version

Summary of OsREG569 (All List)

OrganismOryza sativa  
IDOsREG569  
SequenceCGGGTCCC  
Annotation  
PPDB MotifGGGACCC  function unknown  
PLACE Motif 
Total Entry Count497  

Entry Sequences (497 entries)

LocusGene modelSequenceDescription
Os01g0104400006-026-B08GGGACCCGNONE 
006-030-C01GGGACCCGNONE 
006-055-E02GGGACCCGNONE 
006-061-B12GGGACCCGNONE 
006-064-F06GGGACCCGNONE 
006-078-G10GGGACCCGNONE 
006-079-G09GGGACCCGNONE 
006-080-B08GGGACCCGNONE 
006-100-E07GGGACCCGNONE 
006-110-E01GGGACCCGNONE 
006-118-D10GGGACCCGNONE 
006-120-C12GGGACCCGNONE 
AK060132GGGACCCGNONE 
AK071375GGGACCCGRicin B-related lectin domain containing protein. 
AK104555GGGACCCGNONE 
AK104820GGGACCCGNONE 
J023121J21GGGACCCGNONE 
Os01g0175100AK071289CGGGTCCCAKv1.4 voltage-gated K+ channel family protein. 
J023088B10CGGGTCCCANONE 
J065122H15CGGGTCCCANONE 
J065140B19CGGGTCCCANONE 
J100031E12CGGGTCCCANONE 
J100068J03CGGGTCCCANONE 
J100083E12CGGGTCCCANONE 
Os01g0506200AK073118CGGGTCCCTetratricopeptide-like helical domain containing protein. 
J065002A07CGGGTCCCNONE 
J065079J08CGGGTCCCNONE 
J065167M18CGGGTCCCNONE 
Os01g0564300AK064825CGGGTCCCPeptidylprolyl isomerase, FKBP-type domain containing protein. 
Os01g0681900AB008845GGGACCCGNADH dependent Glutamate Synthase precursor (EC 1.4.1.14). 
AK105755GGGACCCGNONE 
Os01g0757200AB092485GGGACCCGCGCNONE 
AK060666GGGACCCGCGCNONE 
AK060714GGGACCCGCGCNONE 
AK099350GGGACCCGCGCNONE 
AK101713GGGACCCGCGCSimilar to GA 2-oxidase 4. 
Os01g0850400AJ575220TGGGACCCGNONE 
AK108582TGGGACCCGSimilar to MYBY1 protein (Fragment). 
Os01g0885600AK059523CGGGTCCCEsterase/lipase/thioesterase domain containing protein. 
AK059523CGGGTCCCACEsterase/lipase/thioesterase domain containing protein. 
J065013G01CGGGTCCCNONE 
J065013G01CGGGTCCCACNONE 
J065063D03CGGGTCCCNONE 
J065063D03CGGGTCCCACNONE 
J065143H01CGGGTCCCNONE 
J065143H01CGGGTCCCACNONE 
J065146F08CGGGTCCCNONE 
J065146F08CGGGTCCCACNONE 
J065153D14CGGGTCCCNONE 
J065153D14CGGGTCCCACNONE 
J065170E02CGGGTCCCNONE 
J065170E02CGGGTCCCACNONE 
J065175M22CGGGTCCCNONE 
J065175M22CGGGTCCCACNONE 
J065186E13CGGGTCCCNONE 
J065186E13CGGGTCCCACNONE 
J075023J16CGGGTCCCNONE 
J075023J16CGGGTCCCACNONE 
J075176J06CGGGTCCCNONE 
J075176J06CGGGTCCCACNONE 
Os01g0908100AK072293CGGGTCCCACRabGAP/TBC domain containing protein. 
J065010B13CGGGTCCCACNONE 
J065010M12CGGGTCCCACNONE 
J065047C19CGGGTCCCACNONE 
J065069B18CGGGTCCCACNONE 
J065071K24CGGGTCCCACNONE 
J065142P04CGGGTCCCACNONE 
J065170E11CGGGTCCCACNONE 
Os02g0115900AF006825CGGGTCCCNONE 
AK065743CGGGTCCCEndosperm lumenal binding protein. 
AK119653CGGGTCCCNONE 
Os02g0521300AK120851GGGACCCGGCCCCGCGGGGGC2 domain containing protein. 
Os02g0530300014-069-H07CGGGTCCCNONE 
AK063708CGGGTCCCZinc finger, A20-type domain containing protein. 
Os02g0577900J065164K11GGGACCCGConserved hypothetical protein. 
Os02g0630000AK108631CGGGTCCCCyclin-like F-box domain containing protein. 
J075104C09CGGGTCCCNONE 
J075126N10CGGGTCCCNONE 
Os02g0672700AK059611CCCCCGCGGGGCCGGGTCCCDNA-directed RNA polymerase, subunit C11/M/9 family protein. 
AK059611GGGACCCGDNA-directed RNA polymerase, subunit C11/M/9 family protein. 
AK099179CCCCCGCGGGGCCGGGTCCCNONE 
AK099179GGGACCCGNONE 
