGTTGGGCTGGGCCGGCNONE 
011-075-D11TTCGGCCCAGTTNONE 
AK101841TGTTGGGCTGGGCCGGCProtein prenyltransferase domain containing protein. 
AK101841TTCGGCCCAGTTProtein prenyltransferase domain containing protein. 
J033069G13TGTTGGGCTGGGCCGGCNONE 
J033069G13TTCGGCCCAGTTNONE 
Os03g0100400AK068556TCTGGGCCGGCNONE 
AK121880TCTGGGCCGGCSimilar to DNA repair endonuclease UVH1 (EC 3.1.-.-) (Ultraviolet hypersensitive 1) (AtRAD1) (DNA excision repair protein XP-F homolog). 
Os03g0113700AK103835CCTGGGCCGGCCCAAAASimilar to Heat shock 70 kDa protein, mitochondrial precursor. 
Os03g0113800AK065925TTTTGGGCCGGCCCAGGProtein prenyltransferase domain containing protein. 
J013047E20TTTTGGGCCGGCCCAGGNONE 
J065026F21TTTTGGGCCGGCCCAGGNONE 
J065047B03TTTTGGGCCGGCCCAGGNONE 
J065054J12TTTTGGGCCGGCCCAGGNONE 
J065079M24TTTTGGGCCGGCCCAGGNONE 
J065093M07TTTTGGGCCGGCCCAGGNONE 
J065153F02TTTTGGGCCGGCCCAGGNONE 
J065155E21TTTTGGGCCGGCCCAGGNONE 
J065179H15TTTTGGGCCGGCCCAGGNONE 
J075019N02TTTTGGGCCGGCCCAGGNONE 
J075089E01TTTTGGGCCGGCCCAGGNONE 
J090066I18TTTTGGGCCGGCCCAGGNONE 
J090087K20TTTTGGGCCGGCCCAGGNONE 
J100079F05TTTTGGGCCGGCCCAGGNONE 
Os03g0130700AK110670GCTGGGCCGGTNONE 
Os03g0160200AK064836CACGGCCCAGTConserved hypothetical protein. 
AK071081CACGGCCCAGTNONE 
AK100712CACGGCCCAGTNONE 
AK104859CACGGCCCAGTNONE 
J013000F21CACGGCCCAGTNONE 
J013024G05CACGGCCCAGTNONE 
J013035E12CACGGCCCAGTNONE 
J013041A17CACGGCCCAGTNONE 
J013045D10CACGGCCCAGTNONE 
J013045F04CACGGCCCAGTNONE 
J013046F04CACGGCCCAGTNONE 
J013047F10CACGGCCCAGTNONE 
J013051E10CACGGCCCAGTNONE 
J013059J07CACGGCCCAGTNONE 
J013059O17CACGGCCCAGTNONE 
J013060A20CACGGCCCAGTNONE 
J013063J23CACGGCCCAGTNONE 
J013066D19CACGGCCCAGTNONE 
J013069O08CACGGCCCAGTNONE 
J013088K24CACGGCCCAGTNONE 
J013098G04CACGGCCCAGTNONE 
J013100I15CACGGCCCAGTNONE 
J013102E18CACGGCCCAGTNONE 
J013102O09CACGGCCCAGTNONE 
J013119M18CACGGCCCAGTNONE 
J013123I19CACGGCCCAGTNONE 
J013146H15CACGGCCCAGTNONE 
J013149A14CACGGCCCAGTNONE 
J023003A05CACGGCCCAGTNONE 
J023013O19CACGGCCCAGTNONE 
J023044M05CACGGCCCAGTNONE 
J023048O03CACGGCCCAGTNONE 
J023049L17CACGGCCCAGTNONE 
J023060D22CACGGCCCAGTNONE 
J023060F20CACGGCCCAGTNONE 
J023069G09CACGGCCCAGTNONE 
J023086E11CACGGCCCAGTNONE 
J023091I09CACGGCCCAGTNONE 
J023091M19CACGGCCCAGTNONE 
J023101D06CACGGCCCAGTNONE 
J023109B03CACGGCCCAGTNONE 
J023113B14CACGGCCCAGTNONE 
J023114B19CACGGCCCAGTNONE 
J023115H16CACGGCCCAGTNONE 
J023134F22CACGGCCCAGTNONE 
J023139I06CACGGCCCAGTNONE 
J023150C02CACGGCCCAGTNONE 
J033033A14CACGGCCCAGTNONE 
J033058O11CACGGCCCAGTNONE 
J033060H13CACGGCCCAGTNONE 
J033075P14CACGGCCCAGTNONE 
J033084O05CACGGCCCAGTNONE 
J033087G04CACGGCCCAGTNONE 
J033092E18CACGGCCCAGTNONE 
J033101G23CACGGCCCAGTNONE 
J033112I05CACGGCCCAGTNONE 
J033118E14CACGGCCCAGTNONE 
J033118P04CACGGCCCAGTNONE 
J033123C07CACGGCCCAGTNONE 
J043003C01CACGGCCCAGTNONE 
J043024B21CACGGCCCAGTNONE 
J043030N04CACGGCCCAGTNONE 
J043039J02CACGGCCCAGTNONE 
J043039N08CACGGCCCAGTNONE 
J075006N21CACGGCCCAGTNONE 
J075008A16CACGGCCCAGTNONE 
J075018J16CACGGCCCAGTNONE 
J075023G04CACGGCCCAGTNONE 
J075134F18CACGGCCCAGTNONE 
J075181B05CACGGCCCAGTNONE 
J090014O14CACGGCCCAGTNONE 
J090020H22CACGGCCCAGTNONE 
J090022G17CACGGCCCAGTNONE 
J090023J24CACGGCCCAGTNONE 
J090033H01CACGGCCCAGTNONE 
J090038A03CACGGCCCAGTNONE 
J090041O22CACGGCCCAGTNONE 
J090049E10CACGGCCCAGTNONE 
J090063E24CACGGCCCAGTNONE 
J090080N12CACGGCCCAGTNONE 
J100021G23CACGGCCCAGTNONE 
J100028P06CACGGCCCAGTNONE 
J100060L21CACGGCCCAGTNONE 
J100077D16CACGGCCCAGTNONE 
J100088I09CACGGCCCAGTNONE 
Os03g0172200AK069130TCCGGCCCAGCCACACGArmadillo-like helical domain containing protein. 
Os03g0176800AK103848ATCTGGGCCGCConserved hypothetical protein. 
J033148K19ATCTGGGCCGCNONE 
J090079G01ATCTGGGCCGCNONE 
Os03g0186800AK100356CCACGGCCCAGTModifier of rudimentary, Modr family protein. 
Os03g0190100AK061907GCGGCCCAGCCNONE 
AK066332GCGGCCCAGCCUbiA prenyltransferase family protein. 
J013051N11GCGGCCCAGCCNONE 
J013060C07GCGGCCCAGCCNONE 
J065117L08GCGGCCCAGCCNONE 
J100067H10GCGGCCCAGCCNONE 
Os03g0214900AK100534TCCAACGGCCCAGATConserved hypothetical protein. 
Os03g0251800AK067333TCCGGCCCAGCCCAGCSimilar to Possible OmpA family member precursor. 
AK073337TCCGGCCCAGCCCAGCNONE 
Os03g0279600006-070-A07CTGGGCCGTGNONE 
AK061080CTGGGCCGTGConserved hypothetical protein. 
AK071043CTGGGCCGTGNONE 
AK103191CTGGGCCGTGNONE 
J065077E22CTGGGCCGTGNONE 
J065208F22CTGGGCCGTGNONE 
J075156K12CTGGGCCGTGNONE 
Os03g0299600009-037-H11TCTCGGCCCAGACTGACAGNONE 
011-072-E02TCTCGGCCCAGACTGACAGNONE 
AK068151TCTCGGCCCAGACTGACAGWound-induced WI12 family protein. 
J013132L05TCTCGGCCCAGACTGACAGNONE 
J023012P15TCTCGGCCCAGACTGACAGNONE 
J023022H03TCTCGGCCCAGACTGACAGNONE 
J023026N15TCTCGGCCCAGACTGACAGNONE 
J023056A21TCTCGGCCCAGACTGACAGNONE 
J023093P10TCTCGGCCCAGACTGACAGNONE 
J075143J10TCTCGGCCCAGACTGACAGNONE 
J075166I19TCTCGGCCCAGACTGACAGNONE 
J090010G13TCTCGGCCCAGACTGACAGNONE 
J090033D23TCTCGGCCCAGACTGACAGNONE 
J090090L22TCTCGGCCCAGACTGACAGNONE 
Os03g0308500AK103891CCACGGCCCAGCCCDEAD/DEAH box helicase, N-terminal domain containing protein. 
Os03g0326600AK107632TCTGGGCCGTGGGCCCTTGGTGGGCCAARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os03g0337600AF119232CTCGGCCCAGTNONE 
AK070859CTCGGCCCAGTSimilar to Uroporphyrinogen decarboxylase (EC 4.1.1.37) (URO-D) (UPD) (Fragment). 
J013110I18CTCGGCCCAGTNONE 
J013147M17CTCGGCCCAGTNONE 
J065083M01CTCGGCCCAGTNONE 
J065199H24CTCGGCCCAGTNONE 
Os03g0337800AK059309TGATGGGCCGACGGCCCAGCCCAGCCSimilar to 60S ribosomal protein L19 (Fragment). 
AK102721TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J023146K24TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J033069H01TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J033105G07TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065009B17TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065010F02TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065068A06TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065085M23TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065095H02TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065118O17TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065121I06TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065138J02TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065143L09TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065146P12TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065169D03TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065181E03TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065184C13TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065188D08TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065188O16TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J075066J20TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J075081E13TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J075175B07TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J080301E05TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J080302B07TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J080316P06TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J080319C09TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J090038K21TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J090046J05TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J090098B03TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J100039N19TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J100041E17TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J100081L04TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J100089N15TGATGGGCCGACGGCCCAGCCCAGCCNONE 
Os03g0410700J065102A22AACTGGGCCGTGNONE 
Os03g0410900J065067F10CACGGCCCAGTTNONE 
J065073D08CACGGCCCAGTTNONE 
J065176C06CACGGCCCAGTTNONE 
J065189O13CACGGCCCAGTTNONE 
J065214E05CACGGCCCAGTTNONE 
J080007H09CACGGCCCAGTTNONE 
J080012B19CACGGCCCAGTTNONE 
J080020J16CACGGCCCAGTTNONE 
J080038J22CACGGCCCAGTTNONE 
J080045I09CACGGCCCAGTTNONE 
J080059M16CACGGCCCAGTTNONE 
J080060C19CACGGCCCAGTTNONE 
J080080P22CACGGCCCAGTTNONE 
J080083C03CACGGCCCAGTTNONE 
J080093M17CACGGCCCAGTTNONE 
J100029F12CACGGCCCAGTTLike-Sm ribonucleoprotein, core family protein. 
Os03g0439800009-197-D03GACGGCCCAGTTNONE 
AK058503GACGGCCCAGTTNONE 
AK066154GACGGCCCAGTTConserved hypothetical protein. 
J065017G24GACGGCCCAGTTNONE 
J090084E18GACGGCCCAGTTNONE 
Os03g0577200006-030-H11ATCCGACGGCCCAGGNONE 
AK061735ATCCGACGGCCCAGGSimilar to Mps one binder kinase activator-like 1A (Mob1 homolog 1A) (Mob1A) (Mob1B) (Protein Mob4A). 
AK098953ATCCGACGGCCCAGGNONE 
AK099558ATCCGACGGCCCAGGNONE 
AK104547ATCCGACGGCCCAGGNONE 
J013034B14ATCCGACGGCCCAGGNONE 
J013066J17ATCCGACGGCCCAGGNONE 
J090033N14ATCCGACGGCCCAGGNONE 
Os03g0587600Os03g0587600GCGGCCCAGAZinc finger, CCHC-type domain containing protein. 
Os03g0612600009-073-H01GACGGCCCAGCNONE 
AK071403GACGGCCCAGCRibosomal protein L25-like domain containing protein. 
Os03g0647500015-025-E10AGTTGGGCTGGGCCGTANONE 
AK064308AGTTGGGCTGGGCCGTAConserved hypothetical protein. 
AK103649AGTTGGGCTGGGCCGTANONE 
J033135D01AGTTGGGCTGGGCCGTANONE 
Os03g0684400AK100086GATCGGACGGCCCAGATMg2+ transporter protein, CorA-like family protein. 
Os03g0685600AK111863CCTGGGCCGGGWD40-like domain containing protein. 
Os03g0711400AK100286CCAACGGCCCAGATSimilar to Coatomer alpha subunit. 
Os03g0725000AK059294CCTGGGCCGGGNONE 
J043026H11CCTGGGCCGGGNONE 
J065187O06CCTGGGCCGGGNONE 
J090066M23CCTGGGCCGGGNONE 
Os03g0734700AK072060GCTGGGCCGGCMitochondrial substrate carrier family protein. 
AK120533GCTGGGCCGGCNONE 
J043026E20GCTGGGCCGGCNONE 
Os03g0735300AK071715ATCCGACGGCCCAGGAlba, DNA/RNA-binding protein family protein. 
J065100I07ATCCGACGGCCCAGGNONE 
Os03g0737600014-094-E01TACTGGGCCGAGCCGNONE 
014-094-E01TACTGGGCCGGGCCGANONE 
AB038234TACTGGGCCGAGCCGNONE 
AB038234TACTGGGCCGGGCCGANONE 
AK101854TACTGGGCCGAGCCGCyclin H-1. 
AK101854TACTGGGCCGGGCCGACyclin H-1. 
AK105468TACTGGGCCGAGCCGNONE 
AK105468TACTGGGCCGGGCCGANONE 
J033069N12TACTGGGCCGAGCCGNONE 
J033069N12TACTGGGCCGGGCCGANONE 
J043017A22TACTGGGCCGAGCCGNONE 
J043017A22TACTGGGCCGGGCCGANONE 
J065154A20TACTGGGCCGAGCCGNONE 
J065154A20TACTGGGCCGGGCCGANONE 
Os03g0744800AK059983TCTCGGCCCAGCCCAAATemp24/gp25L/p24 family protein. 
J065067D01TCTCGGCCCAGCCCAAATNONE 
J065122L19TCTCGGCCCAGCCCAAATNONE 
J090041I03TCTCGGCCCAGCCCAAATNONE 
J100039H03TCTCGGCCCAGCCCAAATNONE 
Os03g0746000AK073682TTTCGGCCCAGGConserved hypothetical protein. 
AK111472TTTCGGCCCAGGNONE 
J090083F05TTTCGGCCCAGGNONE 
Os03g0747300006-120-B12GACGGCCCAGATNONE 
AK060347GACGGCCCAGATNONE 
AK071214GACGGCCCAGATProtein of unknown function DUF124 family protein. 
J023082F22GACGGCCCAGATNONE 
J043034I22GACGGCCCAGATNONE 
J053037D23GACGGCCCAGATNONE 
J053043C01GACGGCCCAGATNONE 
J053083D14GACGGCCCAGATNONE 
J053100J21GACGGCCCAGATNONE 
J065008H11GACGGCCCAGATNONE 
J065024G19GACGGCCCAGATNONE 
J065030G05GACGGCCCAGATNONE 
J065073N07GACGGCCCAGATNONE 
J065101N18GACGGCCCAGATNONE 
J065129O04GACGGCCCAGATNONE 
J065152M14GACGGCCCAGATNONE 
J065161L08GACGGCCCAGATNONE 
J065191G23GACGGCCCAGATNONE 
J090008A11GACGGCCCAGATNONE 
J090047J20GACGGCCCAGATNONE 
J090047J23GACGGCCCAGATNONE 
J090064C23GACGGCCCAGATNONE 
J090087H06GACGGCCCAGATNONE 
J100027M11GACGGCCCAGATNONE 
J100081M15GACGGCCCAGATNONE 
J100084C22GACGGCCCAGATNONE 
J100086C11GACGGCCCAGATNONE 
Os03g0752800AB041020TCGGCCCAGAAAAGCCCACGANONE 
AF058697TCGGCCCAGAAAAGCCCACGAMADS14 protein. 
AF139664TCGGCCCAGAAAAGCCCACGANONE 
AK121171TCGGCCCAGAAAAGCCCACGANONE 
AY332478TCGGCCCAGAAAAGCCCACGANONE 
AY551916TCGGCCCAGAAAAGCCCACGANONE 
J023081C04TCGGCCCAGAAAAGCCCACGANONE 
Os03g0763000AK120812CCTGGGCCGAASimilar to Casein kinase II alpha subunit. 
Os03g0769600AK100054TCCGGCCCAGTTResB-like family protein. 
Os03g0770100AK108776AACGGCCCAGCRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os03g0784000AK067337GCTGGGCCGGANONE 
AK100003GCTGGGCCGGAFAD dependent oxidoreductase family protein. 
J013102O14GCTGGGCCGGANONE 
J013135F18GCTGGGCCGGANONE 
Os03g0797700005-001-F11GCCCACGCGGCCCAGCCCAACCNONE 
AK061648GCCCACGCGGCCCAGCCCAACCConserved hypothetical protein. 
AK098876GCCCACGCGGCCCAGCCCAACCNONE 
J013001D18GCCCACGCGGCCCAGCCCAACCNONE 
J033070I21GCCCACGCGGCCCAGCCCAACCNONE 
J065124F13GCCCACGCGGCCCAGCCCAACCNONE 
J065218D02GCCCACGCGGCCCAGCCCAACCNONE 
J090080A22GCCCACGCGGCCCAGCCCAACCNONE 
J100032P18GCCCACGCGGCCCAGCCCAACCNONE 
Os03g0807200011-031-F07CCCGGCCCAGCNONE 
AK063932CCCGGCCCAGCNONE 
AK103496CCCGGCCCAGCProtein of unknown function DUF1639 family protein. 
