version

Summary of OsREG567 (All List)

OrganismOryza sativa  
IDOsREG567  
SequenceCGGGCCCC  
Annotation  
PPDB MotifACGGGC  function unknown  
PLACE Motif 
Total Entry Count1158  

Entry Sequences (1158 entries)

LocusGene modelSequenceDescription
Os01g0102600AK064812CACGTGGGGCCCGCAShikimate kinase domain containing protein. 
J013000E05CACGTGGGGCCCGCANONE 
J013027D08CACGTGGGGCCCGCANONE 
J013045K12CACGTGGGGCCCGCANONE 
J023119M03CACGTGGGGCCCGCANONE 
J065081F02CACGTGGGGCCCGCANONE 
J065180C08CACGTGGGGCCCGCANONE 
J065211M06CACGTGGGGCCCGCANONE 
J075073J06CACGTGGGGCCCGCANONE 
J075123A18CACGTGGGGCCCGCANONE 
J075124A07CACGTGGGGCCCGCANONE 
J075187B05CACGTGGGGCCCGCANONE 
Os01g0224100011-010-A11CTGGGGCCCGNONE 
011-034-B03CTGGGGCCCGNONE 
011-067-G07CTGGGGCCCGNONE 
015-017-C02CTGGGGCCCGNONE 
015-090-E01CTGGGGCCCGNONE 
AK101054CTGGGGCCCGNONE 
AK106517CTGGGGCCCGSimilar to DNA binding protein-like protein. 
Os01g0253500J100088F12CGGGCCCCACGTConserved hypothetical protein. 
Os01g0254900AK068204CGTGTGGGGCCCGGASimilar to Syntaxin 22 (AtSYP22) (AtVAM3). 
AY789530CGTGTGGGGCCCGGANONE 
Os01g0331100J090084H20GGGGCCCGCCCACTCCNONE 
Os01g0506200AK073118CCCGGGCCCCGCCCCACATetratricopeptide-like helical domain containing protein. 
J065002A07CCCGGGCCCCGCCCCACANONE 
J065079J08CCCGGGCCCCGCCCCACANONE 
J065167M18CCCGGGCCCCGCCCCACANONE 
Os01g0580300AK063468GCGGGCCCCACCTGTCConserved hypothetical protein. 
Os01g0588200006-052-E10TGCGGGCCCCACTGACAGNONE 
AJ251563TGCGGGCCCCACTGACAGNONE 
AK070745TGCGGGCCCCACTGACAGVoltage-dependent anion channel. 
AK104055TGCGGGCCCCACTGACAGNONE 
AK104419TGCGGGCCCCACTGACAGNONE 
J023057A07TGCGGGCCCCACTGACAGNONE 
J023068C08TGCGGGCCCCACTGACAGNONE 
J023148E24TGCGGGCCCCACTGACAGNONE 
J090045O22TGCGGGCCCCACTGACAGNONE 
J090045P03TGCGGGCCCCACTGACAGNONE 
J090050C18TGCGGGCCCCACTGACAGNONE 
J100023F01TGCGGGCCCCACTGACAGNONE 
J100051I18TGCGGGCCCCACTGACAGNONE 
J100060P17TGCGGGCCCCACTGACAGNONE 
Os01g0596700AK107371AACGGGCCCCACGFBD domain containing protein. 
Os01g0612600004-008-D07TGCGGGCCCCACTGACNONE 
009-057-C09TGCGGGCCCCACTGACNONE 
009-130-C01TGCGGGCCCCACTGACNONE 
AK062906TGCGGGCCCCACTGACNONE 
AK066561TGCGGGCCCCACTGACProtein of unknown function DUF1644 family protein. 
J013065E14TGCGGGCCCCACTGACNONE 
J013073D14TGCGGGCCCCACTGACNONE 
J023014A21TGCGGGCCCCACTGACNONE 
J023073M13TGCGGGCCCCACTGACNONE 
J023079F02TGCGGGCCCCACTGACNONE 
J023083B16TGCGGGCCCCACTGACNONE 
J023090G19TGCGGGCCCCACTGACNONE 
J023095F15TGCGGGCCCCACTGACNONE 
J023119H11TGCGGGCCCCACTGACNONE 
J033040B01TGCGGGCCCCACTGACNONE 
J033044F13TGCGGGCCCCACTGACNONE 
J033081E23TGCGGGCCCCACTGACNONE 
J033121K07TGCGGGCCCCACTGACNONE 
J033124D11TGCGGGCCCCACTGACNONE 
J033131N22TGCGGGCCCCACTGACNONE 
J065179E10TGCGGGCCCCACTGACNONE 
J090020A13TGCGGGCCCCACTGACNONE 
J090045K17TGCGGGCCCCACTGACNONE 
J090047M24TGCGGGCCCCACTGACNONE 
J090064G23TGCGGGCCCCACTGACNONE 
J090084G08TGCGGGCCCCACTGACNONE 
J090086F18TGCGGGCCCCACTGACNONE 
J100032D09TGCGGGCCCCACTGACNONE 
J100037O18TGCGGGCCCCACTGACNONE 
J100042B03TGCGGGCCCCACTGACNONE 
J100061D06TGCGGGCCCCACTGACNONE 
J100061I03TGCGGGCCCCACTGACNONE 
J100063B17TGCGGGCCCCACTGACNONE 
Os01g0636500012-066-G03GGGGCCCGTTNONE 
AK073853GGGGCCCGTTSimilar to Polygalacturonase PG2. 
AK104990GGGGCCCGTTNONE 
J033072D05GGGGCCCGTTNONE 
Os01g0645000AK108658GCGGGCCCCACGSimilar to TIS11 protein (dTIS11). 
Os01g0667900013-097-A02GCGGGCCCCCACGGTGACGTCACCNONE 
013-097-A02GCGTCGCGCGGGCCCCACCNONE 
014-011-C01GCGGGCCCCCACGGTGACGTCACCNONE 
014-011-C01GCGTCGCGCGGGCCCCACCNONE 
AK105335GCGGGCCCCCACGGTGACGTCACCGlutaredoxin-like, plant II family protein. 
AK105335GCGTCGCGCGGGCCCCACCGlutaredoxin-like, plant II family protein. 
J065156F10GCGGGCCCCCACGGTGACGTCACCNONE 
J065156F10GCGTCGCGCGGGCCCCACCNONE 
J065163D22GCGGGCCCCCACGGTGACGTCACCNONE 
J065163D22GCGTCGCGCGGGCCCCACCNONE 
J065197J04GCGGGCCCCCACGGTGACGTCACCNONE 
J065197J04GCGTCGCGCGGGCCCCACCNONE 
J075122C02GCGGGCCCCCACGGTGACGTCACCNONE 
J075122C02GCGTCGCGCGGGCCCCACCNONE 
J100047L16GCGGGCCCCCACGGTGACGTCACCNONE 
J100047L16GCGTCGCGCGGGCCCCACCNONE 
Os01g0672400AK060901GGGGCCCGCNONE 
AK061329GGGGCCCGCDrought induced 19 family protein. 
AK101922GGGGCCCGCNONE 
Os01g0730300AK101207GGTGGGGCGGGCCCCHAD-superfamily hydrolase subfamily IIB protein. 
AK109542GGTGGGGCGGGCCCCNONE 
Os01g0757400AB110177GCGGGCCCCACCAACNONE 
AK058626GCGGGCCCCACCAACNONE 
AK102585GCGGGCCCCACCAACNONE 
AK105474GCGGGCCCCACCAACSimilar to Katanin p60 ATPase-containing subunit A1 (EC 3.6.4.3) (Katanin p60 subunit A1) (p60 katanin). Splice isoform 2. 
J033098E22GCGGGCCCCACCAACNONE 
J033105O19GCGGGCCCCACCAACNONE 
J065019C21GCGGGCCCCACCAACNONE 
J090082H11GCGGGCCCCACCAACNONE 
J100050B19GCGGGCCCCACCAACNONE 
J100078H19GCGGGCCCCACCAACNONE 
Os01g0764800AK102809GGGGCCCGGGSimilar to Nt-gh3 deduced protein. 
Os01g0767600AK070672CCCGGGCCCCConserved hypothetical protein. 
J013131M12CCCGGGCCCCNONE 
J023027B15CCCGGGCCCCNONE 
J023059I06CCCGGGCCCCNONE 
J023095L05CCCGGGCCCCNONE 
J033033E20CCCGGGCCCCNONE 
J033105F24CCCGGGCCCCNONE 
J033148N05CCCGGGCCCCNONE 
J065060H14CCCGGGCCCCNONE 
J090093E17CCCGGGCCCCNONE 
Os01g0770500AK071653ACCGGGCCCCNONE 
AK099603ACCGGGCCCCSimilar to ABC transporter ATP-binding protein. 
