version

Summary of OsREG566 (All List)

OrganismOryza sativa  
IDOsREG566  
SequenceCGGGCCCA  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
ACGGGC  function unknown  
PLACE Motif 
Total Entry Count2127  

Entry Sequences (2127 entries)

LocusGene modelSequenceDescription
Os01g0131600006-030-A03CGCGTGGGCCCGGANONE 
006-049-C10CGCGTGGGCCCGGANONE 
006-054-E02CGCGTGGGCCCGGANONE 
011-035-H02CGCGTGGGCCCGGANONE 
011-036-E04CGCGTGGGCCCGGANONE 
012-047-C08CGCGTGGGCCCGGANONE 
012-079-F08CGCGTGGGCCCGGANONE 
012-097-C02CGCGTGGGCCCGGANONE 
012-100-A07CGCGTGGGCCCGGANONE 
013-015-H05CGCGTGGGCCCGGANONE 
013-047-A03CGCGTGGGCCCGGANONE 
013-051-B05CGCGTGGGCCCGGANONE 
013-061-G02CGCGTGGGCCCGGANONE 
013-077-H02CGCGTGGGCCCGGANONE 
015-005-D04CGCGTGGGCCCGGANONE 
015-064-B06CGCGTGGGCCCGGANONE 
015-072-D02CGCGTGGGCCCGGANONE 
016-073-E09CGCGTGGGCCCGGANONE 
016-088-H03CGCGTGGGCCCGGANONE 
AK062063CGCGTGGGCCCGGANONE 
AK101133CGCGTGGGCCCGGASimilar to AP2 domain containing protein RAP2.6 (Fragment). 
AK102277CGCGTGGGCCCGGANONE 
AK119645CGCGTGGGCCCGGANONE 
AY341828CGCGTGGGCCCGGANONE 
J013036O08CGCGTGGGCCCGGANONE 
J013037M17CGCGTGGGCCCGGANONE 
J013039B11CGCGTGGGCCCGGANONE 
J013039L20CGCGTGGGCCCGGANONE 
J013047B20CGCGTGGGCCCGGANONE 
J013048E23CGCGTGGGCCCGGANONE 
J013051E12CGCGTGGGCCCGGANONE 
J013051F12CGCGTGGGCCCGGANONE 
J013056B05CGCGTGGGCCCGGANONE 
J013057N24CGCGTGGGCCCGGANONE 
J013064D21CGCGTGGGCCCGGANONE 
J013065G24CGCGTGGGCCCGGANONE 
J013075L13CGCGTGGGCCCGGANONE 
J013075L24CGCGTGGGCCCGGANONE 
J013092F04CGCGTGGGCCCGGANONE 
J013092F10CGCGTGGGCCCGGANONE 
J013092M16CGCGTGGGCCCGGANONE 
J013096K06CGCGTGGGCCCGGANONE 
J013111F10CGCGTGGGCCCGGANONE 
J013120B17CGCGTGGGCCCGGANONE 
J013120P07CGCGTGGGCCCGGANONE 
J013122F18CGCGTGGGCCCGGANONE 
J013122H23CGCGTGGGCCCGGANONE 
J013126I15CGCGTGGGCCCGGANONE 
J013126L17CGCGTGGGCCCGGANONE 
J013129C15CGCGTGGGCCCGGANONE 
J013146A04CGCGTGGGCCCGGANONE 
J013146A06CGCGTGGGCCCGGANONE 
J013153F01CGCGTGGGCCCGGANONE 
J013156O06CGCGTGGGCCCGGANONE 
J013162D05CGCGTGGGCCCGGANONE 
J023008N04CGCGTGGGCCCGGANONE 
J023010D06CGCGTGGGCCCGGANONE 
J023011I23CGCGTGGGCCCGGANONE 
J023023I15CGCGTGGGCCCGGANONE 
J023025C08CGCGTGGGCCCGGANONE 
J023029H02CGCGTGGGCCCGGANONE 
J023033C18CGCGTGGGCCCGGANONE 
J023037D21CGCGTGGGCCCGGANONE 
J023049F17CGCGTGGGCCCGGANONE 
J023052B15CGCGTGGGCCCGGANONE 
J023061D03CGCGTGGGCCCGGANONE 
J023062M01CGCGTGGGCCCGGANONE 
J023089D24CGCGTGGGCCCGGANONE 
J023109J20CGCGTGGGCCCGGANONE 
J023109M21CGCGTGGGCCCGGANONE 
J023120N04CGCGTGGGCCCGGANONE 
J023122A04CGCGTGGGCCCGGANONE 
J023134F23CGCGTGGGCCCGGANONE 
J023149E20CGCGTGGGCCCGGANONE 
J033022A12CGCGTGGGCCCGGANONE 
J033022C04CGCGTGGGCCCGGANONE 
J033024K06CGCGTGGGCCCGGANONE 
J033026F23CGCGTGGGCCCGGANONE 
J033029J19CGCGTGGGCCCGGANONE 
J033040H20CGCGTGGGCCCGGANONE 
J033042P21CGCGTGGGCCCGGANONE 
J033043F14CGCGTGGGCCCGGANONE 
J033044G11CGCGTGGGCCCGGANONE 
J033052L10CGCGTGGGCCCGGANONE 
J033052O03CGCGTGGGCCCGGANONE 
J033052P03CGCGTGGGCCCGGANONE 
J033079B20CGCGTGGGCCCGGANONE 
J033089D21CGCGTGGGCCCGGANONE 
J033094P04CGCGTGGGCCCGGANONE 
J033103N02CGCGTGGGCCCGGANONE 
J033110J19CGCGTGGGCCCGGANONE 
J033114E17CGCGTGGGCCCGGANONE 
J033115K04CGCGTGGGCCCGGANONE 
J033119I06CGCGTGGGCCCGGANONE 
J033121L10CGCGTGGGCCCGGANONE 
J033123H14CGCGTGGGCCCGGANONE 
J033136H10CGCGTGGGCCCGGANONE 
J033139L07CGCGTGGGCCCGGANONE 
J033143G23CGCGTGGGCCCGGANONE 
J043021F16CGCGTGGGCCCGGANONE 
J080304G01CGCGTGGGCCCGGANONE 
J080305H24CGCGTGGGCCCGGANONE 
J080309B11CGCGTGGGCCCGGANONE 
J080315N09CGCGTGGGCCCGGANONE 
J080319J20CGCGTGGGCCCGGANONE 
J090014D01CGCGTGGGCCCGGANONE 
J090067F08CGCGTGGGCCCGGANONE 
J090079P18CGCGTGGGCCCGGANONE 
J090082K13CGCGTGGGCCCGGANONE 
J090093K17CGCGTGGGCCCGGANONE 
J090099G18CGCGTGGGCCCGGANONE 
J100022K14CGCGTGGGCCCGGANONE 
J100052G17CGCGTGGGCCCGGANONE 
Os01g0144600006-037-H02ACCGGGCCCACANONE 
006-037-H02ACCGGGCCGTGGTGATGGGCCCGNONE 
006-037-H02TGTGGGCCCGCACGCCACNONE 
AK061501ACCGGGCCCACAConserved hypothetical protein. 
AK061501ACCGGGCCGTGGTGATGGGCCCGConserved hypothetical protein. 
AK061501TGTGGGCCCGCACGCCACConserved hypothetical protein. 
AK102823ACCGGGCCCACANONE 
AK102823ACCGGGCCGTGGTGATGGGCCCGNONE 
AK102823TGTGGGCCCGCACGCCACNONE 
J033108P10ACCGGGCCCACANONE 
J033108P10ACCGGGCCGTGGTGATGGGCCCGNONE 
J033108P10TGTGGGCCCGCACGCCACNONE 
J043026K08ACCGGGCCCACANONE 
J043026K08ACCGGGCCGTGGTGATGGGCCCGNONE 
J043026K08TGTGGGCCCGCACGCCACNONE 
J090009H21ACCGGGCCCACANONE 
J090009H21ACCGGGCCGTGGTGATGGGCCCGNONE 
J090009H21TGTGGGCCCGCACGCCACNONE 
Os01g0184800AK073377CACTGACAGCCCGGGCCCACCPhosducin family protein. 
AK102544CACTGACAGCCCGGGCCCACCNONE 
J023047L21CACTGACAGCCCGGGCCCACCNONE 
J023135I09CACTGACAGCCCGGGCCCACCNONE 
J033028G17CACTGACAGCCCGGGCCCACCNONE 
J065164L07CACTGACAGCCCGGGCCCACCNONE 
J065193F22CACTGACAGCCCGGGCCCACCNONE 
J075035I10CACTGACAGCCCGGGCCCACCNONE 
J075168H15CACTGACAGCCCGGGCCCACCNONE 
Os01g0185200009-146-B06GCGGGCCCACACNONE 
009-163-F01GCGGGCCCACACNONE 
AK062984GCGGGCCCACACNONE 
AK065125GCGGGCCCACACGlutamyl-tRNA synthetase, class Ic family protein. 
AK105222GCGGGCCCACACNONE 
AK111284GCGGGCCCACACNONE 
Os01g0192550J065164G16CACGGCCCATGGGCCCGGCConserved hypothetical protein. 
Os01g0218700AK064992CGCGTGGGCCCGGCABC transporter, transmembrane region, type 1 domain containing protein. 
Os01g0239700AK067723ACCGGGCCCACAASimilar to Leucine-rich receptor-like protein kinase. 
AK122130ACCGGGCCCACAANONE 
Os01g0246500AK058984TCCGGGCCGGGCCCAAAASimilar to Minus dominance protein. 
Os01g0281100AK109672GCGGGCCCACTTGTCAGTGConserved hypothetical protein. 
J065013K07GCGGGCCCACTTGTCAGTGNONE 
J065040E15GCGGGCCCACTTGTCAGTGNONE 
J065127F12GCGGGCCCACTTGTCAGTGNONE 
J075155K23GCGGGCCCACTTGTCAGTGNONE 
Os01g0355900AK120976GCGGGCCCATGGGCCATPeptidase C48, SUMO/Sentrin/Ubl1 family protein. 
J023041L20GCGGGCCCATGGGCCATNONE 
J043003M03GCGGGCCCATGGGCCATNONE 
J075094C04GCGGGCCCATGGGCCATNONE 
J090026M16GCGGGCCCATGGGCCATNONE 
J100023F23GCGGGCCCATGGGCCATNONE 
Y11189GCGGGCCCATGGGCCATNONE 
Os01g0530366J075001P06AACGGGCCCAGTTNONE 
J075006K21AACGGGCCCAGTTRNA polymerase Rbp10 domain containing protein. 
J075030G13AACGGGCCCAGTTNONE 
Os01g0658500AK058491GCGGGCCCAACProtein of unknown function DUF852, eukaryotic family protein. 
AK069050GCGGGCCCAACNONE 
J043036P22GCGGGCCCAACNONE 
Os01g0666500AK102689GGCCGGGCCCACTConserved hypothetical protein. 
Os01g0688200AK120982GCGGGCCCACAAlpha/beta hydrolase family protein. 
Os01g0700500AK072715CGGGCCCATCCCytochrome P450 family protein. 
AK119264CGGGCCCATCCNONE 
Os01g0707300AK059962TGCGGGCCCACCTNONE 
AK104463TGCGGGCCCACCTSimilar to Vesicle transport v-SNARE 13 (AtVTI13) (Vesicle transport v-SNARE protein VTI13) (Vesicle soluble NSF attachment protein receptor 13). 
Os01g0720700J033124M22TCCGGGCCCACGCNONE 
J065006G21TCCGGGCCCACGCNONE 
J065025M24TCCGGGCCCACGCNONE 
J065041J02TCCGGGCCCACGCNONE 
J065044B14TCCGGGCCCACGCNONE 
J065061J06TCCGGGCCCACGCNONE 
J065116L21TCCGGGCCCACGCNONE 
J075030F18TCCGGGCCCACGCNONE 
J075034K17TCCGGGCCCACGCNONE 
J075063I02TCCGGGCCCACGCNONE 
J075110D21TCCGGGCCCACGCSimilar to Serine acetyltransferase. 
J075188L15TCCGGGCCCACGCNONE 
J075197B17TCCGGGCCCACGCNONE 
Os01g0723000AK073592TTGTGGGCCCGSimilar to Elongation factor EF-2 (Fragment). 
AK102586TTGTGGGCCCGNONE 
J033048F11TTGTGGGCCCGNONE 
J033098E24TTGTGGGCCCGNONE 
Os01g0725100J075035B02CTTGGGCCCGCANONE 
Os01g0729900AK064793CGGGCCCAGGNONE 
AK065503CGGGCCCAGGConserved hypothetical protein. 
AK104681CGGGCCCAGGNONE 
AK120504CGGGCCCAGGNONE 
Os01g0764800AK102809GCGGGCCCACGTGSimilar to Nt-gh3 deduced protein. 
Os01g0778700AK064933GCGGGCCCACCTGConserved hypothetical protein. 
Os01g0807000AK109751TGTTGGGCCCGConserved hypothetical protein. 
Os01g0816100012-082-H02GGGCCGGGCCCACCTGCAGCCCACGTNONE 
AB028183GGGCCGGGCCCACCTGCAGCCCACGTNONE 
AK073848GGGCCGGGCCCACCTGCAGCCCACGTNONE 
AY986504GGGCCGGGCCCACCTGCAGCCCACGTSimilar to NAC domain protein. 
J100061B19GGGCCGGGCCCACCTGCAGCCCACGTNONE 
Os01g0818600AK066550TGTGGGCCCGGTLeucine rich repeat, N-terminal domain containing protein. 
Os01g0835500AK100241GCGGGCCCACTSimilar to Respiratory burst oxidase protein. 
Os01g0837600AK108007CGGGTGGGCCCGGCConserved hypothetical protein 1589, plant family protein. 
J065005C19CGGGTGGGCCCGGCNONE 
J065025H20CGGGTGGGCCCGGCNONE 
J065061E22CGGGTGGGCCCGGCNONE 
J065065F14CGGGTGGGCCCGGCNONE 
J065083O21CGGGTGGGCCCGGCNONE 
J065201G05CGGGTGGGCCCGGCNONE 
Os01g0856500AK103981TGGATGGGCTACTGGGCCCGNONE 
Os01g0866300006-029-F08GGCCGGGCCCACTNONE 
006-074-E10GGCCGGGCCCACTNONE 
006-079-E11GGCCGGGCCCACTNONE 
009-048-A05GGCCGGGCCCACTNONE 
AK059875GGCCGGGCCCACTNONE 
J043005O17GGCCGGGCCCACTNONE 
Os01g0877500AK101067GGTGGGCCCGGAProtein of unknown function UPF0054 family protein. 
Os01g0887700AF045571CGTGGACCGGGCCCATGNONE 
AF047428CGTGGACCGGGCCCATGNONE 
AK071139CGTGGACCGGGCCCATGZinc finger, FYVE/PHD-type domain containing protein. 
J023082D05CGTGGACCGGGCCCATGNONE 
J065062L19CGTGGACCGGGCCCATGNONE 
J065116H15CGTGGACCGGGCCCATGNONE 
J065194N09CGTGGACCGGGCCCATGNONE 
J100074C19CGTGGACCGGGCCCATGNONE 
Os01g0905400012-077-F08CGGGCCCACCTGTCAGTGNONE 
AK063530CGGGCCCACCTGTCAGTGTranscriptional factor B3 family protein. 
Os01g0915800AK103859TTTTGGGCCGGGCCCAAACSimilar to FK506-binding protein 2-2 precursor (EC 5.2.1.8) (Peptidyl-prolyl cis- trans isomerase) (PPIase) (Rotamase) (15 kDa FKBP) (FKBP-15-2). 
J090051E20TTTTGGGCCGGGCCCAAACNONE 
J090056H03TTTTGGGCCGGGCCCAAACNONE 
J090058L14TTTTGGGCCGGGCCCAAACNONE 
J090058P16TTTTGGGCCGGGCCCAAACNONE 
J090076C19TTTTGGGCCGGGCCCAAACNONE 
J100086P14TTTTGGGCCGGGCCCAAACNONE 
Os01g0918200009-034-H02GCGGGCCCACTNONE 
AK062434GCGGGCCCACTSimilar to Ubiquitin-like protein SMT3. 
AK103092GCGGGCCCACTNONE 
J065093P18GCGGGCCCACTNONE 
J065137C15GCGGGCCCACTNONE 
J065156G01GCGGGCCCACTNONE 
J065206H16GCGGGCCCACTNONE 
J065209D03GCGGGCCCACTNONE 
J075073K05GCGGGCCCACTNONE 
J075099B17GCGGGCCCACTNONE 
J075166N04GCGGGCCCACTNONE 
Os01g0921600AK071344CCCGGGCCCACGTGTCSimilar to Mitochondrial import receptor subunit TOM20 (Translocase of outer membrane 20 kDa subunit). 