J033131A04CCCGGCCCAGCNONE 
J065109O03CCCGGCCCAGCNONE 
J080001M11CCCGGCCCAGCNONE 
J080002H18CCCGGCCCAGCNONE 
J080005I08CCCGGCCCAGCNONE 
J080006B05CCCGGCCCAGCNONE 
J080006D17CCCGGCCCAGCNONE 
J080007M19CCCGGCCCAGCNONE 
J080011E07CCCGGCCCAGCNONE 
J080012H06CCCGGCCCAGCNONE 
J080014D08CCCGGCCCAGCNONE 
J080017D06CCCGGCCCAGCNONE 
J080017K17CCCGGCCCAGCNONE 
J080020B17CCCGGCCCAGCNONE 
J080021O05CCCGGCCCAGCNONE 
J080021O15CCCGGCCCAGCNONE 
J080023I18CCCGGCCCAGCNONE 
J080025A21CCCGGCCCAGCNONE 
J080027P22CCCGGCCCAGCNONE 
J080028M22CCCGGCCCAGCNONE 
J080029B09CCCGGCCCAGCNONE 
J080029M07CCCGGCCCAGCNONE 
J080029M17CCCGGCCCAGCNONE 
J080030H23CCCGGCCCAGCNONE 
J080030K16CCCGGCCCAGCNONE 
J080030L19CCCGGCCCAGCNONE 
J080031A12CCCGGCCCAGCNONE 
J080031N21CCCGGCCCAGCNONE 
J080032G05CCCGGCCCAGCNONE 
J080032P20CCCGGCCCAGCNONE 
J080033H20CCCGGCCCAGCNONE 
J080034H22CCCGGCCCAGCNONE 
J080034J03CCCGGCCCAGCNONE 
J080034J16CCCGGCCCAGCNONE 
J080034N01CCCGGCCCAGCNONE 
J080035K20CCCGGCCCAGCNONE 
J080036I04CCCGGCCCAGCNONE 
J080036I19CCCGGCCCAGCNONE 
J080036O21CCCGGCCCAGCNONE 
J080038D06CCCGGCCCAGCNONE 
J080039J15CCCGGCCCAGCNONE 
J080039P18CCCGGCCCAGCNONE 
J080041H20CCCGGCCCAGCNONE 
J080041M11CCCGGCCCAGCNONE 
J080042F14CCCGGCCCAGCNONE 
J080043G10CCCGGCCCAGCNONE 
J080043J02CCCGGCCCAGCNONE 
J080044C19CCCGGCCCAGCNONE 
J080044G11CCCGGCCCAGCNONE 
J080045M03CCCGGCCCAGCNONE 
J080045N07CCCGGCCCAGCNONE 
J080047K14CCCGGCCCAGCNONE 
J080049I21CCCGGCCCAGCNONE 
J080050A06CCCGGCCCAGCNONE 
J080050I16CCCGGCCCAGCNONE 
J080050N16CCCGGCCCAGCNONE 
J080052C23CCCGGCCCAGCNONE 
J080052D18CCCGGCCCAGCNONE 
J080052F20CCCGGCCCAGCNONE 
J080052F23CCCGGCCCAGCNONE 
J080053M03CCCGGCCCAGCNONE 
J080054G13CCCGGCCCAGCNONE 
J080054H12CCCGGCCCAGCNONE 
J080055N03CCCGGCCCAGCNONE 
J080056E07CCCGGCCCAGCNONE 
J080057L04CCCGGCCCAGCNONE 
J080063O19CCCGGCCCAGCNONE 
J080064E21CCCGGCCCAGCNONE 
J080065D18CCCGGCCCAGCNONE 
J080065F18CCCGGCCCAGCNONE 
J080065H14CCCGGCCCAGCNONE 
J080065K15CCCGGCCCAGCNONE 
J080065M24CCCGGCCCAGCNONE 
J080066B18CCCGGCCCAGCNONE 
J080066B19CCCGGCCCAGCNONE 
J080071H19CCCGGCCCAGCNONE 
J080072E18CCCGGCCCAGCNONE 
J080074K21CCCGGCCCAGCNONE 
J080075B06CCCGGCCCAGCNONE 
J080076H07CCCGGCCCAGCNONE 
J080079D16CCCGGCCCAGCNONE 
J080082B20CCCGGCCCAGCNONE 
J080084N16CCCGGCCCAGCNONE 
J080085L07CCCGGCCCAGCNONE 
J080086L04CCCGGCCCAGCNONE 
J080086M07CCCGGCCCAGCNONE 
J080087D02CCCGGCCCAGCNONE 
J080087D15CCCGGCCCAGCNONE 
J080087J19CCCGGCCCAGCNONE 
J080088G20CCCGGCCCAGCNONE 
J080092M15CCCGGCCCAGCNONE 
J080093O10CCCGGCCCAGCNONE 
J080095L09CCCGGCCCAGCNONE 
J080096A18CCCGGCCCAGCNONE 
J080097C03CCCGGCCCAGCNONE 
J090019J07CCCGGCCCAGCNONE 
J090024N12CCCGGCCCAGCNONE 
J090049I09CCCGGCCCAGCNONE 
Os03g0822200AK069405GCTGGGCCGGANAD-dependent epimerase/dehydratase family protein. 
AK104151GCTGGGCCGGANONE 
AK104209GCTGGGCCGGANONE 
J065107D01GCTGGGCCGGANONE 
J065191L23GCTGGGCCGGANONE 
J065217B05GCTGGGCCGGANONE 
Os03g0822300AK060050TCCGGCCCAGCRibosomal RNA methyltransferase RrmJ/FtsJ domain containing protein. 
J065198I20TCCGGCCCAGCNONE 
Os03g0822900AK099787GGCTGGGCCGGTZinc finger, BED-type predicted domain containing protein. 
J013042C24GGCTGGGCCGGTNONE 
J013096O21GGCTGGGCCGGTNONE 
J023109I23GGCTGGGCCGGTNONE 
J033106N09GGCTGGGCCGGTNONE 
J033107H03GGCTGGGCCGGTNONE 
J033118G03GGCTGGGCCGGTNONE 
J033145I24GGCTGGGCCGGTNONE 
J065138D15GGCTGGGCCGGTNONE 
J065140L13GGCTGGGCCGGTNONE 
J065179M13GGCTGGGCCGGTNONE 
J065200F05GGCTGGGCCGGTNONE 
J075104F20GGCTGGGCCGGTNONE 
J075143A15GGCTGGGCCGGTNONE 
J075197J11GGCTGGGCCGGTNONE 
Os03g0831100AK103115CTCGGCCCAGTArmadillo-like helical domain containing protein. 
J033119F15CTCGGCCCAGTNONE 
J065011M19CTCGGCCCAGTNONE 
J075019I08CTCGGCCCAGTNONE 
J075047A01CTCGGCCCAGTNONE 
J075096P21CTCGGCCCAGTNONE 
J075121I05CTCGGCCCAGTNONE 
J075121I07CTCGGCCCAGTNONE 
J090063F13CTCGGCCCAGTNONE 
J090068F16CTCGGCCCAGTNONE 
J090094E14CTCGGCCCAGTNONE 
Os03g0837900AK068346GCCACGTCGGCCCAGAStreptomyces cyclase/dehydrase family protein. 
Os03g0846400AK067706GCTGGGCCGTGTCTGGGCCGGGCCGTGNONE 
AK070549GCTGGGCCGTGTCTGGGCCGGGCCGTGPeptidase, trypsin-like serine and cysteine domain containing protein. 
Os03g0848300AK059137TCTGGGCCGGCNONE 
J065110J17TCTGGGCCGGCNONE 
Os03g0855600006-029-G09TCTGGGCCGTANONE 
006-033-E02TCTGGGCCGTANONE 
006-069-G07TCTGGGCCGTANONE 
006-083-A02TCTGGGCCGTANONE 
006-098-H04TCTGGGCCGTANONE 
009-054-C04TCTGGGCCGTANONE 
AK060030TCTGGGCCGTANONE 
AK061467TCTGGGCCGTAConserved hypothetical protein. 
AK067858TCTGGGCCGTANONE 
AK106030TCTGGGCCGTANONE 
J013123A10TCTGGGCCGTANONE 
J065001I24TCTGGGCCGTANONE 
J065015N21TCTGGGCCGTANONE 
J065016H07TCTGGGCCGTANONE 
J065040A05TCTGGGCCGTANONE 
J065040F01TCTGGGCCGTANONE 
J065066G17TCTGGGCCGTANONE 
J065077I09TCTGGGCCGTANONE 
J065099M22TCTGGGCCGTANONE 
J065135B13TCTGGGCCGTANONE 
J065144H19TCTGGGCCGTANONE 
J065146I03TCTGGGCCGTANONE 
J065169E02TCTGGGCCGTANONE 
J065177D21TCTGGGCCGTANONE 
J065189L20TCTGGGCCGTANONE 
J065207H13TCTGGGCCGTANONE 
J065210D24TCTGGGCCGTANONE 
J065212I03TCTGGGCCGTANONE 
J075007E21TCTGGGCCGTANONE 
J075013H07TCTGGGCCGTANONE 
J075023K06TCTGGGCCGTANONE 
J075031D23TCTGGGCCGTANONE 
J075038K09TCTGGGCCGTANONE 
J075084C08TCTGGGCCGTANONE 
J075098K20TCTGGGCCGTANONE 
J090028E04TCTGGGCCGTANONE 
J090031E20TCTGGGCCGTANONE 
J090042F06TCTGGGCCGTANONE 
J090049L05TCTGGGCCGTANONE 
J090086G03TCTGGGCCGTANONE 
J090096J04TCTGGGCCGTANONE 
J100035O03TCTGGGCCGTANONE 
J100053H24TCTGGGCCGTANONE 
J100056L17TCTGGGCCGTANONE 
J100058K06TCTGGGCCGTANONE 
J100059G09TCTGGGCCGTANONE 
J100081C15TCTGGGCCGTANONE 
Os03g0858700006-024-D11GGTGGGGCTGGGCCGTCNONE 
AK061723GGTGGGGCTGGGCCGTCProtein of unknown function DUF1499 family protein. 
AK064976GGTGGGGCTGGGCCGTCNONE 
J013001B23GGTGGGGCTGGGCCGTCNONE 
Os04g0105500AK068066TACGGCCCAGTANONE 
AK071444TACGGCCCAGTASimilar to Kluyveromyces lactis strain NRRL Y-1140 chromosome E of strain NRRL Y- 1140 of Kluyveromyces lactis. 
J013130G18TACGGCCCAGTANONE 
J023093I17TACGGCCCAGTANONE 
J033079J01TACGGCCCAGTANONE 
J043027J02TACGGCCCAGTANONE 
J065135G05TACGGCCCAGTANONE 
Os04g0208400AK069629GCCGGCCCGGCACGGCCCAGCCyclin-like F-box domain containing protein. 
AK069629GCTGGGCCGGGCCGCyclin-like F-box domain containing protein. 
Os04g0320200012-089-H09GCGGCCCAGTANONE 
AK069513GCGGCCCAGTAUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
AK104028GCGGCCCAGTANONE 
AK119256GCGGCCCAGTANONE 
J023020H09GCGGCCCAGTANONE 
J065112F21GCGGCCCAGTANONE 
J100036M07GCGGCCCAGTANONE 
Os04g0419100AK107777CACGGCCCAGTConserved hypothetical protein. 
J065037F08CACGGCCCAGTNONE 
Os04g0428900009-068-A06CCTGGGCCGGANONE 
AK061355CCTGGGCCGGASimilar to CSN8. 
AK099153CCTGGGCCGGANONE 
AY336991CCTGGGCCGGANONE 
J023069F08CCTGGGCCGGANONE 
J065112H12CCTGGGCCGGANONE 
J075022F23CCTGGGCCGGANONE 
J090045D23CCTGGGCCGGANONE 
J090067E18CCTGGGCCGGANONE 
J090099H14CCTGGGCCGGANONE 
Os04g0443000011-022-G04TACTGGGCCGGNONE 
AK100533TACTGGGCCGGFAR1 domain containing protein. 
J023101L24TACTGGGCCGGNONE 
Os04g0461100009-136-H10ATCTGGGCCGGGCCGTTTNONE 
009-147-H12ATCTGGGCCGGGCCGTTTNONE 
AK068022ATCTGGGCCGGGCCGTTTPlastid and cyanobacterial ribosomal protein PSRP-3/Ycf65 family protein. 
J013130N24ATCTGGGCCGGGCCGTTTNONE 
J065019D10ATCTGGGCCGGGCCGTTTNONE 
J065168O21ATCTGGGCCGGGCCGTTTNONE 
J075051G06ATCTGGGCCGGGCCGTTTNONE 
J075148G11ATCTGGGCCGGGCCGTTTNONE 
Os04g0479300AK106088TACGGCCCAGCCConserved hypothetical protein. 
Os04g0503800J065116G03GCCGGCCCAGCCCAGTANONE 
Os04g0508100009-180-A02AACTGGGCCGAGTCATGGGCCGCANONE 
AK121759AACTGGGCCGAGTCATGGGCCGCAConserved hypothetical protein. 
J023007G10AACTGGGCCGAGTCATGGGCCGCANONE 
J033089A17AACTGGGCCGAGTCATGGGCCGCANONE 
J065193E13AACTGGGCCGAGTCATGGGCCGCANONE 
J075025M02AACTGGGCCGAGTCATGGGCCGCANONE 
J075027J10AACTGGGCCGAGTCATGGGCCGCANONE 
J075030N03AACTGGGCCGAGTCATGGGCCGCANONE 
J075045I20AACTGGGCCGAGTCATGGGCCGCANONE 
J075065E04AACTGGGCCGAGTCATGGGCCGCANONE 
J075134M16AACTGGGCCGAGTCATGGGCCGCANONE 
J075140B10AACTGGGCCGAGTCATGGGCCGCANONE 
Os04g0527700AK072980AACGGGCCGGGCCGGCCCAGTACHCH domain containing protein. 
J023117E20AACGGGCCGGGCCGGCCCAGTANONE 
J023150D11AACGGGCCGGGCCGGCCCAGTANONE 
Os04g0528100009-090-G06TTTCGGCCCAGCCNONE 
009-168-C11TTTCGGCCCAGCCNONE 
AK065957TTTCGGCCCAGCCConserved hypothetical protein. 
J013039G20TTTCGGCCCAGCCNONE 
J013044D08TTTCGGCCCAGCCNONE 
J065013L14TTTCGGCCCAGCCNONE 
J065143H08TTTCGGCCCAGCCNONE 
J065146C14TTTCGGCCCAGCCNONE 
J065149K22TTTCGGCCCAGCCNONE 
J065156B18TTTCGGCCCAGCCNONE 
J065201A04TTTCGGCCCAGCCNONE 
J065209A04TTTCGGCCCAGCCNONE 
Os04g0530400AK067634CTCGGCCCAGTt-snare domain containing protein. 
Os04g0549600AK101956CCACCAACGGCCCAGATHeat shock protein DnaJ family protein. 
J013057N16CCACCAACGGCCCAGATNONE 
Os04g0551300AK103502AACGGCCCAGCSimilar to Growth regulator like protein. 
Os04g0577000AK073711AACTGGGCCGGAUbiquitin fusion degradation protein UFD1 family protein. 
AK119957AACTGGGCCGGANONE 
J013127H04AACTGGGCCGGANONE 
J033035G06AACTGGGCCGGANONE 
J033061G23AACTGGGCCGGANONE 
J033127L07AACTGGGCCGGANONE 
J065015F17AACTGGGCCGGANONE 
J065062G08AACTGGGCCGGANONE 
J065132M07AACTGGGCCGGANONE 
J065155C12AACTGGGCCGGANONE 
J075055I08AACTGGGCCGGANONE 
J075140D07AACTGGGCCGGANONE 
J090055B21AACTGGGCCGGANONE 
J100031D23AACTGGGCCGGANONE 
Os04g0577500006-039-C03TACTGGGCCGATAAGCCCAGNONE 
006-043-H01TACTGGGCCGATAAGCCCAGNONE 
AK061538TACTGGGCCGATAAGCCCAGNONE 
AK065648TACTGGGCCGATAAGCCCAGTatD-related deoxyribonuclease family protein. 
AK104763TACTGGGCCGATAAGCCCAGNONE 
J013035E21TACTGGGCCGATAAGCCCAGNONE 
J013066M11TACTGGGCCGATAAGCCCAGNONE 
J100026B02TACTGGGCCGATAAGCCCAGNONE 
Os04g0586500015-095-E09CCTGGGCCGAANONE 
AK106447CCTGGGCCGAAConserved hypothetical protein. 
J075065I17CCTGGGCCGAANONE 
J100078J08CCTGGGCCGAANONE 
Os04g0589600011-100-F04ATATGGGCTACTGGGCCGTANONE 
AK061833ATATGGGCTACTGGGCCGTAGlycosyl transferase, group 1 domain containing protein. 
AK098964ATATGGGCTACTGGGCCGTANONE 
AK100053ATATGGGCTACTGGGCCGTANONE 
Os04g0591000006-090-E02ACTGGGCCGANONE 
AK072902ACTGGGCCGARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J065061E23ACTGGGCCGANONE 
Os04g0592500AK066893ACTGGGCCGAPhosphoenolpyruvate carboxykinase (ATP) family protein. 
