version

Summary of OsREG568 (All List)

OrganismOryza sativa  
IDOsREG568  
SequenceCGGGCCGA  
Annotation  
PPDB MotifACGGGC  function unknown  
PLACE Motif 
Total Entry Count724  

Entry Sequences (724 entries)

LocusGene modelSequenceDescription
Os01g0166800AK073783ATCTCGGCCCGGCConserved hypothetical protein. 
AK099378ATCTCGGCCCGGCNONE 
J033026H10ATCTCGGCCCGGCNONE 
J033067O18ATCTCGGCCCGGCNONE 
J033108A17ATCTCGGCCCGGCNONE 
J065015J11ATCTCGGCCCGGCNONE 
J065204P09ATCTCGGCCCGGCNONE 
Os01g0231700012-002-F11ATATGGGCCGGGCCGAGNONE 
013-082-F05ATATGGGCCGGGCCGAGNONE 
AK107453ATATGGGCCGGGCCGAGSimilar to 60S acidic ribosomal protein P2-B (CaRP2B). 
J065005L22ATATGGGCCGGGCCGAGNONE 
J065023E21ATATGGGCCGGGCCGAGNONE 
J065036H21ATATGGGCCGGGCCGAGNONE 
J065037M24ATATGGGCCGGGCCGAGNONE 
J065049L04ATATGGGCCGGGCCGAGNONE 
J065072F17ATATGGGCCGGGCCGAGNONE 
J065085H10ATATGGGCCGGGCCGAGNONE 
J065109N19ATATGGGCCGGGCCGAGNONE 
J065117M19ATATGGGCCGGGCCGAGNONE 
J065144C15ATATGGGCCGGGCCGAGNONE 
J065159G24ATATGGGCCGGGCCGAGNONE 
J065164N14ATATGGGCCGGGCCGAGNONE 
J075025K16ATATGGGCCGGGCCGAGNONE 
J075057L05ATATGGGCCGGGCCGAGNONE 
J075070I16ATATGGGCCGGGCCGAGNONE 
J075089D10ATATGGGCCGGGCCGAGNONE 
J075138F10ATATGGGCCGGGCCGAGNONE 
J090018C11ATATGGGCCGGGCCGAGNONE 
J100018L19ATATGGGCCGGGCCGAGNONE 
J100024B14ATATGGGCCGGGCCGAGNONE 
J100048L02ATATGGGCCGGGCCGAGNONE 
J100055A22ATATGGGCCGGGCCGAGNONE 
J100069K01ATATGGGCCGGGCCGAGNONE 
Os01g0271700J065184P16CGGGCCGAANONE 
J065184P16CGGGCCGAAANONE 
J075182E21CGGGCCGAANONE 
J075182E21CGGGCCGAAANONE 
J075191M19CGGGCCGAANONE 
J075191M19CGGGCCGAAANONE 
J090021E22CGGGCCGAANONE 
J090021E22CGGGCCGAAANONE 
Os01g0327600AK120216CTCGGCCCGNONE 
AK121799CTCGGCCCGConserved hypothetical protein. 
J065081I07CTCGGCCCGNONE 
J065082D04CTCGGCCCGNONE 
J065082G10CTCGGCCCGNONE 
J065085G24CTCGGCCCGNONE 
J065105J24CTCGGCCCGNONE 
J065128D18CTCGGCCCGNONE 
J065155D13CTCGGCCCGNONE 
J065200C11CTCGGCCCGNONE 
Os01g0558600006-120-G12ATCTCGGCCCGGCCCGGCCCAACTNONE 
J013100N20ATCTCGGCCCGGCCCGGCCCAACTNONE 
J033043P09ATCTCGGCCCGGCCCGGCCCAACTNONE 
J033125M18ATCTCGGCCCGGCCCGGCCCAACTNONE 
J053043N11ATCTCGGCCCGGCCCGGCCCAACTNONE 
J065008E07ATCTCGGCCCGGCCCGGCCCAACTNONE 
J065080O16ATCTCGGCCCGGCCCGGCCCAACTNONE 
J075002G24ATCTCGGCCCGGCCCGGCCCAACTNONE 
J075123C09ATCTCGGCCCGGCCCGGCCCAACTNONE 
S66160ATCTCGGCCCGGCCCGGCCCAACTRas-related protein RIC1. 
Os01g0582400AK069484AATGGGCCGTAATCTCGGCCCGTTSimilar to Multidomain cyclophilin type peptidyl-prolyl cis-trans isomerase. 
J023019D12AATGGGCCGTAATCTCGGCCCGTTNONE 
J023036F15AATGGGCCGTAATCTCGGCCCGTTNONE 
J023095O16AATGGGCCGTAATCTCGGCCCGTTNONE 
J033102M15AATGGGCCGTAATCTCGGCCCGTTNONE 
J043013I06AATGGGCCGTAATCTCGGCCCGTTNONE 
J065083M21AATGGGCCGTAATCTCGGCCCGTTNONE 
J065176A17AATGGGCCGTAATCTCGGCCCGTTNONE 
Os01g0588700AK066951CTCGGCCCGGTProtein of unknown function DUF572 family protein. 
AK071911CTCGGCCCGGTNONE 
J013059D18CTCGGCCCGGTNONE 
J013090C12CTCGGCCCGGTNONE 
J090043F17CTCGGCCCGGTNONE 
Os01g0642900009-109-F01TCGGCCCGNONE 
AK063836TCGGCCCGSingle-strand binding protein/Primosomal replication protein n family protein. 
AK073560TCGGCCCGNONE 
J033043K18TCGGCCCGNONE 
J100023C05TCGGCCCGNONE 
J100038C15TCGGCCCGNONE 
J100039C23TCGGCCCGNONE 
Os01g0672700AK121375TCTCGGCCCGDNA polymerase, beta-like region domain containing protein. 