Os01g0798500006-106-C11CTGGGGCCCGCANONE 
AK061244CTGGGGCCCGCANONE 
AK068219CTGGGGCCCGCAMalate synthase-like family protein. 
J065199O16CTGGGGCCCGCANONE 
Os01g0852500015-058-H06TGTGGGGCCCGNONE 
AK069637TGTGGGGCCCGELM2 domain containing protein. 
AK100453TGTGGGGCCCGNONE 
Os01g0865100016-066-A05TCCGGGCCCCACCNONE 
AK065779TCCGGGCCCCACCNONE 
AK071410TCCGGGCCCCACCSimilar to Uricase (Fragment). 
J013039E23TCCGGGCCCCACCNONE 
J023024I07TCCGGGCCCCACCNONE 
J065160J15TCCGGGCCCCACCNONE 
J090052J17TCCGGGCCCCACCNONE 
Os02g0118400012-047-C10CGGGCCCCNONE 
AK064002CGGGCCCCSimilar to CMP-N-acetylneuraminate-beta-galactosamide-alpha-2,6-sialyltransferase (EC 2.4.99.1) (Beta-galactoside alpha-2,6-sialyltransferase) (Alpha 2,6-ST) (Sialyltransferase 1) (ST6Gal I) (B-cell antigen CD75). 
AK101004CGGGCCCCNONE 
J065022L23CGGGCCCCNONE 
J065087F24CGGGCCCCNONE 
Os02g0137800AK060530ACCGGGCCCCACCCCCCAConserved hypothetical protein. 
AK101629ACCGGGCCCCACCCCCCANONE 
J065195A10ACCGGGCCCCACCCCCCANONE 
Os02g0198200J075078L15CGTGGGGCCCGCANONE 
J075097G10CGTGGGGCCCGCANONE 
J075099N12CGTGGGGCCCGCANONE 
J075142K24CGTGGGGCCCGCANONE 
J075199K14CGTGGGGCCCGCANONE 
Os02g0316200AK073932GTGTGGGGGCCCGCACyclin-like F-box domain containing protein. 
AK105757GTGTGGGGGCCCGCANONE 
J023039G03GTGTGGGGGCCCGCANONE 
J033076K03GTGTGGGGGCCCGCANONE 
J075157J22GTGTGGGGGCCCGCANONE 
J090097K02GTGTGGGGGCCCGCANONE 
J100053F10GTGTGGGGGCCCGCANONE 
Os02g0326700AK064977GGCCGGGCCCCACGRhomboid-like protein family protein. 
Os02g0438700012-040-C07GCGGGCCCCACACNONE 
AK062610GCGGGCCCCACACNONE 
AK105276GCGGGCCCCACACConserved hypothetical protein. 
J065104J01GCGGGCCCCACACNONE 
Os02g0509500009-117-G07GGGGCCCGCGTGCGNONE 
009-122-G08GGGGCCCGCGTGCGNONE 
AK105187GGGGCCCGCGTGCGConserved hypothetical protein. 
J065025C04GGGGCCCGCGTGCGNONE 
J065030F10GGGGCCCGCGTGCGNONE 
J065112P22GGGGCCCGCGTGCGNONE 
J065116I22GGGGCCCGCGTGCGNONE 
J065127F24GGGGCCCGCGTGCGNONE 
J065176E11GGGGCCCGCGTGCGNONE 
J065186F02GGGGCCCGCGTGCGNONE 
J075041F12GGGGCCCGCGTGCGNONE 
J075118L20GGGGCCCGCGTGCGNONE 
J075181D20GGGGCCCGCGTGCGNONE 
J090023P12GGGGCCCGCGTGCGNONE 
Os02g0521300AK120851GGGGCCCGCC2 domain containing protein. 
Os02g0527300AK101934TCCGGGCCCCGCCGAGATSimilar to Heat shock transcription factor 31 (Fragment). 
J013047O11TCCGGGCCCCGCCGAGATNONE 
J033073P11TCCGGGCCCCGCCGAGATNONE 
Os02g0562300AK073250ACCGGGCCCCACGTCalmodulin binding protein-like family protein. 
Os02g0629000009-047-E10CCCGGGCCCCACCCGNONE 
AK062480CCCGGGCCCCACCCGProtein of unknown function DUF584 family protein. 
Os02g0631000AK068667ACCGGGCCCCConserved hypothetical protein. 
J013159L03ACCGGGCCCCNONE 
J023119O20ACCGGGCCCCNONE 
J090098N20ACCGGGCCCCNONE 
Os02g0721800AK100043GCGGGCCCCACGTGTCCSimilar to Phosphatidylinositol transfer-like protein IV. 
Os02g0731500J065098J18CGGGCCCCAWPM-19-like family protein. 
J065123G07CGGGCCCCNONE 
Os02g0767500005-017-F10AACGGGCCCCACACGNONE 
AB016065AACGGGCCCCACACGNONE 
AK069611AACGGGCCCCACACGMitochondrial phosphate transporter. 
J013020K11AACGGGCCCCACACGNONE 
J013066I18AACGGGCCCCACACGNONE 
J023012D02AACGGGCCCCACACGNONE 
J023020J16AACGGGCCCCACACGNONE 
J023022H13AACGGGCCCCACACGNONE 
J023044N15AACGGGCCCCACACGNONE 
J023067E15AACGGGCCCCACACGNONE 
J023079C06AACGGGCCCCACACGNONE 
J023080B07AACGGGCCCCACACGNONE 
J023081G11AACGGGCCCCACACGNONE 
J023091H22AACGGGCCCCACACGNONE 
J023092J03AACGGGCCCCACACGNONE 
J023114D02AACGGGCCCCACACGNONE 
J023121J15AACGGGCCCCACACGNONE 
J023128G10AACGGGCCCCACACGNONE 
J023132B15AACGGGCCCCACACGNONE 
J023140G10AACGGGCCCCACACGNONE 
J023142B10AACGGGCCCCACACGNONE 
J033026C15AACGGGCCCCACACGNONE 
J033029F21AACGGGCCCCACACGNONE 
J033037I09AACGGGCCCCACACGNONE 
J033046D11AACGGGCCCCACACGNONE 
J033081L20AACGGGCCCCACACGNONE 
J033097J19AACGGGCCCCACACGNONE 
J033125D19AACGGGCCCCACACGNONE 
J033125I04AACGGGCCCCACACGNONE 
J033141M21AACGGGCCCCACACGNONE 
J033143K08AACGGGCCCCACACGNONE 
J053091N01AACGGGCCCCACACGNONE 
J065093C20AACGGGCCCCACACGNONE 
J065104K11AACGGGCCCCACACGNONE 
J065143L16AACGGGCCCCACACGNONE 
J065205I23AACGGGCCCCACACGNONE 
J090057C12AACGGGCCCCACACGNONE 
J090075P11AACGGGCCCCACACGNONE 
Os02g0773300AK071811GGGGCCCGCPyridoxal phosphate-dependent deaminase family protein. 
J013056D10GGGGCCCGCNONE 
J013096G18GGGGCCCGCNONE 
Os02g0778200AK065948GCGGGCCCCAGAminoacyl-tRNA synthetase, class I family protein. 
Os02g0817500AK072707CGGGCCCCACCACKCNAB voltage-gated K+ channel, beta subunit family protein. 
AK104135CGGGCCCCACCACNONE 
U46758CGGGCCCCACCACNONE 
Os02g0829100AB037145GCGGGCCCCACGTGTCNONE 
AJ278822GCGGGCCCCACGTGTCReplication protein A 30kDa. 
AK103235GCGGGCCCCACGTGTCNONE 
Os03g0114300AK121970CGGGCCCCAProtein kinase-like domain containing protein. 
Os03g0138600Os03g0138600GCCGGGCCCCACCACProtein of unknown function DUF810 family protein. 
Os03g0189100AK066877CGGGCCCCConserved hypothetical protein. 
J065040J15CGGGCCCCNONE 
J065152H18CGGGCCCCNONE 
J065152K18CGGGCCCCNONE 
J090030C10CGGGCCCCNONE 
Os03g0199500J065099N05CCCGGGCCCCNONE 
J065152P14CCCGGGCCCCConserved hypothetical protein. 