J013090K18ACTGGGCCGANONE 
Os04g0636400006-064-G07TTCGGCCCAGGCCCAGCNONE 
006-097-D05TTCGGCCCAGGCCCAGCNONE 
AK061848TTCGGCCCAGGCCCAGCSimilar to Senescence-associated protein 6. 
AK099573TTCGGCCCAGGCCCAGCNONE 
J013035J20TTCGGCCCAGGCCCAGCNONE 
Os04g0636600AK073550GACACGTGACTGGGCCGTGCGGTGConserved hypothetical protein. 
AK111077GACACGTGACTGGGCCGTGCGGTGNONE 
J033044F09GACACGTGACTGGGCCGTGCGGTGNONE 
J033091D12GACACGTGACTGGGCCGTGCGGTGNONE 
J043034F06GACACGTGACTGGGCCGTGCGGTGNONE 
J090017C08GACACGTGACTGGGCCGTGCGGTGNONE 
J090027K09GACACGTGACTGGGCCGTGCGGTGNONE 
J090033A12GACACGTGACTGGGCCGTGCGGTGNONE 
Os04g0636900011-028-G03AAACGGCCCAGTTNONE 
012-040-G03AAACGGCCCAGTTNONE 
AK058405AAACGGCCCAGTTNONE 
AK065789AAACGGCCCAGTTNONE 
AK101408AAACGGCCCAGTTNONE 
AK119286AAACGGCCCAGTTNONE 
J013042J24AAACGGCCCAGTTNONE 
J033037I12AAACGGCCCAGTTNONE 
J043031B12AAACGGCCCAGTTNONE 
J065152N10AAACGGCCCAGTTNONE 
J090060K17AAACGGCCCAGTTNONE 
J090083K14AAACGGCCCAGTTNONE 
J100046O13AAACGGCCCAGTTNONE 
J100066G22AAACGGCCCAGTTNONE 
Os04g0644100AK106954CGGACGGCCCAGATSterile alpha motif homology domain containing protein. 
Os04g0650500AK066690TTCGGCCCAGAConserved hypothetical protein. 
AK104273TTCGGCCCAGANONE 
Os04g0659400AK070174GGCTGGGCCGGCENT domain containing protein. 
Os04g0663800013-021-G09GCGGCCCAGCNONE 
AK105321GCGGCCCAGCSimilar to Peptidyl-prolyl cis-trans isomerase 1 (EC 5.2.1.8) (Rotamase Pin1) (PPIase Pin1) (PIN1At). 
Os04g0668700012-043-D01ATCTGGGCCGTCCNONE 
AK065237ATCTGGGCCGTCCPhosphatidylinositol 3- and 4-kinase, catalytic domain containing protein. 
J013002G17ATCTGGGCCGTCCNONE 
J013002I02ATCTGGGCCGTCCNONE 
J013059C11ATCTGGGCCGTCCNONE 
J013059D22ATCTGGGCCGTCCNONE 
J013063G18ATCTGGGCCGTCCNONE 
J013088O04ATCTGGGCCGTCCNONE 
J013095K03ATCTGGGCCGTCCNONE 
J013096K15ATCTGGGCCGTCCNONE 
J013100O17ATCTGGGCCGTCCNONE 
J013102F10ATCTGGGCCGTCCNONE 
J013111L07ATCTGGGCCGTCCNONE 
J013127E24ATCTGGGCCGTCCNONE 
J013130A10ATCTGGGCCGTCCNONE 
J013134L13ATCTGGGCCGTCCNONE 
J023109G08ATCTGGGCCGTCCNONE 
J033022E17ATCTGGGCCGTCCNONE 
J033022N13ATCTGGGCCGTCCNONE 
J033026D04ATCTGGGCCGTCCNONE 
J033028M05ATCTGGGCCGTCCNONE 
J033037E04ATCTGGGCCGTCCNONE 
J033042D11ATCTGGGCCGTCCNONE 
J033044N20ATCTGGGCCGTCCNONE 
J033046K11ATCTGGGCCGTCCNONE 
J033046M21ATCTGGGCCGTCCNONE 
J033076E19ATCTGGGCCGTCCNONE 
J033076J24ATCTGGGCCGTCCNONE 
J033086N03ATCTGGGCCGTCCNONE 
J033095F22ATCTGGGCCGTCCNONE 
J033115F17ATCTGGGCCGTCCNONE 
J033117M06ATCTGGGCCGTCCNONE 
J033125D22ATCTGGGCCGTCCNONE 
J033129J10ATCTGGGCCGTCCNONE 
J033145E18ATCTGGGCCGTCCNONE 
J043021F24ATCTGGGCCGTCCNONE 
J053046G14ATCTGGGCCGTCCNONE 
J053090P03ATCTGGGCCGTCCNONE 
J065042N10ATCTGGGCCGTCCNONE 
J065053B13ATCTGGGCCGTCCNONE 
J065085G03ATCTGGGCCGTCCNONE 
J065173J11ATCTGGGCCGTCCNONE 
J090014M14ATCTGGGCCGTCCNONE 
J090027J07ATCTGGGCCGTCCNONE 
J090039E23ATCTGGGCCGTCCNONE 
J090051C15ATCTGGGCCGTCCNONE 
J090055H06ATCTGGGCCGTCCNONE 
J090062L03ATCTGGGCCGTCCNONE 
J100017L21ATCTGGGCCGTCCNONE 
J100024B07ATCTGGGCCGTCCNONE 
J100032G07ATCTGGGCCGTCCNONE 
J100040N09ATCTGGGCCGTCCNONE 
J100062N03ATCTGGGCCGTCCNONE 
J100078E07ATCTGGGCCGTCCNONE 
J100080E14ATCTGGGCCGTCCNONE 
J100084D07ATCTGGGCCGTCCNONE 
Os04g0669300AK071148TCTGGGCCGCDynamin family protein. 
Os04g0670600AK064255AAAAGCCCGGCCCAGTTNONE 
Os05g0100500AK071466GATCGGACGGCCCAGGSimilar to Debaryomyces hansenii chromosome F of strain CBS767 of Debaryomyces hansenii. 
Os05g0110300AK067116TGCGGCCCAGTANONE 
AK071038TGCGGCCCAGTANAD-dependent epimerase/dehydratase family protein. 
J065060E20TGCGGCCCAGTANONE 
J065093K05TGCGGCCCAGTANONE 
Os05g0125900009-168-E11TCGGCCCAGATGCCCACCTNONE 
AK063078TCGGCCCAGATGCCCACCTConserved hypothetical protein. 
AK119230TCGGCCCAGATGCCCACCTNONE 
Os05g0150600011-043-D06TACGGCCCAGATNONE 
AK072977TACGGCCCAGATATP-dependent DNA helicase RecQ family protein. 
AY180331TACGGCCCAGATNONE 
J090053A16TACGGCCCAGATNONE 
Os05g0169400AK073439GCTGGGCCGGATCGGGCCGAProtein of unknown function DUF1421 family protein. 
J013110E15GCTGGGCCGGATCGGGCCGANONE 
J033044H02GCTGGGCCGGATCGGGCCGANONE 
Os05g0170000003-129-C04CCGATCCGACGGCCCAGANONE 
AK100216CCGATCCGACGGCCCAGAProtein of unknown function DUF266, plant family protein. 
AK103412CCGATCCGACGGCCCAGANONE 
J023045H21CCGATCCGACGGCCCAGANONE 
J033128G01CCGATCCGACGGCCCAGANONE 
J065017O10CCGATCCGACGGCCCAGANONE 
J065032H11CCGATCCGACGGCCCAGANONE 
J065120G09CCGATCCGACGGCCCAGANONE 
Os05g0180700J100062K04GCTGGGCCGGTConserved hypothetical protein. 
Os05g0215600AK066642TGCGGCCCAGTConserved hypothetical protein. 
AK099688TGCGGCCCAGTNONE 
Os05g0295900AK069962AACTGGGCCGGTConserved hypothetical protein. 
Os05g0346300009-033-C06GCGGCCCAGCAAGGCCCATCGNONE 
AF529175GCGGCCCAGCAAGGCCCATCGNONE 
AK061627GCGGCCCAGCAAGGCCCATCGSimilar to 40S ribosomal protein S7. 
AK103081GCGGCCCAGCAAGGCCCATCGNONE 
AK104191GCGGCCCAGCAAGGCCCATCGNONE 
J013049B09GCGGCCCAGCAAGGCCCATCGNONE 
J023142E24GCGGCCCAGCAAGGCCCATCGNONE 
J033052M14GCGGCCCAGCAAGGCCCATCGNONE 
J033089N04GCGGCCCAGCAAGGCCCATCGNONE 
J033118F01GCGGCCCAGCAAGGCCCATCGNONE 
J065054E07GCGGCCCAGCAAGGCCCATCGNONE 
J065066L18GCGGCCCAGCAAGGCCCATCGNONE 
J065078C21GCGGCCCAGCAAGGCCCATCGNONE 
J065127G23GCGGCCCAGCAAGGCCCATCGNONE 
J065128N24GCGGCCCAGCAAGGCCCATCGNONE 
J065144P17GCGGCCCAGCAAGGCCCATCGNONE 
J065147P14GCGGCCCAGCAAGGCCCATCGNONE 
J065170E16GCGGCCCAGCAAGGCCCATCGNONE 
J065175D17GCGGCCCAGCAAGGCCCATCGNONE 
J065176M05GCGGCCCAGCAAGGCCCATCGNONE 
J065218G20GCGGCCCAGCAAGGCCCATCGNONE 
J090074J12GCGGCCCAGCAAGGCCCATCGNONE 
J100019H16GCGGCCCAGCAAGGCCCATCGNONE 
J100031N24GCGGCCCAGCAAGGCCCATCGNONE 
J100072G08GCGGCCCAGCAAGGCCCATCGNONE 
J100086I23GCGGCCCAGCAAGGCCCATCGNONE 
Os05g0397700AK067298GAGGCCCACTGGGCCGTGSecY protein family protein. 
Os05g0413000AK058277TCTGGGCCGTGMitochodrial transcription termination factor-related family protein. 
Os05g0415600AK065818TGCGGCCCAGGNONE 
J013042K21TGCGGCCCAGGNONE 
J013114E15TGCGGCCCAGGNONE 
J013131H02TGCGGCCCAGGNONE 
J023041G06TGCGGCCCAGGNONE 
J100037M21TGCGGCCCAGGNONE 
Os05g0424700AK107848GCCGGCCCAGCSimilar to Copper transporter 1. 
Os05g0428600AK106696CCAACGGCCCAGATCACGCCACTGACSimilar to HSP70 precursor. 
Os05g0451200AK073037GCTGGGCCGGAConserved hypothetical protein. 
Os05g0455600AK060152CACGGCCCAGTAPrenylated rab acceptor PRA1 family protein. 
AK103269CACGGCCCAGTANONE 
AK105995CACGGCCCAGTANONE 
J023109E13CACGGCCCAGTANONE 
J023120K13CACGGCCCAGTANONE 
J033124H03CACGGCCCAGTANONE 
Os05g0465000AK111286CCCGGCCCAGAConserved hypothetical protein. 
Os05g0480700AK100850AACTGGGCCGTCCSimilar to Vacuolar ATP synthase subunit E (EC 3.6.3.14) (V-ATPase E subunit) (Vacuolar proton pump E subunit). 
J023123I11AACTGGGCCGTCCNONE 
Os05g0490900AK111382TTCGGCCCAGCCCAAAConserved hypothetical protein. 
Os05g0495100AK108028CCTGGGCCGTGGConserved hypothetical protein. 
Os05g0501300006-075-B11ATCTGGGCCGTTGNONE 
006-083-H08ATCTGGGCCGTTGNONE 
AK059889ATCTGGGCCGTTGSimilar to Flavoprotein wrbA (Trp repressor binding protein). 
J043030K02ATCTGGGCCGTTGNONE 
Os05g0509200AK061566ACTGGGCCGGTNADH dehydrogenase (ubiquinone), 24 kDa subunit family protein. 
AK099007ACTGGGCCGGTNONE 
AK100226ACTGGGCCGGTNONE 
J013114B12ACTGGGCCGGTNONE 
J023048D09ACTGGGCCGGTNONE 
Os05g0526300AK099438CCTGGGCCGCNONE 
Os05g0548100AK060333GCGGCCCAGATConserved hypothetical protein. 
AK100682GCGGCCCAGATNONE 
J013151E01GCGGCCCAGATNONE 
J023113L22GCGGCCCAGATNONE 
J043027A19GCGGCCCAGATNONE 
J075093E06GCGGCCCAGATNONE 
J090060D15GCGGCCCAGATNONE 
J090082J03GCGGCCCAGATNONE 
J100050E01GCGGCCCAGATNONE 
Os05g0552900AK102095GCCCGGCCCAGTAMAP65/ASE1 family protein. 
Os05g0566300AK099641GGCTGGGCCGA16S rRNA processing protein RimM family protein. 
Os05g0571400009-019-B04GACGGCCCGGCCCAGTTNONE 
009-043-H02GACGGCCCGGCCCAGTTNONE 
AK062369GACGGCCCGGCCCAGTTConserved hypothetical protein. 
Os05g0592800AK067627CAACGGCCCAGASimilar to Protein phosphatase 2C ABI2 (EC 3.1.3.16) (PP2C) (Abscisic acid- insensitive 2). 
AK070388CAACGGCCCAGANONE 
AK104323CAACGGCCCAGANONE 
Os05g0597100011-044-C10GGACGGCCCAGCNONE 
AF255711GGACGGCCCAGCNONE 
AK072845GGACGGCCCAGCSimilar to Nucleolar histone deacetylase HD2-p39. 
J023050H16GGACGGCCCAGCNONE 
J023135M22GGACGGCCCAGCNONE 
J023141B21GGACGGCCCAGCNONE 
J023142J09GGACGGCCCAGCNONE 
J033025E09GGACGGCCCAGCNONE 
J033111A20GGACGGCCCAGCNONE 
J033126I01GGACGGCCCAGCNONE 
Os06g0101600AF093636TCCGGCCCAGANONE 
AK070447TCCGGCCCAGAPlastocyanin, chloroplast precursor. 
J065001A20TCCGGCCCAGANONE 
J065019M17TCCGGCCCAGANONE 
J065021H18TCCGGCCCAGANONE 
J065061A17TCCGGCCCAGANONE 
J065073L02TCCGGCCCAGANONE 
J065099F17TCCGGCCCAGANONE 
J065101C23TCCGGCCCAGANONE 
J065121E23TCCGGCCCAGANONE 
J065122N04TCCGGCCCAGANONE 
J065141N05TCCGGCCCAGANONE 
J065143N21TCCGGCCCAGANONE 
J065161H09TCCGGCCCAGANONE 
J065161J04TCCGGCCCAGANONE 
J065162P20TCCGGCCCAGANONE 
J065182K10TCCGGCCCAGANONE 
J065184M05TCCGGCCCAGANONE 
J065186H24TCCGGCCCAGANONE 
J065189G21TCCGGCCCAGANONE 
J065190N14TCCGGCCCAGANONE 
J065191H08TCCGGCCCAGANONE 
J065205H17TCCGGCCCAGANONE 
J075001E03TCCGGCCCAGANONE 
J075001H21TCCGGCCCAGANONE 
J075003J23TCCGGCCCAGANONE 
J075003K01TCCGGCCCAGANONE 
J075005I11TCCGGCCCAGANONE 
J075007F16TCCGGCCCAGANONE 
J075017I11TCCGGCCCAGANONE 
J075018O05TCCGGCCCAGANONE 
J075019G24TCCGGCCCAGANONE 
J075032D04TCCGGCCCAGANONE 
J075032N13TCCGGCCCAGANONE 
J075033C09TCCGGCCCAGANONE 
J075033D11TCCGGCCCAGANONE 
J075039A20TCCGGCCCAGANONE 
J075058P12TCCGGCCCAGANONE 
J075062E10TCCGGCCCAGANONE 
J075062P16TCCGGCCCAGANONE 
J075063C17TCCGGCCCAGANONE 
J075066E07TCCGGCCCAGANONE 
J075066I20TCCGGCCCAGANONE 
J075075K21TCCGGCCCAGANONE 
J075078F03TCCGGCCCAGANONE 
J075082F10TCCGGCCCAGANONE 
J075086G16TCCGGCCCAGANONE 
J075087E07TCCGGCCCAGANONE 
J075087K06TCCGGCCCAGANONE 
J075087L04TCCGGCCCAGANONE 
J075088B16TCCGGCCCAGANONE 
J075088D02TCCGGCCCAGANONE 
J075094H21TCCGGCCCAGANONE 
J075094I24TCCGGCCCAGANONE 
J075094K10TCCGGCCCAGANONE 
J075095C18TCCGGCCCAGANONE 
J075097B05TCCGGCCCAGANONE 
J075099C13TCCGGCCCAGANONE 
J075099H22TCCGGCCCAGANONE 
J075099L16TCCGGCCCAGANONE 
J075104K08TCCGGCCCAGANONE 
J075118O06TCCGGCCCAGANONE 
J075119E15TCCGGCCCAGANONE 
J075124N06TCCGGCCCAGANONE 
J075126G02TCCGGCCCAGANONE 
J075127L24TCCGGCCCAGANONE 
J075131E23TCCGGCCCAGANONE 
J075140H06TCCGGCCCAGANONE 
J075146I20TCCGGCCCAGANONE 
J075146N24TCCGGCCCAGANONE 
J075147I19TCCGGCCCAGANONE 
J075155K07TCCGGCCCAGANONE 
J075156C05TCCGGCCCAGANONE 
J075161G07TCCGGCCCAGANONE 
J075164G01TCCGGCCCAGANONE 
J075170J18TCCGGCCCAGANONE 
J075172G17TCCGGCCCAGANONE 
J075176G10TCCGGCCCAGANONE 
J075178C05TCCGGCCCAGANONE 
J075179G01TCCGGCCCAGANONE 
J075181E24TCCGGCCCAGANONE 
J080029D19TCCGGCCCAGANONE 
J080034L11TCCGGCCCAGANONE 
J080039G07TCCGGCCCAGANONE 
J080062M23TCCGGCCCAGANONE 
J080302A01TCCGGCCCAGANONE 
J100042I15TCCGGCCCAGANONE 
J100043G22TCCGGCCCAGANONE 
J100056L12TCCGGCCCAGANONE 
J100061A12TCCGGCCCAGANONE 
J100073O20TCCGGCCCAGANONE 
J100082I08TCCGGCCCAGANONE 
Os06g0104000AK068490ACTGGGCCGTTConserved hypothetical protein. 