J023127C22TCTCGGCCCGNONE 
J033092B05TCTCGGCCCGNONE 
J033129P21TCTCGGCCCGNONE 
J065079H18TCTCGGCCCGNONE 
Os01g0727400AK065692TTTCGGCCCGConserved hypothetical protein. 
Os01g0753800AK121555TCGGCCCGGCConserved hypothetical protein. 
J013075H19TCGGCCCGGCNONE 
J013130F24TCGGCCCGGCNONE 
J033033I01TCGGCCCGGCNONE 
Os01g0764600AK060621CGGATCGGGCCGAGFosfomycin resistance kinase FomA family protein. 
J013111L18CGGATCGGGCCGAGNONE 
J013134N08CGGATCGGGCCGAGNONE 
Os01g0853800006-033-H02CTCGGCCCGNONE 
006-037-A10CTCGGCCCGNONE 
006-038-F10CTCGGCCCGNONE 
006-054-E01CTCGGCCCGNONE 
006-067-E10CTCGGCCCGNONE 
012-015-G05CTCGGCCCGNONE 
AK069147CTCGGCCCGC2 calcium/lipid-binding region, CaLB domain containing protein. 
AK105929CTCGGCCCGNONE 
AK106144CTCGGCCCGNONE 
AK106186CTCGGCCCGNONE 
J023007P09CTCGGCCCGNONE 
J023007P10CTCGGCCCGNONE 
J065084L10CTCGGCCCGNONE 
J065179B10CTCGGCCCGNONE 
J065186D16CTCGGCCCGNONE 
J075040I08CTCGGCCCGNONE 
J075043K21CTCGGCCCGNONE 
J075051J08CTCGGCCCGNONE 
J075061D24CTCGGCCCGNONE 
J075095H04CTCGGCCCGNONE 
J075145J12CTCGGCCCGNONE 
J075148O18CTCGGCCCGNONE 
J075187J05CTCGGCCCGNONE 
J090042A20CTCGGCCCGNONE 
J100025K01CTCGGCCCGNONE 
Os01g0870100AK103428CTCGGCCCGCACGCCTCNONE 
Os01g0877500AK101067CTCGGCCCGProtein of unknown function UPF0054 family protein. 
Os01g0908400009-140-E01TCTCGGCCCGNONE 
AK062957TCTCGGCCCGConserved hypothetical protein. 
AK099301TCTCGGCCCGNONE 
J065123M13TCTCGGCCCGNONE 
J075020O14TCTCGGCCCGNONE 
J075136L21TCTCGGCCCGNONE 
Os01g0913800011-060-B02ATTGGGCCGGGCCGANONE 
016-088-H02ATTGGGCCGGGCCGAProtein prenyltransferase domain containing protein. 
Os01g0973400AK060011AGATGGGCCGGGCCGGGCCGAGCCGNONE 
AK068879AGATGGGCCGGGCCGGGCCGAGCCGConserved hypothetical protein 48 family protein. 
AK099210AGATGGGCCGGGCCGGGCCGAGCCGNONE 
AK104863AGATGGGCCGGGCCGGGCCGAGCCGNONE 
J013170C09AGATGGGCCGGGCCGGGCCGAGCCGNONE 
J033106K13AGATGGGCCGGGCCGGGCCGAGCCGNONE 
J075018P18AGATGGGCCGGGCCGGGCCGAGCCGNONE 
J075039C18AGATGGGCCGGGCCGGGCCGAGCCGNONE 
J075104L18AGATGGGCCGGGCCGGGCCGAGCCGNONE 
Os02g0115900AF006825ATCTCGGCCCGTTNONE 
AK065743ATCTCGGCCCGTTEndosperm lumenal binding protein. 
AK119653ATCTCGGCCCGTTNONE 
Os02g0149700AK103492CGGGCCGAGExo70 exocyst complex subunit family protein. 
Os02g0169000AK101628TCGGCCCGGCCCATGTConserved hypothetical protein. 
Os02g0193500009-092-G09CTCGGCCCGGCCCNONE 
AK101237CTCGGCCCGGCCCHypothetical protein. 
J033031K13CTCGGCCCGGCCCNONE 
J033034P12CTCGGCCCGGCCCNONE 
J080304L19CTCGGCCCGGCCCNONE 
J100059N21CTCGGCCCGGCCCNONE 
Os02g0266500AK100307TCGGCCCGSimilar to RASPBERRY3. 
Os02g0601800AB060276TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
AK099539TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
AK101873TCGGCCCGGGTGGGGCCCACGCCCAGATBromodomain containing protein. 
AK106801TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
AK121758TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
AK121891TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J013059H01TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J013092F08TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J013146J04TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J023001K12TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J023002H16TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J023013B10TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J023081I22TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J023084K19TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J023150E24TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J033023B18TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J033025F18TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J033048P08TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J033060M24TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J033070G06TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J033088P12TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J033105C13TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J043009N18TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J065103G21TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J075039H15TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090014K10TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090022N02TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090033F18TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090033I04TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090041F11TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090045P20TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090054B01TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090055M12TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090071K09TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090098O16TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090099P15TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J100050I16TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
Os02g0626100005-017-F11CTCGGCCCGCANONE 
AK058306CTCGGCCCGCANONE 
Os02g0741900009-042-A12CGGGCCGAGNONE 
AK068461CGGGCCGAGConserved hypothetical protein. 
J065203C15CGGGCCGAGNONE 
Os02g0792900AK068367TCGGCCCGGGTMS membrane protein/tumour differentially expressed protein family protein. 