J013039J22CCCGGGCCCACGTGTCNONE 
J013109E03CCCGGGCCCACGTGTCNONE 
J023081J12CCCGGGCCCACGTGTCNONE 
J023091E24CCCGGGCCCACGTGTCNONE 
J033022A01CCCGGGCCCACGTGTCNONE 
J033074C13CCCGGGCCCACGTGTCNONE 
J065199E03CCCGGGCCCACGTGTCNONE 
J075172O04CCCGGGCCCACGTGTCNONE 
J090007G18CCCGGGCCCACGTGTCNONE 
J090052B17CCCGGGCCCACGTGTCNONE 
J090074H01CCCGGGCCCACGTGTCNONE 
J100043J09CCCGGGCCCACGTGTCNONE 
J100059J05CCCGGGCCCACGTGTCNONE 
Os01g0924000004-020-C09CGGGCCCACAANONE 
005-014-A06CGGGCCCACAANONE 
009-085-G12CGGGCCCACAANONE 
009-123-A08CGGGCCCACAANONE 
009-134-A05CGGGCCCACAANONE 
009-137-F06CGGGCCCACAANONE 
016-016-B08CGGGCCCACAANONE 
AF050674CGGGCCCACAANONE 
AK061690CGGGCCCACAASimilar to Chloroplast 50S ribosomal protein L27 (Fragment). 
AK120797CGGGCCCACAANONE 
J013040A15CGGGCCCACAANONE 
J013104L20CGGGCCCACAANONE 
J013127E12CGGGCCCACAANONE 
J013158O05CGGGCCCACAANONE 
J023012E09CGGGCCCACAANONE 
J023126L23CGGGCCCACAANONE 
J023143B03CGGGCCCACAANONE 
J065005B16CGGGCCCACAANONE 
J065101J15CGGGCCCACAANONE 
J065105K16CGGGCCCACAANONE 
J065155K16CGGGCCCACAANONE 
J065171M17CGGGCCCACAANONE 
J065182F07CGGGCCCACAANONE 
J065187D10CGGGCCCACAANONE 
J065194I24CGGGCCCACAANONE 
J065207E24CGGGCCCACAANONE 
J075001C24CGGGCCCACAANONE 
J075090O10CGGGCCCACAANONE 
J075095H17CGGGCCCACAANONE 
J075109M24CGGGCCCACAANONE 
J075123C18CGGGCCCACAANONE 
J075148G22CGGGCCCACAANONE 
J090009B09CGGGCCCACAANONE 
J090075K17CGGGCCCACAANONE 
J090081H23CGGGCCCACAANONE 
J090097H21CGGGCCCACAANONE 
J100063P14CGGGCCCACAANONE 
Os01g0931300012-055-E05AGTGGGCCCGNONE 
AK068196AGTGGGCCCGTafazzin family protein. 
AK099213AGTGGGCCCGNONE 
Os01g0952600AK067525ACCGGGCCCACCCNONE 
AK070047ACCGGGCCCACCCSimilar to LacZ (Fragment). 
Os01g0953100AK064981CGGGCCCATCTNONE 
AK068882CGGGCCCATCTProtein of unknown function DUF594 family protein. 
J013001C07CGGGCCCATCTNONE 
J013169K14CGGGCCCATCTNONE 
J033114G07CGGGCCCATCTNONE 
J065035K15CGGGCCCATCTNONE 
J065082E12CGGGCCCATCTNONE 
Os02g0106100AK072245AATGGGCCCGCGCCACGTGSimilar to Fructosyltransferase. 
Os02g0115700AK065094CCCGGGCCCACCACatalase isozyme A (EC 1.11.1.6) (CAT-A). 
AK099231CCCGGGCCCACCANONE 
AK099923CCCGGGCCCACCANONE 
X61626CCCGGGCCCACCANONE 
Os02g0119400AK060055GTTTGGGCCCGGCCCACCTNONE 
AK102774GTTTGGGCCCGGCCCACCTSimilar to Syntaxin 52 (AtSYP52). 
J033107H09GTTTGGGCCCGGCCCACCTNONE 
J075175F09GTTTGGGCCCGGCCCACCTNONE 
J090011H05GTTTGGGCCCGGCCCACCTNONE 
J090091O05GTTTGGGCCCGGCCCACCTNONE 
Os02g0121100012-035-F06CGGGCCCACGCGTNONE 
013-031-H05CGGGCCCACGCGTNONE 
013-058-E11CGGGCCCACGCGTNONE 
014-010-D01CGGGCCCACGCGTNONE 
AK070711CGGGCCCACGCGTConserved hypothetical protein. 
AK119758CGGGCCCACGCGTNONE 
J013033G12CGGGCCCACGCGTNONE 
J023007M16CGGGCCCACGCGTNONE 
J023020K20CGGGCCCACGCGTNONE 
J023061H10CGGGCCCACGCGTNONE 
J033027H20CGGGCCCACGCGTNONE 
J033051E18CGGGCCCACGCGTNONE 
J090005F12CGGGCCCACGCGTNONE 
J090017A20CGGGCCCACGCGTNONE 
J090018G11CGGGCCCACGCGTNONE 
J090062C18CGGGCCCACGCGTNONE 
J100027N10CGGGCCCACGCGTNONE 
J100032L14CGGGCCCACGCGTNONE 
J100045C14CGGGCCCACGCGTNONE 
J100061M09CGGGCCCACGCGTNONE 
J100062K11CGGGCCCACGCGTNONE 
J100064H11CGGGCCCACGCGTNONE 
J100074H16CGGGCCCACGCGTNONE 
J100082N01CGGGCCCACGCGTNONE 
Os02g0180100005-013-B11TCATGGGCCCGNONE 
AK067359TCATGGGCCCGPeptidase C12, ubiquitin carboxyl-terminal hydrolase 1 family protein. 
AK104700TCATGGGCCCGNONE 
J013090O22TCATGGGCCCGNONE 
J013099P19TCATGGGCCCGNONE 
J090041M21TCATGGGCCCGNONE 
J090049C14TCATGGGCCCGNONE 
Os02g0190900AK111037TTTTGGGCCGGGCCCATTAPhytoene dehydrogenase-like protein. 
Os02g0197600003-113-H08CCCGGGCCCACCCNONE 
003-129-H06CCCGGGCCCACCCNONE 
006-021-H09CCCGGGCCCACCCNONE 
006-022-B05CCCGGGCCCACCCNONE 
006-022-G12CCCGGGCCCACCCNONE 
006-023-A02CCCGGGCCCACCCNONE 
006-023-C02CCCGGGCCCACCCNONE 
006-023-G09CCCGGGCCCACCCNONE 
006-024-D12CCCGGGCCCACCCNONE 
006-025-C09CCCGGGCCCACCCNONE 
006-025-E01CCCGGGCCCACCCNONE 
006-026-A11CCCGGGCCCACCCNONE 
006-026-A12CCCGGGCCCACCCNONE 
006-028-E11CCCGGGCCCACCCNONE 
006-028-G03CCCGGGCCCACCCNONE 
006-029-A09CCCGGGCCCACCCNONE 
006-029-A12CCCGGGCCCACCCNONE 
006-029-D01CCCGGGCCCACCCNONE 
006-029-F12CCCGGGCCCACCCNONE 
006-029-G12CCCGGGCCCACCCNONE 
006-030-A08CCCGGGCCCACCCNONE 
006-030-C09CCCGGGCCCACCCNONE 
006-030-G06CCCGGGCCCACCCNONE 
006-031-D06CCCGGGCCCACCCNONE 
006-032-C01CCCGGGCCCACCCNONE 
006-034-B07CCCGGGCCCACCCNONE 
006-035-G01CCCGGGCCCACCCNONE 
006-036-H12CCCGGGCCCACCCNONE 
006-040-C01CCCGGGCCCACCCNONE 
006-041-G12CCCGGGCCCACCCNONE 
006-041-H02CCCGGGCCCACCCNONE 
006-041-H11CCCGGGCCCACCCNONE 
006-042-B01CCCGGGCCCACCCNONE 
006-042-F10CCCGGGCCCACCCNONE 
006-043-C04CCCGGGCCCACCCNONE 
006-044-D10CCCGGGCCCACCCNONE 
006-048-D11CCCGGGCCCACCCNONE 
006-049-D07CCCGGGCCCACCCNONE 
006-050-H05CCCGGGCCCACCCNONE 
006-051-D10CCCGGGCCCACCCNONE 
006-051-E05CCCGGGCCCACCCNONE 
006-053-C07CCCGGGCCCACCCNONE 
006-054-B10CCCGGGCCCACCCNONE 
006-054-C12CCCGGGCCCACCCNONE 
006-054-G08CCCGGGCCCACCCNONE 
006-055-D12CCCGGGCCCACCCNONE 
006-056-C04CCCGGGCCCACCCNONE 
006-056-H06CCCGGGCCCACCCNONE 
006-057-E07CCCGGGCCCACCCNONE 
006-058-C12CCCGGGCCCACCCNONE 
006-059-B06CCCGGGCCCACCCNONE 
006-059-B09CCCGGGCCCACCCNONE 
006-059-D05CCCGGGCCCACCCNONE 
006-060-D07CCCGGGCCCACCCNONE 
006-061-D01CCCGGGCCCACCCNONE 
006-061-G09CCCGGGCCCACCCNONE 
006-062-A12CCCGGGCCCACCCNONE 
006-062-D04CCCGGGCCCACCCNONE 
006-062-G01CCCGGGCCCACCCNONE 
006-063-C10CCCGGGCCCACCCNONE 
006-064-A10CCCGGGCCCACCCNONE 
006-067-E04CCCGGGCCCACCCNONE 
006-067-H11CCCGGGCCCACCCNONE 
006-069-G08CCCGGGCCCACCCNONE 
006-071-G06CCCGGGCCCACCCNONE 
006-073-E06CCCGGGCCCACCCNONE 
006-074-B12CCCGGGCCCACCCNONE 
006-074-F06CCCGGGCCCACCCNONE 
006-074-H01CCCGGGCCCACCCNONE 
006-076-D12CCCGGGCCCACCCNONE 
006-077-C08CCCGGGCCCACCCNONE 
006-083-H01CCCGGGCCCACCCNONE 
006-083-H09CCCGGGCCCACCCNONE 
006-084-C02CCCGGGCCCACCCNONE 
006-086-D05CCCGGGCCCACCCNONE 
006-086-E09CCCGGGCCCACCCNONE 
006-087-D04CCCGGGCCCACCCNONE 
006-087-E12CCCGGGCCCACCCNONE 
006-088-A01CCCGGGCCCACCCNONE 
006-088-H09CCCGGGCCCACCCNONE 
006-089-G01CCCGGGCCCACCCNONE 
006-090-G01CCCGGGCCCACCCNONE 
006-092-H10CCCGGGCCCACCCNONE 
006-096-G12CCCGGGCCCACCCNONE 
006-097-C04CCCGGGCCCACCCNONE 
006-098-B06CCCGGGCCCACCCNONE 
006-099-A02CCCGGGCCCACCCNONE 
006-099-B05CCCGGGCCCACCCNONE 
006-100-F02CCCGGGCCCACCCNONE 
006-100-F07CCCGGGCCCACCCNONE 
006-104-A01CCCGGGCCCACCCNONE 
006-107-F06CCCGGGCCCACCCNONE 
006-109-A05CCCGGGCCCACCCNONE 
006-110-G03CCCGGGCCCACCCNONE 
006-111-A06CCCGGGCCCACCCNONE 
006-111-C12CCCGGGCCCACCCNONE 
006-112-B03CCCGGGCCCACCCNONE 
006-113-A02CCCGGGCCCACCCNONE 
006-113-H06CCCGGGCCCACCCNONE 
006-115-D11CCCGGGCCCACCCNONE 
006-116-F11CCCGGGCCCACCCNONE 
006-117-A10CCCGGGCCCACCCNONE 
006-117-C01CCCGGGCCCACCCNONE 
006-117-D08CCCGGGCCCACCCNONE 
006-118-B12CCCGGGCCCACCCNONE 
006-118-D08CCCGGGCCCACCCNONE 
006-118-E11CCCGGGCCCACCCNONE 
006-118-H08CCCGGGCCCACCCNONE 
006-119-C10CCCGGGCCCACCCNONE 
006-120-H11CCCGGGCCCACCCNONE 
009-025-G09CCCGGGCCCACCCNONE 
009-061-H06CCCGGGCCCACCCNONE 
009-070-E02CCCGGGCCCACCCNONE 
009-077-A07CCCGGGCCCACCCNONE 
009-114-A07CCCGGGCCCACCCNONE 
009-115-G02CCCGGGCCCACCCNONE 
009-123-C06CCCGGGCCCACCCNONE 
009-125-H03CCCGGGCCCACCCNONE 
009-127-H11CCCGGGCCCACCCNONE 
009-136-G03CCCGGGCCCACCCNONE 
009-154-B05CCCGGGCCCACCCNONE 
009-162-B02CCCGGGCCCACCCNONE 
009-176-D09CCCGGGCCCACCCNONE 
009-178-F10CCCGGGCCCACCCNONE 
009-190-F05CCCGGGCCCACCCNONE 
009-200-C08CCCGGGCCCACCCNONE 
011-064-H10CCCGGGCCCACCCNONE 
AK060143CCCGGGCCCACCCNONE 
AK060970CCCGGGCCCACCCNONE 
AK068102CCCGGGCCCACCCSimilar to PSI type III chlorophyll a/b-binding protein. 
AK104096CCCGGGCCCACCCNONE 
AK104215CCCGGGCCCACCCNONE 
AK104348CCCGGGCCCACCCNONE 
AK104385CCCGGGCCCACCCNONE 
AK104392CCCGGGCCCACCCNONE 
AK104446CCCGGGCCCACCCNONE 
AK104458CCCGGGCCCACCCNONE 
AK104469CCCGGGCCCACCCNONE 
AK104522CCCGGGCCCACCCNONE 
AK104535CCCGGGCCCACCCNONE 
AK104557CCCGGGCCCACCCNONE 
AK104636CCCGGGCCCACCCNONE 
AK104646CCCGGGCCCACCCNONE 
AK104734CCCGGGCCCACCCNONE 
AK106085CCCGGGCCCACCCNONE 
AK109398CCCGGGCCCACCCNONE 
AK119554CCCGGGCCCACCCNONE 
J013044I21CCCGGGCCCACCCNONE 
J013090N21CCCGGGCCCACCCNONE 
J013130I24CCCGGGCCCACCCNONE 
J023038D09CCCGGGCCCACCCNONE 
J023064C23CCCGGGCCCACCCNONE 
J023088A09CCCGGGCCCACCCNONE 
J023105K12CCCGGGCCCACCCNONE 
J065022M15CCCGGGCCCACCCNONE 
J075062L23CCCGGGCCCACCCNONE 
J075069B05CCCGGGCCCACCCNONE 
J075072D15CCCGGGCCCACCCNONE 
J075090E24CCCGGGCCCACCCNONE 
J075126D14CCCGGGCCCACCCNONE 
J075154L21CCCGGGCCCACCCNONE 
J075165F23CCCGGGCCCACCCNONE 
J075166D04CCCGGGCCCACCCNONE 
J080003O05CCCGGGCCCACCCNONE 
J080005L07CCCGGGCCCACCCNONE 
J080008K15CCCGGGCCCACCCNONE 
J080009A07CCCGGGCCCACCCNONE 
J080009F05CCCGGGCCCACCCNONE 
J080010M06CCCGGGCCCACCCNONE 
J080011E06CCCGGGCCCACCCNONE 
J080011H20CCCGGGCCCACCCNONE 
J080018I05CCCGGGCCCACCCNONE 
J080021N17CCCGGGCCCACCCNONE 
J080036E20CCCGGGCCCACCCNONE 
J080040E22CCCGGGCCCACCCNONE 
J080044D19CCCGGGCCCACCCNONE 
J080045C21CCCGGGCCCACCCNONE 
J080047B08CCCGGGCCCACCCNONE 
J080048E24CCCGGGCCCACCCNONE 
J080053D19CCCGGGCCCACCCNONE 
J080053N09CCCGGGCCCACCCNONE 
J080054A19CCCGGGCCCACCCNONE 
J080061O16CCCGGGCCCACCCNONE 
J080064P15CCCGGGCCCACCCNONE 
J080065M06CCCGGGCCCACCCNONE 
J080067G11CCCGGGCCCACCCNONE 
J080072M09CCCGGGCCCACCCNONE 
J080079I15CCCGGGCCCACCCNONE 
J080082I12CCCGGGCCCACCCNONE 
J080083K21CCCGGGCCCACCCNONE 
J080096H12CCCGGGCCCACCCNONE 
J080096J10CCCGGGCCCACCCNONE 
J080097O13CCCGGGCCCACCCNONE 
J080305P05CCCGGGCCCACCCNONE 
J080311C21CCCGGGCCCACCCNONE 
J080317C16CCCGGGCCCACCCNONE 
Os02g0299200AK105486CGGGCCCACAIQ calmodulin-binding region domain containing protein. 