Os06g0111800AK102134GCCGGCCCAGTNONE 
AK105393GCCGGCCCAGTSimilar to CSLD2 (Fragment). 
Os06g0114600015-077-E06CCTGGGCCGGGCCNONE 
015-077-E06TCCGGCCCAGTANONE 
AK067972CCTGGGCCGGGCCConserved hypothetical protein. 
AK067972TCCGGCCCAGTAConserved hypothetical protein. 
Os06g0132600006-104-C03GCGGCCCAGCNONE 
AK061226GCGGCCCAGCConserved hypothetical protein. 
AK074010GCGGCCCAGCNONE 
J033076A22GCGGCCCAGCNONE 
Os06g0152400AK064640ATCCGACGGCCCAGATSimilar to Hexaprenyldihydroxybenzoate methyltransferase, mitochondrial precursor (EC 2.1.1.114) (Dihydroxyhexaprenylbenzoate methyltransferase) (3,4- dihydroxy-5-hexaprenylbenzoate methyltransferase) (DHHB methyltransferase) (DHHB-MT) (DHHB-MTase). 
AK064640ATCTGGGCCGTCCSimilar to Hexaprenyldihydroxybenzoate methyltransferase, mitochondrial precursor (EC 2.1.1.114) (Dihydroxyhexaprenylbenzoate methyltransferase) (3,4- dihydroxy-5-hexaprenylbenzoate methyltransferase) (DHHB methyltransferase) (DHHB-MT) (DHHB-MTase). 
J075086I24ATCCGACGGCCCAGATNONE 
J075086I24ATCTGGGCCGTCCNONE 
J075127E23ATCCGACGGCCCAGATNONE 
J075127E23ATCTGGGCCGTCCNONE 
J075157B19ATCCGACGGCCCAGATNONE 
J075157B19ATCTGGGCCGTCCNONE 
J090038E06ATCCGACGGCCCAGATNONE 
J090038E06ATCTGGGCCGTCCNONE 
Os06g0152800003-125-D04ATTTGGGCCGGCCCAGGNONE 
AK099578ATTTGGGCCGGCCCAGGConserved hypothetical protein. 
Os06g0156700AK107226GCCGGCCCAGCCCLipolytic enzyme, G-D-S-L family protein. 
J075021O05GCCGGCCCAGCCCNONE 
J075023M12GCCGGCCCAGCCCNONE 
J075041C14GCCGGCCCAGCCCNONE 
J075041C19GCCGGCCCAGCCCNONE 
J075064F08GCCGGCCCAGCCCNONE 
J075116I03GCCGGCCCAGCCCNONE 
J075123I02GCCGGCCCAGCCCNONE 
Os06g0157800AK121504TCGGCCCGGCCCAGTTSimilar to CG7224 (Fragment). 
J033022L20TCGGCCCGGCCCAGTTNONE 
J075033D09TCGGCCCGGCCCAGTTNONE 
Os06g0210500AK066979GGACGGCTGGGCCGTGGGCCCCCGTGGGCTGCCGTGGGCCTTSimilar to Mitochondrial phosphate transporter. 
Os06g0266800009-057-G11CGGCCCAGCNONE 
AK062516CGGCCCAGCSimilar to GAST1 protein precursor. 
Os06g0291100J043017O10CTTGGGCTTCCGGCCCAGCHypothetical protein. 
Os06g0326400AK065052CCAACGGCCCAGATCTCTCCGCNONE 
AK121116CCAACGGCCCAGATCTCTCCGCPyrophosphate-dependent phosphofructokinase PfpB family protein. 
J013107E23CCAACGGCCCAGATCTCTCCGCNONE 
J013129K13CCAACGGCCCAGATCTCTCCGCNONE 
J023010F22CCAACGGCCCAGATCTCTCCGCNONE 
J023120K19CCAACGGCCCAGATCTCTCCGCNONE 
Os06g0332500009-108-G06ACCGGCCCAGTNONE 
009-119-F06ACCGGCCCAGTNONE 
AK121262ACCGGCCCAGTConserved hypothetical protein. 
J023104L05ACCGGCCCAGTNONE 
J033022F22ACCGGCCCAGTNONE 
Os06g0355500AK065914GCTGGGCCGCCCAACABromodomain containing protein. 
Os06g0498500AK099764GCAGCCCACCCGACTGGGCCGGTNONE 
AK103794GCAGCCCACCCGACTGGGCCGGTNucleolar complex-associated family protein. 
AK121899GCAGCCCACCCGACTGGGCCGGTNONE 
Os06g0530200009-042-B02ACCGGCCCAGCNONE 
009-050-E10ACCGGCCCAGCNONE 
009-060-F07ACCGGCCCAGCNONE 
009-117-H08ACCGGCCCAGCNONE 
009-129-C10ACCGGCCCAGCNONE 
AK073116ACCGGCCCAGCConserved hypothetical protein. 
AK104077ACCGGCCCAGCNONE 
J065032N16ACCGGCCCAGCNONE 
J065153K07ACCGGCCCAGCNONE 
J065169N18ACCGGCCCAGCNONE 
J065190H18ACCGGCCCAGCNONE 
J075127E14ACCGGCCCAGCNONE 
J090008F20ACCGGCCCAGCNONE 
Os06g0598900AK100386TACGGCCCAGCCCAACASimilar to Serine-threonine kinase receptor-associated protein (UNR-interacting protein) (WD-40 repeat protein PT-WD) (MAP activator with WD repeats). 
J013088O05TACGGCCCAGCCCAACANONE 
J090043L20TACGGCCCAGCCCAACANONE 
Os06g0647900AK073750ACCGGCCCAGATConserved hypothetical protein. 
J033029K17ACCGGCCCAGATNONE 
J033070L21ACCGGCCCAGATNONE 
Os06g0656800AK109762ATCTGGGCCGTABeta-Ig-H3/fasciclin domain containing protein. 
Os06g0664400Os06g0664400ATCCAACGGCCCAGAHMG-I and HMG-Y, DNA-binding domain containing protein. 
Os06g0667400AK065424GACGGCCCAGATConserved hypothetical protein. 
AK065580GACGGCCCAGATNONE 
Os06g0693000AK064280TCTGGGCCGGGCCGTGProtein kinase-like domain containing protein. 
Os06g0704300AK107008ATCTGGGCCGGGCCCZinc finger, CCCH-type domain containing protein. 
J065038I12ATCTGGGCCGGGCCCNONE 
J065079E03ATCTGGGCCGGGCCCNONE 
J075035B15ATCTGGGCCGGGCCCNONE 
J090072D21ATCTGGGCCGGGCCCNONE 
Os06g0708600009-019-C12ATCTGGGCCGCNONE 
013-092-H09ATCTGGGCCGCNONE 
014-031-G05ATCTGGGCCGCNONE 
AK100915ATCTGGGCCGCConserved hypothetical protein. 
J065065F24ATCTGGGCCGCNONE 
J065208J10ATCTGGGCCGCNONE 
J100068H01ATCTGGGCCGCNONE 
J100084D18ATCTGGGCCGCNONE 
Os06g0709100006-057-D06GCTGGGCCGTCNONE 
011-040-A08GCTGGGCCGTCNONE 
016-044-A01GCTGGGCCGTCNONE 
AK059732GCTGGGCCGTCNONE 
AK070881GCTGGGCCGTCCyclin-like F-box domain containing protein. 
AK103683GCTGGGCCGTCNONE 
J065026P10GCTGGGCCGTCNONE 
J090017L13GCTGGGCCGTCNONE 
Os06g0715000AK107114GGGCTGGGCCGGCConserved hypothetical protein. 
Os06g0726800AK070518GATCCGACGGCCCAGATG2/mitotic-specific cyclin 2 (B-like cyclin) (CycOs2). 
J023055K12GATCCGACGGCCCAGATNONE 
J053032B13GATCCGACGGCCCAGATNONE 
X82036GATCCGACGGCCCAGATNONE 
Os07g0105300AK107419GCCGGGCCTGGGCCGGCConserved hypothetical protein. 
AK109521GCCGGGCCTGGGCCGGCNONE 
Os07g0110100009-059-D11GCTGGGCCGAGNONE 
AK071499GCTGGGCCGAGConserved hypothetical protein. 
J065064P17GCTGGGCCGAGNONE 
J065111B09GCTGGGCCGAGNONE 
J075099A14GCTGGGCCGAGNONE 
J075139C23GCTGGGCCGAGNONE 
Os07g0136300AK064609GCTGGGCCGAAConserved hypothetical protein. 
Os07g0146600J075074M15GCGGCCCAGAConserved hypothetical protein. 
J075120F11GCGGCCCAGANONE 
J075170L13GCGGCCCAGANONE 
J080302A21GCGGCCCAGANONE 
J080304J04GCGGCCCAGANONE 
J080308I12GCGGCCCAGANONE 
J080312F11GCGGCCCAGANONE 
J080315M22GCGGCCCAGANONE 
Os07g0160300AK065685TCTGGGCCGTGConserved hypothetical protein. 
J013020G13TCTGGGCCGTGNONE 
J013024B14TCTGGGCCGTGNONE 
J013040D10TCTGGGCCGTGNONE 
J043024N02TCTGGGCCGTGNONE 
J065063E19TCTGGGCCGTGNONE 
J065200G01TCTGGGCCGTGNONE 
J090098A05TCTGGGCCGTGNONE 
J100089M23TCTGGGCCGTGNONE 
Os07g0164500J013094M18CCTGGGCCGGCNONE 
J013094M18GGCTGGGCCGTGNONE 
J013153L05CCTGGGCCGGCNONE 
J013153L05GGCTGGGCCGTGNONE 
J023011J18CCTGGGCCGGCNONE 
J023011J18GGCTGGGCCGTGNONE 
J023106H21CCTGGGCCGGCNONE 
J023106H21GGCTGGGCCGTGNONE 
J033105F10CCTGGGCCGGCNONE 
J033105F10GGCTGGGCCGTGNONE 
J065210M20CCTGGGCCGGCSimilar to Dolichyl pyrophosphate Man9GlcNAc2 alpha-1,3-glucosyltransferase (EC 2.4.1.-) (Dolichyl-P-Glc:Man9GlcNAc2-PP-dolichyl glucosyltransferase). 
J065210M20GGCTGGGCCGTGSimilar to Dolichyl pyrophosphate Man9GlcNAc2 alpha-1,3-glucosyltransferase (EC 2.4.1.-) (Dolichyl-P-Glc:Man9GlcNAc2-PP-dolichyl glucosyltransferase). 
J090060F05CCTGGGCCGGCNONE 
J090060F05GGCTGGGCCGTGNONE 
J090061C13CCTGGGCCGGCNONE 
J090061C13GGCTGGGCCGTGNONE 
J090074K15CCTGGGCCGGCNONE 
J090074K15GGCTGGGCCGTGNONE 
Os07g0185700012-040-A11CCTGGGCCGANONE 
AK070572CCTGGGCCGAConserved hypothetical protein. 
J065116D10CCTGGGCCGANONE 
J065122F20CCTGGGCCGANONE 
Os07g0190900012-063-F11TCTGGGCCGTTTGGGCCGAANONE 
AK073533TCTGGGCCGTTTGGGCCGAASMAD/FHA domain containing protein. 
J013110O09TCTGGGCCGTTTGGGCCGAANONE 
J033041I12TCTGGGCCGTTTGGGCCGAANONE 
J033046D05TCTGGGCCGTTTGGGCCGAANONE 
J033101K24TCTGGGCCGTTTGGGCCGAANONE 
J090009F10TCTGGGCCGTTTGGGCCGAANONE 
J090095B17TCTGGGCCGTTTGGGCCGAANONE 
Os07g0191000AK071379TTCGGCCCAAACGGCCCAGAInositol monophosphatase family protein. 
AK103440TTCGGCCCAAACGGCCCAGANONE 
Os07g0191700AK066389GCGGCCCAGCCCAAGSimilar to AT.I.24-9 protein (Fragment). 
AK103768GCGGCCCAGCCCAAGNONE 
Os07g0205700AK120553GCGGCCCAGTTSimilar to Xaa-Pro dipeptidase (EC 3.4.-.-). 
J065022J24GCGGCCCAGTTNONE 
Os07g0209000AK059111GATCGGACGGCCCAGATSimilar to Dolichyl-di-phosphooligosaccharide-protein glycotransferase (Oligosaccharyltransferase)-like. 
AK099319GATCGGACGGCCCAGATNONE 
Os07g0222800009-072-E05AAACGGCCCAGCNONE 
AK060442AAACGGCCCAGCNONE 
AK100823AAACGGCCCAGCAcyl carrier protein-like protein. 
AK103131AAACGGCCCAGCNONE 
AY224456AAACGGCCCAGCNONE 
J075026H13AAACGGCCCAGCNONE 
J075142G06AAACGGCCCAGCNONE 
J100033K08AAACGGCCCAGCNONE 
Os07g0242600AK065752CCTGGGCCGGACyclin-like F-box domain containing protein. 
J013037K22CCTGGGCCGGANONE 
Os07g0245100J023048C16CCCACGGGACTCGACGCCCACCACACGGCCCAGCNONE 
J023110L14CCCACGGGACTCGACGCCCACCACACGGCCCAGCNONE 
J053023B18CCCACGGGACTCGACGCCCACCACACGGCCCAGCNONE 
J053031L17CCCACGGGACTCGACGCCCACCACACGGCCCAGCNONE 
J065035I22CCCACGGGACTCGACGCCCACCACACGGCCCAGCNONE 
J065043D21CCCACGGGACTCGACGCCCACCACACGGCCCAGCNONE 
J065072L16CCCACGGGACTCGACGCCCACCACACGGCCCAGCNONE 
J065214I23CCCACGGGACTCGACGCCCACCACACGGCCCAGCNONE 
Os07g0301200AB110202GCCGGCCCGGCACGGCCCAGCNONE 
AB110202GCTGGGCCGGGCCGNONE 
AK073463GCCGGCCCGGCACGGCCCAGCSimilar to RNA helicase (Fragment). 
AK073463GCTGGGCCGGGCCGSimilar to RNA helicase (Fragment). 
Os07g0406300AK064867TCGGCCCAGCSimilar to Glucose-6-phosphate 1-dehydrogenase precursor (EC 1.1.1.49). 
AK099891TCGGCCCAGCNONE 
AY339367TCGGCCCAGCNONE 
Os07g0502200006-027-C06GCCGGCCCAGGNONE 
012-007-C05GCCGGCCCAGGNONE 
AK120682GCCGGCCCAGGMulti antimicrobial extrusion protein MatE family protein. 
J053045G13GCCGGCCCAGGNONE 
J053064I18GCCGGCCCAGGNONE 
J053091G24GCCGGCCCAGGNONE 
J065016E10GCCGGCCCAGGNONE 
J065021B18GCCGGCCCAGGNONE 
J065022A17GCCGGCCCAGGNONE 
J065059D18GCCGGCCCAGGNONE 
J065063N19GCCGGCCCAGGNONE 
J065065O10GCCGGCCCAGGNONE 
J065196F12GCCGGCCCAGGNONE 
J065208I01GCCGGCCCAGGNONE 
J065218G15GCCGGCCCAGGNONE 
J100040G01GCCGGCCCAGGNONE 
J100060M03GCCGGCCCAGGNONE 
J100061P09GCCGGCCCAGGNONE 
J100065P05GCCGGCCCAGGNONE 
Os07g0512100Os07g0512100TTGTGGGCCCGGCCCGGCCCGGCCCAGTTAnkyrin repeat containing protein. 
Os07g0516900009-108-C10GCGGCCCAGATNONE 
AK062798GCGGCCCAGATNONE 
Os07g0539900AK071889GCCCGGCCCAGTTSimilar to Beta-1,3-glucanase-like protein. 
AK098943GCCCGGCCCAGTTNONE 
J013047P11GCCCGGCCCAGTTNONE 
Os07g0546700009-110-H10TACTGGGCCGTCNONE 
AK058262TACTGGGCCGTCNONE 
J065154I05TACTGGGCCGTCNONE 
J065175P09TACTGGGCCGTCNONE 
J065187F11TACTGGGCCGTCNONE 
J075114K16TACTGGGCCGTCNONE 
J090031L21TACTGGGCCGTCNONE 
U86017TACTGGGCCGTCSimilar to 60S ribosomal protein L38. 
Os07g0555400AK070977GCTGGGCCGGGCCGCCCATTTConserved hypothetical protein. 