AK104731TCGGCCCGGGNONE 
AK106174TCGGCCCGGGNONE 
AK119191TCGGCCCGGGNONE 
Os02g0814300AK111376CGGGCCGAAACytochrome c, monohaem domain containing protein. 
J065063I24CGGGCCGAAANONE 
Os02g0824400AK121390TCGGCCCGConserved hypothetical protein. 
J023128P21TCGGCCCGNONE 
J053097O16TCGGCCCGNONE 
J065012I02TCGGCCCGNONE 
J065049C06TCGGCCCGNONE 
J065051H02TCGGCCCGNONE 
J065069A13TCGGCCCGNONE 
J065082E04TCGGCCCGNONE 
J065102N09TCGGCCCGNONE 
J065157O10TCGGCCCGNONE 
J065188N23TCGGCCCGNONE 
J065190J11TCGGCCCGNONE 
J065202M09TCGGCCCGNONE 
Os02g0824500AK111296CGGGCCGASimilar to Remorin. 
J065048M11CGGGCCGANONE 
J065081F01CGGGCCGANONE 
Os02g0826200AK070787CTCGGCCCGdTDP-4-dehydrorhamnose reductase family protein. 
J075022D14CTCGGCCCGNONE 
Os03g0102200AK120183TCGGCCCGGCCCGGTSimilar to DNA-directed RNA polymerase II 14.5 kDa polypeptide (EC 2.7.7.6) (RPB9) (RPB14.5). 
J013034D10TCGGCCCGGCCCGGTNONE 
J065116C05TCGGCCCGGCCCGGTNONE 
J065120N21TCGGCCCGGCCCGGTNONE 
J090049D24TCGGCCCGGCCCGGTNONE 
Os03g0108000014-001-C09AACGGGCCGAGNONE 
AK102520AACGGGCCGAGSimilar to Dual specificity phosphatase Cdc25 (EC 3.1.3.48) (Arath;CDC25). 
J023083K07AACGGGCCGAGNONE 
J023110F13AACGGGCCGAGNONE 
J033095O09AACGGGCCGAGNONE 
J065219M15AACGGGCCGAGNONE 
J075009G03AACGGGCCGAGNONE 
J080301C17AACGGGCCGAGNONE 
J080301I02AACGGGCCGAGNONE 
J080301O05AACGGGCCGAGNONE 
J080305C08AACGGGCCGAGNONE 
J080305D11AACGGGCCGAGNONE 
J080311B05AACGGGCCGAGNONE 
J080316A17AACGGGCCGAGNONE 
J080317K12AACGGGCCGAGNONE 
J100087M06AACGGGCCGAGNONE 
Os03g0133300AK064510TGTTGGGCCGGGCCGAConserved hypothetical protein. 
Os03g0157700015-011-D01CGCGCGACGCGGGCCGAGNONE 
AK102075CGCGCGACGCGGGCCGAGProtein of unknown function DUF639 family protein. 
AK106245CGCGCGACGCGGGCCGAGNONE 
J075144I02CGCGCGACGCGGGCCGAGNONE 
Os03g0162200009-031-E05CGGGCCGANONE 
013-049-D04CGGGCCGANONE 
013-082-E03CGGGCCGANONE 
014-039-G04CGGGCCGANONE 
014-098-G11CGGGCCGANONE 
AK061605CGGGCCGANONE 
AK121533CGGGCCGASimilar to Histone H2A. 
J033024D06CGGGCCGANONE 
J033030P21CGGGCCGANONE 
J065063C20CGGGCCGANONE 
J065064A18CGGGCCGANONE 
J065147G02CGGGCCGANONE 
J065204K06CGGGCCGANONE 
J090004C22CGGGCCGANONE 
J090014K02CGGGCCGANONE 
J090074E10CGGGCCGANONE 
J090086L09CGGGCCGANONE 
Os03g0171700J065192H12TCGGCCCGBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
Os03g0277500014-019-A09CTCGGCCCGNONE 
AK063650CTCGGCCCGGlyoxalase/bleomycin resistance protein/dioxygenase domain containing protein. 
J065043F18CTCGGCCCGNONE 
J065092A08CTCGGCCCGNONE 
J065122E17CTCGGCCCGNONE 
J065182K12CTCGGCCCGNONE 
J065197H15CTCGGCCCGNONE 
J075115A05CTCGGCCCGNONE 
Os03g0302700006-099-F12ATCTCGGCCCGNONE 
AK112010ATCTCGGCCCGZinc finger, RING-type domain containing protein. 
AK121656ATCTCGGCCCGNONE 
J075090A19ATCTCGGCCCGNONE 
J075148M06ATCTCGGCCCGNONE 
Os03g0338600AK066604AACGGGCCGAtRNA pseudouridine synthase family protein. 
Os03g0340700011-070-H05CGGGCCGAGTTGGGCCTANONE 
AK100470CGGGCCGAGTTGGGCCTATetratricopeptide-like helical domain containing protein. 
J013158I08CGGGCCGAGTTGGGCCTANONE 
J023009H24CGGGCCGAGTTGGGCCTANONE 
J023031L20CGGGCCGAGTTGGGCCTANONE 
J023093E24CGGGCCGAGTTGGGCCTANONE 
J023105J11CGGGCCGAGTTGGGCCTANONE 
J100059O05CGGGCCGAGTTGGGCCTANONE 
J100075G03CGGGCCGAGTTGGGCCTANONE 
J100086J06CGGGCCGAGTTGGGCCTANONE 
Os03g0383100AK107106CCCGGGCCGAAAConserved hypothetical protein. 
Os03g0654800013-068-E05TCGGCCCGNONE 
AK103330TCGGCCCGHypothetical protein. 