J080009C14CCCGGGCCCCNONE 
J080011K01CCCGGGCCCCNONE 
J080015H12CCCGGGCCCCNONE 
J080022K05CCCGGGCCCCNONE 
J080034G01CCCGGGCCCCNONE 
J080038I04CCCGGGCCCCNONE 
J080039F20CCCGGGCCCCNONE 
J080042J22CCCGGGCCCCNONE 
J080042N23CCCGGGCCCCNONE 
J080043E07CCCGGGCCCCNONE 
J080050A12CCCGGGCCCCNONE 
J080050C11CCCGGGCCCCNONE 
J080052B01CCCGGGCCCCNONE 
J080052H22CCCGGGCCCCNONE 
J080060E02CCCGGGCCCCNONE 
J080063K24CCCGGGCCCCNONE 
J080067I07CCCGGGCCCCNONE 
J080081H22CCCGGGCCCCNONE 
J080085J10CCCGGGCCCCNONE 
J080089E20CCCGGGCCCCNONE 
J080092N04CCCGGGCCCCNONE 
J080093B01CCCGGGCCCCNONE 
J080093N04CCCGGGCCCCNONE 
J080097B03CCCGGGCCCCNONE 
Os03g0268300AK102684TGCGGGCCCCSimilar to Digalactosyldiacylglycerol synthase 2. 
J013043J22TGCGGGCCCCNONE 
J013057J23TGCGGGCCCCNONE 
J013149I10TGCGGGCCCCNONE 
J013149M20TGCGGGCCCCNONE 
J013151D14TGCGGGCCCCNONE 
J013162O11TGCGGGCCCCNONE 
J023001F12TGCGGGCCCCNONE 
J023031B21TGCGGGCCCCNONE 
J023080A07TGCGGGCCCCNONE 
J023081N04TGCGGGCCCCNONE 
J023090C08TGCGGGCCCCNONE 
J023134G05TGCGGGCCCCNONE 
J023139G17TGCGGGCCCCNONE 
J023143I10TGCGGGCCCCNONE 
J023147D04TGCGGGCCCCNONE 
J023147O15TGCGGGCCCCNONE 
J033102K23TGCGGGCCCCNONE 
J033106C17TGCGGGCCCCNONE 
J075033G19TGCGGGCCCCNONE 
J075039J18TGCGGGCCCCNONE 
J075050K20TGCGGGCCCCNONE 
J075075J03TGCGGGCCCCNONE 
J075080E16TGCGGGCCCCNONE 
J075086L08TGCGGGCCCCNONE 
J075091K19TGCGGGCCCCNONE 
J075099O20TGCGGGCCCCNONE 
J075104I06TGCGGGCCCCNONE 
J075137C16TGCGGGCCCCNONE 
J075152G03TGCGGGCCCCNONE 
J075176N12TGCGGGCCCCNONE 
J100086K11TGCGGGCCCCNONE 
Os03g0278200AK103544GCGGGCCCCACCACNAD-dependent epimerase/dehydratase family protein. 
Os03g0284500012-066-D02CGGGCCCCTCGCGCGNONE 
AK105295CGGGCCCCTCGCGCGNONE 
AK121300CGGGCCCCTCGCGCGHAD-superfamily subfamily IIA hydrolase, CECR5 protein. 
Os03g0287900009-074-B07GCGGGCCCCACGTNONE 
014-027-E07GCGGGCCCCACGTNONE 
AK063663GCGGGCCCCACGTSimilar to Protein disulfide isomerase. 
J065009N21GCGGGCCCCACGTNONE 
Os03g0293500015-054-D06GCGGGCCCCANONE 
AK101594GCGGGCCCCASimilar to Pyruvate decarboxylase isozyme 3 (EC 4.1.1.1) (PDC) (Fragment). 
AK119500GCGGGCCCCANONE 
J033051F01GCGGGCCCCANONE 
J090058D14GCGGGCCCCANONE 
J100037N18GCGGGCCCCANONE 
J100042J23GCGGGCCCCANONE 
J100053E20GCGGGCCCCANONE 
J100060G07GCGGGCCCCANONE 
U27350GCGGGCCCCANONE 
Os03g0295700AK067856ACCGGGCCCCConserved hypothetical protein. 
Os03g0302800AK061293GCGGGCCCCACCCCCCAConserved hypothetical protein. 
Os03g0356484009-038-H01ACCGGGCCCCACANONE 
AK105146ACCGGGCCCCACATetratricopeptide-like helical domain containing protein. 
J065204G11ACCGGGCCCCACANONE 
Os03g0374400016-027-B12GGCCGGGCCCCACCCGNONE 
AK069719GGCCGGGCCCCACCCGConserved hypothetical protein. 
J023020L05GGCCGGGCCCCACCCGNONE 
J023026H16GGCCGGGCCCCACCCGNONE 
J033025P22GGCCGGGCCCCACCCGNONE 
J075016I21GGCCGGGCCCCACCCGNONE 
J090015G21GGCCGGGCCCCACCCGNONE 
Os03g0374500Os03g0374500GGCCGGGCCCCACCCGHypothetical protein. 
Os03g0588700Os03g0588700GCGGGCCCCACACConserved hypothetical protein. 
Os03g0633800AK073044CCCGGGCCCCACCTGTCSimilar to IAA6 (Fragment). 
J065038L22CCCGGGCCCCACCTGTCNONE 
J065185C13CCCGGGCCCCACCTGTCNONE 
Os03g0659900AK067560GCGGGCCCCASimilar to S3 self-incompatibility locus-linked pollen 3.15 protein. 
J090029C14GCGGGCCCCANONE 
Os03g0669200J013037D23GCGGGCCCCACGTNONE 
J023026K09GCGGGCCCCACGTNONE 
J075008E21GCGGGCCCCACGTNONE 
J075061B21GCGGGCCCCACGTNONE 
J075151B13GCGGGCCCCACGTNONE 
J075195L02GCGGGCCCCACGTNONE 
J090061B07GCGGGCCCCACGTNONE 
Os03g0698900013-074-A08CGGGCCCCACCAACNONE 
AK073303CGGGCCCCACCAACAlkaline phytoceramidase family protein. 
AK103953CGGGCCCCACCAACNONE 
J033024P22CGGGCCCCACCAACNONE 
J065194N16CGGGCCCCACCAACNONE 
J065195O11CGGGCCCCACCAACNONE 
J075020F03CGGGCCCCACCAACNONE 
J075032P18CGGGCCCCACCAACNONE 
J075037H13CGGGCCCCACCAACNONE 
J075147I01CGGGCCCCACCAACNONE 
J075187B13CGGGCCCCACCAACNONE 
J100043G08CGGGCCCCACCAACNONE 
J100060L06CGGGCCCCACCAACNONE 
J100063O21CGGGCCCCACCAACNONE 
J100066O13CGGGCCCCACCAACNONE 
J100072K20CGGGCCCCACCAACNONE 
J100083G21CGGGCCCCACCAACNONE 
J100085D07CGGGCCCCACCAACNONE 
Os03g0736600AK060375GGGGCCCGGTCCAGAConserved hypothetical protein. 
Os03g0752800AB041020GGGGCCCGGGCCGGCNONE 
AF058697GGGGCCCGGGCCGGCMADS14 protein. 
AF139664GGGGCCCGGGCCGGCNONE 
AK121171GGGGCCCGGGCCGGCNONE 
AY332478GGGGCCCGGGCCGGCNONE 
AY551916GGGGCCCGGGCCGGCNONE 
J023081C04GGGGCCCGGGCCGGCNONE 
Os03g0807900006-056-G10GACACGTGGGGCCCGGCNONE 
AK060962GACACGTGGGGCCCGGCChaperonin-like RbcX family protein. 
AK070287GACACGTGGGGCCCGGCNONE 
J023049O16GACACGTGGGGCCCGGCNONE 
J100025I21GACACGTGGGGCCCGGCNONE 
J100035K21GACACGTGGGGCCCGGCNONE 
Os03g0825700AK067902TGCGGGCCCCACASimilar to Defective in exine formation. 
Os03g0836200009-165-F07CGGGCCCCACANONE 
015-092-G01CGGGCCCCACANONE 
AK058443CGGGCCCCACANONE 
AK067084CGGGCCCCACASimilar to RNA-binding protein RZ-1. 
AK101225CGGGCCCCACANONE 
J013092A03CGGGCCCCACANONE 
J013095N17CGGGCCCCACANONE 
J013147J18CGGGCCCCACANONE 
J023019O10CGGGCCCCACANONE 
J023065N18CGGGCCCCACANONE 
J033113E18CGGGCCCCACANONE 
J033133E03CGGGCCCCACANONE 
J065059J15CGGGCCCCACANONE 
J065075O11CGGGCCCCACANONE 
J065119I07CGGGCCCCACANONE 
J065171J03CGGGCCCCACANONE 
J090016D21CGGGCCCCACANONE 
J090081O03CGGGCCCCACANONE 
J100040G18CGGGCCCCACANONE 
J100040L10CGGGCCCCACANONE 
J100055H13CGGGCCCCACANONE 
J100059I22CGGGCCCCACANONE 
J100078A08CGGGCCCCACANONE 
Os03g0854500012-067-H08CCCACGGGCCCCNONE 
AK100430CCCACGGGCCCCSimilar to Heat shock transcription factor 31 (Fragment). 