Os07g0562700003-111-G08GCTGGGCCGAAANONE 
004-013-E07GCTGGGCCGAAANONE 
006-021-D03GCTGGGCCGAAANONE 
006-021-D07GCTGGGCCGAAANONE 
006-021-F09GCTGGGCCGAAANONE 
006-023-D01GCTGGGCCGAAANONE 
006-024-F04GCTGGGCCGAAANONE 
006-024-G09GCTGGGCCGAAANONE 
006-024-G11GCTGGGCCGAAANONE 
006-025-A10GCTGGGCCGAAANONE 
006-025-B08GCTGGGCCGAAANONE 
006-025-E10GCTGGGCCGAAANONE 
006-025-F10GCTGGGCCGAAANONE 
006-026-B04GCTGGGCCGAAANONE 
006-026-C08GCTGGGCCGAAANONE 
006-026-D03GCTGGGCCGAAANONE 
006-026-F03GCTGGGCCGAAANONE 
006-026-F08GCTGGGCCGAAANONE 
006-026-F12GCTGGGCCGAAANONE 
006-027-A10GCTGGGCCGAAANONE 
006-027-C03GCTGGGCCGAAANONE 
006-028-C03GCTGGGCCGAAANONE 
006-029-E02GCTGGGCCGAAANONE 
006-029-G05GCTGGGCCGAAANONE 
006-030-A10GCTGGGCCGAAANONE 
006-030-C06GCTGGGCCGAAANONE 
006-030-D03GCTGGGCCGAAANONE 
006-030-D06GCTGGGCCGAAANONE 
006-030-G05GCTGGGCCGAAANONE 
006-031-B10GCTGGGCCGAAANONE 
006-031-D04GCTGGGCCGAAANONE 
006-031-D11GCTGGGCCGAAANONE 
006-031-H09GCTGGGCCGAAANONE 
006-032-C09GCTGGGCCGAAANONE 
006-032-H09GCTGGGCCGAAANONE 
006-033-B02GCTGGGCCGAAANONE 
006-033-B09GCTGGGCCGAAANONE 
006-033-E01GCTGGGCCGAAANONE 
006-033-F06GCTGGGCCGAAANONE 
006-033-G03GCTGGGCCGAAANONE 
006-034-A08GCTGGGCCGAAANONE 
006-034-C09GCTGGGCCGAAANONE 
006-034-F06GCTGGGCCGAAANONE 
006-035-B12GCTGGGCCGAAANONE 
006-035-C12GCTGGGCCGAAANONE 
006-035-H04GCTGGGCCGAAANONE 
006-035-H12GCTGGGCCGAAANONE 
006-036-A05GCTGGGCCGAAANONE 
006-036-A09GCTGGGCCGAAANONE 
006-036-B10GCTGGGCCGAAANONE 
006-036-C03GCTGGGCCGAAANONE 
006-036-E06GCTGGGCCGAAANONE 
006-037-H11GCTGGGCCGAAANONE 
006-038-G01GCTGGGCCGAAANONE 
006-039-B01GCTGGGCCGAAANONE 
006-039-B12GCTGGGCCGAAANONE 
006-039-C02GCTGGGCCGAAANONE 
006-039-E06GCTGGGCCGAAANONE 
006-039-G12GCTGGGCCGAAANONE 
006-040-G07GCTGGGCCGAAANONE 
006-041-H04GCTGGGCCGAAANONE 
006-042-A11GCTGGGCCGAAANONE 
006-042-E07GCTGGGCCGAAANONE 
006-042-F12GCTGGGCCGAAANONE 
006-043-C01GCTGGGCCGAAANONE 
006-045-H12GCTGGGCCGAAANONE 
006-046-A12GCTGGGCCGAAANONE 
006-046-F03GCTGGGCCGAAANONE 
006-047-A07GCTGGGCCGAAANONE 
006-047-A09GCTGGGCCGAAANONE 
006-047-E10GCTGGGCCGAAANONE 
006-047-G12GCTGGGCCGAAANONE 
006-048-B04GCTGGGCCGAAANONE 
006-049-D01GCTGGGCCGAAANONE 
006-049-G02GCTGGGCCGAAANONE 
006-049-G10GCTGGGCCGAAANONE 
006-049-H04GCTGGGCCGAAANONE 
006-050-D05GCTGGGCCGAAANONE 
006-050-F05GCTGGGCCGAAANONE 
006-051-B05GCTGGGCCGAAANONE 
006-051-G12GCTGGGCCGAAANONE 
006-052-D12GCTGGGCCGAAANONE 
006-053-D06GCTGGGCCGAAANONE 
006-054-H02GCTGGGCCGAAANONE 
006-055-A03GCTGGGCCGAAANONE 
006-055-C01GCTGGGCCGAAANONE 
006-055-E07GCTGGGCCGAAANONE 
006-055-H06GCTGGGCCGAAANONE 
006-056-F06GCTGGGCCGAAANONE 
006-057-D03GCTGGGCCGAAANONE 
006-057-D05GCTGGGCCGAAANONE 
006-057-G01GCTGGGCCGAAANONE 
006-058-A03GCTGGGCCGAAANONE 
006-058-B06GCTGGGCCGAAANONE 
006-059-A09GCTGGGCCGAAANONE 
006-059-H11GCTGGGCCGAAANONE 
006-060-A04GCTGGGCCGAAANONE 
006-060-A09GCTGGGCCGAAANONE 
006-060-C11GCTGGGCCGAAANONE 
006-060-D08GCTGGGCCGAAANONE 
006-061-A04GCTGGGCCGAAANONE 
006-061-E01GCTGGGCCGAAANONE 
006-061-G10GCTGGGCCGAAANONE 
006-061-H12GCTGGGCCGAAANONE 
006-062-B07GCTGGGCCGAAANONE 
006-062-G03GCTGGGCCGAAANONE 
006-062-H12GCTGGGCCGAAANONE 
006-063-D05GCTGGGCCGAAANONE 
006-063-E04GCTGGGCCGAAANONE 
006-063-F05GCTGGGCCGAAANONE 
006-063-G05GCTGGGCCGAAANONE 
006-064-B07GCTGGGCCGAAANONE 
006-065-C11GCTGGGCCGAAANONE 
006-065-H02GCTGGGCCGAAANONE 
006-067-C12GCTGGGCCGAAANONE 
006-067-F10GCTGGGCCGAAANONE 
006-068-E02GCTGGGCCGAAANONE 
006-068-G04GCTGGGCCGAAANONE 
006-069-A02GCTGGGCCGAAANONE 
006-071-A07GCTGGGCCGAAANONE 
006-072-F11GCTGGGCCGAAANONE 
006-072-F12GCTGGGCCGAAANONE 
006-073-E12GCTGGGCCGAAANONE 
006-073-F08GCTGGGCCGAAANONE 
006-073-H07GCTGGGCCGAAANONE 
006-074-A07GCTGGGCCGAAANONE 
006-075-A12GCTGGGCCGAAANONE 
006-075-B01GCTGGGCCGAAANONE 
006-075-H10GCTGGGCCGAAANONE 
006-075-H12GCTGGGCCGAAANONE 
006-076-B06GCTGGGCCGAAANONE 
006-077-A09GCTGGGCCGAAANONE 
006-077-D05GCTGGGCCGAAANONE 
006-078-C11GCTGGGCCGAAANONE 
006-078-D12GCTGGGCCGAAANONE 
006-078-E02GCTGGGCCGAAANONE 
006-079-A01GCTGGGCCGAAANONE 
006-079-E02GCTGGGCCGAAANONE 
006-079-F03GCTGGGCCGAAANONE 
006-080-G11GCTGGGCCGAAANONE 
006-081-C02GCTGGGCCGAAANONE 
006-081-C08GCTGGGCCGAAANONE 
006-082-B06GCTGGGCCGAAANONE 
006-082-C11GCTGGGCCGAAANONE 
006-082-H04GCTGGGCCGAAANONE 
006-083-E04GCTGGGCCGAAANONE 
006-083-H12GCTGGGCCGAAANONE 
006-084-C08GCTGGGCCGAAANONE 
006-084-E07GCTGGGCCGAAANONE 
006-084-E10GCTGGGCCGAAANONE 
006-085-E06GCTGGGCCGAAANONE 
006-085-E10GCTGGGCCGAAANONE 
006-086-F06GCTGGGCCGAAANONE 
006-087-D08GCTGGGCCGAAANONE 
006-087-F03GCTGGGCCGAAANONE 
006-087-F10GCTGGGCCGAAANONE 
006-087-G07GCTGGGCCGAAANONE 
006-088-A02GCTGGGCCGAAANONE 
006-089-A04GCTGGGCCGAAANONE 
006-089-B12GCTGGGCCGAAANONE 
006-089-D06GCTGGGCCGAAANONE 
006-089-D10GCTGGGCCGAAANONE 
006-089-H05GCTGGGCCGAAANONE 
006-090-C06GCTGGGCCGAAANONE 
006-091-A03GCTGGGCCGAAANONE 
006-091-E04GCTGGGCCGAAANONE 
006-091-H12GCTGGGCCGAAANONE 
006-092-A08GCTGGGCCGAAANONE 
006-092-F01GCTGGGCCGAAANONE 
006-092-G08GCTGGGCCGAAANONE 
006-093-B12GCTGGGCCGAAANONE 
006-093-D04GCTGGGCCGAAANONE 
006-093-F01GCTGGGCCGAAANONE 
006-094-A08GCTGGGCCGAAANONE 
006-094-F01GCTGGGCCGAAANONE 
006-094-F03GCTGGGCCGAAANONE 
006-095-C12GCTGGGCCGAAANONE 
006-095-E10GCTGGGCCGAAANONE 
006-095-E12GCTGGGCCGAAANONE 
006-095-G06GCTGGGCCGAAANONE 
006-096-B12GCTGGGCCGAAANONE 
006-096-C12GCTGGGCCGAAANONE 
006-096-G02GCTGGGCCGAAANONE 
006-097-D01GCTGGGCCGAAANONE 
006-097-D07GCTGGGCCGAAANONE 
006-097-F04GCTGGGCCGAAANONE 
006-098-C07GCTGGGCCGAAANONE 
006-098-D04GCTGGGCCGAAANONE 
006-099-E06GCTGGGCCGAAANONE 
006-099-F02GCTGGGCCGAAANONE 
006-099-F10GCTGGGCCGAAANONE 
006-100-A07GCTGGGCCGAAANONE 
006-100-B10GCTGGGCCGAAANONE 
006-100-G01GCTGGGCCGAAANONE 
006-100-H06GCTGGGCCGAAANONE 
006-101-D01GCTGGGCCGAAANONE 
006-101-F03GCTGGGCCGAAANONE 
006-102-A12GCTGGGCCGAAANONE 
006-102-B11GCTGGGCCGAAANONE 
006-102-C03GCTGGGCCGAAANONE 
006-102-F11GCTGGGCCGAAANONE 
006-103-A08GCTGGGCCGAAANONE 
006-103-B06GCTGGGCCGAAANONE 
006-103-D01GCTGGGCCGAAANONE 
006-103-F02GCTGGGCCGAAANONE 
006-104-B02GCTGGGCCGAAANONE 
006-104-C01GCTGGGCCGAAANONE 
006-104-F09GCTGGGCCGAAANONE 
006-104-H11GCTGGGCCGAAANONE 
006-105-A03GCTGGGCCGAAANONE 
006-105-D09GCTGGGCCGAAANONE 
006-106-B10GCTGGGCCGAAANONE 
006-107-A06GCTGGGCCGAAANONE 
006-107-C04GCTGGGCCGAAANONE 
006-107-E03GCTGGGCCGAAANONE 
006-107-F05GCTGGGCCGAAANONE 
006-108-C09GCTGGGCCGAAANONE 
006-109-C09GCTGGGCCGAAANONE 
006-109-D10GCTGGGCCGAAANONE 
006-109-E06GCTGGGCCGAAANONE 
006-109-E10GCTGGGCCGAAANONE 
006-110-A06GCTGGGCCGAAANONE 
006-110-C11GCTGGGCCGAAANONE 
006-111-A02GCTGGGCCGAAANONE 
006-111-F02GCTGGGCCGAAANONE 
006-112-A08GCTGGGCCGAAANONE 
006-112-H06GCTGGGCCGAAANONE 
006-113-A08GCTGGGCCGAAANONE 
006-113-B01GCTGGGCCGAAANONE 
006-113-C05GCTGGGCCGAAANONE 
006-113-D01GCTGGGCCGAAANONE 
006-113-D04GCTGGGCCGAAANONE 
006-113-D06GCTGGGCCGAAANONE 
006-113-E09GCTGGGCCGAAANONE 
006-114-F06GCTGGGCCGAAANONE 
006-116-B02GCTGGGCCGAAANONE 
006-117-B07GCTGGGCCGAAANONE 
006-117-G04GCTGGGCCGAAANONE 
006-118-D01GCTGGGCCGAAANONE 
006-118-D12GCTGGGCCGAAANONE 
006-118-F12GCTGGGCCGAAANONE 
006-118-G12GCTGGGCCGAAANONE 
006-119-B08GCTGGGCCGAAANONE 
006-120-E09GCTGGGCCGAAANONE 
006-120-G05GCTGGGCCGAAANONE 
006-120-G10GCTGGGCCGAAANONE 
009-022-D12GCTGGGCCGAAANONE 
009-051-H08GCTGGGCCGAAANONE 
009-065-F05GCTGGGCCGAAANONE 
009-070-A06GCTGGGCCGAAANONE 
009-073-B07GCTGGGCCGAAANONE 
009-092-C10GCTGGGCCGAAANONE 
009-093-D03GCTGGGCCGAAANONE 
009-103-B04GCTGGGCCGAAANONE 
009-106-H08GCTGGGCCGAAANONE 
009-120-B05GCTGGGCCGAAANONE 
009-121-F05GCTGGGCCGAAANONE 
009-122-B04GCTGGGCCGAAANONE 
009-122-D08GCTGGGCCGAAANONE 
009-123-F07GCTGGGCCGAAANONE 
009-125-G02GCTGGGCCGAAANONE 
009-128-F02GCTGGGCCGAAANONE 
009-128-H07GCTGGGCCGAAANONE 
009-131-C06GCTGGGCCGAAANONE 
009-132-F08GCTGGGCCGAAANONE 
009-133-G08GCTGGGCCGAAANONE 
009-134-D09GCTGGGCCGAAANONE 
009-135-F01GCTGGGCCGAAANONE 
009-149-E11GCTGGGCCGAAANONE 
009-153-H04GCTGGGCCGAAANONE 
009-161-E04GCTGGGCCGAAANONE 
009-163-A09GCTGGGCCGAAANONE 
009-163-C05GCTGGGCCGAAANONE 
009-163-E10GCTGGGCCGAAANONE 
009-165-F04GCTGGGCCGAAANONE 
009-166-A07GCTGGGCCGAAANONE 
009-169-G12GCTGGGCCGAAANONE 
009-172-G08GCTGGGCCGAAANONE 
009-179-E06GCTGGGCCGAAANONE 
009-181-F09GCTGGGCCGAAANONE 
009-190-G07GCTGGGCCGAAANONE 
009-191-D01GCTGGGCCGAAANONE 
009-195-G02GCTGGGCCGAAANONE 
AF022738GCTGGGCCGAAANONE 
AK061512GCTGGGCCGAAANONE 
AK068972GCTGGGCCGAAANONE 
AK103926GCTGGGCCGAAANONE 
AK103999GCTGGGCCGAAANONE 
AK104224GCTGGGCCGAAANONE 
AK104465GCTGGGCCGAAANONE 
AK104495GCTGGGCCGAAANONE 
AK109399GCTGGGCCGAAASimilar to Type III chlorophyll a/b-binding protein (Fragment). 
AK119533GCTGGGCCGAAANONE 
AK119545GCTGGGCCGAAANONE 
J013043L10GCTGGGCCGAAANONE 
J013050A09GCTGGGCCGAAANONE 
J023001G03GCTGGGCCGAAANONE 
J023024D14GCTGGGCCGAAANONE 
J023072E11GCTGGGCCGAAANONE 
J023149E18GCTGGGCCGAAANONE 
J033029B16GCTGGGCCGAAANONE 
J065001O21GCTGGGCCGAAANONE 
J065035B04GCTGGGCCGAAANONE 
J065044D18GCTGGGCCGAAANONE 
J065057F12GCTGGGCCGAAANONE 
J065060A11GCTGGGCCGAAANONE 
J065062G15GCTGGGCCGAAANONE 
J065080F13GCTGGGCCGAAANONE 
J065084N12GCTGGGCCGAAANONE 
J065101D02GCTGGGCCGAAANONE 
J065107C07GCTGGGCCGAAANONE 
J065112N24GCTGGGCCGAAANONE 
J065141I16GCTGGGCCGAAANONE 
J065147D05GCTGGGCCGAAANONE 
J065167H02GCTGGGCCGAAANONE 
J065207K23GCTGGGCCGAAANONE 
J075008E16GCTGGGCCGAAANONE 
J075014F03GCTGGGCCGAAANONE 
J075015O17GCTGGGCCGAAANONE 
J075020H20GCTGGGCCGAAANONE 
J075021E22GCTGGGCCGAAANONE 
J075023N13GCTGGGCCGAAANONE 
J075028H10GCTGGGCCGAAANONE 
J075040F20GCTGGGCCGAAANONE 
J075051L23GCTGGGCCGAAANONE 
J075069G16GCTGGGCCGAAANONE 
J075084F24GCTGGGCCGAAANONE 
J075090H09GCTGGGCCGAAANONE 
J075092M21GCTGGGCCGAAANONE 
J075110C10GCTGGGCCGAAANONE 
J075111J12GCTGGGCCGAAANONE 
J075114L04GCTGGGCCGAAANONE 
J075139E02GCTGGGCCGAAANONE 
J075160M10GCTGGGCCGAAANONE 
J075176J03GCTGGGCCGAAANONE 
J075183I17GCTGGGCCGAAANONE 
J075191N10GCTGGGCCGAAANONE 
J075193D07GCTGGGCCGAAANONE 
J075194M16GCTGGGCCGAAANONE 
J075197K04GCTGGGCCGAAANONE 
J080032I11GCTGGGCCGAAANONE 
J080076M11GCTGGGCCGAAANONE 
J080311J08GCTGGGCCGAAANONE 
J080317E05GCTGGGCCGAAANONE 
J090034L08GCTGGGCCGAAANONE 
J100040D19GCTGGGCCGAAANONE 
J100074C11GCTGGGCCGAAANONE 
Os07g0563700AK121078GGACGGCCCAGATIKI3 family protein. 