J033125N05TCGGCCCGNONE 
J065171F15TCGGCCCGNONE 
J100056J05TCGGCCCGNONE 
J100069D02TCGGCCCGNONE 
Os03g0668900AK108369TCGGCCCGConserved hypothetical protein. 
Os03g0701900AK068404TTTCGGCCCGConserved hypothetical protein. 
Os03g0703300016-074-H01CTCGGCCCGGANONE 
AK073831CTCGGCCCGGACalponin-like actin-binding domain containing protein. 
Os03g0737600014-094-E01TACTGGGCCGGGCCGANONE 
AB038234TACTGGGCCGGGCCGANONE 
AK101854TACTGGGCCGGGCCGACyclin H-1. 
AK105468TACTGGGCCGGGCCGANONE 
J033069N12TACTGGGCCGGGCCGANONE 
J043017A22TACTGGGCCGGGCCGANONE 
J065154A20TACTGGGCCGGGCCGANONE 
Os03g0740700011-093-H12CGGGCCGATGGGCCGANONE 
AK102723CGGGCCGATGGGCCGAProtein similar to CwfJ, C-terminal 1 domain containing protein. 
J013059N19CGGGCCGATGGGCCGANONE 
J013126N16CGGGCCGATGGGCCGANONE 
J033105J16CGGGCCGATGGGCCGANONE 
J090059D19CGGGCCGATGGGCCGANONE 
Os03g0748500AK110695TCCGGGCCGAANONE 
Os03g0758800AJ252135CGGGCCGAGCCGAATGGGCCGGCNONE 
AJ312906CGGGCCGAGCCGAATGGGCCGGCNONE 
AK060387CGGGCCGAGCCGAATGGGCCGGCSimilar to Eukaryotic translation initiation factor 5A-2 (eIF-5A-2) (eIF-4D). 
AK121592CGGGCCGAGCCGAATGGGCCGGCNONE 
J023109G09CGGGCCGAGCCGAATGGGCCGGCNONE 
J033038B14CGGGCCGAGCCGAATGGGCCGGCNONE 
J043013C09CGGGCCGAGCCGAATGGGCCGGCNONE 
J053096E21CGGGCCGAGCCGAATGGGCCGGCNONE 
J065026B08CGGGCCGAGCCGAATGGGCCGGCNONE 
J065062B16CGGGCCGAGCCGAATGGGCCGGCNONE 
J065066E03CGGGCCGAGCCGAATGGGCCGGCNONE 
J065091J12CGGGCCGAGCCGAATGGGCCGGCNONE 
J065164A06CGGGCCGAGCCGAATGGGCCGGCNONE 
J075014I20CGGGCCGAGCCGAATGGGCCGGCNONE 
J075117N07CGGGCCGAGCCGAATGGGCCGGCNONE 
J075142M03CGGGCCGAGCCGAATGGGCCGGCNONE 
J075175D04CGGGCCGAGCCGAATGGGCCGGCNONE 
J075188M01CGGGCCGAGCCGAATGGGCCGGCNONE 
J075199I20CGGGCCGAGCCGAATGGGCCGGCNONE 
J090010J12CGGGCCGAGCCGAATGGGCCGGCNONE 
J090025O16CGGGCCGAGCCGAATGGGCCGGCNONE 
J090041H05CGGGCCGAGCCGAATGGGCCGGCNONE 
J090078P07CGGGCCGAGCCGAATGGGCCGGCNONE 
J100031K10CGGGCCGAGCCGAATGGGCCGGCNONE 
J100055F23CGGGCCGAGCCGAATGGGCCGGCNONE 
J100064G05CGGGCCGAGCCGAATGGGCCGGCNONE 
J100080C24CGGGCCGAGCCGAATGGGCCGGCNONE 
J100080O07CGGGCCGAGCCGAATGGGCCGGCNONE 
J100090F01CGGGCCGAGCCGAATGGGCCGGCNONE 
Os03g0846400AK067706GCAGCCCATGGGCCGGATCGGCCCGGCNONE 
AK070549GCAGCCCATGGGCCGGATCGGCCCGGCPeptidase, trypsin-like serine and cysteine domain containing protein. 
Os04g0206200015-013-E04CCCGGGCCGANONE 
AK109506CCCGGGCCGANONE 
AK110950CCCGGGCCGANONE 
Os04g0418000006-025-C05CGGGCCGAAANONE 
006-025-D11CGGGCCGAAANONE 
006-045-F02CGGGCCGAAANONE 
006-060-B04CGGGCCGAAANONE 
006-063-E03CGGGCCGAAANONE 
006-070-G08CGGGCCGAAANONE 
006-072-H05CGGGCCGAAANONE 
AK061030CGGGCCGAAANONE 
AK099124CGGGCCGAAANONE 
AK106155CGGGCCGAAAConserved hypothetical protein. 
AK119714CGGGCCGAAANONE 
J023039I07CGGGCCGAAANONE 
J065025N03CGGGCCGAAANONE 
Os04g0436100AK072631TCTCGGCCCGPhenylacetic acid degradation-related protein domain containing protein. 
J023132I18TCTCGGCCCGNONE 
J065112K15TCTCGGCCCGNONE 
J065138F04TCTCGGCCCGNONE 
J075078D03TCTCGGCCCGNONE 
J090090K17TCTCGGCCCGNONE 
Os04g0449000016-008-B09CGGGCCGAANONE 
AK106468CGGGCCGAAMitochondrial substrate carrier family protein. 
Os04g0476400J033082D17TTTCGGCCCGNONE 
Os04g0486400AJ535489GGGCCGGGCCGGGCCGAANONE 
AK103296GGGCCGGGCCGGGCCGAARML1 protein. 