AK106118CCCACGGGCCCCNONE 
AY344485CCCACGGGCCCCNONE 
J023088F14CCCACGGGCCCCNONE 
J100041G01CCCACGGGCCCCNONE 
J100046N19CCCACGGGCCCCNONE 
J100052O08CCCACGGGCCCCNONE 
Os04g0218600009-123-A05GGGGCCCGNONE 
AK062873GGGGCCCGNONE 
AK103472GGGGCCCGConserved hypothetical protein. 
J090077A20GGGGCCCGNONE 
Os04g0282400AK120187CCCGGGCCCCACACSimilar to FPF1 protein-like (RAA1). 
J013034O10CCCGGGCCCCACACNONE 
J013071G20CCCGGGCCCCACACNONE 
Os04g0382300AK071912TGCGGGCCCCACCNONE 
AK101795TGCGGGCCCCACCSimilar to SNF1-related protein kinase regulatory gamma subunit 1 (AKIN gamma1) (AKING1). 
Os04g0390500AK066575TCCGGGCCCCNONE 
AK099908TCCGGGCCCCNONE 
AK100148TCCGGGCCCCNONE 
Os04g0444900AK063657ACCGGGCCCCACACSimilar to Alfin-1. 
AK098960ACCGGGCCCCACACNONE 
J065037L14ACCGGGCCCCACACNONE 
J065037P22ACCGGGCCCCACACNONE 
J065173O15ACCGGGCCCCACACNONE 
Os04g0476400J033082D17GCGGGCCCCNONE 
Os04g0481100AK099817CGGGCCCCSimilar to Seed imbibition protein (Fragment). 
AK100197CGGGCCCCNONE 
AK111421CGGGCCCCNONE 
Os04g0490500AK065576GCCGGGCCCCSimilar to Pto kinase interactor 1. 
J080004D10GCCGGGCCCCNONE 
J080083C02GCCGGGCCCCNONE 
J080083G13GCCGGGCCCCNONE 
J080097F03GCCGGGCCCCNONE 
Os04g0504200AK110863CGGGCCCCACConserved hypothetical protein. 
Os04g0548000011-097-D07GGGGCCCGCNONE 
AK073099GGGGCCCGCNONE 
AK104979GGGGCCCGCProtein of unknown function DUF862, eukaryotic domain containing protein. 
J065102C18GGGGCCCGCNONE 
J075076A16GGGGCCCGCNONE 
J075082L09GGGGCCCGCNONE 
J075092L18GGGGCCCGCNONE 
J075092N01GGGGCCCGCNONE 
J075122P14GGGGCCCGCNONE 
J075148L06GGGGCCCGCNONE 
Os04g0561200AK107862CCCGGGCCCCCACCellular retinaldehyde-binding/triple function, C-terminal domain containing protein. 
J065028J03CCCGGGCCCCCACNONE 
J065042H13CCCGGGCCCCCACNONE 
J065079N01CCCGGGCCCCCACNONE 
J065190N16CCCGGGCCCCCACNONE 
J065191H22CCCGGGCCCCCACNONE 
Os05g0116000AK058320CCACTGACATGCGGGCCCCACNONE 
AK121775CCACTGACATGCGGGCCCCAC11-S plant seed storage protein family protein. 
J023003L12CCACTGACATGCGGGCCCCACNONE 
J023025C18CCACTGACATGCGGGCCCCACNONE 
J023074E20CCACTGACATGCGGGCCCCACNONE 
J023128H09CCACTGACATGCGGGCCCCACNONE 
J033092N18CCACTGACATGCGGGCCCCACNONE 
J065009J09CCACTGACATGCGGGCCCCACNONE 
J090073L21CCACTGACATGCGGGCCCCACNONE 
Os05g0148600003-016-C11GGTGGGGCCCGTTNONE 
AK066168GGTGGGGCCCGTTNONE 
AK104336GGTGGGGCCCGTTSimilar to Na+/H+ antiporter. 
AY360145GGTGGGGCCCGTTNONE 
J013055J22GGTGGGGCCCGTTNONE 
J013057M24GGTGGGGCCCGTTNONE 
J013074N03GGTGGGGCCCGTTNONE 
J013158A22GGTGGGGCCCGTTNONE 
J075118H09GGTGGGGCCCGTTNONE 
Os05g0186300AK070360GCGGGCCCCCACSimilar to NADP-malic enzyme. 
AK099249GCGGGCCCCCACNONE 
AY435404GCGGGCCCCCACNONE 
J023006D11GCGGGCCCCCACNONE 
J023059P07GCGGGCCCCCACNONE 
Os05g0242600016-092-A07CCCGTGGGGCCCGCNONE 
AK107430CCCGTGGGGCCCGCPrefoldin domain containing protein. 
J065218C11CCCGTGGGGCCCGCNONE 
Os05g0295100AK100239CCCGTGGGGGCCCGProtein of unknown function DUF1253 family protein. 
AK108559CCCGTGGGGGCCCGNONE 
Os05g0350600AK066244ACCGGGCCCCACCCCACCACSimilar to Atranbp1b protein. 
J075100E12ACCGGGCCCCACCCCACCACNONE 
J090024D03ACCGGGCCCCACCCCACCACNONE 
J100027C02ACCGGGCCCCACCCCACCACNONE 
J100053P05ACCGGGCCCCACCCCACCACNONE 
J100055P22ACCGGGCCCCACCCCACCACNONE 
Os05g0387600011-059-E01CGGGCCCCNONE 
AK105254CGGGCCCCNONE 
AK120230CGGGCCCCProtein kinase-like domain containing protein. 
Os05g0408200AK100057GCGGGCCCCACGCGCGACGCSBP domain containing protein. 
J065182F20GCGGGCCCCACGCGCGACGCNONE 
Os05g0509500AB115419CGGGCCCCNONE 
AK068958CGGGCCCCSimilar to Signal recognition particle 54 kDa protein 2 (SRP54). 
Os05g0533600AK067577TCCGGGCCCCACTCCSimilar to Starch synthase IVa (Glycogen (Starch) synthase-like). 
AY224560TCCGGGCCCCACTCCNONE 
AY373258TCCGGGCCCCACTCCNONE 
Os05g0535900AK101539GGTGGGGCCCGCANONE 
AK101555GGTGGGGCCCGCAIQ calmodulin-binding region domain containing protein. 
J013047J05GGTGGGGCCCGCANONE 
Os05g0571600Os05g0571600GGGGCCCGTTConserved hypothetical protein. 
Os06g0212900AK071518GGCCGGGCCCCACTCCHeat shock protein Hsp70 family protein. 
AK104048GGCCGGGCCCCACTCCNONE 
J023019O18GGCCGGGCCCCACTCCNONE 
J023090N13GGCCGGGCCCCACTCCNONE 
J023101M15GGCCGGGCCCCACTCCNONE 
J023122F06GGCCGGGCCCCACTCCNONE 
J075023H16GGCCGGGCCCCACTCCNONE 
J090006J22GGCCGGGCCCCACTCCNONE 
J090075F24GGCCGGGCCCCACTCCNONE 
J090095A17GGCCGGGCCCCACTCCNONE 
Os06g0229800AB115915GCGGGCCCCNONE 
AB115916GCGGGCCCCNONE 
AB115917GCGGGCCCCNONE 
AB115918GCGGGCCCCNONE 
AF419099GCGGGCCCCSimilar to Starch synthase IIA. 
AK101978GCGGGCCCCNONE 
Os06g0264300AK061556CGGGCCCCNONE 
AK073271CGGGCCCCSimilar to RAD23, isoform I. 
Os06g0624900006-066-E01GGGGCCCGGGNONE 
AK061790GGGGCCCGGGNONE 
AK065620GGGGCCCGGGConserved hypothetical protein. 
AK067251GGGGCCCGGGNONE 
J013099A07GGGGCCCGGGNONE 
J065029M10GGGGCCCGGGNONE 
J065068B08GGGGCCCGGGNONE 
J065072A12GGGGCCCGGGNONE 
J065075F16GGGGCCCGGGNONE 
J065080C16GGGGCCCGGGNONE 
J075007G04GGGGCCCGGGNONE 
J075027O03GGGGCCCGGGNONE 
J075055A13GGGGCCCGGGNONE 
J075055E01GGGGCCCGGGNONE 
J075110N02GGGGCCCGGGNONE 
J075147P10GGGGCCCGGGNONE 
J075175L20GGGGCCCGGGNONE 
Os07g0240400009-080-C04GCGGGCCCCACGAANONE 
AK062643GCGGGCCCCACGAAConserved hypothetical protein. 