Os02g0301100006-029-F04GGGTGGGCCCGGCNONE 
012-005-F07GGGTGGGCCCGGCNONE 
013-093-H10GGGTGGGCCCGGCNONE 
015-042-B01GGGTGGGCCCGGCNONE 
016-017-F09GGGTGGGCCCGGCNONE 
016-079-B07GGGTGGGCCCGGCNONE 
016-079-G03GGGTGGGCCCGGCNONE 
016-087-F11GGGTGGGCCCGGCNONE 
AK071676GGGTGGGCCCGGCNONE 
AK100174GGGTGGGCCCGGCMtN3 and saliva related transmembrane protein family protein. 
AK104411GGGTGGGCCCGGCNONE 
AK104467GGGTGGGCCCGGCNONE 
J023069G02GGGTGGGCCCGGCNONE 
J023108F17GGGTGGGCCCGGCNONE 
J033042B04GGGTGGGCCCGGCNONE 
J033128D06GGGTGGGCCCGGCNONE 
J033138I12GGGTGGGCCCGGCNONE 
J053064K16GGGTGGGCCCGGCNONE 
J065088A12GGGTGGGCCCGGCNONE 
J065102L08GGGTGGGCCCGGCNONE 
J065104L14GGGTGGGCCCGGCNONE 
J065117M20GGGTGGGCCCGGCNONE 
J065117N14GGGTGGGCCCGGCNONE 
J065120H23GGGTGGGCCCGGCNONE 
J065135F06GGGTGGGCCCGGCNONE 
J065138J17GGGTGGGCCCGGCNONE 
J065138P06GGGTGGGCCCGGCNONE 
J065156G16GGGTGGGCCCGGCNONE 
J065163M20GGGTGGGCCCGGCNONE 
J065176A14GGGTGGGCCCGGCNONE 
J065182C02GGGTGGGCCCGGCNONE 
J065200C05GGGTGGGCCCGGCNONE 
J065213J22GGGTGGGCCCGGCNONE 
J065217D24GGGTGGGCCCGGCNONE 
J075009H03GGGTGGGCCCGGCNONE 
J075020D10GGGTGGGCCCGGCNONE 
J075026L24GGGTGGGCCCGGCNONE 
J075028L01GGGTGGGCCCGGCNONE 
J075057O09GGGTGGGCCCGGCNONE 
J075089A20GGGTGGGCCCGGCNONE 
J075094J15GGGTGGGCCCGGCNONE 
J075103B11GGGTGGGCCCGGCNONE 
J075143L13GGGTGGGCCCGGCNONE 
J075153K15GGGTGGGCCCGGCNONE 
J075161P22GGGTGGGCCCGGCNONE 
J075166J06GGGTGGGCCCGGCNONE 
J075177G06GGGTGGGCCCGGCNONE 
J075198N06GGGTGGGCCCGGCNONE 
Os02g0461900009-042-C04GGTGGGCCCGACTCGACNONE 
AF140492GGTGGGCCCGACTCGACNONE 
AK072619GGTGGGCCCGACTCGACNONE 
AK104969GGTGGGCCCGACTCGACConserved hypothetical protein. 
AK119466GGTGGGCCCGACTCGACNONE 
Os02g0510100AK058487ATCTGGGCCCGCNONE 
AK122107ATCTGGGCCCGCSimilar to U6 snRNA-associated Sm-like protein LSm6 (Sm protein F). 
J033126F06ATCTGGGCCCGCNONE 
J053077L04ATCTGGGCCCGCNONE 
J065010C11ATCTGGGCCCGCNONE 
J075104O14ATCTGGGCCCGCNONE 
J080003G03ATCTGGGCCCGCNONE 
J080014K05ATCTGGGCCCGCNONE 
J080026F03ATCTGGGCCCGCNONE 
J080027O05ATCTGGGCCCGCNONE 
J080037K15ATCTGGGCCCGCNONE 
J080039D24ATCTGGGCCCGCNONE 
J080043G19ATCTGGGCCCGCNONE 
J080047P05ATCTGGGCCCGCNONE 
J080048D22ATCTGGGCCCGCNONE 
J080049F23ATCTGGGCCCGCNONE 
J080062A21ATCTGGGCCCGCNONE 
J080063H20ATCTGGGCCCGCNONE 
J080067P15ATCTGGGCCCGCNONE 
J080068P19ATCTGGGCCCGCNONE 
J080079J15ATCTGGGCCCGCNONE 
J080092K19ATCTGGGCCCGCNONE 
J080096M04ATCTGGGCCCGCNONE 
Os02g0575900AK102188CGGGCCCATTExo70 exocyst complex subunit family protein. 
J033032M01CGGGCCCATTNONE 
J033086P19CGGGCCCATTNONE 
J033148L20CGGGCCCATTNONE 
J100040L08CGGGCCCATTNONE 
Os02g0586900013-044-D08AACGGGCCCAGANONE 
014-087-D07AACGGGCCCAGANONE 
AK063583AACGGGCCCAGASimilar to Glycine rich protein (Fragment). 
AK105378AACGGGCCCAGANONE 
Os02g0600200009-154-A06CCCACCCGGGCCCACACNONE 
AK058978CCCACCCGGGCCCACACNONE 
AK066974CCCACCCGGGCCCACACIQ calmodulin-binding region domain containing protein. 
Os02g0606800AK073760CCCGGGCCCACAIsochorismatase hydrolase family protein. 
J100033B19CCCGGGCCCACANONE 
J100047E15CCCGGGCCCACANONE 
J100058A18CCCGGGCCCACANONE 
J100068L14CCCGGGCCCACANONE 
J100089I02CCCGGGCCCACANONE 
Os02g0614400016-088-D04ACCGGGCCCAATNONE 
AK071805ACCGGGCCCAATConserved hypothetical protein. 
J023108N22ACCGGGCCCAATNONE 
Os02g0672600AK070286TATTGGGCCCGCSimilar to N6-adenosine-methyltransferase 70 kDa subunit (EC 2.1.1.62) (MT-A70) (Methyltransferase-like protein 3). Splice isoform 2. 
AK101174TATTGGGCCCGCNONE 
Os02g0686300AK066567AGAGTGGGCCCGConserved hypothetical protein. 
Os02g0697200015-013-B10AACGGGCCCACANONE 
AK059475AACGGGCCCACANONE 
AK102993AACGGGCCCACAConserved hypothetical protein. 
J033079I18AACGGGCCCACANONE 
J033082A14AACGGGCCCACANONE 
J065047H08AACGGGCCCACANONE 
J065131M14AACGGGCCCACANONE 
Os02g0708100AK059630TCGTGGGCCCGCNONE 
AK102055TCGTGGGCCCGCSimilar to Carbamoyl phosphate synthetase small subunit (EC 6.3.5.5). 
Os02g0731700AK072346AGTGGGCCCGCSimilar to CONSTANS-like 1 protein. 
AK120314AGTGGGCCCGCNONE 
Os02g0756200AK063454CGGGCCCATGGNONE 
AK101655CGGGCCCATGGSimilar to Phi-1 protein. 
J065104L21CGGGCCCATGGNONE 
J065141A07CGGGCCCATGGNONE 
Os02g0767100011-054-E05AATTGGGCCCGNONE 
AK063351AATTGGGCCCGNONE 
AK103640AATTGGGCCCGConserved hypothetical protein. 
J090022G11AATTGGGCCCGNONE 
J090072L18AATTGGGCCCGNONE 
Os02g0767500005-017-F10CGGGCCCACANONE 
AB016065CGGGCCCACANONE 
AK069611CGGGCCCACAMitochondrial phosphate transporter. 
J013020K11CGGGCCCACANONE 
J013066I18CGGGCCCACANONE 
J023012D02CGGGCCCACANONE 
J023020J16CGGGCCCACANONE 
J023022H13CGGGCCCACANONE 
J023044N15CGGGCCCACANONE 
J023067E15CGGGCCCACANONE 
J023079C06CGGGCCCACANONE 
J023080B07CGGGCCCACANONE 
J023081G11CGGGCCCACANONE 
J023091H22CGGGCCCACANONE 
J023092J03CGGGCCCACANONE 
J023114D02CGGGCCCACANONE 
J023121J15CGGGCCCACANONE 
J023128G10CGGGCCCACANONE 
J023132B15CGGGCCCACANONE 
J023140G10CGGGCCCACANONE 
J023142B10CGGGCCCACANONE 
J033026C15CGGGCCCACANONE 
J033029F21CGGGCCCACANONE 
J033037I09CGGGCCCACANONE 
J033046D11CGGGCCCACANONE 
J033081L20CGGGCCCACANONE 
J033097J19CGGGCCCACANONE 
J033125D19CGGGCCCACANONE 
J033125I04CGGGCCCACANONE 
J033141M21CGGGCCCACANONE 
J033143K08CGGGCCCACANONE 
J053091N01CGGGCCCACANONE 
J065093C20CGGGCCCACANONE 
J065104K11CGGGCCCACANONE 
J065143L16CGGGCCCACANONE 
J065205I23CGGGCCCACANONE 
J090057C12CGGGCCCACANONE 
J090075P11CGGGCCCACANONE 
Os02g0794400AK065845GTTTGGGCTTGTGGGCCCGTGGCCCAACTInitiation factor 3 family protein. 
J013042M03GTTTGGGCTTGTGGGCCCGTGGCCCAACTNONE 
Os02g0805200AK071591CAGGTGGGCCCGProliferating cell nuclear antigen (PCNA) (Cyclin). 
J023105C08CAGGTGGGCCCGNONE 
J033030H07CAGGTGGGCCCGNONE 
J033050M24CAGGTGGGCCCGNONE 
J033069B10CAGGTGGGCCCGNONE 
J033121A16CAGGTGGGCCCGNONE 
J053023M14CAGGTGGGCCCGNONE 
J053033A15CAGGTGGGCCCGNONE 
J053054H14CAGGTGGGCCCGNONE 
J053055H24CAGGTGGGCCCGNONE 
J053082B18CAGGTGGGCCCGNONE 
J065001N03CAGGTGGGCCCGNONE 
J065011O16CAGGTGGGCCCGNONE 
J065026K24CAGGTGGGCCCGNONE 
J065056C09CAGGTGGGCCCGNONE 
J065067H11CAGGTGGGCCCGNONE 
J065097E19CAGGTGGGCCCGNONE 
J065118O11CAGGTGGGCCCGNONE 
J065124N09CAGGTGGGCCCGNONE 
J065143A02CAGGTGGGCCCGNONE 
J065213P06CAGGTGGGCCCGNONE 
J065215E24CAGGTGGGCCCGNONE 
J075051B11CAGGTGGGCCCGNONE 
J075065K05CAGGTGGGCCCGNONE 
J080306E10CAGGTGGGCCCGNONE 
J090042I16CAGGTGGGCCCGNONE 
J090066J24CAGGTGGGCCCGNONE 
J090092K17CAGGTGGGCCCGNONE 
J100029A17CAGGTGGGCCCGNONE 
J100052N08CAGGTGGGCCCGNONE 
J100071I23CAGGTGGGCCCGNONE 
Os02g0823800AK120318GCAGCCCATACAACGGGCCCAACTConserved hypothetical protein. 
J075055J16GCAGCCCATACAACGGGCCCAACTNONE 
Os03g0148000AK110468GCCGGGCCCACAProtein of unknown function DUF677 family protein. 
Os03g0151800AK064955CGGGCCCACACNONE 
AK098874CGGGCCCACACNONE 
AK098980CGGGCCCACACNONE 
AK099712CGGGCCCACACNONE 
AK099889CGGGCCCACACNONE 
AK121641CGGGCCCACACSimilar to Cell division control protein 48 homolog A (AtCDC48a). 
J013001A05CGGGCCCACACNONE 
J013001D04CGGGCCCACACNONE 
J013121O12CGGGCCCACACNONE 
Os03g0156500011-075-F02CGGGCCCACGTGNONE 
012-077-G10CGGGCCCACGTGNONE 
AK103466CGGGCCCACGTGLupus La protein family protein. 
J013088H17CGGGCCCACGTGNONE 
J013135G21CGGGCCCACGTGNONE 
J033050E10CGGGCCCACGTGNONE 
J033050J01CGGGCCCACGTGNONE 
J033129N23CGGGCCCACGTGNONE 
J065085L16CGGGCCCACGTGNONE 
J065101B19CGGGCCCACGTGNONE 
J065167N03CGGGCCCACGTGNONE 
J090009O21CGGGCCCACGTGNONE 
J090049D11CGGGCCCACGTGNONE 
J100017F23CGGGCCCACGTGNONE 
J100040E12CGGGCCCACGTGNONE 
J100055O18CGGGCCCACGTGNONE 
J100061K08CGGGCCCACGTGNONE 
J100072M05CGGGCCCACGTGNONE 
J100077B08CGGGCCCACGTGNONE 
J100086G03CGGGCCCACGTGNONE 
Os03g0160900J065071D24CGGGCCCAACTNONE 
J065132L03CGGGCCCAACTHypothetical protein. 
J075189L19CGGGCCCAACTNONE 
Os03g0171700J065192H12CCCGGGCCCACTBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
Os03g0181500AK100798CCTGGGCCCGCNONE 
Os03g0184600AK065264ATTTGGGCCCGGCCCACAANAD-dependent epimerase/dehydratase family protein. 
AK065264CTTGGGCCCGCNAD-dependent epimerase/dehydratase family protein. 
Os03g0191200AK070228TGGTGGGCCCGGTWW/Rsp5/WWP domain containing protein. 
Os03g0192400009-081-A03AGTGGGCCCGGCCCNONE 
009-159-B02AGTGGGCCCGGCCCNONE 
AK070573AGTGGGCCCGGCCCGRIM-19 family protein. 
J023056B01AGTGGGCCCGGCCCNONE 
J023075G06AGTGGGCCCGGCCCNONE 
J033048K16AGTGGGCCCGGCCCNONE 
J033048L16AGTGGGCCCGGCCCNONE 
J053031H23AGTGGGCCCGGCCCNONE 
J065002H14AGTGGGCCCGGCCCNONE 
J065006G22AGTGGGCCCGGCCCNONE 
J065032G13AGTGGGCCCGGCCCNONE 
J065056A09AGTGGGCCCGGCCCNONE 
J065078I01AGTGGGCCCGGCCCNONE 
J065095G01AGTGGGCCCGGCCCNONE 
J065095I18AGTGGGCCCGGCCCNONE 
J065134M18AGTGGGCCCGGCCCNONE 
J065158P07AGTGGGCCCGGCCCNONE 
J065165K17AGTGGGCCCGGCCCNONE 
J065181J12AGTGGGCCCGGCCCNONE 
J065189N09AGTGGGCCCGGCCCNONE 
J065200D13AGTGGGCCCGGCCCNONE 
J065202H20AGTGGGCCCGGCCCNONE 
J065215K20AGTGGGCCCGGCCCNONE 
J075049N19AGTGGGCCCGGCCCNONE 
J075147J16AGTGGGCCCGGCCCNONE 
J090081E19AGTGGGCCCGGCCCNONE 
J100017C16AGTGGGCCCGGCCCNONE 
J100039M16AGTGGGCCCGGCCCNONE 
J100043E23AGTGGGCCCGGCCCNONE 
J100063L12AGTGGGCCCGGCCCNONE 
J100079F22AGTGGGCCCGGCCCNONE 
Os03g0192700012-005-H03GGTGGGCCCGNONE 
012-006-B05GGTGGGCCCGNONE 
012-006-E07GGTGGGCCCGNONE 
012-051-D10GGTGGGCCCGNONE 
014-089-H06GGTGGGCCCGNONE 
015-034-C05GGTGGGCCCGNONE 
015-042-C06GGTGGGCCCGNONE 
015-059-E09GGTGGGCCCGNONE 
015-096-A08GGTGGGCCCGNONE 
016-030-D06GGTGGGCCCGNONE 
016-053-H07GGTGGGCCCGNONE 
016-064-D02GGTGGGCCCGNONE 
AB012107GGTGGGCCCGNONE 
AK058750GGTGGGCCCGSimilar to Myo-inositol-1-phosphate synthase. 