J013045L03GGGCCGGGCCGGGCCGAANONE 
J013045M03GGGCCGGGCCGGGCCGAANONE 
J033034L24GGGCCGGGCCGGGCCGAANONE 
J033125B02GGGCCGGGCCGGGCCGAANONE 
J075001G08GGGCCGGGCCGGGCCGAANONE 
J075011I16GGGCCGGGCCGGGCCGAANONE 
J075033M08GGGCCGGGCCGGGCCGAANONE 
J075044G01GGGCCGGGCCGGGCCGAANONE 
J075047D04GGGCCGGGCCGGGCCGAANONE 
J075061J09GGGCCGGGCCGGGCCGAANONE 
J075085L07GGGCCGGGCCGGGCCGAANONE 
J075087D20GGGCCGGGCCGGGCCGAANONE 
J075117A04GGGCCGGGCCGGGCCGAANONE 
J075134H06GGGCCGGGCCGGGCCGAANONE 
J075184J12GGGCCGGGCCGGGCCGAANONE 
Os04g0490700AK072099CGGGCCGAConserved hypothetical protein. 
J065140P05CGGGCCGANONE 
J100055M05CGGGCCGANONE 
J100071P15CGGGCCGANONE 
Os04g0491500AK068089TTTCGGCCCGGCCCAACCNONE 
AK101116TTTCGGCCCGGCCCAACCTGF-beta receptor, type I/II extracellular region family protein. 
Os04g0542900AK068610TTCGGCCCGGTConserved hypothetical protein. 
Os04g0591000006-090-E02AACGGGCCGAANONE 
AK072902AACGGGCCGAARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J065061E23AACGGGCCGAANONE 
Os04g0627000AK101563TCCGGGCCGAGANONE 
Os04g0659400AK070174CTCGGCCCGGAENT domain containing protein. 
Os04g0683800011-050-B05CTCGGCCCGGCCCNONE 
AK073897CTCGGCCCGGCCCSimilar to Phosphoribosyltransferase (Fragment). 
AK102910CTCGGCCCGGCCCNONE 
J033075A06CTCGGCCCGGCCCNONE 
J033079F23CTCGGCCCGGCCCNONE 
J033093D20CTCGGCCCGGCCCNONE 
J033099B18CTCGGCCCGGCCCNONE 
J033129G13CTCGGCCCGGCCCNONE 
J065075F21CTCGGCCCGGCCCNONE 
J065093M19CTCGGCCCGGCCCNONE 
J075023K10CTCGGCCCGGCCCNONE 
J075046J08CTCGGCCCGGCCCNONE 
J090003I20CTCGGCCCGGCCCNONE 
J090017L12CTCGGCCCGGCCCNONE 
J090024B04CTCGGCCCGGCCCNONE 
J090033A20CTCGGCCCGGCCCNONE 
J090083F02CTCGGCCCGGCCCNONE 
Os05g0169400AK073439GCTGGGCCGGATCGGGCCGAProtein of unknown function DUF1421 family protein. 
J013110E15GCTGGGCCGGATCGGGCCGANONE 
J033044H02GCTGGGCCGGATCGGGCCGANONE 
Os05g0194600AK102487TTTCGGCCCGPeptidase M22, O-sialoglycoprotein endopeptidase family protein. 
J100032M01TTTCGGCCCGNONE 
J100041A08TTTCGGCCCGNONE 
Os05g0241400AK107803CGGGCCGAConserved hypothetical protein. 
Os05g0304200009-059-H05TCGGCCCGTTNONE 
AK099372TCGGCCCGTTNONE 
AK112073TCGGCCCGTTPAP fibrillin family protein. 
Os05g0328000AK107977TCTGGCCCGTTCGGCCCGConserved hypothetical protein. 
AK107977TTTCGGCCCGGAConserved hypothetical protein. 
J065005I02TCTGGCCCGTTCGGCCCGNONE 
J065005I02TTTCGGCCCGGANONE 
J065049M05TCTGGCCCGTTCGGCCCGNONE 
J065049M05TTTCGGCCCGGANONE 
J080005F01TCTGGCCCGTTCGGCCCGNONE 
J080005F01TTTCGGCCCGGANONE 
J080005H15TCTGGCCCGTTCGGCCCGNONE 
J080005H15TTTCGGCCCGGANONE 
J080005K23TCTGGCCCGTTCGGCCCGNONE 
J080005K23TTTCGGCCCGGANONE 
J080007O03TCTGGCCCGTTCGGCCCGNONE 
J080007O03TTTCGGCCCGGANONE 
J080013H09TCTGGCCCGTTCGGCCCGNONE 
J080013H09TTTCGGCCCGGANONE 
J080024C02TCTGGCCCGTTCGGCCCGNONE 
J080024C02TTTCGGCCCGGANONE 
J080026M22TCTGGCCCGTTCGGCCCGNONE 
J080026M22TTTCGGCCCGGANONE 
J080029K21TCTGGCCCGTTCGGCCCGNONE 
J080029K21TTTCGGCCCGGANONE 
J080032K04TCTGGCCCGTTCGGCCCGNONE 
J080032K04TTTCGGCCCGGANONE 
J080034M16TCTGGCCCGTTCGGCCCGNONE 
J080034M16TTTCGGCCCGGANONE 
J080037G11TCTGGCCCGTTCGGCCCGNONE 
J080037G11TTTCGGCCCGGANONE 
J080040L01TCTGGCCCGTTCGGCCCGNONE 
J080040L01TTTCGGCCCGGANONE 
J080041D13TCTGGCCCGTTCGGCCCGNONE 
J080041D13TTTCGGCCCGGANONE 
J080043G20TCTGGCCCGTTCGGCCCGNONE 
J080043G20TTTCGGCCCGGANONE 
J080046H17TCTGGCCCGTTCGGCCCGNONE 