Os07g0255900J075118F23CGGGCCCCConserved hypothetical protein. 
Os07g0410300AK108503GCGGGCCCCACCGCACPathogenesis-related transcriptional factor and ERF domain containing protein. 
Os07g0438800AK060412ACCGGGCCCCACGNONE 
AK100065ACCGGGCCCCACGSimilar to Phosphate starvation regulator protein (Regulatory protein of P- starvation acclimation response Psr1). 
AK103195ACCGGGCCCCACGNONE 
AY224478ACCGGGCCCCACGNONE 
J013160O05ACCGGGCCCCACGNONE 
J023030C05ACCGGGCCCCACGNONE 
J033025O04ACCGGGCCCCACGNONE 
J033121P15ACCGGGCCCCACGNONE 
J043034I23ACCGGGCCCCACGNONE 
J065022N01ACCGGGCCCCACGNONE 
J065022N02ACCGGGCCCCACGNONE 
J065023M01ACCGGGCCCCACGNONE 
J065101G13ACCGGGCCCCACGNONE 
J075058P13ACCGGGCCCCACGNONE 
J075186K10ACCGGGCCCCACGNONE 
J075199F17ACCGGGCCCCACGNONE 
Os07g0474300AK108961CGCCACGTGTCCGGGCCCCConserved hypothetical protein. 
Os07g0552800AF435651GGGGCCCGCNONE 
AK066835GGGGCCCGCNONE 
J023009K24GGGGCCCGCNONE 
J023050L14GGGGCCCGCNONE 
J023092I02GGGGCCCGCNONE 
J023100P04GGGGCCCGCNONE 
J023112O13GGGGCCCGCNONE 
J023121J20GGGGCCCGCNONE 
Os07g0561300AK072982ACCGGGCCCCACACGCyclin-like F-box domain containing protein. 
J023149I22ACCGGGCCCCACACGNONE 
J065149C18ACCGGGCCCCACACGNONE 
J065166N15ACCGGGCCCCACACGNONE 
J075011J01ACCGGGCCCCACACGNONE 
J075013I05ACCGGGCCCCACACGNONE 
J075039H11ACCGGGCCCCACACGNONE 
J075067J09ACCGGGCCCCACACGNONE 
J075084E08ACCGGGCCCCACACGNONE 
J075085E12ACCGGGCCCCACACGNONE 
J075090D11ACCGGGCCCCACACGNONE 
J075092D12ACCGGGCCCCACACGNONE 
J075126N17ACCGGGCCCCACACGNONE 
J075179F01ACCGGGCCCCACACGNONE 
J075184P21ACCGGGCCCCACACGNONE 
Os07g0568000AK069485CCCGGGCCCCNONE 
AK072783CCCGGGCCCCApolipophorin III-like domain containing protein. 
Os07g0577600006-021-H11CGGGCCCCACCNONE 
006-022-B11CGGGCCCCACCNONE 
006-022-D10CGGGCCCCACCNONE 
006-022-E02CGGGCCCCACCNONE 
006-022-F03CGGGCCCCACCNONE 
006-023-C11CGGGCCCCACCNONE 
006-024-C10CGGGCCCCACCNONE 
006-024-C12CGGGCCCCACCNONE 
006-024-G12CGGGCCCCACCNONE 
006-026-C04CGGGCCCCACCNONE 
006-026-E05CGGGCCCCACCNONE 
006-026-E11CGGGCCCCACCNONE 
006-026-F09CGGGCCCCACCNONE 
006-026-H05CGGGCCCCACCNONE 
006-027-D03CGGGCCCCACCNONE 
006-028-C04CGGGCCCCACCNONE 
006-029-G10CGGGCCCCACCNONE 
006-030-A11CGGGCCCCACCNONE 
006-030-D12CGGGCCCCACCNONE 
006-031-G05CGGGCCCCACCNONE 
006-032-H06CGGGCCCCACCNONE 
006-033-A02CGGGCCCCACCNONE 
006-033-A06CGGGCCCCACCNONE 
006-034-B10CGGGCCCCACCNONE 
006-034-F07CGGGCCCCACCNONE 
006-035-A08CGGGCCCCACCNONE 
006-035-F07CGGGCCCCACCNONE 
006-036-A04CGGGCCCCACCNONE 
006-036-B04CGGGCCCCACCNONE 
006-037-D02CGGGCCCCACCNONE 
006-037-F12CGGGCCCCACCNONE 
006-037-H12CGGGCCCCACCNONE 
006-040-G12CGGGCCCCACCNONE 
006-040-H03CGGGCCCCACCNONE 
006-040-H06CGGGCCCCACCNONE 
006-042-B12CGGGCCCCACCNONE 
006-042-H10CGGGCCCCACCNONE 
006-044-G09CGGGCCCCACCNONE 
006-045-C04CGGGCCCCACCNONE 
006-046-B10CGGGCCCCACCNONE 
006-047-A05CGGGCCCCACCNONE 
006-048-D05CGGGCCCCACCNONE 
006-049-A08CGGGCCCCACCNONE 
006-050-C07CGGGCCCCACCNONE 
006-050-H10CGGGCCCCACCNONE 
006-051-G03CGGGCCCCACCNONE 
006-052-A01CGGGCCCCACCNONE 
006-052-A05CGGGCCCCACCNONE 
006-052-B03CGGGCCCCACCNONE 
006-052-D10CGGGCCCCACCNONE 
006-054-D03CGGGCCCCACCNONE 
006-055-A12CGGGCCCCACCNONE 
006-055-C05CGGGCCCCACCNONE 
006-055-F05CGGGCCCCACCNONE 
006-055-H10CGGGCCCCACCNONE 
006-056-A02CGGGCCCCACCNONE 
006-056-D07CGGGCCCCACCNONE 
006-057-A03CGGGCCCCACCNONE 
006-057-B06CGGGCCCCACCNONE 
006-057-H08CGGGCCCCACCNONE 
006-058-C04CGGGCCCCACCNONE 
006-058-F06CGGGCCCCACCNONE 
006-059-C10CGGGCCCCACCNONE 
006-059-G08CGGGCCCCACCNONE 
006-060-E10CGGGCCCCACCNONE 
006-061-B10CGGGCCCCACCNONE 
006-062-A05CGGGCCCCACCNONE 
006-062-B04CGGGCCCCACCNONE 
006-063-A04CGGGCCCCACCNONE 
006-063-D01CGGGCCCCACCNONE 
006-063-G12CGGGCCCCACCNONE 
006-064-D12CGGGCCCCACCNONE 
006-066-A03CGGGCCCCACCNONE 
006-066-C03CGGGCCCCACCNONE 
006-067-A03CGGGCCCCACCNONE 
006-067-G07CGGGCCCCACCNONE 
006-068-A06CGGGCCCCACCNONE 
006-069-D04CGGGCCCCACCNONE 
006-069-G05CGGGCCCCACCNONE 
006-070-H08CGGGCCCCACCNONE 
006-071-A05CGGGCCCCACCNONE 
006-071-H11CGGGCCCCACCNONE 
006-072-A07CGGGCCCCACCNONE 
006-072-B02CGGGCCCCACCNONE 
006-072-D11CGGGCCCCACCNONE 
006-072-H12CGGGCCCCACCNONE 
006-075-G06CGGGCCCCACCNONE 
006-077-B09CGGGCCCCACCNONE 
006-078-D01CGGGCCCCACCNONE 
006-078-D02CGGGCCCCACCNONE 
006-078-E05CGGGCCCCACCNONE 
006-078-G07CGGGCCCCACCNONE 
006-079-C03CGGGCCCCACCNONE 
006-079-F12CGGGCCCCACCNONE 
006-079-H01CGGGCCCCACCNONE 
006-080-D04CGGGCCCCACCNONE 
006-080-H04CGGGCCCCACCNONE 
006-081-A10CGGGCCCCACCNONE 
006-082-G02CGGGCCCCACCNONE 
006-082-H07CGGGCCCCACCNONE 
006-083-B03CGGGCCCCACCNONE 
006-085-A09CGGGCCCCACCNONE 
006-085-A12CGGGCCCCACCNONE 
006-085-F07CGGGCCCCACCNONE 
006-086-B11CGGGCCCCACCNONE 
006-086-D01CGGGCCCCACCNONE 
006-086-G04CGGGCCCCACCNONE 
006-087-E04CGGGCCCCACCNONE 
006-087-G09CGGGCCCCACCNONE 