AK103501GGTGGGCCCGNONE 
J023102F09GGTGGGCCCGNONE 
J023103H09GGTGGGCCCGNONE 
J023107F22GGTGGGCCCGNONE 
J033031E17GGTGGGCCCGNONE 
J033090C03GGTGGGCCCGNONE 
J033090C17GGTGGGCCCGNONE 
J033091K19GGTGGGCCCGNONE 
J033131B11GGTGGGCCCGNONE 
J033133D04GGTGGGCCCGNONE 
J053050C09GGTGGGCCCGNONE 
J053078O12GGTGGGCCCGNONE 
J075037B10GGTGGGCCCGNONE 
J090021M23GGTGGGCCCGNONE 
Os03g0195900J065063O15ATTGGGCCCGNONE 
Os03g0206400AK066494GGGTGGGCCCGCConserved hypothetical protein. 
AK107011GGGTGGGCCCGCNONE 
J065162G04GGGTGGGCCCGCNONE 
Os03g0222100AK070688CCCGGGCCCACTSimilar to Topoisomerase-like protein. 
J023057E15CCCGGGCCCACTNONE 
J023099M24CCCGGGCCCACTNONE 
J023147F14CCCGGGCCCACTNONE 
Os03g0240700009-086-G10TAATGGGCCCGGCCCAAACNONE 
AK071799TAATGGGCCCGGCCCAAACConserved hypothetical protein. 
J023112A13TAATGGGCCCGGCCCAAACNONE 
J043022A01TAATGGGCCCGGCCCAAACNONE 
J065106A01TAATGGGCCCGGCCCAAACNONE 
J075023P22TAATGGGCCCGGCCCAAACNONE 
J075138I21TAATGGGCCCGGCCCAAACNONE 
J075173L02TAATGGGCCCGGCCCAAACNONE 
Os03g0240800006-092-D05GTTTGGGCCGGGCCCATTANONE 
AK059292GTTTGGGCCGGGCCCATTANONE 
AK061178GTTTGGGCCGGGCCCATTASimilar to AGL157Cp. 
AK121552GTTTGGGCCGGGCCCATTANONE 
J023131D06GTTTGGGCCGGGCCCATTANONE 
J033033E14GTTTGGGCCGGGCCCATTANONE 
J033105B01GTTTGGGCCGGGCCCATTANONE 
J033114L18GTTTGGGCCGGGCCCATTANONE 
J033132N24GTTTGGGCCGGGCCCATTANONE 
J065032H03GTTTGGGCCGGGCCCATTANONE 
J065115J20GTTTGGGCCGGGCCCATTANONE 
J065150C05GTTTGGGCCGGGCCCATTANONE 
J080302A11GTTTGGGCCGGGCCCATTANONE 
J080302H16GTTTGGGCCGGGCCCATTANONE 
J080305M12GTTTGGGCCGGGCCCATTANONE 
J080306F13GTTTGGGCCGGGCCCATTANONE 
J080312A06GTTTGGGCCGGGCCCATTANONE 
J090088P09GTTTGGGCCGGGCCCATTANONE 
Os03g0244700011-100-F11CCCACGGGCCCACCTNONE 
015-065-B06CCCACGGGCCCACCTNONE 
AK100399CCCACGGGCCCACCTNONE 
AK100620CCCACGGGCCCACCTArmadillo-like helical domain containing protein. 
J023086N09CCCACGGGCCCACCTNONE 
J100032P14CCCACGGGCCCACCTNONE 
Os03g0260100AK066143AACGGGCCCATGGConserved hypothetical protein. 
Os03g0271500AK068546GCGGGCCCACCCACCGCACGCGNONE 
AK109239GCGGGCCCACCCACCGCACGCGConserved hypothetical protein. 
J013157P04GCGGGCCCACCCACCGCACGCGNONE 
J075041K23GCGGGCCCACCCACCGCACGCGNONE 
Os03g0278400015-014-G10GCTGGGCCCGGGNONE 
AK070052GCTGGGCCCGGGSimilar to ADP ribosylation GTPase-like protein (Fragment). 
AY224461GCTGGGCCCGGGNONE 
J065218E15GCTGGGCCCGGGNONE 
J075115A06GCTGGGCCCGGGNONE 
J075134I05GCTGGGCCCGGGNONE 
J100032D08GCTGGGCCCGGGNONE 
J100044O13GCTGGGCCCGGGNONE 
J100051G15GCTGGGCCCGGGNONE 
J100052O21GCTGGGCCCGGGNONE 
J100071A12GCTGGGCCCGGGNONE 
Os03g0279200009-097-C06CGGGCCCACCACNONE 
013-007-B07CGGGCCCACCACNONE 
AK121750CGGGCCCACCACSimilar to Histone H2A. 
J033087I02CGGGCCCACCACNONE 
J065002G20CGGGCCCACCACNONE 
J065102M04CGGGCCCACCACNONE 
J065139A02CGGGCCCACCACNONE 
J075109D21CGGGCCCACCACNONE 
J075191L12CGGGCCCACCACNONE 
J090096C03CGGGCCCACCACNONE 
J100036C23CGGGCCCACCACNONE 
Os03g0288400Os03g0288400GCGGGCCCACCAConserved hypothetical protein. 
Os03g0294200AK069285CCCGGGCCCACASimilar to Fructose-6-phosphate-2-kinase/fructose-2, 6-bisphosphatase. 
Os03g0344100009-166-F10TATGGGCCCGNONE 
AK061903TATGGGCCCGNONE 
AK065547TATGGGCCCGSimilar to ASF/SF2-like pre-mRNA splicing factor SRP32''. 
J023095G24TATGGGCCCGNONE 
J033087C06TATGGGCCCGNONE 
J053073I09TATGGGCCCGNONE 
J065189D11TATGGGCCCGNONE 
J090032B15TATGGGCCCGNONE 
Os03g0379300006-039-F11GACAGGTGGGCCCGTTNONE 
AK061515GACAGGTGGGCCCGTTBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
AK068704GACAGGTGGGCCCGTTNONE 
J013159M16GACAGGTGGGCCCGTTNONE 
J090067F01GACAGGTGGGCCCGTTNONE 
J090083F21GACAGGTGGGCCCGTTNONE 
J100040M08GACAGGTGGGCCCGTTNONE 
J100048C03GACAGGTGGGCCCGTTNONE 
J100056M07GACAGGTGGGCCCGTTNONE 
J100062N22GACAGGTGGGCCCGTTNONE 
J100086L07GACAGGTGGGCCCGTTNONE 
Os03g0390400009-175-E06TCCGGGCCCATTTNONE 
013-040-G01TCCGGGCCCATTTNONE 
014-050-G05TCCGGGCCCATTTNONE 
AB025187TCCGGGCCCATTTSimilar to Cytochrome c oxidase subunit 6b. 
AK120174TCCGGGCCCATTTNONE 
J013033A17TCCGGGCCCATTTNONE 
J023028J08TCCGGGCCCATTTNONE 
J023061N05TCCGGGCCCATTTNONE 
J023077A03TCCGGGCCCATTTNONE 
J023086E01TCCGGGCCCATTTNONE 
J033022A08TCCGGGCCCATTTNONE 
J033040F24TCCGGGCCCATTTNONE 
J075073I24TCCGGGCCCATTTNONE 
J075081H01TCCGGGCCCATTTNONE 
J075175N19TCCGGGCCCATTTNONE 
J100025M03TCCGGGCCCATTTNONE 
J100036J06TCCGGGCCCATTTNONE 
J100045O18TCCGGGCCCATTTNONE 
J100062G15TCCGGGCCCATTTNONE 
J100090N19TCCGGGCCCATTTNONE 
Os03g0397400AB112772CGTGTGGGCCCGGGCCCGGANONE 
AK069928CGTGTGGGCCCGGGCCCGGASimilar to Low affinity calcium transporter CAX2 (Fragment). 
J023014O18CGTGTGGGCCCGGGCCCGGANONE 
J023036P06CGTGTGGGCCCGGGCCCGGANONE 
J023145E24CGTGTGGGCCCGGGCCCGGANONE 
J033142I11CGTGTGGGCCCGGGCCCGGANONE 
J043003A10CGTGTGGGCCCGGGCCCGGANONE 
J075023H21CGTGTGGGCCCGGGCCCGGANONE 
J075145O10CGTGTGGGCCCGGGCCCGGANONE 
J075149A03CGTGTGGGCCCGGGCCCGGANONE 
J090099B09CGTGTGGGCCCGGGCCCGGANONE 
J100017L14CGTGTGGGCCCGGGCCCGGANONE 
J100050K18CGTGTGGGCCCGGGCCCGGANONE 
J100063P16CGTGTGGGCCCGGGCCCGGANONE 
Os03g0410700J065102A22AACTGGGCCCGNONE 
Os03g0410900J065067F10CGGGCCCAGTTNONE 
J065073D08CGGGCCCAGTTNONE 
J065176C06CGGGCCCAGTTNONE 
J065189O13CGGGCCCAGTTNONE 
J065214E05CGGGCCCAGTTNONE 
J080007H09CGGGCCCAGTTNONE 
J080012B19CGGGCCCAGTTNONE 
J080020J16CGGGCCCAGTTNONE 
J080038J22CGGGCCCAGTTNONE 
J080045I09CGGGCCCAGTTNONE 
J080059M16CGGGCCCAGTTNONE 
J080060C19CGGGCCCAGTTNONE 
J080080P22CGGGCCCAGTTNONE 
J080083C03CGGGCCCAGTTNONE 
J080093M17CGGGCCCAGTTNONE 
J100029F12CGGGCCCAGTTLike-Sm ribonucleoprotein, core family protein. 
Os03g0413000009-180-E02CGGGCCCACCCNONE 
009-188-B06CGGGCCCACCCNONE 
AK060225CGGGCCCACCCNONE 
AY062181CGGGCCCACCCSimilar to Potential histone-like transcription factor. 
Os03g0625900AK101109CGGGCCCAAAAWD40-like domain containing protein. 
Os03g0626250J075100A11CGGGCCCATCANONE 
J075134H15CGGGCCCATCANONE 
J075142J02CGGGCCCATCANONE 
J075181A14CGGGCCCATCANONE 
J075192K17CGGGCCCATCANONE 
J090046B06CGGGCCCATCANONE 
Os03g0628900009-062-G01ATTTGGGCCCGGGNONE 
AK103619ATTTGGGCCCGGGPrefoldin domain containing protein. 
J033133L23ATTTGGGCCCGGGNONE 
J100039C17ATTTGGGCCCGGGNONE 
J100048I07ATTTGGGCCCGGGNONE 
J100062E19ATTTGGGCCCGGGNONE 
J100063B11ATTTGGGCCCGGGNONE 
Os03g0648400005-003-D07CCCGGGCCCAGCNONE 
006-048-C12CCCGGGCCCAGCNONE 
006-049-A03CCCGGGCCCAGCNONE 
011-008-F07CCCGGGCCCAGCNONE 
011-039-A07CCCGGGCCCAGCNONE 
011-044-D10CCCGGGCCCAGCNONE 
011-099-C01CCCGGGCCCAGCNONE 
012-051-B09CCCGGGCCCAGCNONE 
012-051-D08CCCGGGCCCAGCNONE 
012-056-G07CCCGGGCCCAGCNONE 
012-062-A01CCCGGGCCCAGCNONE 
012-079-C03CCCGGGCCCAGCNONE 
014-003-A06CCCGGGCCCAGCNONE 
015-010-D02CCCGGGCCCAGCNONE 
AK102263CCCGGGCCCAGCSimilar to DnaJ protein homolog (DNAJ-1). 
AK103763CCCGGGCCCAGCNONE 
AK105028CCCGGGCCCAGCNONE 
AY224432CCCGGGCCCAGCNONE 
J013043H01CCCGGGCCCAGCNONE 
J013134K10CCCGGGCCCAGCNONE 
J023037D18CCCGGGCCCAGCNONE 
J023077K20CCCGGGCCCAGCNONE 
J023105M19CCCGGGCCCAGCNONE 
J023131M09CCCGGGCCCAGCNONE 
J033022F05CCCGGGCCCAGCNONE 
J033051J22CCCGGGCCCAGCNONE 
J033061D03CCCGGGCCCAGCNONE 
J033084H04CCCGGGCCCAGCNONE 
J033088M01CCCGGGCCCAGCNONE 
J033119H12CCCGGGCCCAGCNONE 
J033131C18CCCGGGCCCAGCNONE 
J043030C06CCCGGGCCCAGCNONE 
J080032A08CCCGGGCCCAGCNONE 
J090008C11CCCGGGCCCAGCNONE 
J090014D24CCCGGGCCCAGCNONE 
J090024C20CCCGGGCCCAGCNONE 
J090024H08CCCGGGCCCAGCNONE 
J090029F10CCCGGGCCCAGCNONE 
J090032K16CCCGGGCCCAGCNONE 
J090034L14CCCGGGCCCAGCNONE 
J090035C20CCCGGGCCCAGCNONE 
J090044H05CCCGGGCCCAGCNONE 
J090048M09CCCGGGCCCAGCNONE 
J090056I15CCCGGGCCCAGCNONE 
J090062B01CCCGGGCCCAGCNONE 
J090076F06CCCGGGCCCAGCNONE 
J090077A02CCCGGGCCCAGCNONE 
J090084E21CCCGGGCCCAGCNONE 
J090084J09CCCGGGCCCAGCNONE 
J090086G11CCCGGGCCCAGCNONE 
J090092C20CCCGGGCCCAGCNONE 
J100018G14CCCGGGCCCAGCNONE 
J100018I22CCCGGGCCCAGCNONE 
J100024N14CCCGGGCCCAGCNONE 
J100032K09CCCGGGCCCAGCNONE 
J100036F09CCCGGGCCCAGCNONE 
J100041M04CCCGGGCCCAGCNONE 
J100042H05CCCGGGCCCAGCNONE 
J100043P19CCCGGGCCCAGCNONE 
J100044B04CCCGGGCCCAGCNONE 
J100049L24CCCGGGCCCAGCNONE 
J100050M21CCCGGGCCCAGCNONE 
J100057F24CCCGGGCCCAGCNONE 
J100063I11CCCGGGCCCAGCNONE 
J100064J24CCCGGGCCCAGCNONE 
J100070B13CCCGGGCCCAGCNONE 
J100076A13CCCGGGCCCAGCNONE 
J100081C20CCCGGGCCCAGCNONE 
J100081L09CCCGGGCCCAGCNONE 
J100084G23CCCGGGCCCAGCNONE 
J100088H02CCCGGGCCCAGCNONE 
Os03g0666200AK102364GCGGGCCCACTCTPleckstrin homology-type domain containing protein. 
J033097E16GCGGGCCCACTCTNONE 
Os03g0701000J075172J23CCCGGGCCCACCCGNONE 
Os03g0712200AK073205AACTGGGCCCGGTTGGGCCAGZinc finger, RanBP2-type domain containing protein. 
AK098968AACTGGGCCCGGTTGGGCCAGNONE 
Os03g0755000AK068540ACCGGGCCCATACSimilar to Serine/threonine kinase (Fragment). 
Os03g0756800009-100-H11CCGTGGGCCGGTGGGCCCGNONE 
AK120423CCGTGGGCCGGTGGGCCCGProtein of unknown function UPF0139 family protein. 
J013095D02CCGTGGGCCGGTGGGCCCGNONE 
J023091G12CCGTGGGCCGGTGGGCCCGNONE 
J065207J17CCGTGGGCCGGTGGGCCCGNONE 
J100067G13CCGTGGGCCGGTGGGCCCGNONE 
J100089L11CCGTGGGCCGGTGGGCCCGNONE 
Os03g0780800AK059874GGCCCGGGCCCACCACNONE 
AK103085GGCCCGGGCCCACCACFatty acid hydroxylase domain containing protein. 
J065214L21GGCCCGGGCCCACCACNONE 
J075178I24GGCCCGGGCCCACCACNONE 
J075197K14GGCCCGGGCCCACCACNONE 
Os03g0789200015-015-H03CCCGGGCCCACCANONE 
AK071787CCCGGGCCCACCAProtein of unknown function DUF593 family protein. 