Os07g0564400Os07g0564400CTCGGCCCAGANucleic acid-binding, OB-fold domain containing protein. 
Os07g0565600AK071983CCTGGGCCGTTSimilar to Peptidyl-prolyl cis-trans isomerase TLP38, chloroplast precursor (EC 5.2.1.8) (PPIase) (Rotamase) (Thylakoid lumen PPIase of 38 kDa) (p38). 
AK107481CCTGGGCCGTTNONE 
Os07g0567700AK059008CCTGGGCCGCNONE 
Os07g0570300AK100076TCCGGCCCAGCCCATCTPeptidase M16, C-terminal domain containing protein. 
J100033J04TCCGGCCCAGCCCATCTNONE 
J100065L10TCCGGCCCAGCCCATCTNONE 
Os07g0585800006-106-A05ACTGGGCCGAGANONE 
006-106-A05GCCGGCCCAGATNONE 
006-106-A05TCTGGGCCGCAAGGCCCGGCCCATAANONE 
AK066419ACTGGGCCGAGANONE 
AK066419GCCGGCCCAGATNONE 
AK066419TCTGGGCCGCAAGGCCCGGCCCATAANONE 
AK105064ACTGGGCCGAGASimilar to NADH-ubiquinone oxidoreductase 18 kDa subunit (EC 1.6.5.3) (EC 1.6.99.3) (Complex I-18KD) (CI-18KD) (Fragment). 
AK105064GCCGGCCCAGATSimilar to NADH-ubiquinone oxidoreductase 18 kDa subunit (EC 1.6.5.3) (EC 1.6.99.3) (Complex I-18KD) (CI-18KD) (Fragment). 
AK105064TCTGGGCCGCAAGGCCCGGCCCATAASimilar to NADH-ubiquinone oxidoreductase 18 kDa subunit (EC 1.6.5.3) (EC 1.6.99.3) (Complex I-18KD) (CI-18KD) (Fragment). 
J065065N01ACTGGGCCGAGANONE 
J065065N01GCCGGCCCAGATNONE 
J065065N01TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J065085B08ACTGGGCCGAGANONE 
J065085B08GCCGGCCCAGATNONE 
J065085B08TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J065099I23ACTGGGCCGAGANONE 
J065099I23GCCGGCCCAGATNONE 
J065099I23TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J065169A01ACTGGGCCGAGANONE 
J065169A01GCCGGCCCAGATNONE 
J065169A01TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J065187N13ACTGGGCCGAGANONE 
J065187N13GCCGGCCCAGATNONE 
J065187N13TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J065191L18ACTGGGCCGAGANONE 
J065191L18GCCGGCCCAGATNONE 
J065191L18TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J065194D04ACTGGGCCGAGANONE 
J065194D04GCCGGCCCAGATNONE 
J065194D04TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J065211M09ACTGGGCCGAGANONE 
J065211M09GCCGGCCCAGATNONE 
J065211M09TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J065212I02ACTGGGCCGAGANONE 
J065212I02GCCGGCCCAGATNONE 
J065212I02TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J090003C10ACTGGGCCGAGANONE 
J090003C10GCCGGCCCAGATNONE 
J090003C10TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J090025O11ACTGGGCCGAGANONE 
J090025O11GCCGGCCCAGATNONE 
J090025O11TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J090092F10ACTGGGCCGAGANONE 
J090092F10GCCGGCCCAGATNONE 
J090092F10TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J100055A04ACTGGGCCGAGANONE 
J100055A04GCCGGCCCAGATNONE 
J100055A04TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J100064A01ACTGGGCCGAGANONE 
J100064A01GCCGGCCCAGATNONE 
J100064A01TCTGGGCCGCAAGGCCCGGCCCATAANONE 
J100080L02ACTGGGCCGAGANONE 
J100080L02GCCGGCCCAGATNONE 
J100080L02TCTGGGCCGCAAGGCCCGGCCCATAANONE 
Os07g0588800015-027-E02GCTGGGCCGCNONE 
AK070635GCTGGGCCGCNONE 
AK103183GCTGGGCCGCConserved hypothetical protein. 
J023058H18GCTGGGCCGCNONE 
Os07g0589400AK072501AACTGGGCCGCAQuinonprotein alcohol dehydrogenase-like domain containing protein. 
AK104617AACTGGGCCGCANONE 
AK104756AACTGGGCCGCANONE 
Os07g0598100AK068136GTATGGGCCTGGGCCGTASimilar to Hydroxyproline-rich glycoprotein DZ-HRGP precursor. 
Os07g0618800009-116-H12TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
AK074019TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCSimilar to Centrin (Caltractin). 
J033074L14TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J065187P13TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080002E06TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080010A10TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080012N16TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080014F21TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080016E05TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080018L10TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080021F24TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080022M11TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080023F12TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080023H02TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080024A13TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080025F03TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080025F04TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080028H05TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080030B18TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080031E07TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080033H12TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080038J06TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080039M20TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080042E01TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080042G10TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080044H14TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080046F19TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080047A01TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080049O03TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080050H10TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080052P06TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080052P09TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080056I06TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080061A12TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080061I04TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080063K06TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080069I24TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080072D24TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080076D19TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080076F15TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080076I22TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080076J11TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080077C19TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080080A22TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080081E12TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080081I23TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080084H01TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080085A04TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080085N21TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080086A14TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080086G22TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080096H06TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J080097G06TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J090002O14TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J100072G23TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
J100077M11TCCGGCCCGGCCGGCCCATCCCGGCCCAGCCNONE 
Os07g0634300AK109879TTTCGGCCCAGCCCATConserved hypothetical protein. 
J100035O13TTTCGGCCCAGCCCATNONE 
J100039D07TTTCGGCCCAGCCCATNONE 
J100039F13TTTCGGCCCAGCCCATNONE 
Os07g0667400AK073297ACTGGGCCGGCSAM (and some other nucleotide) binding motif domain containing protein. 
J033027J22ACTGGGCCGGCNONE 
J033122B17ACTGGGCCGGCNONE 
J065017H12ACTGGGCCGGCNONE 
J065106D19ACTGGGCCGGCNONE 
J065196J16ACTGGGCCGGCNONE 
J090084F01ACTGGGCCGGCNONE 
Os07g0673700AK071934TCGGCCCAGCCCACCCCyclin-like F-box domain containing protein. 
AK107556TCGGCCCAGCCCACCCNONE 
Os07g0681500AK103662GATCGGACGGCCCAGATNONE 
AK121650GATCGGACGGCCCAGATAnkyrin repeat containing protein. 
Os07g0681700AK103213TCCGGCCCAGCGlycosyl transferase, family 8 protein. 
AK103213TTTCGGCCCAGCGlycosyl transferase, family 8 protein. 
Os07g0685800AK064532GCTGGGCCGGCGlucose/ribitol dehydrogenase family protein. 
Os08g0116800AK063695CTCGGCCCAGGExoribonuclease domain containing protein. 
AK063695TCTCGGCCCAGGExoribonuclease domain containing protein. 
Os08g0175200AK072367TACGGCCCAGATProtein of unknown function DUF292, eukaryotic domain containing protein. 
J013149H16TACGGCCCAGATNONE 
J023075K04TACGGCCCAGATNONE 
J023082L15TACGGCCCAGATNONE 
J043015G07TACGGCCCAGATNONE 
J065052L17TACGGCCCAGATNONE 
J065202P07TACGGCCCAGATNONE 
J075061D17TACGGCCCAGATNONE 
J100088P13TACGGCCCAGATNONE 
Os08g0192800AK059490ATCTGGGCCGTCCGATCNONE 
AK101678ATCTGGGCCGTCCGATCNONE 
AK120613ATCTGGGCCGTCCGATCBromodomain containing protein. 
J080039B22ATCTGGGCCGTCCGATCNONE 
J080039I23ATCTGGGCCGTCCGATCNONE 
J080074D19ATCTGGGCCGTCCGATCNONE 
J080086N13ATCTGGGCCGTCCGATCNONE 
Os08g0195400006-057-E04CCTGGGCCGTGNONE 
006-060-B10CCTGGGCCGTGNONE 
AK070464CCTGGGCCGTGConserved hypothetical protein. 
AK104389CCTGGGCCGTGNONE 
AK106140CCTGGGCCGTGNONE 
J023013G08CCTGGGCCGTGNONE 
J023054K19CCTGGGCCGTGNONE 
J023089D18CCTGGGCCGTGNONE 
J023092K05CCTGGGCCGTGNONE 
J033025A08CCTGGGCCGTGNONE 
J033067P12CCTGGGCCGTGNONE 
J033098A10CCTGGGCCGTGNONE 
J065219L04CCTGGGCCGTGNONE 
J090021P06CCTGGGCCGTGNONE 
J090062M05CCTGGGCCGTGNONE 
J090079F15CCTGGGCCGTGNONE 
J100041H19CCTGGGCCGTGNONE 
Os08g0224200AK101331CTCGGCCCAGGSimilar to Ythdf2-prov protein. 
AK101331GGCCGGGCCTGGGCCGTGSimilar to Ythdf2-prov protein. 
AK101331TGTTGGGCCGTGCCTGGGCCGTGSimilar to Ythdf2-prov protein. 
Os08g0233300AK067421AACTGGGCCGAANONE 
AK067421TACTGGGCCGAANONE 
AK120342AACTGGGCCGAAConserved hypothetical protein. 
AK120342TACTGGGCCGAAConserved hypothetical protein. 
J013061K19AACTGGGCCGAANONE 
J013061K19TACTGGGCCGAANONE 
J013106J20AACTGGGCCGAANONE 
J013106J20TACTGGGCCGAANONE 
J023022P16AACTGGGCCGAANONE 
J023022P16TACTGGGCCGAANONE 
J090015I03AACTGGGCCGAANONE 
J090015I03TACTGGGCCGAANONE 
Os08g0314800AK065167GCGGCCCAGTNONE 
AK098867GCGGCCCAGTSimilar to Poly(A)-binding protein. 
Os08g0375800AK101199AGCCCAACGCGGCCCAGCProtein prenyltransferase domain containing protein. 
J033030L22AGCCCAACGCGGCCCAGCNONE 
Os08g0412100AK072641TACGGCCCAGCDisease resistance protein family protein. 
Os08g0414300AK072217ATCCGACGGCCCAGATConserved hypothetical protein. 
J065039C07ATCCGACGGCCCAGATNONE 
J065098N11ATCCGACGGCCCAGATNONE 
J065120J15ATCCGACGGCCCAGATNONE 
J075076H12ATCCGACGGCCCAGATNONE 
J075101N16ATCCGACGGCCCAGATNONE 
J080010A07ATCCGACGGCCCAGATNONE 
J080023C16ATCCGACGGCCCAGATNONE 
J080027G22ATCCGACGGCCCAGATNONE 
J080053D02ATCCGACGGCCCAGATNONE 
J080065E17ATCCGACGGCCCAGATNONE 
J080068C15ATCCGACGGCCCAGATNONE 
J090061J10ATCCGACGGCCCAGATNONE 
Os08g0427900AK103217GGGCTGGGCCGTASimilar to Hin19 (Fragment). 
AK109208GGGCTGGGCCGTANONE 
J080005C08GGGCTGGGCCGTANONE 
J080010B10GGGCTGGGCCGTANONE 
J080013C21GGGCTGGGCCGTANONE 
J080022L12GGGCTGGGCCGTANONE 
J080029C08GGGCTGGGCCGTANONE 
J080029G09GGGCTGGGCCGTANONE 
J080035L14GGGCTGGGCCGTANONE 
J080040M20GGGCTGGGCCGTANONE 
J080043M18GGGCTGGGCCGTANONE 
J080045K15GGGCTGGGCCGTANONE 
J080048I17GGGCTGGGCCGTANONE 
J080051P16GGGCTGGGCCGTANONE 
J080053L16GGGCTGGGCCGTANONE 
J080059P14GGGCTGGGCCGTANONE 
J080063E13GGGCTGGGCCGTANONE 
J080075N18GGGCTGGGCCGTANONE 
J080077E05GGGCTGGGCCGTANONE 
J080080H23GGGCTGGGCCGTANONE 
J080081L16GGGCTGGGCCGTANONE 
J080083F17GGGCTGGGCCGTANONE 
J080085C23GGGCTGGGCCGTANONE 
J080086A12GGGCTGGGCCGTANONE 
J080088N06GGGCTGGGCCGTANONE 
J080092G10GGGCTGGGCCGTANONE 
J080093F04GGGCTGGGCCGTANONE 
J080094C03GGGCTGGGCCGTANONE 
J090032L12GGGCTGGGCCGTANONE 
Os08g0440000006-056-A06TCTCGGCCCAGTTNONE 
AK060959TCTCGGCCCAGTTNONE 
AK102539TCTCGGCCCAGTTVesicle transport v-SNARE family protein. 
J065012O03TCTCGGCCCAGTTNONE 
Os08g0441400011-033-F01TTCGGCCCAGTANONE 
015-084-B04TTCGGCCCAGTANONE 
AK063317TTCGGCCCAGTANONE 
AK064141TTCGGCCCAGTAConserved hypothetical protein. 
J065060F06TTCGGCCCAGTANONE 
J075110A22TTCGGCCCAGTANONE 
J080307P11TTCGGCCCAGTANONE 
J090041E06TTCGGCCCAGTANONE 
Os08g0449850J075182C20TCTGGGCCGAConserved hypothetical protein. 
Os08g0465300AK108076AACTGGGCCGTTConserved hypothetical protein. 
Os08g0465800AY428025CACGGCCCAGCCNONE 
J013029M24CACGGCCCAGCCNONE 
J013030K15CACGGCCCAGCCNONE 
J013048G12CACGGCCCAGCCNONE 
J023041H10CACGGCCCAGCCNONE 
J023065G12CACGGCCCAGCCNONE 
J023074A02CACGGCCCAGCCNONE 
J023092B20CACGGCCCAGCCNONE 
J023147A01CACGGCCCAGCCNONE 
J023150L07CACGGCCCAGCCNONE 
J043007P21CACGGCCCAGCCNONE 
J090004P19CACGGCCCAGCCNONE 
J100030K13CACGGCCCAGCCNONE 
J100060N03CACGGCCCAGCCNONE 
Os08g0478500AK099704GATCCGACGGCCCAGAPeptidase C19, ubiquitin carboxyl-terminal hydrolase 2 family protein. 
Os08g0480000006-053-A10GCCGGCCCAGCCNONE 
AK067748GCCGGCCCAGCCMulti antimicrobial extrusion protein MatE family protein. 
J013118K06GCCGGCCCAGCCNONE 
Os08g0527100AK119411TACTGGGCCGGGCCTTGPeptidase C19, ubiquitin carboxyl-terminal hydrolase 2 family protein. 
J090013J12TACTGGGCCGGGCCTTGNONE 
J090029K18TACTGGGCCGGGCCTTGNONE 
Os08g0532300009-122-A05TCCGGCCCAGTANONE 
009-129-H05TCCGGCCCAGTANONE 
AB011262TCCGGCCCAGTANONE 
AK065141TCCGGCCCAGTANONE 
AK119730TCCGGCCCAGTASimilar to Nuclear transport factor 2 (NTF-2) (Allergen Cla h ?). 