006-088-E11CGGGCCCCACCNONE 
006-088-G10CGGGCCCCACCNONE 
006-088-H01CGGGCCCCACCNONE 
006-089-B04CGGGCCCCACCNONE 
006-089-D05CGGGCCCCACCNONE 
006-089-F07CGGGCCCCACCNONE 
006-089-H07CGGGCCCCACCNONE 
006-090-B06CGGGCCCCACCNONE 
006-090-H05CGGGCCCCACCNONE 
006-091-E11CGGGCCCCACCNONE 
006-092-H01CGGGCCCCACCNONE 
006-093-B08CGGGCCCCACCNONE 
006-093-C07CGGGCCCCACCNONE 
006-093-F02CGGGCCCCACCNONE 
006-093-G05CGGGCCCCACCNONE 
006-093-G06CGGGCCCCACCNONE 
006-094-D10CGGGCCCCACCNONE 
006-094-H07CGGGCCCCACCNONE 
006-095-G03CGGGCCCCACCNONE 
006-096-A06CGGGCCCCACCNONE 
006-096-E03CGGGCCCCACCNONE 
006-097-B03CGGGCCCCACCNONE 
006-097-D03CGGGCCCCACCNONE 
006-098-B07CGGGCCCCACCNONE 
006-098-G05CGGGCCCCACCNONE 
006-099-F05CGGGCCCCACCNONE 
006-100-H10CGGGCCCCACCNONE 
006-100-H12CGGGCCCCACCNONE 
006-101-A06CGGGCCCCACCNONE 
006-101-A08CGGGCCCCACCNONE 
006-101-A12CGGGCCCCACCNONE 
006-101-D04CGGGCCCCACCNONE 
006-101-G07CGGGCCCCACCNONE 
006-102-B12CGGGCCCCACCNONE 
006-102-E09CGGGCCCCACCNONE 
006-102-F02CGGGCCCCACCNONE 
006-103-D09CGGGCCCCACCNONE 
006-105-D05CGGGCCCCACCNONE 
006-105-D08CGGGCCCCACCNONE 
006-106-C07CGGGCCCCACCNONE 
006-106-F12CGGGCCCCACCNONE 
006-107-D01CGGGCCCCACCNONE 
006-109-C05CGGGCCCCACCNONE 
006-109-C08CGGGCCCCACCNONE 
006-109-D02CGGGCCCCACCNONE 
006-111-F03CGGGCCCCACCNONE 
006-112-C12CGGGCCCCACCNONE 
006-112-D08CGGGCCCCACCNONE 
006-113-A01CGGGCCCCACCNONE 
006-113-B03CGGGCCCCACCNONE 
006-113-C11CGGGCCCCACCNONE 
006-113-E07CGGGCCCCACCNONE 
006-113-F08CGGGCCCCACCNONE 
006-114-D08CGGGCCCCACCNONE 
006-114-H08CGGGCCCCACCNONE 
006-115-A08CGGGCCCCACCNONE 
006-115-A09CGGGCCCCACCNONE 
006-115-G05CGGGCCCCACCNONE 
006-117-B06CGGGCCCCACCNONE 
006-117-B09CGGGCCCCACCNONE 
006-117-F11CGGGCCCCACCNONE 
006-117-G10CGGGCCCCACCNONE 
006-117-H08CGGGCCCCACCNONE 
006-118-C06CGGGCCCCACCNONE 
006-118-G11CGGGCCCCACCNONE 
006-119-H03CGGGCCCCACCNONE 
006-120-D01CGGGCCCCACCNONE 
006-120-D12CGGGCCCCACCNONE 
006-120-H04CGGGCCCCACCNONE 
009-022-E12CGGGCCCCACCNONE 
009-044-H02CGGGCCCCACCNONE 
009-074-B08CGGGCCCCACCNONE 
009-145-B08CGGGCCCCACCNONE 
009-156-D09CGGGCCCCACCNONE 
009-163-F03CGGGCCCCACCNONE 
009-193-G03CGGGCCCCACCNONE 
AF010321CGGGCCCCACCNONE 
AK060987CGGGCCCCACCNONE 
AK070051CGGGCCCCACCNONE 
AK103966CGGGCCCCACCNONE 
AK104016CGGGCCCCACCNONE 
AK104127CGGGCCCCACCNONE 
AK104177CGGGCCCCACCNONE 
AK104283CGGGCCCCACCNONE 
AK104608CGGGCCCCACCNONE 
AK104651CGGGCCCCACCNONE 
AK119176CGGGCCCCACCSimilar to Type II chlorophyll a/b binding protein from photosystem I precursor. 
J065013J05CGGGCCCCACCNONE 
J065129D23CGGGCCCCACCNONE 
J065138E06CGGGCCCCACCNONE 
J065179N22CGGGCCCCACCNONE 
J065192A07CGGGCCCCACCNONE 
J065208G16CGGGCCCCACCNONE 
J075013K01CGGGCCCCACCNONE 
J075017B12CGGGCCCCACCNONE 
J075018O17CGGGCCCCACCNONE 
J075023H05CGGGCCCCACCNONE 
J075053L02CGGGCCCCACCNONE 
J075067I01CGGGCCCCACCNONE 
J075083D19CGGGCCCCACCNONE 
J075083G03CGGGCCCCACCNONE 
J075084F12CGGGCCCCACCNONE 
J075088K18CGGGCCCCACCNONE 
J075094A18CGGGCCCCACCNONE 
J075094I22CGGGCCCCACCNONE 
J075097E17CGGGCCCCACCNONE 
J075098I24CGGGCCCCACCNONE 
J075110K19CGGGCCCCACCNONE 
J075118G21CGGGCCCCACCNONE 
J075118J20CGGGCCCCACCNONE 
J075120G14CGGGCCCCACCNONE 
J075120H20CGGGCCCCACCNONE 
J075127H23CGGGCCCCACCNONE 
J075139M03CGGGCCCCACCNONE 
J075142E17CGGGCCCCACCNONE 
J075149N17CGGGCCCCACCNONE 
J075152A20CGGGCCCCACCNONE 
J075157N22CGGGCCCCACCNONE 
J075159K21CGGGCCCCACCNONE 
J075173B20CGGGCCCCACCNONE 
J075192N20CGGGCCCCACCNONE 
J075196A07CGGGCCCCACCNONE 
J075199N04CGGGCCCCACCNONE 
J080005P10CGGGCCCCACCNONE 
J080025I24CGGGCCCCACCNONE 
J080064D09CGGGCCCCACCNONE 
J080064N24CGGGCCCCACCNONE 
J080068B02CGGGCCCCACCNONE 
J080097K04CGGGCCCCACCNONE 
J080097K19CGGGCCCCACCNONE 
J080097N20CGGGCCCCACCNONE 
J100055P07CGGGCCCCACCNONE 
Os07g0605200AF091458GCGGGCCCCANONE 
AF139665GCGGGCCCCANONE 
AJ011675GCGGGCCCCANONE 
AK064704GCGGGCCCCAMADS box transcription factor 18 (OsMADS18) (MADS box protein 2) (MADS box protein 28) (FDRMADS7). 
J075159J15GCGGGCCCCANONE 
J090034M06GCGGGCCCCANONE 
J090079L24GCGGGCCCCANONE 
Os07g0615900AK066317GCGGGCCCCAGZinc finger, GATA-type domain containing protein. 
AK073803GCGGGCCCCAGNONE 
J013026A07GCGGGCCCCAGNONE 
J013064I12GCGGGCCCCAGNONE 
J033068D01GCGGGCCCCAGNONE 
J033074A10GCGGGCCCCAGNONE 
J033129C06GCGGGCCCCAGNONE 
J100035K20GCGGGCCCCAGNONE 
J100044G13GCGGGCCCCAGNONE 
J100050K01GCGGGCCCCAGNONE 
J100069P20GCGGGCCCCAGNONE 
J100071O09GCGGGCCCCAGNONE 
J100086K01GCGGGCCCCAGNONE 
J100089G11GCGGGCCCCAGNONE 
Os07g0623600AK063642TGCGGGCCCCACGTGTCConserved hypothetical protein. 
Os07g0647800AK102332GGGGCCCGCAConserved hypothetical protein. 
Os08g0107900014-055-C03TGTGGGGCCCGCANONE 
J065062G20TGTGGGGCCCGCANONE 
Os08g0160600AK106763CCCGGGCCCCACCTGTConserved hypothetical protein. 
Os08g0163400AB005290GCGGGCCCCSigma-70 factor family protein. 