AY224542CCCGGGCCCACCANONE 
J023110P10CCCGGGCCCACCANONE 
J075039H19CCCGGGCCCACCANONE 
Os03g0796600003-113-D10CCCGGGCCCAGCGCACCGCCACGTCNONE 
011-076-B12CCCGGGCCCAGCGCACCGCCACGTCNONE 
AK105257CCCGGGCCCAGCGCACCGCCACGTCProtein of unknown function DUF506, plant family protein. 
J075105C03CCCGGGCCCAGCGCACCGCCACGTCNONE 
J080036O17CCCGGGCCCAGCGCACCGCCACGTCNONE 
J080064E16CCCGGGCCCAGCGCACCGCCACGTCNONE 
J080069E03CCCGGGCCCAGCGCACCGCCACGTCNONE 
J080079E23CCCGGGCCCAGCGCACCGCCACGTCNONE 
J090036H20CCCGGGCCCAGCGCACCGCCACGTCNONE 
J100029L10CCCGGGCCCAGCGCACCGCCACGTCNONE 
J100055G09CCCGGGCCCAGCGCACCGCCACGTCNONE 
Os03g0796800J065024O22GCCACGTGGGCCCGGGConserved hypothetical protein. 
J065024O22TGTGGGCCCGCConserved hypothetical protein. 
Os03g0798600AK121716TCTGGGCCCGSimilar to 40S ribosomal protein S15 (Fragment). 
J013120B18TCTGGGCCCGNONE 
J033079G18TCTGGGCCCGNONE 
J043038B19TCTGGGCCCGNONE 
J065091E15TCTGGGCCCGNONE 
J065092P10TCTGGGCCCGNONE 
J065189F18TCTGGGCCCGNONE 
J065189L12TCTGGGCCCGNONE 
J075021B11TCTGGGCCCGNONE 
J075022L15TCTGGGCCCGNONE 
J075046G12TCTGGGCCCGNONE 
J075080H15TCTGGGCCCGNONE 
J090045H01TCTGGGCCCGNONE 
J090077H16TCTGGGCCCGNONE 
J090083D22TCTGGGCCCGNONE 
J100021D24TCTGGGCCCGNONE 
J100023G04TCTGGGCCCGNONE 
J100049J23TCTGGGCCCGNONE 
J100075K23TCTGGGCCCGNONE 
J100077G22TCTGGGCCCGNONE 
Os03g0822700005-010-E01TCCGGGCCCACCANONE 
006-088-H12TCCGGGCCCACCANONE 
AK061682TCCGGGCCCACCANONE 
AK101448TCCGGGCCCACCAArmadillo-like helical domain containing protein. 
J023091N05TCCGGGCCCACCANONE 
Os03g0822900AK099787CGGGCCCAGAZinc finger, BED-type predicted domain containing protein. 
J013042C24CGGGCCCAGANONE 
J013096O21CGGGCCCAGANONE 
J023109I23CGGGCCCAGANONE 
J033106N09CGGGCCCAGANONE 
J033107H03CGGGCCCAGANONE 
J033118G03CGGGCCCAGANONE 
J033145I24CGGGCCCAGANONE 
J065138D15CGGGCCCAGANONE 
J065140L13CGGGCCCAGANONE 
J065179M13CGGGCCCAGANONE 
J065200F05CGGGCCCAGANONE 
J075104F20CGGGCCCAGANONE 
J075143A15CGGGCCCAGANONE 
J075197J11CGGGCCCAGANONE 
Os03g0837900AK068346ACCGGGCCCACACStreptomyces cyclase/dehydrase family protein. 
Os03g0843500AK067985CGGGCCCAACANONE 
AK067985CGGGCCCAGCCCACGCNONE 
AK101661CGGGCCCAACASimilar to Sarcoplasmic reticulum protein (With alternative splicing). 
AK101661CGGGCCCAGCCCACGCSimilar to Sarcoplasmic reticulum protein (With alternative splicing). 
AY224454CGGGCCCAACANONE 
AY224454CGGGCCCAGCCCACGCNONE 
J080302L23CGGGCCCAACANONE 
J080302L23CGGGCCCAGCCCACGCNONE 
Os03g0851000006-098-C01TTGTGGGCCGGGCCCAAACNONE 
AK060496TTGTGGGCCGGGCCCAAACSimilar to Transcription factor homolog BTF3-like protein. 
AK102202TTGTGGGCCGGGCCCAAACNONE 
AK104157TTGTGGGCCGGGCCCAAACNONE 
J033087F19TTGTGGGCCGGGCCCAAACNONE 
J065087I16TTGTGGGCCGGGCCCAAACNONE 
J065113G04TTGTGGGCCGGGCCCAAACNONE 
J090026M02TTGTGGGCCGGGCCCAAACNONE 
J090027I04TTGTGGGCCGGGCCCAAACNONE 
J100073E19TTGTGGGCCGGGCCCAAACNONE 
Os03g0852600009-174-G04ATATGGGCCCGGANONE 
AK063101ATATGGGCCCGGAProtein of unknown function DUF565 family protein. 
J065131H12ATATGGGCCCGGANONE 
J090046K24ATATGGGCCCGGANONE 
Os03g0852900011-012-A12TCCGGGCCCAACTNONE 
AK100660TCCGGGCCCAACTSimilar to Cleavage and polyadenylation specificity factor, 73 kDa subunit (CPSF 73 kDa subunit). 
J013073D18TCCGGGCCCAACTNONE 
J013152K17TCCGGGCCCAACTNONE 
J023111N01TCCGGGCCCAACTNONE 
J065214G07TCCGGGCCCAACTNONE 
J090080E10TCCGGGCCCAACTNONE 
Os03g0854000009-186-C03GCGGGCCCACCTNONE 
AK061374GCGGGCCCACCTProtein of unknown function UPF0131 family protein. 
J065138B11GCGGGCCCACCTNONE 
Os03g0855700AK070400GCTGGGCCCGGTNucleic acid-binding, OB-fold domain containing protein. 
Os04g0126800AK107895CCCGGGCCCACGGGHypothetical protein. 
Os04g0128700AK107172TGCGGGCCCATTAThioredoxin-like fold domain containing protein. 
J065102M16TGCGGGCCCATTANONE 
J065124K01TGCGGGCCCATTANONE 
J065129I12TGCGGGCCCATTANONE 
J065192C08TGCGGGCCCATTANONE 
Os04g0259200AK119366CGGGCCCAGCCCAAATHypothetical protein. 
Os04g0270100AK063713CGGGCCCAGGNONE 
AK107968CGGGCCCAGGNONE 
Os04g0346800AK101242AAATGGGCCTATCGTGGGCCCGCGCGGCCCAATTNONE 
AK109486AAATGGGCCTATCGTGGGCCCGCGCGGCCCAATTEAR repeat containing protein. 
J080306O15AAATGGGCCTATCGTGGGCCCGCGCGGCCCAATTNONE 
J080317H19AAATGGGCCTATCGTGGGCCCGCGCGGCCCAATTNONE 
Os04g0387600009-148-E01CGGGCCCAGCNONE 
009-155-A11CGGGCCCAGCNONE 
009-175-F04CGGGCCCAGCNONE 
AK063862CGGGCCCAGCConserved hypothetical protein. 
J065035F12CGGGCCCAGCNONE 
J065162C13CGGGCCCAGCNONE 
J065169L19CGGGCCCAGCNONE 
Os04g0435700AK100857CCCACCCGGGCCCACCCGSimilar to UVB-resistance protein UVR8. 
Os04g0476000Os04g0476000ACCGGGCCCAATATetratricopeptide-like helical domain containing protein. 
Os04g0482800AK068497CCACTGACAGGTGGGCCCGCSimilar to Topoisomerase-like protein. 
J065141K24CCACTGACAGGTGGGCCCGCNONE 
J065144O22CCACTGACAGGTGGGCCCGCNONE 
J065162F11CCACTGACAGGTGGGCCCGCNONE 
Os04g0497000006-097-G07GCGGGCCCAGCNONE 
AK069136GCGGGCCCAGCNONE 
AK109382GCGGGCCCAGCSimilar to Allyl alcohol dehydrogenase. 
J023008C06GCGGGCCCAGCNONE 
J043007K16GCGGGCCCAGCNONE 
J065110K06GCGGGCCCAGCNONE 
J080012F02GCGGGCCCAGCNONE 
J080020N21GCGGGCCCAGCNONE 
J080026H09GCGGGCCCAGCNONE 
J080029D13GCGGGCCCAGCNONE 
J080034C08GCGGGCCCAGCNONE 
J080050J07GCGGGCCCAGCNONE 
Os04g0503500AK099404CGGGCCCACAALeucine-rich repeat, cysteine-containing subtype containing protein. 
AK101695CGGGCCCACAANONE 
Os04g0563300AK100487CAGGTGGGCCCGGCCCATACyclin-like F-box domain containing protein. 
J023097O18CAGGTGGGCCCGGCCCATANONE 
J065100E16CAGGTGGGCCCGGCCCATANONE 
J075022C23CAGGTGGGCCCGGCCCATANONE 
J075023L18CAGGTGGGCCCGGCCCATANONE 
J075040N10CAGGTGGGCCCGGCCCATANONE 
J075061L14CAGGTGGGCCCGGCCCATANONE 
J075069B15CAGGTGGGCCCGGCCCATANONE 
J075106C16CAGGTGGGCCCGGCCCATANONE 
J075138P13CAGGTGGGCCCGGCCCATANONE 
J075139H18CAGGTGGGCCCGGCCCATANONE 
J075139L06CAGGTGGGCCCGGCCCATANONE 
J075149B07CAGGTGGGCCCGGCCCATANONE 
J075177N21CAGGTGGGCCCGGCCCATANONE 
Os04g0612600AB042115TCCGACGGGCCCACCTNONE 
AK060707TCCGACGGGCCCACCTSimilar to Coatomer-like protein, epsilon subunit. 
AK099008TCCGACGGGCCCACCTNONE 
AK104427TCCGACGGGCCCACCTNONE 
J023043H02TCCGACGGGCCCACCTNONE 
J033033I23TCCGACGGGCCCACCTNONE 
J033067P21TCCGACGGGCCCACCTNONE 
J033088M21TCCGACGGGCCCACCTNONE 
J033133M08TCCGACGGGCCCACCTNONE 
J043030I16TCCGACGGGCCCACCTNONE 
J075049H08TCCGACGGGCCCACCTNONE 
Os04g0660600009-113-A11CCCGGGCCCAATTNONE 
AK120899CCCGGGCCCAATTATPase, V0 complex, subunit H family protein. 
J023030J05CCCGGGCCCAATTNONE 
J065068M07CCCGGGCCCAATTNONE 
J065120G22CCCGGGCCCAATTNONE 
J065168J18CCCGGGCCCAATTNONE 
J065211M10CCCGGGCCCAATTNONE 
J075175E21CCCGGGCCCAATTNONE 
J090021C06CCCGGGCCCAATTNONE 
J090032P15CCCGGGCCCAATTNONE 
J090082E05CCCGGGCCCAATTNONE 
J100090O11CCCGGGCCCAATTNONE 
Os04g0661200AK102842GCCACGTGGGCCCGCACCGCProtein of unknown function DUF941 family protein. 
J033075E19GCCACGTGGGCCCGCACCGCNONE 
J033109O19GCCACGTGGGCCCGCACCGCNONE 
J065002J12GCCACGTGGGCCCGCACCGCNONE 
J065026E22GCCACGTGGGCCCGCACCGCNONE 
J065061F05GCCACGTGGGCCCGCACCGCNONE 
J065068D22GCCACGTGGGCCCGCACCGCNONE 
J065072N14GCCACGTGGGCCCGCACCGCNONE 
J065085F02GCCACGTGGGCCCGCACCGCNONE 
J075055G19GCCACGTGGGCCCGCACCGCNONE 
J075105B14GCCACGTGGGCCCGCACCGCNONE 
J075118M17GCCACGTGGGCCCGCACCGCNONE 
J075193H02GCCACGTGGGCCCGCACCGCNONE 
J100040O05GCCACGTGGGCCCGCACCGCNONE 
J100064I04GCCACGTGGGCCCGCACCGCNONE 
Os04g0674000006-093-C01GCGGGCCCACGCNONE 
009-040-F06GCGGGCCCACGCNONE 
AK071276GCGGGCCCACGCNONE 
AK109377GCGGGCCCACGCConserved hypothetical protein. 
AK119671GCGGGCCCACGCNONE 
J023084J11GCGGGCCCACGCNONE 
J023088F18GCGGGCCCACGCNONE 
J065099M12GCGGGCCCACGCNONE 
J065136J08GCGGGCCCACGCNONE 
J065167H22GCGGGCCCACGCNONE 
J075046L21GCGGGCCCACGCNONE 
J080029F17GCGGGCCCACGCNONE 
J080053C16GCGGGCCCACGCNONE 
J080053E24GCGGGCCCACGCNONE 
J080074D14GCGGGCCCACGCNONE 
J100029C12GCGGGCCCACGCNONE 
J100030D01GCGGGCCCACGCNONE 
J100044E16GCGGGCCCACGCNONE 
J100065N18GCGGGCCCACGCNONE 
J100077D18GCGGGCCCACGCNONE 
J100090P13GCGGGCCCACGCNONE 
Os04g0677033J100048A06CTTGGGCCCGCAConserved hypothetical protein. 
Os04g0684500AK066014TATTGGGCCCGRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os04g0685800AK070891CGGGCCCACCTGTCAGSimilar to Diadenosine 5',5'''-P1,P4-tetraphosphate hydrolase (EC 3.6.1.17). 
AK071345CGGGCCCACCTGTCAGNONE 
J023069G19CGGGCCCACCTGTCAGNONE 
J023097E09CGGGCCCACCTGTCAGNONE 
J065071A01CGGGCCCACCTGTCAGNONE 
J065186F08CGGGCCCACCTGTCAGNONE 
J075044B21CGGGCCCACCTGTCAGNONE 
J075120N18CGGGCCCACCTGTCAGNONE 
J075131B22CGGGCCCACCTGTCAGNONE 
J100041H18CGGGCCCACCTGTCAGNONE 
J100042P13CGGGCCCACCTGTCAGNONE 
Os05g0126200AK059554GTCGAGTCATTGGGCCGGGCCCATATConserved hypothetical protein. 
AK121734GTCGAGTCATTGGGCCGGGCCCATATNONE 
J033084B09GTCGAGTCATTGGGCCGGGCCCATATNONE 
J090010I10GTCGAGTCATTGGGCCGGGCCCATATNONE 
Os05g0176100AF030052CCCGGGCCCACCCNONE 
AK067850CCCGGGCCCACCCNONE 
AK067967CCCGGGCCCACCCNONE 
AK098978CCCGGGCCCACCCNONE 
AK099228CCCGGGCCCACCCNONE 
AK099281CCCGGGCCCACCCNONE 
AK100188CCCGGGCCCACCCSimilar to RSW1-like cellulose synthase catalytic subunit (Fragment). 
AK102140CCCGGGCCCACCCNONE 
Os05g0207700AK102665TGCGGGCCCACCCCCACTCCNONE 
AK103861TGCGGGCCCACCCCCACTCCSimilar to Serine/threonine-protein kinase PBS1 (EC 2.7.1.37) (AvrPphB susceptible protein 1). 
Os05g0208000AK059612CCCACGGGCCCACCTGTCAGTNONE 
AK063666CCCACGGGCCCACCTGTCAGTNONE 
AK071500CCCACGGGCCCACCTGTCAGTSimilar to 2-oxoglutarate/malate translocator. 
Os05g0320700AK100598TCCGGGCCCACGTSimilar to Cytochrome P450. 
AK104994TCCGGGCCCACGTNONE 
Os05g0408200AK100057GCGGGCCCACCCGSBP domain containing protein. 
J065182F20GCGGGCCCACCCGNONE 
Os05g0411300014-098-D05CCGTGGGCCCGNONE 
015-093-F04CCGTGGGCCCGNONE 
AK071931CCGTGGGCCCGConserved hypothetical protein. 
AK073142CCGTGGGCCCGNONE 
Os05g0429900AK066834GCGGGCCCACCACNONE 
AK099108GCGGGCCCACCACNONE 
AK104053GCGGGCCCACCACNONE 
D88617GCGGGCCCACCACSimilar to MybHv5 (Fragment). 
J090031E22GCGGGCCCACCACNONE 
Os05g0430200J090095K16ACCGGGCCCACCTGTCNONE 
Os05g0463400AK100354GTATGGGCCCGTGGCCCATGGGCCCAACCGGCCCGGCCPWWP domain containing protein. 
J013022B18GTATGGGCCCGTGGCCCATGGGCCCAACCGGCCCGGCCNONE 
J023083G23GTATGGGCCCGTGGCCCATGGGCCCAACCGGCCCGGCCNONE 
Os05g0514300AK061747GCGTGGGCCCGSimilar to Tubby-like protein 3. 