J080046H17TTTCGGCCCGGANONE 
J080048A05TCTGGCCCGTTCGGCCCGNONE 
J080048A05TTTCGGCCCGGANONE 
J080064C21TCTGGCCCGTTCGGCCCGNONE 
J080064C21TTTCGGCCCGGANONE 
J080067E15TCTGGCCCGTTCGGCCCGNONE 
J080067E15TTTCGGCCCGGANONE 
J080071P05TCTGGCCCGTTCGGCCCGNONE 
J080071P05TTTCGGCCCGGANONE 
J080074H16TCTGGCCCGTTCGGCCCGNONE 
J080074H16TTTCGGCCCGGANONE 
J080076A18TCTGGCCCGTTCGGCCCGNONE 
J080076A18TTTCGGCCCGGANONE 
J080076D20TCTGGCCCGTTCGGCCCGNONE 
J080076D20TTTCGGCCCGGANONE 
J080077J15TCTGGCCCGTTCGGCCCGNONE 
J080077J15TTTCGGCCCGGANONE 
J080085J11TCTGGCCCGTTCGGCCCGNONE 
J080085J11TTTCGGCCCGGANONE 
J080086E08TCTGGCCCGTTCGGCCCGNONE 
J080086E08TTTCGGCCCGGANONE 
J080088I23TCTGGCCCGTTCGGCCCGNONE 
J080088I23TTTCGGCCCGGANONE 
J080088I24TCTGGCCCGTTCGGCCCGNONE 
J080088I24TTTCGGCCCGGANONE 
J080089D05TCTGGCCCGTTCGGCCCGNONE 
J080089D05TTTCGGCCCGGANONE 
J080093B04TCTGGCCCGTTCGGCCCGNONE 
J080093B04TTTCGGCCCGGANONE 
J080093D07TCTGGCCCGTTCGGCCCGNONE 
J080093D07TTTCGGCCCGGANONE 
J080094A09TCTGGCCCGTTCGGCCCGNONE 
J080094A09TTTCGGCCCGGANONE 
J080096I12TCTGGCCCGTTCGGCCCGNONE 
J080096I12TTTCGGCCCGGANONE 
J080097L23TCTGGCCCGTTCGGCCCGNONE 
J080097L23TTTCGGCCCGGANONE 
Os05g0361900006-033-D04CTCGGCCCGGTNONE 
AK060107CTCGGCCCGGTMitochondrial substrate carrier family protein. 
AK104602CTCGGCCCGGTNONE 
AK104747CTCGGCCCGGTNONE 
J033133L03CTCGGCCCGGTNONE 
J080001O06CTCGGCCCGGTNONE 
J080004F05CTCGGCCCGGTNONE 
J080005D12CTCGGCCCGGTNONE 
J080008G19CTCGGCCCGGTNONE 
J080015D10CTCGGCCCGGTNONE 
J080015H22CTCGGCCCGGTNONE 
J080016K15CTCGGCCCGGTNONE 
J080018D12CTCGGCCCGGTNONE 
J080020A01CTCGGCCCGGTNONE 
J080027A09CTCGGCCCGGTNONE 
J080032F05CTCGGCCCGGTNONE 
J080039D09CTCGGCCCGGTNONE 
J080043J19CTCGGCCCGGTNONE 
J080052G22CTCGGCCCGGTNONE 
J080052M15CTCGGCCCGGTNONE 
J080053D22CTCGGCCCGGTNONE 
J080061I18CTCGGCCCGGTNONE 
J080064O14CTCGGCCCGGTNONE 
J080075K01CTCGGCCCGGTNONE 
J080082I02CTCGGCCCGGTNONE 
J080095C14CTCGGCCCGGTNONE 
J100028N14CTCGGCCCGGTNONE 
Os05g0393800AK069074CGGGCCGAGProtein of unknown function DUF221 domain containing protein. 
Os05g0400800AK065701TGCGGGCCGAASimilar to 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase, chloroplast precursor (EC 5.3.1.16) (Phosphoribosylformimino-5-aminoimidazole carboxamide ribotide isomerase) (5-proFAR isomerase) (BBM II). 
Os05g0409400AK102597CGGGCCGACCGTTGMAP65/ASE1 family protein. 
Os05g0494600AK108158TCCGGGCCGAConserved hypothetical protein. 
Os06g0138500015-050-C10CGGGCCGAANONE 
AK066485CGGGCCGAAConserved hypothetical protein. 
AK069536CGGGCCGAANONE 
J023022B22CGGGCCGAANONE 
J075190L15CGGGCCGAANONE 
J100024C08CGGGCCGAANONE 
J100025K15CGGGCCGAANONE 
J100037C14CGGGCCGAANONE 
J100078F18CGGGCCGAANONE 
J100079N15CGGGCCGAANONE 
Os06g0157800AK121504CTCGGCCCGCASimilar to CG7224 (Fragment). 
AK121504TCGGCCCGGCCCAGTTSimilar to CG7224 (Fragment). 
J033022L20CTCGGCCCGCANONE 
J033022L20TCGGCCCGGCCCAGTTNONE 
J075033D09CTCGGCCCGCANONE 
J075033D09TCGGCCCGGCCCAGTTNONE 
Os06g0220500011-038-H05CGGGCCGANONE 
011-086-F05CGGGCCGANONE 
AK063324CGGGCCGAUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
J100040M16CGGGCCGANONE 
Os06g0648200009-150-E06CTCGGCCCGTTNONE 
014-034-H10CTCGGCCCGTTNONE 
015-035-E11CTCGGCCCGTTNONE 
AK063001CTCGGCCCGTTNONE 
AK063675CTCGGCCCGTTNONE 
AK106303CTCGGCCCGTTConserved hypothetical protein. 