AK065997GCGGGCCCCNONE 
AK071725GCGGGCCCCNONE 
Os08g0459600AK071203GCGGGCCCCACACSimilar to 12-oxophytodienoate reductase 3 (EC 1.3.1.42) (12-oxophytodienoate- 10,11-reductase 3) (OPDA-reductase 3) (LeOPR3). 
AK104843GCGGGCCCCACACNONE 
Os08g0473900012-010-C04ACCGGGCCCCNONE 
012-025-A10ACCGGGCCCCNONE 
012-025-C03ACCGGGCCCCNONE 
012-030-H02ACCGGGCCCCNONE 
012-033-A03ACCGGGCCCCNONE 
012-044-F02ACCGGGCCCCNONE 
012-046-F01ACCGGGCCCCNONE 
012-050-C04ACCGGGCCCCNONE 
012-051-G08ACCGGGCCCCNONE 
012-051-H03ACCGGGCCCCNONE 
012-056-F12ACCGGGCCCCNONE 
012-062-E07ACCGGGCCCCNONE 
012-067-C12ACCGGGCCCCNONE 
012-073-B07ACCGGGCCCCNONE 
012-078-H09ACCGGGCCCCNONE 
012-083-G12ACCGGGCCCCNONE 
012-086-C12ACCGGGCCCCNONE 
012-089-H12ACCGGGCCCCNONE 
012-091-B09ACCGGGCCCCNONE 
012-092-G08ACCGGGCCCCNONE 
014-045-D08ACCGGGCCCCNONE 
015-004-H02ACCGGGCCCCNONE 
015-005-G05ACCGGGCCCCNONE 
015-007-D06ACCGGGCCCCNONE 
015-014-G04ACCGGGCCCCNONE 
015-019-G11ACCGGGCCCCNONE 
015-037-G04ACCGGGCCCCNONE 
015-044-D02ACCGGGCCCCNONE 
015-046-A05ACCGGGCCCCNONE 
015-049-D09ACCGGGCCCCNONE 
015-052-F12ACCGGGCCCCNONE 
015-054-E03ACCGGGCCCCNONE 
015-066-D02ACCGGGCCCCNONE 
015-070-H03ACCGGGCCCCNONE 
015-074-H10ACCGGGCCCCNONE 
015-077-C04ACCGGGCCCCNONE 
015-090-A10ACCGGGCCCCNONE 
015-091-F11ACCGGGCCCCNONE 
016-002-G04ACCGGGCCCCNONE 
016-004-E03ACCGGGCCCCNONE 
016-008-H10ACCGGGCCCCNONE 
016-015-G12ACCGGGCCCCNONE 
016-018-G01ACCGGGCCCCNONE 
016-023-C07ACCGGGCCCCNONE 
016-023-G06ACCGGGCCCCNONE 
016-027-G04ACCGGGCCCCNONE 
016-039-G04ACCGGGCCCCNONE 
016-044-A06ACCGGGCCCCNONE 
016-053-H06ACCGGGCCCCNONE 
016-063-H03ACCGGGCCCCNONE 
016-066-A01ACCGGGCCCCNONE 
016-066-E08ACCGGGCCCCNONE 
016-072-G03ACCGGGCCCCNONE 
016-088-C06ACCGGGCCCCNONE 
016-090-D01ACCGGGCCCCNONE 
AK073487ACCGGGCCCCAlpha-amylase isozyme 3D precursor (EC 3.2.1.1) (1,4-alpha-D-glucan glucanohydrolase). 
AK119561ACCGGGCCCCNONE 
AK119761ACCGGGCCCCNONE 
J033024B15ACCGGGCCCCNONE 
J033040A17ACCGGGCCCCNONE 
J033041J03ACCGGGCCCCNONE 
J033093F11ACCGGGCCCCNONE 
J033117E15ACCGGGCCCCNONE 
J033128F11ACCGGGCCCCNONE 
J065006O09ACCGGGCCCCNONE 
J065010E21ACCGGGCCCCNONE 
J065011P15ACCGGGCCCCNONE 
J065013M15ACCGGGCCCCNONE 
J065019E20ACCGGGCCCCNONE 
J065021I21ACCGGGCCCCNONE 
J065022D23ACCGGGCCCCNONE 
J065024L10ACCGGGCCCCNONE 
J065026P16ACCGGGCCCCNONE 
J065027C20ACCGGGCCCCNONE 
J065027G06ACCGGGCCCCNONE 
J065027G23ACCGGGCCCCNONE 
J065028B11ACCGGGCCCCNONE 
J065030J05ACCGGGCCCCNONE 
J065031G17ACCGGGCCCCNONE 
J065034J07ACCGGGCCCCNONE 
J065037N01ACCGGGCCCCNONE 
J065040H20ACCGGGCCCCNONE 
J065041C22ACCGGGCCCCNONE 
J065044A21ACCGGGCCCCNONE 
J065044L06ACCGGGCCCCNONE 
J065045J02ACCGGGCCCCNONE 
J065048D10ACCGGGCCCCNONE 
J065049H23ACCGGGCCCCNONE 
J065049I21ACCGGGCCCCNONE 
J065052D03ACCGGGCCCCNONE 
J065055D22ACCGGGCCCCNONE 
J065057L13ACCGGGCCCCNONE 
J065058B13ACCGGGCCCCNONE 
J065059B04ACCGGGCCCCNONE 
J065059C05ACCGGGCCCCNONE 
J065059H01ACCGGGCCCCNONE 
J065059K01ACCGGGCCCCNONE 
J065063G19ACCGGGCCCCNONE 
J065073E20ACCGGGCCCCNONE 
J065075I10ACCGGGCCCCNONE 
J065081I24ACCGGGCCCCNONE 
J065084E05ACCGGGCCCCNONE 
J065084E12ACCGGGCCCCNONE 
J065084J12ACCGGGCCCCNONE 
J065086H18ACCGGGCCCCNONE 
J065087F07ACCGGGCCCCNONE 
J065095J02ACCGGGCCCCNONE 
J065097E24ACCGGGCCCCNONE 
J065102I06ACCGGGCCCCNONE 
J065104N21ACCGGGCCCCNONE 
J065105A16ACCGGGCCCCNONE 
J065107C13ACCGGGCCCCNONE 
J065108N11ACCGGGCCCCNONE 
J065112I04ACCGGGCCCCNONE 
J065112J05ACCGGGCCCCNONE 
J065112K17ACCGGGCCCCNONE 
J065115I05ACCGGGCCCCNONE 
J065120J21ACCGGGCCCCNONE 
J065120K18ACCGGGCCCCNONE 
J065121L19ACCGGGCCCCNONE 
J065123K20ACCGGGCCCCNONE 
J065123M10ACCGGGCCCCNONE 
J065124L18ACCGGGCCCCNONE 
J065127E19ACCGGGCCCCNONE 
J065128B05ACCGGGCCCCNONE 
J065130F11ACCGGGCCCCNONE 
J065130P06ACCGGGCCCCNONE 
J065132K13ACCGGGCCCCNONE 
J065134I17ACCGGGCCCCNONE 
J065139I11ACCGGGCCCCNONE 
J065141G14ACCGGGCCCCNONE 
J065141O04ACCGGGCCCCNONE 
J065146P07ACCGGGCCCCNONE 
J065148L24ACCGGGCCCCNONE 
J065154H20ACCGGGCCCCNONE 
J065155I05ACCGGGCCCCNONE 
J065165F05ACCGGGCCCCNONE 
J065166I20ACCGGGCCCCNONE 
J065168D14ACCGGGCCCCNONE 
J065168F12ACCGGGCCCCNONE 
J065169F17ACCGGGCCCCNONE 
J065169J11ACCGGGCCCCNONE 
J065169O14ACCGGGCCCCNONE 
J065171E05ACCGGGCCCCNONE 
J065171L21ACCGGGCCCCNONE 
J065175G24ACCGGGCCCCNONE 
J065178M19ACCGGGCCCCNONE 
J065179C17ACCGGGCCCCNONE 
J065179E04ACCGGGCCCCNONE 
J065180C03ACCGGGCCCCNONE 
J065182D08ACCGGGCCCCNONE 
J065183P17ACCGGGCCCCNONE 
J065188N09ACCGGGCCCCNONE 
J065190G15ACCGGGCCCCNONE 
J065190N03ACCGGGCCCCNONE 
J065191H11ACCGGGCCCCNONE 
J065193C13ACCGGGCCCCNONE 
J065193G19ACCGGGCCCCNONE 
J065199F19ACCGGGCCCCNONE 
J065202L20ACCGGGCCCCNONE 
J065204K12ACCGGGCCCCNONE 
J065206H08ACCGGGCCCCNONE 
J065208E02ACCGGGCCCCNONE 
J065210O09ACCGGGCCCCNONE 
J065211L19ACCGGGCCCCNONE 
J065211N19ACCGGGCCCCNONE 
J065212I06ACCGGGCCCCNONE 
J065213P21ACCGGGCCCCNONE 
J065215C14ACCGGGCCCCNONE 
J100032J03ACCGGGCCCCNONE 
M24287ACCGGGCCCCNONE 
Os08g0536300AF358777GCGGGCCCCACCNONE 
AK099722GCGGGCCCCACCSimilar to Hd1. 