AK098851GCGTGGGCCCGNONE 
Os05g0529300AK102648GCGGGCCCACGTSimilar to ER lumen protein retaining receptor (HDEL receptor). 
Os05g0529400009-126-H06ACGTGGGCCCGCNONE 
AK063846ACGTGGGCCCGCConserved hypothetical protein. 
AK122038ACGTGGGCCCGCNONE 
J033113C01ACGTGGGCCCGCNONE 
Os05g0535700009-067-F01CCACTGACATATGGGCCCGNONE 
AK061590CCACTGACATATGGGCCCGNONE 
AK062545CCACTGACATATGGGCCCGConserved hypothetical protein. 
Os05g0536900009-033-D11AATGGGCCCGTTNONE 
AK105140AATGGGCCCGTTSimilar to RAB7A. 
Os05g0543800AK072185CCCGGGCCCATATConserved hypothetical protein. 
Os05g0577900016-028-C02TTGTGGGCCTACATGGGCCGGGCCCATGGNONE 
AK064201TTGTGGGCCTACATGGGCCGGGCCCATGGConserved hypothetical protein. 
Os05g0578000AK065040CCATGGGCCCGGCCCATGTAGGCCCACAASimilar to PEX14 protein. 
J013001H17CCATGGGCCCGGCCCATGTAGGCCCACAANONE 
J013036A06CCATGGGCCCGGCCCATGTAGGCCCACAANONE 
J033122K08CCATGGGCCCGGCCCATGTAGGCCCACAANONE 
Os05g0585900AK062575CGGGCCCACCCGMitochondrial substrate carrier family protein. 
AK098854CGGGCCCACCCGNONE 
J013000H16CGGGCCCACCCGNONE 
J033118D07CGGGCCCACCCGNONE 
Os06g0114700AK061552GACAGGTGGGCCCGGGProtein of unknown function DUF1218 family protein. 
AK098848GACAGGTGGGCCCGGGNONE 
AK122142GACAGGTGGGCCCGGGNONE 
J013000D16GACAGGTGGGCCCGGGNONE 
Os06g0115200J100029D05TGTGGGCCCGNONE 
J100048P05TGTGGGCCCGQuinonprotein alcohol dehydrogenase-like domain containing protein. 
Os06g0128400AK064390AACGGGCCCAGATNONE 
AK121983AACGGGCCCAGATWD40-like domain containing protein. 
Os06g0128500AK058563GACAGGTGGGCCCGRibosomal protein L47, mitochondrial family protein. 
AK122132GACAGGTGGGCCCGNONE 
J033133F04GACAGGTGGGCCCGNONE 
J065094M24GACAGGTGGGCCCGNONE 
J065122J07GACAGGTGGGCCCGNONE 
J065137G10GACAGGTGGGCCCGNONE 
J065178L09GACAGGTGGGCCCGNONE 
J080011E11GACAGGTGGGCCCGNONE 
J080020G21GACAGGTGGGCCCGNONE 
J080039H03GACAGGTGGGCCCGNONE 
J080039J04GACAGGTGGGCCCGNONE 
Os06g0161800AK064664TGCGGGCCCACCTGTCProtein of unknown function DUF569 family protein. 
Os06g0187900009-171-C09CGGGCCCAAANONE 
AK063879CGGGCCCAAANONE 
AK071765CGGGCCCAAARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J023112N11CGGGCCCAAANONE 
J033098E13CGGGCCCAAANONE 
J100036J11CGGGCCCAAANONE 
J100047B19CGGGCCCAAANONE 
Os06g0215200AK065717GCGGGCCCACAZinc finger, U1-type domain containing protein. 
AK072439GCGGGCCCACANONE 
J013038O15GCGGGCCCACANONE 
J013075B08GCGGGCCCACANONE 
J013169N19GCGGGCCCACANONE 
J023034P11GCGGGCCCACANONE 
J023111C14GCGGGCCCACANONE 
J043013M01GCGGGCCCACANONE 
J043015L12GCGGGCCCACANONE 
J090011M08GCGGGCCCACANONE 
J090047D24GCGGGCCCACANONE 
J090056M10GCGGGCCCACANONE 
J090075G18GCGGGCCCACANONE 
J090079G14GCGGGCCCACANONE 
J100055M21GCGGGCCCACANONE 
J100058H23GCGGGCCCACANONE 
J100090A01GCGGGCCCACANONE 
J100090I21GCGGGCCCACANONE 
Os06g0226500009-030-E06TGTGGGCCCGGCCCNONE 
AK071601TGTGGGCCCGGCCCBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
J023102C01TGTGGGCCCGGCCCNONE 
Os06g0233000009-177-C07CAGGTGGGCCCGCNONE 
AK063118CAGGTGGGCCCGCConserved hypothetical protein. 
Os06g0248200Os06g0248200AACGGGCCCAAAANONE 
Os06g0316100011-089-C01ACATGGGCCGGGCCCAGGNONE 
015-030-D11ACATGGGCCGGGCCCAGGNONE 
015-044-H10ACATGGGCCGGGCCCAGGNONE 
AK105260ACATGGGCCGGGCCCAGGConserved hypothetical protein. 
AK119646ACATGGGCCGGGCCCAGGNONE 
Os06g0360500AK109778CGGGCCCAAATConserved hypothetical protein. 
Os06g0476200AK065566CCCGGGCCCAGANONE 
AK068502CCCGGGCCCAGASimilar to Phosphoglucomutase precursor (EC 5.4.2.2). 
Os06g0567000009-166-G12CCCACCTGTTGGGCCGGGCCCACTNONE 
AK121337CCCACCTGTTGGGCCGGGCCCACTProtein of unknown function UPF0197 family protein. 
J013122F01CCCACCTGTTGGGCCGGGCCCACTNONE 
J023080N12CCCACCTGTTGGGCCGGGCCCACTNONE 
J023120F03CCCACCTGTTGGGCCGGGCCCACTNONE 
J065013B18CCCACCTGTTGGGCCGGGCCCACTNONE 
J065039P21CCCACCTGTTGGGCCGGGCCCACTNONE 
J065089E06CCCACCTGTTGGGCCGGGCCCACTNONE 
J065095N19CCCACCTGTTGGGCCGGGCCCACTNONE 
J065119H03CCCACCTGTTGGGCCGGGCCCACTNONE 
J065121D18CCCACCTGTTGGGCCGGGCCCACTNONE 
J065149G04CCCACCTGTTGGGCCGGGCCCACTNONE 
J075012J04CCCACCTGTTGGGCCGGGCCCACTNONE 
J075021G13CCCACCTGTTGGGCCGGGCCCACTNONE 
J075106I23CCCACCTGTTGGGCCGGGCCCACTNONE 
J075107F19CCCACCTGTTGGGCCGGGCCCACTNONE 
J075152J22CCCACCTGTTGGGCCGGGCCCACTNONE 
J075186J20CCCACCTGTTGGGCCGGGCCCACTNONE 
J075188F16CCCACCTGTTGGGCCGGGCCCACTNONE 
J080001G06CCCACCTGTTGGGCCGGGCCCACTNONE 
J080002O09CCCACCTGTTGGGCCGGGCCCACTNONE 
J080006E10CCCACCTGTTGGGCCGGGCCCACTNONE 
J080006F24CCCACCTGTTGGGCCGGGCCCACTNONE 
J080012L07CCCACCTGTTGGGCCGGGCCCACTNONE 
J080016A10CCCACCTGTTGGGCCGGGCCCACTNONE 
J080017D11CCCACCTGTTGGGCCGGGCCCACTNONE 
J080017I04CCCACCTGTTGGGCCGGGCCCACTNONE 
J080017I10CCCACCTGTTGGGCCGGGCCCACTNONE 
J080020P06CCCACCTGTTGGGCCGGGCCCACTNONE 
J080024A20CCCACCTGTTGGGCCGGGCCCACTNONE 
J080027B10CCCACCTGTTGGGCCGGGCCCACTNONE 
J080027E03CCCACCTGTTGGGCCGGGCCCACTNONE 
J080027I01CCCACCTGTTGGGCCGGGCCCACTNONE 
J080027K20CCCACCTGTTGGGCCGGGCCCACTNONE 
J080041L12CCCACCTGTTGGGCCGGGCCCACTNONE 
J080043D21CCCACCTGTTGGGCCGGGCCCACTNONE 
J080044K11CCCACCTGTTGGGCCGGGCCCACTNONE 
J080048I08CCCACCTGTTGGGCCGGGCCCACTNONE 
J080049M12CCCACCTGTTGGGCCGGGCCCACTNONE 
J080050C14CCCACCTGTTGGGCCGGGCCCACTNONE 
J080050N21CCCACCTGTTGGGCCGGGCCCACTNONE 
J080053F04CCCACCTGTTGGGCCGGGCCCACTNONE 
J080054O16CCCACCTGTTGGGCCGGGCCCACTNONE 
J080058O21CCCACCTGTTGGGCCGGGCCCACTNONE 
J080059M11CCCACCTGTTGGGCCGGGCCCACTNONE 
J080061A11CCCACCTGTTGGGCCGGGCCCACTNONE 
J080063B15CCCACCTGTTGGGCCGGGCCCACTNONE 
J080063F22CCCACCTGTTGGGCCGGGCCCACTNONE 
J080066M18CCCACCTGTTGGGCCGGGCCCACTNONE 
J080068D12CCCACCTGTTGGGCCGGGCCCACTNONE 
J080070D22CCCACCTGTTGGGCCGGGCCCACTNONE 
J080071B06CCCACCTGTTGGGCCGGGCCCACTNONE 
J080072B17CCCACCTGTTGGGCCGGGCCCACTNONE 
J080081O04CCCACCTGTTGGGCCGGGCCCACTNONE 
J080089H05CCCACCTGTTGGGCCGGGCCCACTNONE 
J080093K13CCCACCTGTTGGGCCGGGCCCACTNONE 
J080095I05CCCACCTGTTGGGCCGGGCCCACTNONE 
J080097F19CCCACCTGTTGGGCCGGGCCCACTNONE 
J080304C03CCCACCTGTTGGGCCGGGCCCACTNONE 
J080304H11CCCACCTGTTGGGCCGGGCCCACTNONE 
J080308M21CCCACCTGTTGGGCCGGGCCCACTNONE 
J080313O15CCCACCTGTTGGGCCGGGCCCACTNONE 
J090020N23CCCACCTGTTGGGCCGGGCCCACTNONE 
J100023C12CCCACCTGTTGGGCCGGGCCCACTNONE 
Os06g0603000AK068856GCGGGCCCACTNONE 
AK068856TCCGGGCCCACCTGTCNONE 
AK104955GCGGGCCCACTSimilar to Heme oxygenase 1 (Fragment). 
AK104955TCCGGGCCCACCTGTCSimilar to Heme oxygenase 1 (Fragment). 
Os06g0625500006-034-A05CGGGCCCATCCNONE 
AK058459CGGGCCCATCCSimilar to Thioredoxin peroxidase. 
AK068955CGGGCCCATCCNONE 
AK104130CGGGCCCATCCNONE 
J023003C09CGGGCCCATCCNONE 
J033043I02CGGGCCCATCCNONE 
J065063E05CGGGCCCATCCNONE 
J065190D24CGGGCCCATCCNONE 
J065198I01CGGGCCCATCCNONE 
J075107A02CGGGCCCATCCNONE 
Os06g0647400AK068457TGTGGGCCCGSimilar to Lysosomal Pro-X carboxypeptidase. 
AK103281TGTGGGCCCGNONE 
J013151A14TGTGGGCCCGNONE 
Os07g0124100014-015-G11GCGGGCCCACACNONE 
AJ276693GCGGGCCCACACPhytosulfokines 4 precursor [Contains: Phytosulfokine-alpha (PSK- alpha) (Phytosulfokine-a); Phytosulfokine-beta (PSK-beta) (Phytosulfokine-b)]. 
AK063647GCGGGCCCACACNONE 
Os07g0142000AK059877ACCGGGCCCACAReticulon family protein. 
AK099414ACCGGGCCCACANONE 
Os07g0159800009-100-A07CCCGGGCCCACACGNONE 
009-140-B04CCCGGGCCCACACGNONE 
AK059284CCCGGGCCCACACGNONE 
AK060475CCCGGGCCCACACGE1 protein and Def2/Der2 allergen family protein. 
J023054H06CCCGGGCCCACACGNONE 
J023083L17CCCGGGCCCACACGNONE 
J043005N13CCCGGGCCCACACGNONE 
J065164K01CCCGGGCCCACACGNONE 
J065192C18CCCGGGCCCACACGNONE 
J090058G23CCCGGGCCCACACGNONE 
J100017G10CCCGGGCCCACACGNONE 
J100081F12CCCGGGCCCACACGNONE 
Os07g0162600015-024-F04CTTGGGCCCGGANONE 
015-024-F04TCGTGGGCCCGGANONE 
AK105789CTTGGGCCCGGANONE 
AK105789TCGTGGGCCCGGANONE 
AK106274CTTGGGCCCGGAEsterase/lipase/thioesterase domain containing protein. 
AK106274TCGTGGGCCCGGAEsterase/lipase/thioesterase domain containing protein. 
J100026E18CTTGGGCCCGGANONE 
J100026E18TCGTGGGCCCGGANONE 
J100037B07CTTGGGCCCGGANONE 
J100037B07TCGTGGGCCCGGANONE 
J100090H11CTTGGGCCCGGANONE 
J100090H11TCGTGGGCCCGGANONE 
Os07g0166800006-038-C11TGCGGGCCCACCCACGGGNONE 
012-080-F02TGCGGGCCCACCCACGGGNONE 
AK070524TGCGGGCCCACCCACGGGRad6 (Ubiquitin carrier protein). 
AK121382TGCGGGCCCACCCACGGGNONE 
J023022D19TGCGGGCCCACCCACGGGNONE 
J023055G02TGCGGGCCCACCCACGGGNONE 
J023073E02TGCGGGCCCACCCACGGGNONE 
J023125B08TGCGGGCCCACCCACGGGNONE 
J023127H21TGCGGGCCCACCCACGGGNONE 
J033052G01TGCGGGCCCACCCACGGGNONE 
J033067F13TGCGGGCCCACCCACGGGNONE 
J065046L14TGCGGGCCCACCCACGGGNONE 
J065178D11TGCGGGCCCACCCACGGGNONE 
J065205N17TGCGGGCCCACCCACGGGNONE 
J075006K17TGCGGGCCCACCCACGGGNONE 
J075051D20TGCGGGCCCACCCACGGGNONE 
J075109L04TGCGGGCCCACCCACGGGNONE 
J090024K15TGCGGGCCCACCCACGGGNONE 
J090025N04TGCGGGCCCACCCACGGGNONE 
J090049N09TGCGGGCCCACCCACGGGNONE 
J090070N12TGCGGGCCCACCCACGGGNONE 
J090078O21TGCGGGCCCACCCACGGGNONE 
J090083L07TGCGGGCCCACCCACGGGNONE 
J100063K16TGCGGGCCCACCCACGGGNONE 
J100083D14TGCGGGCCCACCCACGGGNONE 
Os07g0171100AF272978TCCGGGCCCACCACNONE 
AK062132TCCGGGCCCACCACNONE 
AK066475TCCGGGCCCACCACTetratricopeptide-like helical domain containing protein. 
J013068C23TCCGGGCCCACCACNONE 
Os07g0173200AK061624ACCGGGCCCACGTFrigida-like family protein. 
AK061624CGGGCCCACAFrigida-like family protein. 
AK065275ACCGGGCCCACGTNONE 
AK065275CGGGCCCACANONE 
AK098856ACCGGGCCCACGTNONE 
AK098856CGGGCCCACANONE 
AK098899ACCGGGCCCACGTNONE 
AK098899CGGGCCCACANONE 
Os07g0179000AK100008CGGGCCCACCTGNONE 
AK119398CGGGCCCACCTGProtein prenyltransferase domain containing protein. 
AK119505CGGGCCCACCTGNONE 
Os07g0181500AK072431GCCGGGCCCACCTGTCProtein of unknown function DUF506, plant family protein. 
Os07g0185200AK066157CAGGTGGGCCCGCSimilar to Membrane related protein-like. 
Os07g0185700012-040-A11AGGGCCCACGGGCCCATCGNONE 
AK070572AGGGCCCACGGGCCCATCGConserved hypothetical protein. 