J013002A14TCCGGCCCAGTANONE 
J013042K23TCCGGCCCAGTANONE 
J023057J08TCCGGCCCAGTANONE 
J023057N10TCCGGCCCAGTANONE 
J023113C21TCCGGCCCAGTANONE 
J053054E03TCCGGCCCAGTANONE 
J053062B07TCCGGCCCAGTANONE 
J053075O17TCCGGCCCAGTANONE 
J053075P09TCCGGCCCAGTANONE 
J065024H05TCCGGCCCAGTANONE 
J065049F22TCCGGCCCAGTANONE 
J065063L03TCCGGCCCAGTANONE 
J065102O07TCCGGCCCAGTANONE 
J065104M12TCCGGCCCAGTANONE 
J065119E04TCCGGCCCAGTANONE 
J065153E10TCCGGCCCAGTANONE 
J065168M24TCCGGCCCAGTANONE 
J065173I10TCCGGCCCAGTANONE 
J065181L04TCCGGCCCAGTANONE 
J065184I18TCCGGCCCAGTANONE 
J065203M15TCCGGCCCAGTANONE 
J075004C21TCCGGCCCAGTANONE 
J075047B11TCCGGCCCAGTANONE 
J075055F18TCCGGCCCAGTANONE 
J075065G09TCCGGCCCAGTANONE 
J075094O14TCCGGCCCAGTANONE 
J075143C22TCCGGCCCAGTANONE 
J075153K18TCCGGCCCAGTANONE 
J075164N10TCCGGCCCAGTANONE 
J075197C11TCCGGCCCAGTANONE 
J080001A01TCCGGCCCAGTANONE 
J080003B11TCCGGCCCAGTANONE 
J080006G17TCCGGCCCAGTANONE 
J080007J06TCCGGCCCAGTANONE 
J080010H12TCCGGCCCAGTANONE 
J080014I01TCCGGCCCAGTANONE 
J080015C16TCCGGCCCAGTANONE 
J080016P19TCCGGCCCAGTANONE 
J080020G24TCCGGCCCAGTANONE 
J080021E12TCCGGCCCAGTANONE 
J080023I11TCCGGCCCAGTANONE 
J080024H24TCCGGCCCAGTANONE 
J080025G18TCCGGCCCAGTANONE 
J080028H08TCCGGCCCAGTANONE 
J080030G08TCCGGCCCAGTANONE 
J080031H20TCCGGCCCAGTANONE 
J080034C20TCCGGCCCAGTANONE 
J080040H13TCCGGCCCAGTANONE 
J080044M04TCCGGCCCAGTANONE 
J080047D02TCCGGCCCAGTANONE 
J080049D17TCCGGCCCAGTANONE 
J080049J17TCCGGCCCAGTANONE 
J080050A05TCCGGCCCAGTANONE 
J080051C11TCCGGCCCAGTANONE 
J080051K06TCCGGCCCAGTANONE 
J080053A07TCCGGCCCAGTANONE 
J080053I08TCCGGCCCAGTANONE 
J080056L12TCCGGCCCAGTANONE 
J080061I19TCCGGCCCAGTANONE 
J080075G09TCCGGCCCAGTANONE 
J080078C23TCCGGCCCAGTANONE 
J080080I21TCCGGCCCAGTANONE 
J080084F04TCCGGCCCAGTANONE 
J080085K16TCCGGCCCAGTANONE 
J080097A12TCCGGCCCAGTANONE 
J080097N01TCCGGCCCAGTANONE 
J090027L10TCCGGCCCAGTANONE 
J100034N17TCCGGCCCAGTANONE 
Os08g0532400AK101608TACTGGGCCGGASimilar to AT.I.24-7 protein. 
Os08g0540000AK070813GATCCGACGGCCCAGATProtein of unknown function DUF914, eukaryotic family protein. 
J090058N13GATCCGACGGCCCAGATNONE 
Os08g0542100AK058490GCCCGGCCCAGTARibosomal protein L7, eukaryotic form family protein. 
AK101416GCCCGGCCCAGTANONE 
J033037N08GCCCGGCCCAGTANONE 
J033086B16GCCCGGCCCAGTANONE 
J043036J02GCCCGGCCCAGTANONE 
J065137E02GCCCGGCCCAGTANONE 
J090015L07GCCCGGCCCAGTANONE 
J100036D02GCCCGGCCCAGTANONE 
Os08g0544800009-168-G01ACGCGTCCTGGGCCGTCGGATCNONE 
011-046-D09ACGCGTCCTGGGCCGTCGGATCNONE 
012-003-C08ACGCGTCCTGGGCCGTCGGATCNONE 
012-042-B06ACGCGTCCTGGGCCGTCGGATCNONE 
013-035-H12ACGCGTCCTGGGCCGTCGGATCNONE 
013-072-A10ACGCGTCCTGGGCCGTCGGATCNONE 
014-010-B11ACGCGTCCTGGGCCGTCGGATCNONE 
014-097-E06ACGCGTCCTGGGCCGTCGGATCNONE 
015-003-E12ACGCGTCCTGGGCCGTCGGATCNONE 
015-040-B04ACGCGTCCTGGGCCGTCGGATCNONE 
AK060536ACGCGTCCTGGGCCGTCGGATCNONE 
AK102666ACGCGTCCTGGGCCGTCGGATCNONE 
AK119660ACGCGTCCTGGGCCGTCGGATCPCF2. 
D87261ACGCGTCCTGGGCCGTCGGATCNONE 
J090049N23ACGCGTCCTGGGCCGTCGGATCNONE 
J090084G06ACGCGTCCTGGGCCGTCGGATCNONE 
Os08g0547000AK120698CCACGGCCCAGATRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
AK120698GCGGCCCAGATRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os08g0550100AB070258GACGGCCCAGCTCAGCCCAGCNONE 
AK061287GACGGCCCAGCTCAGCCCAGCSimilar to 26S proteasome subunit RPN3a. 
Os09g0281800AK105291GGACGGCCCAGATConserved hypothetical protein. 
Os09g0293900Os09g0293900TCGGCCCAGTAPeptidylprolyl isomerase, FKBP-type domain containing protein. 
Os09g0296400J090084M08GCCCGGCCCAGCCConserved hypothetical protein. 
Os09g0307800AK060843TCTGGGCCGGGNuclear protein SET domain containing protein. 
Os09g0325100J080009O19GCGGCCCAGCCNONE 
J080011H14GCGGCCCAGCCConserved hypothetical protein. 
J080014F14GCGGCCCAGCCNONE 
J080014M09GCGGCCCAGCCNONE 
J080014N20GCGGCCCAGCCNONE 
J080018K13GCGGCCCAGCCNONE 
J080023C08GCGGCCCAGCCNONE 
J080023C09GCGGCCCAGCCNONE 
J080023K14GCGGCCCAGCCNONE 
J080025I09GCGGCCCAGCCNONE 
J080030J04GCGGCCCAGCCNONE 
J080039D08GCGGCCCAGCCNONE 
J080039L17GCGGCCCAGCCNONE 
J080041B13GCGGCCCAGCCNONE 
J080041P21GCGGCCCAGCCNONE 
J080042J21GCGGCCCAGCCNONE 
J080042L19GCGGCCCAGCCNONE 
J080045F07GCGGCCCAGCCNONE 
J080047B10GCGGCCCAGCCNONE 
J080051F23GCGGCCCAGCCNONE 
J080053D15GCGGCCCAGCCNONE 
J080053K02GCGGCCCAGCCNONE 
J080058K18GCGGCCCAGCCNONE 
J080061M13GCGGCCCAGCCNONE 
J080064M24GCGGCCCAGCCNONE 
J080067H07GCGGCCCAGCCNONE 
J080080B21GCGGCCCAGCCNONE 
J080080D18GCGGCCCAGCCNONE 
J080082G07GCGGCCCAGCCNONE 
J080088B01GCGGCCCAGCCNONE 
J080088E09GCGGCCCAGCCNONE 
J080093L01GCGGCCCAGCCNONE 
Os09g0325300011-005-H08GCGGCCCAGGNONE 
AK068435GCGGCCCAGGConserved hypothetical protein. 
AK073998GCGGCCCAGGNONE 
J033071H21GCGGCCCAGGNONE 
J065214H05GCGGCCCAGGNONE 
Os09g0344700J080011F14CCTGGGCCGANONE 
J080011G13CCTGGGCCGANONE 
J080016C06CCTGGGCCGANONE 
J080034K13CCTGGGCCGANONE 
J080043N08CCTGGGCCGANONE 
J080068E01CCTGGGCCGAConserved hypothetical protein. 
J080068L12CCTGGGCCGANONE 
J080071N01CCTGGGCCGANONE 
J080075D11CCTGGGCCGANONE 
J080076D14CCTGGGCCGANONE 
J080093L23CCTGGGCCGANONE 
J080093N22CCTGGGCCGANONE 
Os09g0367900011-030-A03CCGATCCGACGGCCCAGATNONE 
AK061601CCGATCCGACGGCCCAGATNONE 
AK063310CCGATCCGACGGCCCAGATHypothetical protein. 
J100063G01CCGATCCGACGGCCCAGATNONE 
Os09g0375700AK068295CGCGTGGGCCGGCCCAGCHypothetical protein. 
Os09g0397900AK101306AACTGGGCCGAGGCCCACAAAAGCCCAACTSimilar to FEG protein. 
Os09g0406900012-044-F05GCGGCCCAGANONE 
AK063485GCGGCCCAGANONE 
AK067460GCGGCCCAGAConserved hypothetical protein. 
Os09g0434200AK062015GGACGGCCCAGTANONE 
AK103447GGACGGCCCAGTAZinc finger, RING-type domain containing protein. 
Os09g0437900AK107833TCCGGCCCAGCSimilar to Adrenodoxin. 
Os09g0453000AK120561TCTCGGCCCAGAProtein of unknown function UPF0220 family protein. 
AK121475TCTCGGCCCAGANONE 
J013132I06TCTCGGCCCAGANONE 
J023148P12TCTCGGCCCAGANONE 
J033147G24TCTCGGCCCAGANONE 
J053089L13TCTCGGCCCAGANONE 
J053097D02TCTCGGCCCAGANONE 
J065013M20TCTCGGCCCAGANONE 
J075148M10TCTCGGCCCAGANONE 
J075153M04TCTCGGCCCAGANONE 
J075197C14TCTCGGCCCAGANONE 
J080311M12TCTCGGCCCAGANONE 
J090022J07TCTCGGCCCAGANONE 
J090026D19TCTCGGCCCAGANONE 
J090033D10TCTCGGCCCAGANONE 
J090084N05TCTCGGCCCAGANONE 
J090087H04TCTCGGCCCAGANONE 
J100028I02TCTCGGCCCAGANONE 
J100088N15TCTCGGCCCAGANONE 
Os09g0458400AK070055ACCGGCCCAGAConserved hypothetical protein. 
AK120321ACCGGCCCAGANONE 
J065064N11ACCGGCCCAGANONE 
J065083J06ACCGGCCCAGANONE 
J065121D24ACCGGCCCAGANONE 
J065156I22ACCGGCCCAGANONE 
J065163J24ACCGGCCCAGANONE 
J075001I02ACCGGCCCAGANONE 
J090088O06ACCGGCCCAGANONE 
Os09g0465800009-106-E01GCCGGCCCAGCCCAAAANONE 
AK062785GCCGGCCCAGCCCAAAAConserved hypothetical protein. 
J065122K21GCCGGCCCAGCCCAAAANONE 
Os09g0468900AK120990GCTGGGCCGTCCConserved hypothetical protein. 
J013123P13GCTGGGCCGTCCNONE 
J023013I09GCTGGGCCGTCCNONE 
J023023G08GCTGGGCCGTCCNONE 
J023043E08GCTGGGCCGTCCNONE 
J033124D24GCTGGGCCGTCCNONE 
J065047I07GCTGGGCCGTCCNONE 
J065093C16GCTGGGCCGTCCNONE 
J090088O03GCTGGGCCGTCCNONE 
J100032M21GCTGGGCCGTCCNONE 
Os09g0480600AK107853ATCTGGGCCGTCCHypothetical protein. 
Os09g0528100009-173-A08ACTGGGCCGAGANONE 
009-190-G12ACTGGGCCGAGANONE 
AK059096ACTGGGCCGAGASimilar to 30S ribosomal protein S31, chloroplast (Fragment). 
Os09g0535000AK058712GGGCCGGCCCAGGSimilar to Triosephosphate isomerase, chloroplast precursor (EC 5.3.1.1) (TIM) (Triose-phosphate isomerase). 
AK069488GGGCCGGCCCAGGNONE 
AK069832GGGCCGGCCCAGGNONE 
J100065D20GGGCCGGCCCAGGNONE 
Os09g0565200004-007-A08TACGGCCCAGATNONE 
006-045-E10TACGGCCCAGATNONE 
006-051-A01TACGGCCCAGATNONE 
006-079-G03TACGGCCCAGATNONE 
006-097-C05TACGGCCCAGATNONE 
006-097-E11TACGGCCCAGATNONE 
006-111-E07TACGGCCCAGATNONE 
AK069121TACGGCCCAGATSimilar to Nucleic acid-binding protein precursor. 
AK104354TACGGCCCAGATNONE 
J013090J23TACGGCCCAGATNONE 
J013093C19TACGGCCCAGATNONE 
J023007A14TACGGCCCAGATNONE 
J023099J21TACGGCCCAGATNONE 
J065023L09TACGGCCCAGATNONE 
J075060J06TACGGCCCAGATNONE 
J075092C03TACGGCCCAGATNONE 
Os09g0567700AK065913ATCTGGGCCGCWD40-like domain containing protein. 
Os11g0116400AK059833GCTGGGCCGATGGGCTTCSimilar to Elongation factor P (EF-P). 
Os11g0132700AK103286TCGGCCCAGTACytochrome cd1-nitrite reductase-like, C-terminal haem d1 domain containing protein. 
Os11g0139100009-099-H06AAACGGCCCAGTTNONE 
AK121443AAACGGCCCAGTTSimilar to 50S ribosomal protein L24. 
J023140O18AAACGGCCCAGTTNONE 
J023143M23AAACGGCCCAGTTNONE 
J033079G04AAACGGCCCAGTTNONE 
J043004D20AAACGGCCCAGTTNONE 
J065097F05AAACGGCCCAGTTNONE 
Os11g0146700AK065900GCGGCCCAGCNONE 
AK072412GCGGCCCAGCRED-like, C-terminal family protein. 
Os11g0162200009-059-H04GCGGCCCAGCCNONE 
AK060396GCGGCCCAGCCSimilar to Ubiquinol-cytochrome c reductase complex 7.8 kDa protein (EC 1.10.2.2) (Mitochondrial hinge protein) (CR7). 
J065074O11GCGGCCCAGCCNONE 
J065105K09GCGGCCCAGCCNONE 
J075024G12GCGGCCCAGCCNONE 
J075040K04GCGGCCCAGCCNONE 
J075066D13GCGGCCCAGCCNONE 
J075108A11GCGGCCCAGCCNONE 
J100031D04GCGGCCCAGCCNONE 
J100060O05GCGGCCCAGCCNONE 
J100075M22GCGGCCCAGCCNONE 
Os11g0184900011-088-C07GCGGCCCAGCCCAGCNONE 
011-088-C07TGCGGCCCAGGCCCACGCNONE 
015-036-B03GCGGCCCAGCCCAGCNONE 
015-036-B03TGCGGCCCAGGCCCACGCNONE 
016-087-F07GCGGCCCAGCCCAGCNONE 
016-087-F07TGCGGCCCAGGCCCACGCNONE 
AB028184GCGGCCCAGCCCAGCNONE 
AB028184TGCGGCCCAGGCCCACGCNONE 
AK063399GCGGCCCAGCCCAGCSimilar to NAC-domain protein 5-7. 
AK063399TGCGGCCCAGGCCCACGCSimilar to NAC-domain protein 5-7. 
AK064292GCGGCCCAGCCCAGCNONE 
AK064292TGCGGCCCAGGCCCACGCNONE 
AK102475GCGGCCCAGCCCAGCNONE 
AK102475TGCGGCCCAGGCCCACGCNONE 
J033094I01GCGGCCCAGCCCAGCNONE 
J033094I01TGCGGCCCAGGCCCACGCNONE 
J090087J16GCGGCCCAGCCCAGCNONE 
J090087J16TGCGGCCCAGGCCCACGCNONE 
Os11g0216400Os11g0216400TCCGGCCCAGCCProteinase inhibitor, propeptide domain containing protein. 
Os11g0219400AK069850CTCGGCCCAGGAnkyrin repeat containing protein. 
AK069850GCGGCCCAGAAnkyrin repeat containing protein. 
AK069850TATTGGGCCGTGCCTGGGCCGTGAnkyrin repeat containing protein. 
AK099123CTCGGCCCAGGNONE 
AK099123GCGGCCCAGANONE 
AK099123TATTGGGCCGTGCCTGGGCCGTGNONE 
J023143G18CTCGGCCCAGGNONE 
J023143G18GCGGCCCAGANONE 
J023143G18TATTGGGCCGTGCCTGGGCCGTGNONE 
Os11g0425300AK065810CCACGGCCCAGCCCACACConserved hypothetical protein. 
AK067248CCACGGCCCAGCCCACACNONE 
J013038F05CCACGGCCCAGCCCACACNONE 
J013039B05CCACGGCCCAGCCCACACNONE 
J013060P13CCACGGCCCAGCCCACACNONE 
J013099D01CCACGGCCCAGCCCACACNONE 
J023023L06CCACGGCCCAGCCCACACNONE 
J023061G18CCACGGCCCAGCCCACACNONE 
J023099E11CCACGGCCCAGCCCACACNONE 
J065002A08CCACGGCCCAGCCCACACNONE 
J065046L21CCACGGCCCAGCCCACACNONE 
J065122K11CCACGGCCCAGCCCACACNONE 
J090071I21CCACGGCCCAGCCCACACNONE 
J090077P13CCACGGCCCAGCCCACACNONE 
Os11g0488600AK111309CACGGCCCAGCCCACGAConserved hypothetical protein. 
J075011H20CACGGCCCAGCCCACGANONE 
J075068E17CACGGCCCAGCCCACGANONE 
J075102G16CACGGCCCAGCCCACGANONE 
Os11g0497000AK111924GCTGGGCCGTTSimilar to Ubiquitin activating enzyme-like protein (SUMO activating enzyme 1a). 
J065090J11GCTGGGCCGTTNONE 
J065097A08GCTGGGCCGTTNONE 
J065123J10GCTGGGCCGTTNONE 
J075096F04GCTGGGCCGTTNONE 
J080065C15GCTGGGCCGTTNONE 
J090033J04GCTGGGCCGTTNONE 
J090072N23GCTGGGCCGTTNONE 
J100021E08GCTGGGCCGTTNONE 
J100063H21GCTGGGCCGTTNONE 
Os11g0595200009-005-A06TACGGCCCAGANONE 
AK071115TACGGCCCAGANONE 
AK106159TACGGCCCAGAPAP fibrillin family protein. 
AY387683TACGGCCCAGANONE 
AY387684TACGGCCCAGANONE 
J065166K17TACGGCCCAGANONE 
Os11g0657200AK059959CACGGCCCAGC2OG-Fe(II) oxygenase domain containing protein. 