Os06g0711600016-047-G09TTCGGCCCGGTNONE 
AK064384TTCGGCCCGGTmRNA splicing factor SYF2 family protein. 
AK102831TTCGGCCCGGTNONE 
J013072P18TTCGGCCCGGTNONE 
J023049G01TTCGGCCCGGTNONE 
J023088I01TTCGGCCCGGTNONE 
J033023I22TTCGGCCCGGTNONE 
J033106I12TTCGGCCCGGTNONE 
J033109G07TTCGGCCCGGTNONE 
J065030F22TTCGGCCCGGTNONE 
J065132H19TTCGGCCCGGTNONE 
J080301D07TTCGGCCCGGTNONE 
J080305C09TTCGGCCCGGTNONE 
J080312C03TTCGGCCCGGTNONE 
J080313I15TTCGGCCCGGTNONE 
J080315B09TTCGGCCCGGTNONE 
J090056N21TTCGGCCCGGTNONE 
J100027B07TTCGGCCCGGTNONE 
Os07g0184900AK102066TCGGCCCGTGGGCCGTGTTGGGCCGAGGCCCACGTGGGAGTGGGAAGGCCCACGCACCGCSimilar to Ku70-like protein. 
Os07g0258400AK121534CTCGGCCCGGCCCACCTNONE 
L41217CTCGGCCCGGCCCACCTNONE 
S81897CTCGGCCCGGCCCACCTOsNramp1 (Integral membrane protein). 
Os07g0499800AK120716TCGGCCCGZinc finger, RING-type domain containing protein. 
Os07g0504601J065068H15GGGCTTTTTTTCGGCCCGCAConserved hypothetical protein. 
J065095H08GGGCTTTTTTTCGGCCCGCANONE 
Os07g0573400006-035-G11CCCGGGCCGAGNONE 
AK061739CCCGGGCCGAGNONE 
AK065116CCCGGGCCGAGNONE 
AK102732CCCGGGCCGAGProtein of unknown function DUF239, plant domain containing protein. 
AK119637CCCGGGCCGAGNONE 
AK121705CCCGGGCCGAGNONE 
Os07g0573600AK073925GTTTGGGCCGGGCCGAAAREX1 DNA Repair family protein. 
J033072E11GTTTGGGCCGGGCCGAAANONE 
Os07g0578600AK067155TTCGGCCCGGCCCACTCCSimilar to 5-formyltetrahydrofolate cycloligase (EC 6.3.3.2). 
AK106065TTCGGCCCGGCCCACTCCNONE 
Os07g0594400J065137M02ACGTGGGCTTGGGCCACGGGCCGAConserved hypothetical protein. 
J065218E03ACGTGGGCTTGGGCCACGGGCCGANONE 
Os07g0639900J080305F09TCGTGGGCCGGGCCGGGCCGGGCCGAANONE 
J080305J22TCGTGGGCCGGGCCGGGCCGGGCCGAAThymidylate kinase domain containing protein. 
J080311G07TCGTGGGCCGGGCCGGGCCGGGCCGAANONE 
J080315B14TCGTGGGCCGGGCCGGGCCGGGCCGAANONE 
J080317C02TCGTGGGCCGGGCCGGGCCGGGCCGAANONE 
Os08g0206600AK064336TCGGCCCGGTAICARFT/IMPCHase bienzyme family protein. 
AK102764TCGGCCCGGTNONE 
Os08g0379400006-033-C10CGGGCCGAGATNONE 
006-112-H05CGGGCCGAGATNONE 
AK069608CGGGCCGAGATSimilar to Quinone oxidoreductase-like protein. 
AK104318CGGGCCGAGATNONE 
AK109433CGGGCCGAGATNONE 
AK112013CGGGCCGAGATNONE 
J065163C05CGGGCCGAGATNONE 
Os08g0411200AK120890TTCGGCCCGCASAM (and some other nucleotide) binding motif domain containing protein. 
Os08g0441400011-033-F01CGGGCCGAGANONE 
015-084-B04CGGGCCGAGANONE 
AK063317CGGGCCGAGANONE 
AK064141CGGGCCGAGAConserved hypothetical protein. 
J065060F06CGGGCCGAGANONE 
J075110A22CGGGCCGAGANONE 
J080307P11CGGGCCGAGANONE 
J090041E06CGGGCCGAGANONE 
Os08g0549300009-008-F01TCGGCCCGNONE 
009-033-G10TCGGCCCGNONE 
AK120938TCGGCCCGSimilar to Acyl carrier protein III, chloroplast precursor (ACP III). 
D10420TCGGCCCGNONE 
J023037A21TCGGCCCGNONE 
J023066D20TCGGCCCGNONE 
J033099K13TCGGCCCGNONE 
J065116C14TCGGCCCGNONE 
J075009K15TCGGCCCGNONE 
J075071P13TCGGCCCGNONE 
J075080D18TCGGCCCGNONE 
J075124F24TCGGCCCGNONE 
J075198F23TCGGCCCGNONE 
J080006B15TCGGCCCGNONE 
J090078H13TCGGCCCGNONE 
J090089J09TCGGCCCGNONE 
J100017A03TCGGCCCGNONE 
J100023G03TCGGCCCGNONE 
Os09g0241200AK120155TCGGCCCGGTConserved hypothetical protein. 
J013030A17TCGGCCCGGTNONE 
Os09g0243200AK107718TCCGGGCCGAAZinc finger, RING-type domain containing protein. 
Os09g0261300AK059648TTTCGGCCCGCASimilar to 4-nitrophenylphosphatase-like protein. 