J065116D10AGGGCCCACGGGCCCATCGNONE 
J065122F20AGGGCCCACGGGCCCATCGNONE 
Os07g0246200012-046-B07GCCGGGCCCACCCGNONE 
AB021259GCCGGGCCCACCCGNONE 
AK065341GCCGGGCCCACCCGSimilar to Calreticulin (Fragment). 
AK099348GCCGGGCCCACCCGNONE 
AK104328GCCGGGCCCACCCGNONE 
AK104826GCCGGGCCCACCCGNONE 
J013000E04GCCGGGCCCACCCGNONE 
J013093M19GCCGGGCCCACCCGNONE 
J013108J08GCCGGGCCCACCCGNONE 
J013118G03GCCGGGCCCACCCGNONE 
J013121I07GCCGGGCCCACCCGNONE 
J013153K07GCCGGGCCCACCCGNONE 
J023028N07GCCGGGCCCACCCGNONE 
J023034F12GCCGGGCCCACCCGNONE 
J023043J11GCCGGGCCCACCCGNONE 
J023087A03GCCGGGCCCACCCGNONE 
J023099N05GCCGGGCCCACCCGNONE 
J023105B02GCCGGGCCCACCCGNONE 
J023110H02GCCGGGCCCACCCGNONE 
J023112E15GCCGGGCCCACCCGNONE 
J023132C20GCCGGGCCCACCCGNONE 
J023134G12GCCGGGCCCACCCGNONE 
J023138O12GCCGGGCCCACCCGNONE 
J033031E05GCCGGGCCCACCCGNONE 
J033032C03GCCGGGCCCACCCGNONE 
J033039K10GCCGGGCCCACCCGNONE 
J033050P09GCCGGGCCCACCCGNONE 
J033074D03GCCGGGCCCACCCGNONE 
J033075G14GCCGGGCCCACCCGNONE 
J033075I23GCCGGGCCCACCCGNONE 
J033081H23GCCGGGCCCACCCGNONE 
J033087N08GCCGGGCCCACCCGNONE 
J033110B03GCCGGGCCCACCCGNONE 
J033148H22GCCGGGCCCACCCGNONE 
J043027F13GCCGGGCCCACCCGNONE 
J043031H01GCCGGGCCCACCCGNONE 
J080003O10GCCGGGCCCACCCGNONE 
J080022D10GCCGGGCCCACCCGNONE 
J080029I12GCCGGGCCCACCCGNONE 
J080034A09GCCGGGCCCACCCGNONE 
J080035H20GCCGGGCCCACCCGNONE 
J080049C10GCCGGGCCCACCCGNONE 
J080053G14GCCGGGCCCACCCGNONE 
J080055J22GCCGGGCCCACCCGNONE 
J080058J04GCCGGGCCCACCCGNONE 
J080069E14GCCGGGCCCACCCGNONE 
J080069M23GCCGGGCCCACCCGNONE 
J080072E19GCCGGGCCCACCCGNONE 
J080072I03GCCGGGCCCACCCGNONE 
J080075B13GCCGGGCCCACCCGNONE 
J080078I11GCCGGGCCCACCCGNONE 
J080081F16GCCGGGCCCACCCGNONE 
J080088O10GCCGGGCCCACCCGNONE 
J080089G18GCCGGGCCCACCCGNONE 
J090009C10GCCGGGCCCACCCGNONE 
J090022D23GCCGGGCCCACCCGNONE 
J090023A15GCCGGGCCCACCCGNONE 
J090024M10GCCGGGCCCACCCGNONE 
J090038F24GCCGGGCCCACCCGNONE 
J090039O13GCCGGGCCCACCCGNONE 
J090040N12GCCGGGCCCACCCGNONE 
J090054I18GCCGGGCCCACCCGNONE 
J090061C16GCCGGGCCCACCCGNONE 
J090063H23GCCGGGCCCACCCGNONE 
J090067F21GCCGGGCCCACCCGNONE 
J090075A01GCCGGGCCCACCCGNONE 
J090076K11GCCGGGCCCACCCGNONE 
J090078L11GCCGGGCCCACCCGNONE 
J090079P03GCCGGGCCCACCCGNONE 
J090087D23GCCGGGCCCACCCGNONE 
J090087G22GCCGGGCCCACCCGNONE 
J090089F03GCCGGGCCCACCCGNONE 
J090092A04GCCGGGCCCACCCGNONE 
J100024L17GCCGGGCCCACCCGNONE 
J100031P13GCCGGGCCCACCCGNONE 
J100032H05GCCGGGCCCACCCGNONE 
J100036P03GCCGGGCCCACCCGNONE 
J100038L07GCCGGGCCCACCCGNONE 
J100043I20GCCGGGCCCACCCGNONE 
J100069A21GCCGGGCCCACCCGNONE 
J100078G06GCCGGGCCCACCCGNONE 
J100081J24GCCGGGCCCACCCGNONE 
J100081N04GCCGGGCCCACCCGNONE 
J100084K16GCCGGGCCCACCCGNONE 
J100085O06GCCGGGCCCACCCGNONE 
J100088L13GCCGGGCCCACCCGNONE 
J100090O21GCCGGGCCCACCCGNONE 
Os07g0438800AK060412GCCGGCCCGGGCCCACCCNONE 
AK100065GCCGGCCCGGGCCCACCCSimilar to Phosphate starvation regulator protein (Regulatory protein of P- starvation acclimation response Psr1). 
AK103195GCCGGCCCGGGCCCACCCNONE 
AY224478GCCGGCCCGGGCCCACCCNONE 
J013160O05GCCGGCCCGGGCCCACCCNONE 
J023030C05GCCGGCCCGGGCCCACCCNONE 
J033025O04GCCGGCCCGGGCCCACCCNONE 
J033121P15GCCGGCCCGGGCCCACCCNONE 
J043034I23GCCGGCCCGGGCCCACCCNONE 
J065022N01GCCGGCCCGGGCCCACCCNONE 
J065022N02GCCGGCCCGGGCCCACCCNONE 
J065023M01GCCGGCCCGGGCCCACCCNONE 
J065101G13GCCGGCCCGGGCCCACCCNONE 
J075058P13GCCGGCCCGGGCCCACCCNONE 
J075186K10GCCGGCCCGGGCCCACCCNONE 
J075199F17GCCGGCCCGGGCCCACCCNONE 
Os07g0442000AK068559GTGGGACCCACGGGCCCACCACyclin-like F-box domain containing protein. 
Os07g0486500AK063998CGGGCCCACGTGTCGRho GTPase activation protein domain containing protein. 
AK068175CGGGCCCACGTGTCGNONE 
J013130L24CGGGCCCACGTGTCGNONE 
J013156J03CGGGCCCACGTGTCGNONE 
J033031L21CGGGCCCACGTGTCGNONE 
J043001A20CGGGCCCACGTGTCGNONE 
J043007B17CGGGCCCACGTGTCGNONE 
J043017M19CGGGCCCACGTGTCGNONE 
J043024H09CGGGCCCACGTGTCGNONE 
J043030B12CGGGCCCACGTGTCGNONE 
J065177C18CGGGCCCACGTGTCGNONE 
J075004K10CGGGCCCACGTGTCGNONE 
J075004K12CGGGCCCACGTGTCGNONE 
J075088G07CGGGCCCACGTGTCGNONE 
J075107M02CGGGCCCACGTGTCGNONE 
J075126G01CGGGCCCACGTGTCGNONE 
J075185J08CGGGCCCACGTGTCGNONE 
J100034E04CGGGCCCACGTGTCGNONE 
J100038G12CGGGCCCACGTGTCGNONE 
Os07g0512100Os07g0512100TTGTGGGCCCGGCCCGGCCCGGCCCAGTTAnkyrin repeat containing protein. 
Os07g0545400009-136-E03TCCGGGCCCACGANONE 
013-015-G08TCCGGGCCCACGANONE 
AK059228TCCGGGCCCACGANONE 
J065040D09TCCGGGCCCACGANONE 
J065051C19TCCGGGCCCACGANONE 
J065139B05TCCGGGCCCACGANONE 
J065160E20TCCGGGCCCACGANONE 
J065207I17TCCGGGCCCACGANONE 
J080319M24TCCGGGCCCACGANONE 
Os07g0546700009-110-H10TAATGGGCCCGNONE 
AK058262TAATGGGCCCGNONE 
J065154I05TAATGGGCCCGNONE 
J065175P09TAATGGGCCCGNONE 
J065187F11TAATGGGCCCGNONE 
J075114K16TAATGGGCCCGNONE 
J090031L21TAATGGGCCCGNONE 
U86017TAATGGGCCCGSimilar to 60S ribosomal protein L38. 
Os07g0558300AK120618CGGGCCCAGTInositol monophosphatase family protein. 
J080068G22CGGGCCCAGTNONE 
Os07g0569100013-067-E02CCCGGGCCCACCTNONE 
013-081-C06CCCGGGCCCACCTNONE 
014-030-G06CCCGGGCCCACCTNONE 
014-034-H09CCCGGGCCCACCTNONE 
AK120160CCCGGGCCCACCTRemorin, C-terminal region domain containing protein. 
J090034F20CCCGGGCCCACCTNONE 
Os07g0603100AK101352GCGGGCCCACACAGCCCACCACNuclear transport factor 2 domain containing protein. 
J023077E09GCGGGCCCACACAGCCCACCACNONE 
J023081N15GCGGGCCCACACAGCCCACCACNONE 
J033022N22GCGGGCCCACACAGCCCACCACNONE 
J033024M18GCGGGCCCACACAGCCCACCACNONE 
J033034P09GCGGGCCCACACAGCCCACCACNONE 
J033046A06GCGGGCCCACACAGCCCACCACNONE 
J033051K01GCGGGCCCACACAGCCCACCACNONE 
J033081P09GCGGGCCCACACAGCCCACCACNONE 
J033091B17GCGGGCCCACACAGCCCACCACNONE 
J033092K23GCGGGCCCACACAGCCCACCACNONE 
J033132J09GCGGGCCCACACAGCCCACCACNONE 
J033144A14GCGGGCCCACACAGCCCACCACNONE 
J033145A14GCGGGCCCACACAGCCCACCACNONE 
J043021B20GCGGGCCCACACAGCCCACCACNONE 
J053024D23GCGGGCCCACACAGCCCACCACNONE 
J065212J10GCGGGCCCACACAGCCCACCACNONE 
J090055M05GCGGGCCCACACAGCCCACCACNONE 
J090065E14GCGGGCCCACACAGCCCACCACNONE 
J090092J06GCGGGCCCACACAGCCCACCACNONE 
Os07g0608800AK059637TGTGGGCCCGCGTCTCSimilar to Peroxisome assembly protein 10 (Peroxin-10) (AthPEX10) (Pex10p) (PER8). 
Os07g0619400009-095-D09TCCGGGCCCATATNONE 
AK062716TCCGGGCCCATATCalcium-binding EF-hand domain containing protein. 
Os07g0622200AB122058CGGGCCCACANONE 
AK069968CGGGCCCACANONE 
AK105687CGGGCCCACASimilar to M-160-u1_1 (Fragment). 
J075095A10CGGGCCCACANONE 
Os07g0623300AK070292AACTGGGCCCGTTSimilar to Splicing factor SC35. 
J023050C05AACTGGGCCCGTTNONE 
J090025O12AACTGGGCCCGTTNONE 
Os07g0639900J080305F09CAGGTGGGCCGGGCCCATAANONE 
J080305J22CAGGTGGGCCGGGCCCATAAThymidylate kinase domain containing protein. 
J080311G07CAGGTGGGCCGGGCCCATAANONE 
J080315B14CAGGTGGGCCGGGCCCATAANONE 
J080317C02CAGGTGGGCCGGGCCCATAANONE 
Os07g0661600006-050-D12ACGCGTGGGCCCGGGNONE 
009-124-B10ACGCGTGGGCCCGGGNONE 
AK061123ACGCGTGGGCCCGGGNONE 
AK066432ACGCGTGGGCCCGGGSimilar to RNA-binding protein-like protein. 
AK104664ACGCGTGGGCCCGGGNONE 
J013064M13ACGCGTGGGCCCGGGNONE 
J013122O12ACGCGTGGGCCCGGGNONE 
J033044A16ACGCGTGGGCCCGGGNONE 
J033144D14ACGCGTGGGCCCGGGNONE 
J090078P13ACGCGTGGGCCCGGGNONE 
Os07g0681500AK103662TCCGGGCCCACCTGACAGGNONE 
AK121650TCCGGGCCCACCTGACAGGAnkyrin repeat containing protein. 
Os07g0690300012-048-A07CGGGCCCACCTGNONE 
012-048-A07GCCGGGCCCACGGGNONE 
AK099674CGGGCCCACCTGChromatin SPT2 family protein. 
AK099674GCCGGGCCCACGGGChromatin SPT2 family protein. 
J013028F12CGGGCCCACCTGNONE 
J013028F12GCCGGGCCCACGGGNONE 
J013069F21CGGGCCCACCTGNONE 
J013069F21GCCGGGCCCACGGGNONE 
J013104E17CGGGCCCACCTGNONE 
J013104E17GCCGGGCCCACGGGNONE 
J013153M16CGGGCCCACCTGNONE 
J013153M16GCCGGGCCCACGGGNONE 
J023012L09CGGGCCCACCTGNONE 
J023012L09GCCGGGCCCACGGGNONE 
J023069A08CGGGCCCACCTGNONE 
J023069A08GCCGGGCCCACGGGNONE 
J023132L23CGGGCCCACCTGNONE 
J023132L23GCCGGGCCCACGGGNONE 
J033120P19CGGGCCCACCTGNONE 
J033120P19GCCGGGCCCACGGGNONE 
J065173J03CGGGCCCACCTGNONE 
J065173J03GCCGGGCCCACGGGNONE 
J075008H06CGGGCCCACCTGNONE 
J075008H06GCCGGGCCCACGGGNONE 
J075043J15CGGGCCCACCTGNONE 
J075043J15GCCGGGCCCACGGGNONE 
J075147I12CGGGCCCACCTGNONE 
J075147I12GCCGGGCCCACGGGNONE 
J090041G07CGGGCCCACCTGNONE 
J090041G07GCCGGGCCCACGGGNONE 
Os07g0695100AB189039GCGGGCCCACCANONE 
AB189042GCGGGCCCACCANONE 
AK059514GCGGGCCCACCANONE 
AK066112GCGGGCCCACCACheY-like domain containing protein. 
J013051N02GCGGGCCCACCANONE 
J013127M02GCGGGCCCACCANONE 
J023007I05GCGGGCCCACCANONE 
Os08g0120000006-042-E02CCCGGGCCCACANONE 
006-051-F06CCCGGGCCCACANONE 
006-052-G03CCCGGGCCCACANONE 
006-095-B11CCCGGGCCCACANONE 
AB017427CCCGGGCCCACANONE 
AB017428CCCGGGCCCACANONE 
AK059789CCCGGGCCCACANONE 
AK059815CCCGGGCCCACASuccinate dehydrogenase iron-protein subunit (SDHB). 
AK099077CCCGGGCCCACANONE 
AK102607CCCGGGCCCACANONE 
AK104303CCCGGGCCCACANONE 
AK104304CCCGGGCCCACANONE 
AK104421CCCGGGCCCACANONE 
D10414CCCGGGCCCACANONE 
J013170D08CCCGGGCCCACANONE 
J023086D16CCCGGGCCCACANONE 
J033099B04CCCGGGCCCACANONE 
J065042P05CCCGGGCCCACANONE 
J065144E22CCCGGGCCCACANONE 
J065162J20CCCGGGCCCACANONE 
J065196N13CCCGGGCCCACANONE 
J090013B11CCCGGGCCCACANONE 
Os08g0127500AK071322GCCGGGCCCACAAcid phosphatase/vanadium-dependent haloperoxidase related family protein. 
J023087N16GCCGGGCCCACANONE 
J065146A20GCCGGGCCCACANONE 
J075043F12GCCGGGCCCACANONE 
J090015B21GCCGGGCCCACANONE 
Os08g0128200AK120428CGTGTGGGCCCGGGConserved hypothetical protein. 
Os08g0133600AK073987AACGGGCCCAGGNONE 
AK105436AACGGGCCCAGGConserved hypothetical protein. 
Os08g0135900AK072535CCGATCCGGTGGGCCCGGTSimilar to Tryptophan synthase beta chain 1 (EC 4.2.1.20) (Orange pericarp 1) (Fragment). 
Os08g0143400015-006-A10TGCGGGCCCACCANONE 
AK066792TGCGGGCCCACCANONE 
AK120532TGCGGGCCCACCASWIRM domain containing protein. 