J100054G13GCGGGCCCCACCNONE 
Os08g0544800009-168-G01GGGGCCCGGTNONE 
011-046-D09GGGGCCCGGTNONE 
012-003-C08GGGGCCCGGTNONE 
012-042-B06GGGGCCCGGTNONE 
013-035-H12GGGGCCCGGTNONE 
013-072-A10GGGGCCCGGTNONE 
014-010-B11GGGGCCCGGTNONE 
014-097-E06GGGGCCCGGTNONE 
015-003-E12GGGGCCCGGTNONE 
015-040-B04GGGGCCCGGTNONE 
AK060536GGGGCCCGGTNONE 
AK102666GGGGCCCGGTNONE 
AK119660GGGGCCCGGTPCF2. 
D87261GGGGCCCGGTNONE 
J090049N23GGGGCCCGGTNONE 
J090084G06GGGGCCCGGTNONE 
Os08g0546300AK064717GGGGCCCGConserved hypothetical protein. 
AK119794GGGGCCCGNONE 
D10982GGGGCCCGNONE 
J080044B21GGGGCCCGNONE 
Os09g0369500013-023-F11TGCGGGCCCCACGCCTGGGCCCCNONE 
AK105322TGCGGGCCCCACGCCTGGGCCCCNONE 
AK105479TGCGGGCCCCACGCCTGGGCCCCConserved hypothetical protein. 
Os09g0401000AK064679GGGGCCCGCMyb factor. 
J075155B13GGGGCCCGCNONE 
Y11351GGGGCCCGCNONE 
Os09g0433000009-198-H02GGGGCCCGNONE 
AK063243GGGGCCCGNONE 
Os09g0434200AK062015GGGGCCCGNONE 
AK103447GGGGCCCGZinc finger, RING-type domain containing protein. 
Os09g0480400AK100641TCCGGGCCCCCCCGCGSimilar to Glycosyltransferase QUASIMODO1 (EC 2.4.1.-). 
J023110G15TCCGGGCCCCCCCGCGNONE 
J090053K21TCCGGGCCCCCCCGCGNONE 
Os09g0499600015-008-H01GGGGCCCGNONE 
015-040-A02GGGGCCCGNONE 
AK067280GGGGCCCGZinc finger, BED-type predicted domain containing protein. 
J013067K14GGGGCCCGNONE 
J023085B01GGGGCCCGNONE 
J033031F05GGGGCCCGNONE 
J033079H18GGGGCCCGNONE 
J033092O20GGGGCCCGNONE 
J033108A02GGGGCCCGNONE 
J033124I06GGGGCCCGNONE 
J033136B17GGGGCCCGNONE 
Os09g0558200016-083-C09GCGGGCCCCNONE 
AK068834GCGGGCCCCNONE 
AK103673GCGGGCCCCHomeodomain-like containing protein. 
J013159M18GCGGGCCCCNONE 
J065022I04GCGGGCCCCNONE 
J065089B19GCGGGCCCCNONE 
Os11g0156600Os11g0156600ACCGGGCCCCACCTB2/DP1 and HVA22 related protein family protein. 
Os11g0216400Os11g0216400AACGGGCCCCACTCTProteinase inhibitor, propeptide domain containing protein. 
Os11g0445300AK073557GCCGGGCCCCProtein kinase-like domain containing protein. 
J033046C19GCCGGGCCCCNONE 
J065025H02GCCGGGCCCCNONE 
J065026K20GCCGGGCCCCNONE 
J065161F22GCCGGGCCCCNONE 
J065196D22GCCGGGCCCCNONE 
J075130B15GCCGGGCCCCNONE 
J090004H14GCCGGGCCCCNONE 
J090083D24GCCGGGCCCCNONE 
J100077F15GCCGGGCCCCNONE 
Os11g0544700AF464904CCCGGGCCCCNONE 
AK072844CCCGGGCCCCRepressor protein. 
J023143I16CCCGGGCCCCNONE 
Os11g0547000AK100677GCGGGCCCCACCCCCACCACSimilar to FKF1. 
Os11g0604600006-022-C01ACCGGGCCCCACGCGTNONE 
AK061397ACCGGGCCCCACGCGTNONE 
AK102376ACCGGGCCCCACGCGTRINGv domain containing protein. 
J033091P05ACCGGGCCCCACGCGTNONE 
J065062C12ACCGGGCCCCACGCGTNONE 
J065062H09ACCGGGCCCCACGCGTNONE 
J065064A02ACCGGGCCCCACGCGTNONE 
J065101I16ACCGGGCCCCACGCGTNONE 
J065123F23ACCGGGCCCCACGCGTNONE 
J065155N12ACCGGGCCCCACGCGTNONE 
J065164F22ACCGGGCCCCACGCGTNONE 
J065181G08ACCGGGCCCCACGCGTNONE 
J075055H05ACCGGGCCCCACGCGTNONE 
J075058A22ACCGGGCCCCACGCGTNONE 
J075082H23ACCGGGCCCCACGCGTNONE 
J075111A14ACCGGGCCCCACGCGTNONE 
J075176I06ACCGGGCCCCACGCGTNONE 
Os12g0155200AK067300GGGGCCCGSimilar to Rac GTPase activating protein. 
J090050C04GGGGCCCGNONE 
Os12g0541400AK101210CCCGGGCCCCPrefoldin domain containing protein. 
J033031A17CCCGGGCCCCNONE 
J090051F01CCCGGGCCCCNONE 
Os12g0597500AK101904GCGGGCCCCACCNONE 
AK103799GCGGGCCCCACCAmidase, hydantoinase/carbamoylase family protein. 
J065206A02GCGGGCCCCACCNONE 
J100078O15GCGGGCCCCACCNONE 
Os12g0613500009-028-C05CCACTGACAACCGGGCCCCACCACACACCCGGCCCCACANONE 
011-081-E10CCACTGACAACCGGGCCCCACCACACACCCGGCCCCACANONE 
AB118018CCACTGACAACCGGGCCCCACCACACACCCGGCCCCACANONE 
AK058205CCACTGACAACCGGGCCCCACCACACACCCGGCCCCACANONE 
AK101273CCACTGACAACCGGGCCCCACCACACACCCGGCCCCACALissencephaly type-1-like homology motif domain containing protein. 
J033033A11CCACTGACAACCGGGCCCCACCACACACCCGGCCCCACANONE 
Os12g0620400015-008-B10CACGTGGGGCCCGCNONE 
AK059006CACGTGGGGCCCGCNONE 
AK059973CACGTGGGGCCCGCNONE 
AK063843CACGTGGGGCCCGCMethyl-CpG binding domain containing protein. 
AK072503CACGTGGGGCCCGCNONE 
AK072934CACGTGGGGCCCGCNONE 
J023126H05CACGTGGGGCCCGCNONE 
J023131G11CACGTGGGGCCCGCNONE 
J023146E17CACGTGGGGCCCGCNONE 
J033064P08CACGTGGGGCCCGCNONE 
J033095L07CACGTGGGGCCCGCNONE 
J065101N06CACGTGGGGCCCGCNONE 
J065186F11CACGTGGGGCCCGCNONE 
J065215J15CACGTGGGGCCCGCNONE 
J080049H05CACGTGGGGCCCGCNONE 
J080059L05CACGTGGGGCCCGCNONE 
J080061M17CACGTGGGGCCCGCNONE 
J080063D16CACGTGGGGCCCGCNONE 
J090012D01CACGTGGGGCCCGCNONE 
J090023D20CACGTGGGGCCCGCNONE 
J090040A09CACGTGGGGCCCGCNONE 
J090044K08CACGTGGGGCCCGCNONE 
J100019H03CACGTGGGGCCCGCNONE 
J100054N04CACGTGGGGCCCGCNONE 
Os12g0625000006-117-H03TGCGGGCCCCACCTGNONE 
AF073695TGCGGGCCCCACCTGNONE 
AK061993TGCGGGCCCCACCTGNONE 
AK099598TGCGGGCCCCACCTGCysteine synthase (EC 2.5.1.47) (O-acetylserine sulfhydrylase) (O- acetylserine (Thiol)-lyase) (CSase) (OAS-TL). 
Os12g0631600J075087C06GGGGCCCGCAConserved hypothetical protein. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.