Os11g0657300009-101-D07GCTGGGCCGTGNONE 
AK062752GCTGGGCCGTGSimilar to Small nuclear ribonucleoprotein F (snRNP-F) (Sm protein F) (Sm-F) (SmF). 
Os11g0660500009-031-D10ATCTGGGCCGTCCNONE 
009-031-D10GCGGCCCAGATNONE 
009-100-G09ATCTGGGCCGTCCNONE 
009-100-G09GCGGCCCAGATNONE 
009-162-G10ATCTGGGCCGTCCNONE 
009-162-G10GCGGCCCAGATNONE 
009-183-H11ATCTGGGCCGTCCNONE 
009-183-H11GCGGCCCAGATNONE 
013-010-B11ATCTGGGCCGTCCNONE 
013-010-B11GCGGCCCAGATNONE 
013-050-A05ATCTGGGCCGTCCNONE 
013-050-A05GCGGCCCAGATNONE 
013-070-E10ATCTGGGCCGTCCNONE 
013-070-E10GCGGCCCAGATNONE 
AK105453ATCTGGGCCGTCCSimilar to Translationally controlled tumor protein (Fragment). 
AK105453GCGGCCCAGATSimilar to Translationally controlled tumor protein (Fragment). 
D12626ATCTGGGCCGTCCNONE 
D12626GCGGCCCAGATNONE 
J013128M15ATCTGGGCCGTCCNONE 
J013128M15GCGGCCCAGATNONE 
J023004I19ATCTGGGCCGTCCNONE 
J023004I19GCGGCCCAGATNONE 
J033114F08ATCTGGGCCGTCCNONE 
J033114F08GCGGCCCAGATNONE 
J033147I20ATCTGGGCCGTCCNONE 
J033147I20GCGGCCCAGATNONE 
J065031M04ATCTGGGCCGTCCNONE 
J065031M04GCGGCCCAGATNONE 
J065033J03ATCTGGGCCGTCCNONE 
J065033J03GCGGCCCAGATNONE 
J065038E01ATCTGGGCCGTCCNONE 
J065038E01GCGGCCCAGATNONE 
J065048O06ATCTGGGCCGTCCNONE 
J065048O06GCGGCCCAGATNONE 
J065054E01ATCTGGGCCGTCCNONE 
J065054E01GCGGCCCAGATNONE 
J065075N08ATCTGGGCCGTCCNONE 
J065075N08GCGGCCCAGATNONE 
J065080C07ATCTGGGCCGTCCNONE 
J065080C07GCGGCCCAGATNONE 
J065096A12ATCTGGGCCGTCCNONE 
J065096A12GCGGCCCAGATNONE 
J065115P22ATCTGGGCCGTCCNONE 
J065115P22GCGGCCCAGATNONE 
J065122I21ATCTGGGCCGTCCNONE 
J065122I21GCGGCCCAGATNONE 
J065127A13ATCTGGGCCGTCCNONE 
J065127A13GCGGCCCAGATNONE 
J065158B06ATCTGGGCCGTCCNONE 
J065158B06GCGGCCCAGATNONE 
J065162E04ATCTGGGCCGTCCNONE 
J065162E04GCGGCCCAGATNONE 
J065162E05ATCTGGGCCGTCCNONE 
J065162E05GCGGCCCAGATNONE 
J065163L06ATCTGGGCCGTCCNONE 
J065163L06GCGGCCCAGATNONE 
J065177B16ATCTGGGCCGTCCNONE 
J065177B16GCGGCCCAGATNONE 
J065181M15ATCTGGGCCGTCCNONE 
J065181M15GCGGCCCAGATNONE 
J065201G15ATCTGGGCCGTCCNONE 
J065201G15GCGGCCCAGATNONE 
J065202J06ATCTGGGCCGTCCNONE 
J065202J06GCGGCCCAGATNONE 
J075002B19ATCTGGGCCGTCCNONE 
J075002B19GCGGCCCAGATNONE 
J075008G19ATCTGGGCCGTCCNONE 
J075008G19GCGGCCCAGATNONE 
J075010P05ATCTGGGCCGTCCNONE 
J075010P05GCGGCCCAGATNONE 
J075018H23ATCTGGGCCGTCCNONE 
J075018H23GCGGCCCAGATNONE 
J075051E18ATCTGGGCCGTCCNONE 
J075051E18GCGGCCCAGATNONE 
J075053C24ATCTGGGCCGTCCNONE 
J075053C24GCGGCCCAGATNONE 
J075077B06ATCTGGGCCGTCCNONE 
J075077B06GCGGCCCAGATNONE 
J075080B11ATCTGGGCCGTCCNONE 
J075080B11GCGGCCCAGATNONE 
J075083M04ATCTGGGCCGTCCNONE 
J075083M04GCGGCCCAGATNONE 
J075085H01ATCTGGGCCGTCCNONE 
J075085H01GCGGCCCAGATNONE 
J075109E11ATCTGGGCCGTCCNONE 
J075109E11GCGGCCCAGATNONE 
J075111O09ATCTGGGCCGTCCNONE 
J075111O09GCGGCCCAGATNONE 
J075130D13ATCTGGGCCGTCCNONE 
J075130D13GCGGCCCAGATNONE 
J075132H13ATCTGGGCCGTCCNONE 
J075132H13GCGGCCCAGATNONE 
J075147H19ATCTGGGCCGTCCNONE 
J075147H19GCGGCCCAGATNONE 
J075148J01ATCTGGGCCGTCCNONE 
J075148J01GCGGCCCAGATNONE 
J075159A18ATCTGGGCCGTCCNONE 
J075159A18GCGGCCCAGATNONE 
J075166F03ATCTGGGCCGTCCNONE 
J075166F03GCGGCCCAGATNONE 
J075191F09ATCTGGGCCGTCCNONE 
J075191F09GCGGCCCAGATNONE 
J075192K09ATCTGGGCCGTCCNONE 
J075192K09GCGGCCCAGATNONE 
J080006P15ATCTGGGCCGTCCNONE 
J080006P15GCGGCCCAGATNONE 
J080013J18ATCTGGGCCGTCCNONE 
J080013J18GCGGCCCAGATNONE 
J080023O06ATCTGGGCCGTCCNONE 
J080023O06GCGGCCCAGATNONE 
J080024I17ATCTGGGCCGTCCNONE 
J080024I17GCGGCCCAGATNONE 
J080029P03ATCTGGGCCGTCCNONE 
J080029P03GCGGCCCAGATNONE 
J080030C14ATCTGGGCCGTCCNONE 
J080030C14GCGGCCCAGATNONE 
J080038K15ATCTGGGCCGTCCNONE 
J080038K15GCGGCCCAGATNONE 
J080042I15ATCTGGGCCGTCCNONE 
J080042I15GCGGCCCAGATNONE 
J080053L07ATCTGGGCCGTCCNONE 
J080053L07GCGGCCCAGATNONE 
J080061H12ATCTGGGCCGTCCNONE 
J080061H12GCGGCCCAGATNONE 
J080064H24ATCTGGGCCGTCCNONE 
J080064H24GCGGCCCAGATNONE 
J080066J20ATCTGGGCCGTCCNONE 
J080066J20GCGGCCCAGATNONE 
J080074N07ATCTGGGCCGTCCNONE 
J080074N07GCGGCCCAGATNONE 
J080079F16ATCTGGGCCGTCCNONE 
J080079F16GCGGCCCAGATNONE 
J080079O07ATCTGGGCCGTCCNONE 
J080079O07GCGGCCCAGATNONE 
J080092E15ATCTGGGCCGTCCNONE 
J080092E15GCGGCCCAGATNONE 
J080301F19ATCTGGGCCGTCCNONE 
J080301F19GCGGCCCAGATNONE 
J080302O21ATCTGGGCCGTCCNONE 
J080302O21GCGGCCCAGATNONE 
J080306L02ATCTGGGCCGTCCNONE 
J080306L02GCGGCCCAGATNONE 
J080307F16ATCTGGGCCGTCCNONE 
J080307F16GCGGCCCAGATNONE 
J080307G01ATCTGGGCCGTCCNONE 
J080307G01GCGGCCCAGATNONE 
J080307K01ATCTGGGCCGTCCNONE 
J080307K01GCGGCCCAGATNONE 
J080309O22ATCTGGGCCGTCCNONE 
J080309O22GCGGCCCAGATNONE 
J080311E17ATCTGGGCCGTCCNONE 
J080311E17GCGGCCCAGATNONE 
J080311N08ATCTGGGCCGTCCNONE 
J080311N08GCGGCCCAGATNONE 
J080312O12ATCTGGGCCGTCCNONE 
J080312O12GCGGCCCAGATNONE 
J080315C08ATCTGGGCCGTCCNONE 
J080315C08GCGGCCCAGATNONE 
J080316D07ATCTGGGCCGTCCNONE 
J080316D07GCGGCCCAGATNONE 
J080318C17ATCTGGGCCGTCCNONE 
J080318C17GCGGCCCAGATNONE 
J090004B08ATCTGGGCCGTCCNONE 
J090004B08GCGGCCCAGATNONE 
J090009K02ATCTGGGCCGTCCNONE 
J090009K02GCGGCCCAGATNONE 
J090025O15ATCTGGGCCGTCCNONE 
J090025O15GCGGCCCAGATNONE 
J090026L03ATCTGGGCCGTCCNONE 
J090026L03GCGGCCCAGATNONE 
J090036P17ATCTGGGCCGTCCNONE 
J090036P17GCGGCCCAGATNONE 
J090047A21ATCTGGGCCGTCCNONE 
J090047A21GCGGCCCAGATNONE 
J090053O03ATCTGGGCCGTCCNONE 
J090053O03GCGGCCCAGATNONE 
J090059C04ATCTGGGCCGTCCNONE 
J090059C04GCGGCCCAGATNONE 
J090062O21ATCTGGGCCGTCCNONE 
J090062O21GCGGCCCAGATNONE 
J090064M11ATCTGGGCCGTCCNONE 
J090064M11GCGGCCCAGATNONE 
J090070C14ATCTGGGCCGTCCNONE 
J090070C14GCGGCCCAGATNONE 
J090075I03ATCTGGGCCGTCCNONE 
J090075I03GCGGCCCAGATNONE 
J090081G22ATCTGGGCCGTCCNONE 
J090081G22GCGGCCCAGATNONE 
J090083E18ATCTGGGCCGTCCNONE 
J090083E18GCGGCCCAGATNONE 
J090084A05ATCTGGGCCGTCCNONE 
J090084A05GCGGCCCAGATNONE 
J100019L11ATCTGGGCCGTCCNONE 
J100019L11GCGGCCCAGATNONE 
J100022D16ATCTGGGCCGTCCNONE 
J100022D16GCGGCCCAGATNONE 
J100042F09ATCTGGGCCGTCCNONE 
J100042F09GCGGCCCAGATNONE 
J100051J12ATCTGGGCCGTCCNONE 
J100051J12GCGGCCCAGATNONE 
J100065G21ATCTGGGCCGTCCNONE 
J100065G21GCGGCCCAGATNONE 
J100066D08ATCTGGGCCGTCCNONE 
J100066D08GCGGCCCAGATNONE 
J100069H04ATCTGGGCCGTCCNONE 
J100069H04GCGGCCCAGATNONE 
J100078I16ATCTGGGCCGTCCNONE 
J100078I16GCGGCCCAGATNONE 
J100090D15ATCTGGGCCGTCCNONE 
J100090D15GCGGCCCAGATNONE 
Os12g0109600AK107606TCTGGGCCGACGGCCCATGGCCCAGProtein of unknown function DUF1677, Oryza sativa family protein. 
J053026B13TCTGGGCCGACGGCCCATGGCCCAGNONE 
J053033C09TCTGGGCCGACGGCCCATGGCCCAGNONE 
J053059G21TCTGGGCCGACGGCCCATGGCCCAGNONE 
J053071A13TCTGGGCCGACGGCCCATGGCCCAGNONE 
J075007L19TCTGGGCCGACGGCCCATGGCCCAGNONE 
J075071J20TCTGGGCCGACGGCCCATGGCCCAGNONE 
J075110F18TCTGGGCCGACGGCCCATGGCCCAGNONE 
Os12g0124700AK073156AACTGGGCCGGACDC45-like protein family protein. 
J090013O22AACTGGGCCGGANONE 
Os12g0131300J090086B06TCGGCCCAGTAHypothetical protein. 
Os12g0133600AK103096TCCGGCCCAGCCConserved hypothetical protein. 
J033118M03TCCGGCCCAGCCNONE 
Os12g0156400012-065-D02GCTGGGCCGTGNONE 
AK072086GCTGGGCCGTGNONE 
AK099278GCTGGGCCGTGDcp1-like decapping family protein. 
J013063H09GCTGGGCCGTGNONE 
J023125D09GCTGGGCCGTGNONE 
J023149G21GCTGGGCCGTGNONE 
J033064E07GCTGGGCCGTGNONE 
J033093C07GCTGGGCCGTGNONE 
J033107E06GCTGGGCCGTGNONE 
J075172A11GCTGGGCCGTGNONE 
J090009E07GCTGGGCCGTGNONE 
J090023F13GCTGGGCCGTGNONE 
J090071N18GCTGGGCCGTGNONE 
Os12g0168200015-027-H11AACTGGGCCGGCCCAGGNONE 
AK069543AACTGGGCCGGCCCAGGSsu72-like protein family protein. 
J023025N02AACTGGGCCGGCCCAGGNONE 
Os12g0194700AK121912AACGGCCCAGATDNA-directed RNA polymerase, 13 to 16 kDa subunit family protein. 
J033106A07AACGGCCCAGATNONE 
Os12g0194800011-016-B07ATCTGGGCCGTTNONE 
AK101810ATCTGGGCCGTTtRNA pseudouridine synthase family protein. 
AK107780ATCTGGGCCGTTNONE 
J043034C07ATCTGGGCCGTTNONE 
Os12g0244500AK102026ACTGGGCCGTGGConserved hypothetical protein. 
J023014D06ACTGGGCCGTGGNONE 
J023060C12ACTGGGCCGTGGNONE 
J033080M18ACTGGGCCGTGGNONE 
J090017I22ACTGGGCCGTGGNONE 
J090023D21ACTGGGCCGTGGNONE 
J090036J05ACTGGGCCGTGGNONE 
J090053M19ACTGGGCCGTGGNONE 
Os12g0274200009-166-H09ACCGGCCCAGCCNONE 
AK063071ACCGGCCCAGCCLipolytic enzyme, G-D-S-L family protein. 
Os12g0299700AK071145CCCGGCCCAGGConserved hypothetical protein. 
J023082N05CCCGGCCCAGGNONE 
Os12g0477600009-115-E02ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
009-125-D04ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
009-152-E11ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
013-003-H06ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
AK099534ACCGGGCCCACTGGGCCGGAGGCCCAAAAConserved hypothetical protein. 
J065109J18ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J065115L23ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075002K19ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075034D13ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075038B07ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075051A21ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075052J11ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075072A08ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075080E10ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075101E13ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075112F22ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075139O17ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075141K08ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075146N01ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075171J24ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
Os12g0508300009-006-G07GCCGGCCCAGGNONE 
009-133-E05GCCGGCCCAGGNONE 
009-137-F10GCCGGCCCAGGNONE 
014-024-A06GCCGGCCCAGGNONE 
AK059123GCCGGCCCAGGRibosomal protein S14 family protein. 
J100088E22GCCGGCCCAGGNONE 
Os12g0533500AK068646GGGCTGGGCCGCGTGGGCCAAConserved hypothetical protein. 
AK068646TCGGCCCGGCCCGGCCCAGAConserved hypothetical protein. 
J013158L10GGGCTGGGCCGCGTGGGCCAANONE 
J013158L10TCGGCCCGGCCCGGCCCAGANONE 
J065083J02GGGCTGGGCCGCGTGGGCCAANONE 
J065083J02TCGGCCCGGCCCGGCCCAGANONE 
J075079D02GGGCTGGGCCGCGTGGGCCAANONE 
J075079D02TCGGCCCGGCCCGGCCCAGANONE 
J100037H16GGGCTGGGCCGCGTGGGCCAANONE 
J100037H16TCGGCCCGGCCCGGCCCAGANONE 
J100075P13GGGCTGGGCCGCGTGGGCCAANONE 
J100075P13TCGGCCCGGCCCGGCCCAGANONE 
Os12g0557800AK121691CCTGGGCCGTGProtein prenyltransferase domain containing protein. 
AK121691GCCGGGCCTGGGCCGGCProtein prenyltransferase domain containing protein. 
J013095M03CCTGGGCCGTGNONE 
J013095M03GCCGGGCCTGGGCCGGCNONE 
J033071H11CCTGGGCCGTGNONE 
J033071H11GCCGGGCCTGGGCCGGCNONE 
J065101B02CCTGGGCCGTGNONE 
J065101B02GCCGGGCCTGGGCCGGCNONE 
Os12g0564800AK103886GCGGCCCAGCCCAAATDisease resistance protein family protein. 
Os12g0588900AK069966GACGGCCCAGCTAGGCCCAATTConserved hypothetical protein. 
AK069966GGACGGCCCAGGConserved hypothetical protein. 
J023038A10GACGGCCCAGCTAGGCCCAATTNONE 
J023038A10GGACGGCCCAGGNONE 
J065061J23GACGGCCCAGCTAGGCCCAATTNONE 
J065061J23GGACGGCCCAGGNONE 
J065176O08GACGGCCCAGCTAGGCCCAATTNONE 
J065176O08GGACGGCCCAGGNONE 
J075143K13GACGGCCCAGCTAGGCCCAATTNONE 
J075143K13GGACGGCCCAGGNONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.