J100083F02TGCGGGCCCACCANONE 
Os08g0158900AK067062AAATGGGCCCGCAGTP1/OBG domain containing protein. 
J013089F04AAATGGGCCCGCANONE 
J013092D16AAATGGGCCCGCANONE 
J033120K14AAATGGGCCCGCANONE 
J033133F24AAATGGGCCCGCANONE 
J033145A10AAATGGGCCCGCANONE 
J033145A11AAATGGGCCCGCANONE 
J053048H24AAATGGGCCCGCANONE 
J053075H10AAATGGGCCCGCANONE 
Os08g0337300AK067509GCGGGCCCACCCNONE 
AK072420GCGGGCCCACCCZinc finger, FYVE/PHD-type domain containing protein. 
Os08g0406500016-001-C06AGGTGGGCCCGTTNONE 
AK064160AGGTGGGCCCGTTTRAF-like domain containing protein. 
Os08g0459100AK121795CTTGGGCCCGCCCCCACGTLeucine-rich repeat, cysteine-containing containing protein. 
Os08g0478500AK099704CGGGCCCACACPeptidase C19, ubiquitin carboxyl-terminal hydrolase 2 family protein. 
Os08g0499900J033080E06ATTTGGGCGGGCCCACANONE 
Os08g0536300AF358777TGGTGGGCCCGNONE 
AK099722TGGTGGGCCCGSimilar to Hd1. 
J100054G13TGGTGGGCCCGNONE 
Os08g0544500AK071354ACGTGGGCCCGSimilar to ARP2/3 regulatory protein subunit NAPP. 
Os08g0554000AK111661TGCGGGCCCACACWD-40 repeat containing protein. 
AK112044TGCGGGCCCACACNONE 
J013039N12TGCGGGCCCACACNONE 
J013134D02TGCGGGCCCACACNONE 
J013153B06TGCGGGCCCACACNONE 
J033044L16TGCGGGCCCACACNONE 
J033073P14TGCGGGCCCACACNONE 
Os09g0274100009-112-B02AGTTGGGCCCGCANONE 
AK062823AGTTGGGCCCGCAConserved hypothetical protein. 
Os09g0309500J100027L22CACTGACAGGGTGGGCCCGCConserved hypothetical protein. 
Os09g0313500AK065687TTGTGGGCCCGDisease resistance protein family protein. 
J013039H12TTGTGGGCCCGNONE 
J090060B10TTGTGGGCCCGNONE 
Os09g0330200AK111018GCCGGGCCCAGGCCACGTCConserved hypothetical protein. 
Os09g0347900AK071224GGCCGGGCCCACCTGConserved hypothetical protein. 
J023087B12GGCCGGGCCCACCTGNONE 
Os09g0376000AK119322CAGGTGGGCCCGConserved hypothetical protein. 
Os09g0416400J075067A16TCGGACGGCGGAGAGGTGGGCCCGGAConserved hypothetical protein. 
J075104N21TCGGACGGCGGAGAGGTGGGCCCGGANONE 
J075106F04TCGGACGGCGGAGAGGTGGGCCCGGANONE 
J075131F08TCGGACGGCGGAGAGGTGGGCCCGGANONE 
Os09g0439600AK100577GCCGGGCCCACGAExo70 exocyst complex subunit family protein. 
J090071K03GCCGGGCCCACGANONE 
Os09g0465600AB107218CCCGGGCCCACCTNONE 
AK068061CCCGGGCCCACCTSimilar to Glucose-6-phosphate isomerase-like protein (Fragment). 
AY224509CCCGGGCCCACCTNONE 
Os09g0482740006-098-F12CACTGACAGGTGGGCCCGNONE 
AK061852CACTGACAGGTGGGCCCGProtein of unknown function DUF1664 family protein. 
J013032I17CACTGACAGGTGGGCCCGNONE 
J013119L22CACTGACAGGTGGGCCCGNONE 
J065114C06CACTGACAGGTGGGCCCGNONE 
J090059O06CACTGACAGGTGGGCCCGNONE 
J090062K09CACTGACAGGTGGGCCCGNONE 
J100031O03CACTGACAGGTGGGCCCGNONE 
J100038P06CACTGACAGGTGGGCCCGNONE 
J100051M18CACTGACAGGTGGGCCCGNONE 
J100075H20CACTGACAGGTGGGCCCGNONE 
J100077O11CACTGACAGGTGGGCCCGNONE 
Os09g0491772011-007-H10CCCGGGCCCACCNONE 
012-015-C11CCCGGGCCCACCNONE 
012-060-G11CCCGGGCCCACCNONE 
015-020-F09CCCGGGCCCACCNONE 
015-035-F07CCCGGGCCCACCNONE 
016-035-G11CCCGGGCCCACCNONE 
AK069787CCCGGGCCCACCSimilar to Heat shock protein 70 (Hsc70-5). 
J023030H18CCCGGGCCCACCNONE 
J023060K21CCCGGGCCCACCNONE 
J023079I08CCCGGGCCCACCNONE 
J023111B17CCCGGGCCCACCNONE 
J023123E03CCCGGGCCCACCNONE 
J023125B22CCCGGGCCCACCNONE 
J023126H24CCCGGGCCCACCNONE 
J023131N16CCCGGGCCCACCNONE 
J023149M09CCCGGGCCCACCNONE 
J033022H04CCCGGGCCCACCNONE 
J033022L09CCCGGGCCCACCNONE 
J033038H14CCCGGGCCCACCNONE 
J033044M15CCCGGGCCCACCNONE 
J033044O04CCCGGGCCCACCNONE 
J033050E01CCCGGGCCCACCNONE 
J033066L09CCCGGGCCCACCNONE 
J033075I19CCCGGGCCCACCNONE 
J033079F17CCCGGGCCCACCNONE 
J033093L14CCCGGGCCCACCNONE 
J033094C14CCCGGGCCCACCNONE 
J033094G07CCCGGGCCCACCNONE 
J033101G06CCCGGGCCCACCNONE 
J033103D07CCCGGGCCCACCNONE 
J033105K18CCCGGGCCCACCNONE 
J033112M23CCCGGGCCCACCNONE 
J033119D21CCCGGGCCCACCNONE 
J033121G18CCCGGGCCCACCNONE 
J033124B01CCCGGGCCCACCNONE 
J033126C07CCCGGGCCCACCNONE 
J033140K24CCCGGGCCCACCNONE 
J033141P13CCCGGGCCCACCNONE 
J033142K24CCCGGGCCCACCNONE 
J043024P12CCCGGGCCCACCNONE 
J043031P09CCCGGGCCCACCNONE 
J043039O09CCCGGGCCCACCNONE 
J065101K22CCCGGGCCCACCNONE 
J065136K09CCCGGGCCCACCNONE 
J090004J08CCCGGGCCCACCNONE 
J090010F03CCCGGGCCCACCNONE 
J090014L23CCCGGGCCCACCNONE 
J090020E05CCCGGGCCCACCNONE 
J090032D02CCCGGGCCCACCNONE 
J090048A04CCCGGGCCCACCNONE 
J090061G05CCCGGGCCCACCNONE 
Os09g0493700015-091-G11TGTGGGCCCGNONE 
AK068501TGTGGGCCCGSimilar to CUC2. 
AK099237TGTGGGCCCGNONE 
J013155B08TGTGGGCCCGNONE 
J023006E01TGTGGGCCCGNONE 
J023060K23TGTGGGCCCGNONE 
J023100B11TGTGGGCCCGNONE 
J033026L19TGTGGGCCCGNONE 
J033129J12TGTGGGCCCGNONE 
J033149K09TGTGGGCCCGNONE 
J065045I06TGTGGGCCCGNONE 
J065061A10TGTGGGCCCGNONE 
J065101H05TGTGGGCCCGNONE 
J065135A03TGTGGGCCCGNONE 
J065169C16TGTGGGCCCGNONE 
J100047C11TGTGGGCCCGNONE 
J100047K07TGTGGGCCCGNONE 
Os09g0516600AK070780CCCGGGCCCACCAGCCCAGNONE 
AK103563CCCGGGCCCACCAGCCCAGNONE 
AY054407CCCGGGCCCACCAGCCCAGGlyoxalase II. 
J013058P06CCCGGGCCCACCAGCCCAGNONE 
J013093G04CCCGGGCCCACCAGCCCAGNONE 
J023007G05CCCGGGCCCACCAGCCCAGNONE 
J023091A08CCCGGGCCCACCAGCCCAGNONE 
J023136K23CCCGGGCCCACCAGCCCAGNONE 
J023138D20CCCGGGCCCACCAGCCCAGNONE 
J033022N20CCCGGGCCCACCAGCCCAGNONE 
J033065N15CCCGGGCCCACCAGCCCAGNONE 
J033109L23CCCGGGCCCACCAGCCCAGNONE 
J053073C08CCCGGGCCCACCAGCCCAGNONE 
J075094J24CCCGGGCCCACCAGCCCAGNONE 
J075106P21CCCGGGCCCACCAGCCCAGNONE 
Os09g0530700AK058211GCGGGCCCACAConserved hypothetical protein. 
AK100759GCGGGCCCACANONE 
J065039L02GCGGGCCCACANONE 
J065043O03GCGGGCCCACANONE 
J065070M16GCGGGCCCACANONE 
Os09g0539100AK071977ACCGGGCCCATTTSimilar to 3-dehydroquinate synthase-like protein. 
AK098959ACCGGGCCCATTTNONE 
Os09g0547200016-021-H03CCCGGGCCCACACACCNONE 
AK073078CCCGGGCCCACACACCProtein of unknown function DUF292, eukaryotic domain containing protein. 
AK104984CCCGGGCCCACACACCNONE 
J065005L05CCCGGGCCCACACACCNONE 
J065039C06CCCGGGCCCACACACCNONE 
J065116H17CCCGGGCCCACACACCNONE 
J100046A17CCCGGGCCCACACACCNONE 
Os11g0216100AK059179ACGTGGGCCCGGGSimilar to Chaperone protein dnaJ. 
Os11g0429000AK067370CCCGGGCCCACGCConserved hypothetical protein. 
Os11g0448400AB095094TGGATGGGCCCGSimilar to Sigma factor SIG2A. 
J075053H03TGGATGGGCCCGNONE 
J075062F23TGGATGGGCCCGNONE 
J090029D08TGGATGGGCCCGNONE 
Os11g0549615AK069660TCCGGGCCCACCTGAcid phosphatase, type 5 family protein. 
J023031L04TCCGGGCCCACCTGNONE 
Os11g0549690J065085G07AGTGGGCCGGGCCCAACTConserved hypothetical protein. 
J065218B08AGTGGGCCGGGCCCAACTNONE 
J090036H16AGTGGGCCGGGCCCAACTNONE 
Os11g0615700AB026561ACACGTGGGCCCGCANONE 
AK059521ACACGTGGGCCCGCANONE 
AK103487ACACGTGGGCCCGCAProteasome subunit alpha type 5 (EC 3.4.25.1) (20S proteasome alpha subunit E) (20S proteasome subunit alpha-5). 
J033055A14ACACGTGGGCCCGCANONE 
J065044A11ACACGTGGGCCCGCANONE 
J065090I02ACACGTGGGCCCGCANONE 
J065104I09ACACGTGGGCCCGCANONE 
J065187J10ACACGTGGGCCCGCANONE 
J075024E07ACACGTGGGCCCGCANONE 
J075025O13ACACGTGGGCCCGCANONE 
J090062N12ACACGTGGGCCCGCANONE 
J090087G06ACACGTGGGCCCGCANONE 
J090098K11ACACGTGGGCCCGCANONE 
Os12g0158700J065021C04TGTGGGCCCGGGNONE 
J090082H20TGTGGGCCCGGGConserved hypothetical protein. 
Os12g0188900012-030-C08CGATGGGCCCGNONE 
J013027N23CGATGGGCCCGConserved hypothetical protein. 
J013156K23CGATGGGCCCGNONE 
J023134K02CGATGGGCCCGNONE 
J033051M18CGATGGGCCCGNONE 
J033143K05CGATGGGCCCGNONE 
J080003C24CGATGGGCCCGNONE 
J080004K05CGATGGGCCCGNONE 
J080009D14CGATGGGCCCGNONE 
J080014L12CGATGGGCCCGNONE 
J080020E23CGATGGGCCCGNONE 
J080021K20CGATGGGCCCGNONE 
J080024B19CGATGGGCCCGNONE 
J080024C12CGATGGGCCCGNONE 
J080031K10CGATGGGCCCGNONE 
J080034G09CGATGGGCCCGNONE 
J080036C10CGATGGGCCCGNONE 
J080037K18CGATGGGCCCGNONE 
J080039J17CGATGGGCCCGNONE 
J080040A20CGATGGGCCCGNONE 
J080042B06CGATGGGCCCGNONE 
J080046P07CGATGGGCCCGNONE 
J080047G02CGATGGGCCCGNONE 
J080049E12CGATGGGCCCGNONE 
J080056N14CGATGGGCCCGNONE 
J080059K10CGATGGGCCCGNONE 
J080064F05CGATGGGCCCGNONE 
J080064I04CGATGGGCCCGNONE 
J080064K17CGATGGGCCCGNONE 
J080069A15CGATGGGCCCGNONE 
J080071E22CGATGGGCCCGNONE 
J080071M24CGATGGGCCCGNONE 
J080074C17CGATGGGCCCGNONE 
J080075J07CGATGGGCCCGNONE 
J080079F11CGATGGGCCCGNONE 
J080083F15CGATGGGCCCGNONE 
J080084N21CGATGGGCCCGNONE 
J080086O03CGATGGGCCCGNONE 
J080089K02CGATGGGCCCGNONE 
J080092K22CGATGGGCCCGNONE 
J080093P09CGATGGGCCCGNONE 
J090001N04CGATGGGCCCGNONE 
J090041M02CGATGGGCCCGNONE 
Os12g0210200AF309381CGGGCCCACANONE 
AF309381TGTGGGCCCGGGNONE 
AK069105CGGGCCCACASimilar to Glutathione S-transferase GST 18 (EC 2.5.1.18). 
AK069105TGTGGGCCCGGGSimilar to Glutathione S-transferase GST 18 (EC 2.5.1.18). 
J023004I03CGGGCCCACANONE 
J023004I03TGTGGGCCCGGGNONE 
J033069C11CGGGCCCACANONE 
J033069C11TGTGGGCCCGGGNONE 
J065087E20CGGGCCCACANONE 
J065087E20TGTGGGCCCGGGNONE 
J065097G21CGGGCCCACANONE 
J065097G21TGTGGGCCCGGGNONE 
Os12g0266000J075093G23GCGGGCCCAGCNONE 
Os12g0294100AK111535CGGGCCCAACTWD40-like domain containing protein. 
J013030D09CGGGCCCAACTNONE 
J013153J16CGGGCCCAACTNONE 
J033079N17CGGGCCCAACTNONE 
J090002M14CGGGCCCAACTNONE 
J090071M08CGGGCCCAACTNONE 
J090090E07CGGGCCCAACTNONE 
Os12g0443700AK069541GCCGGGCCCATCCSimilar to Glu-prolyl-tRNA aminoacyl synthetase (Fragment). 
AK104881GCCGGGCCCATCCNONE 
Os12g0460800J023003J21CGGGCCCACCANONE 
Os12g0477600009-115-E02ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
009-125-D04ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
009-152-E11ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
013-003-H06ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
AK099534ACCGGGCCCACTGGGCCGGAGGCCCAAAAConserved hypothetical protein. 
J065109J18ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J065115L23ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075002K19ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075034D13ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075038B07ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075051A21ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075052J11ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075072A08ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075080E10ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075101E13ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075112F22ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075139O17ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075141K08ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075146N01ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
J075171J24ACCGGGCCCACTGGGCCGGAGGCCCAAAANONE 
Os12g0527500AK109836CCAGGCCCATCCGGGCCCACGGCCCyclin-like F-box domain containing protein. 
Os12g0560300AK060332CCCGGGCCCACGTGTCSimilar to NTGB2 (Fragment). 
AK099125CCCGGGCCCACGTGTCNONE 
AK099149CCCGGGCCCACGTGTCNONE 
J023044P12CCCGGGCCCACGTGTCNONE 
J023063C05CCCGGGCCCACGTGTCNONE 
J043006H11CCCGGGCCCACGTGTCNONE 
J065055C21CCCGGGCCCACGTGTCNONE 
J065104A14CCCGGGCCCACGTGTCNONE 
J075156I06CCCGGGCCCACGTGTCNONE 
J090083J19CCCGGGCCCACGTGTCNONE 
J100069A17CCCGGGCCCACGTGTCNONE 
Os12g0621500AK111785GCGGGCCCACCCGSimilar to IRE. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.