AK121797TTTCGGCCCGCANONE 
J033095P18TTTCGGCCCGCANONE 
J043039L01TTTCGGCCCGCANONE 
J065153N19TTTCGGCCCGCANONE 
Os09g0329800AK069775CGGGCCGATGGGCCAGGCCCConserved hypothetical protein. 
Os09g0329900Os09g0329900CGGGCCGATGGGCCAGGCCCNONE 
Os09g0338400AK059171AACGGGCCGAANONE 
AK068798AACGGGCCGAANONE 
AK072043AACGGGCCGAANONE 
AK098947AACGGGCCGAASimilar to Cysteine desulfurase, mitochondrial precursor (EC 2.8.1.7) (m-Nfs1). 
Os09g0450700AK067088TCGGCCCGConserved hypothetical protein. 
J013094N24TCGGCCCGNONE 
J033034O19TCGGCCCGNONE 
J065019O16TCGGCCCGNONE 
J065080P17TCGGCCCGNONE 
J065082O14TCGGCCCGNONE 
Os09g0533600AK070024ACCGGGCCGASimilar to Avr9/Cf-9 induced kinase 1. 
Os09g0533900003-104-E05TCGGCCCGNONE 
012-076-C03TCGGCCCGNONE 
AK067774TCGGCCCGNONE 
AK100449TCGGCCCGSimilar to CEL5=CELLULASE 5 (Fragment). 
J013048F07TCGGCCCGNONE 
J023026E11TCGGCCCGNONE 
J023028B20TCGGCCCGNONE 
J023050P11TCGGCCCGNONE 
J023052K08TCGGCCCGNONE 
J023075J03TCGGCCCGNONE 
J023078E15TCGGCCCGNONE 
J023090P12TCGGCCCGNONE 
J023120E01TCGGCCCGNONE 
J023142K01TCGGCCCGNONE 
J033027K23TCGGCCCGNONE 
J033058A09TCGGCCCGNONE 
J033058C12TCGGCCCGNONE 
J033125A04TCGGCCCGNONE 
J043040L01TCGGCCCGNONE 
J053061D06TCGGCCCGNONE 
J053096N13TCGGCCCGNONE 
J065193H10TCGGCCCGNONE 
J090075L17TCGGCCCGNONE 
J100050D10TCGGCCCGNONE 
Os11g0115800AK106102TCGGCCCGTTConserved hypothetical protein. 
J065057N13TCGGCCCGTTNONE 
Os11g0130300AK059597TTCGGCCCGCANse1 non-SMC component of SMC5-6 complex family protein. 
AK101224TTCGGCCCGCANONE 
J033031D09TTCGGCCCGCANONE 
J033135B02TTCGGCCCGCANONE 
J100021A17TTCGGCCCGCANONE 
J100066G09TTCGGCCCGCANONE 
Os11g0146700AK065900CGGGCCGAANONE 
AK072412CGGGCCGAARED-like, C-terminal family protein. 
Os11g0484300AK121422AAATGGGCCGGGCCGAGGCCCAAASimilar to Mcm2-prov protein. 
Os11g0544600AK064128CTCGGCCCGGCCCGGCCCGGCCConserved hypothetical protein. 
J075118L07CTCGGCCCGGCCCGGCCCGGCCNONE 
Os11g0586300AK072257TCGGCCCGGCCCACGTConserved hypothetical protein. 
Os11g0620300AJ704770CGGGCCGAAANONE 
AK107901CGGGCCGAAASimilar to Nonspecific lipid-transfer protein 2 (LTP 2). 
J075006M12CGGGCCGAAANONE 
J075046J22CGGGCCGAAANONE 
Os12g0150100009-047-B11ACCGGGCCGAAANONE 
AK105075ACCGGGCCGAAASimilar to 60S ribosomal protein L26A. 
J013067G22ACCGGGCCGAAANONE 
J033103F08ACCGGGCCGAAANONE 
J065029P11ACCGGGCCGAAANONE 
J065043B18ACCGGGCCGAAANONE 
J065123E16ACCGGGCCGAAANONE 
J065141O20ACCGGGCCGAAANONE 
J065161O04ACCGGGCCGAAANONE 
J065201M07ACCGGGCCGAAANONE 
J075058I23ACCGGGCCGAAANONE 
J075172J08ACCGGGCCGAAANONE 
J100040L13ACCGGGCCGAAANONE 
Os12g0182200009-110-C10CTCGGCCCGNONE 
AK069414CTCGGCCCGNONE 
Os12g0256300AK073908TTCGGCCCGGTSimilar to Schizosaccharomyces pombe (Fragment). 
AK099579TTCGGCCCGGTNONE 
Os12g0297500AK072331TCGGCCCGGlycoside hydrolase, starch-binding domain containing protein. 
Os12g0533500AK068646TCGGCCCGGCCCGGCCCAGAConserved hypothetical protein. 
J013158L10TCGGCCCGGCCCGGCCCAGANONE 
J065083J02TCGGCCCGGCCCGGCCCAGANONE 
J075079D02TCGGCCCGGCCCGGCCCAGANONE 
J100037H16TCGGCCCGGCCCGGCCCAGANONE 
J100075P13TCGGCCCGGCCCGGCCCAGANONE 
Os12g0554400AK072345TTCGGCCCGTetratricopeptide-like helical domain containing protein. 
Os12g0599900AK101252TCTCGGCCCGGCCTetratricopeptide region domain containing protein. 
J033032F05TCTCGGCCCGGCCNONE 
Os12g0601400009-057-A09TCGGCCCGNONE 
AK073361TCGGCCCGSimilar to Auxin-responsive protein (Aux/IAA) (Fragment). 
J065037G12TCGGCCCGNONE 
J065099K06TCGGCCCGNONE 
J065156F11TCGGCCCGNONE 
J100025G04TCGGCCCGNONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.