J023098L23CCCCCGCGGGGCCGGGTCCCNONE 
J023098L23GGGACCCGNONE 
J065042J21CCCCCGCGGGGCCGGGTCCCNONE 
J065042J21GGGACCCGNONE 
J065187L09CCCCCGCGGGGCCGGGTCCCNONE 
J065187L09GGGACCCGNONE 
J065190O10CCCCCGCGGGGCCGGGTCCCNONE 
J065190O10GGGACCCGNONE 
J080041G14CCCCCGCGGGGCCGGGTCCCNONE 
J080041G14GGGACCCGNONE 
J080078K08CCCCCGCGGGGCCGGGTCCCNONE 
J080078K08GGGACCCGNONE 
J080089D20CCCCCGCGGGGCCGGGTCCCNONE 
J080089D20GGGACCCGNONE 
J080094D04CCCCCGCGGGGCCGGGTCCCNONE 
J080094D04GGGACCCGNONE 
Os02g0677300006-102-D12CGGGTCCCNONE 
AK060550CGGGTCCCNONE 
AK106041CGGGTCCCSimilar to CRT/DRE binding factor 1. 
Os02g0686700AK111294AGCCCACAGACAGGTGGGACCCGProtein of unknown function DUF581 family protein. 
Os02g0705500006-032-F08GGGACCCGNONE 
AK073952GGGACCCGNONE 
AK119183GGGACCCGBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
Os02g0753800AK101787CGGGTCCCACCSimilar to Annexin p35. 
Os02g0754500AK069965CGGGTCCCACNONE 
AK105696CGGGTCCCACAmidase family protein. 
Os03g0143000AK073102TGAGGGACCCGSAM (and some other nucleotide) binding motif domain containing protein. 
J033051I24TGAGGGACCCGNONE 
Os03g0218300015-078-G09CGGGTCCCConserved hypothetical protein. 
J090095I10CGGGTCCCNONE 
Os03g0255900009-164-C12GGGACCCGNONE 
AK063057GGGACCCGConserved hypothetical protein. 
Os03g0321900AK073317GGGACCCGGCCGGCCCCMP/dCMP deaminase, zinc-binding domain containing protein. 
Os03g0341600AK067497CGGGTCCCConserved hypothetical protein. 
Os03g0372900AK100417TGAGGGACCCGCyclin-like F-box domain containing protein. 
Os03g0418700AK099879GTGGGACCCGNONE 
AK101797GTGGGACCCGConserved hypothetical protein. 
Os03g0576900AK071314GGGCCGGGTCCCAmino acid/polyamine transporter I family protein. 
J023074L08GGGCCGGGTCCCNONE 
J023084D13GGGCCGGGTCCCNONE 
J080011C14GGGCCGGGTCCCNONE 
J080012F24GGGCCGGGTCCCNONE 
J080018M05GGGCCGGGTCCCNONE 
J080021G05GGGCCGGGTCCCNONE 
J080021N18GGGCCGGGTCCCNONE 
J080023E19GGGCCGGGTCCCNONE 
J080024H14GGGCCGGGTCCCNONE 
J080025E15GGGCCGGGTCCCNONE 
J080038F19GGGCCGGGTCCCNONE 
J080044N09GGGCCGGGTCCCNONE 
J080054D05GGGCCGGGTCCCNONE 
J080057J16GGGCCGGGTCCCNONE 
J080060A05GGGCCGGGTCCCNONE 
J080061M12GGGCCGGGTCCCNONE 
J080063H13GGGCCGGGTCCCNONE 
J080065O04GGGCCGGGTCCCNONE 
J080066I17GGGCCGGGTCCCNONE 
J080066J06GGGCCGGGTCCCNONE 
J080089J22GGGCCGGGTCCCNONE 
J080090I03GGGCCGGGTCCCNONE 
J080091J23GGGCCGGGTCCCNONE 
J080091K20GGGCCGGGTCCCNONE 
J080093G24GGGCCGGGTCCCNONE 
J080094I08GGGCCGGGTCCCNONE 
J080096A17GGGCCGGGTCCCNONE 
J090051G12GGGCCGGGTCCCNONE 
Os03g0581800009-177-G11TGAGGGACCCGNONE 
AK059201TGAGGGACCCGNONE 
AK121839TGAGGGACCCGHypothetical protein. 
J023022K06TGAGGGACCCGNONE 
J023110K21TGAGGGACCCGNONE 
J033100N18TGAGGGACCCGNONE 
J033120D11TGAGGGACCCGNONE 
J065044P15TGAGGGACCCGNONE 
J065102G22TGAGGGACCCGNONE 
J065149N14TGAGGGACCCGNONE 
J065201L18TGAGGGACCCGNONE 
J065205K10TGAGGGACCCGNONE 
J075035D19TGAGGGACCCGNONE 
J075073E06TGAGGGACCCGNONE 
J075134M11TGAGGGACCCGNONE 
J090004P12TGAGGGACCCGNONE 
J090070H20TGAGGGACCCGNONE 
J090087B04TGAGGGACCCGNONE 
J100028F10TGAGGGACCCGNONE 
J100036M18TGAGGGACCCGNONE 
J100065C24TGAGGGACCCGNONE 
J100080O13TGAGGGACCCGNONE 
Os03g0736300AK104929GGGACCCGTGGGGCNONE 
Os03g0780500005-002-D07TGGGACCCGNONE 
AK061643TGGGACCCGSimilar to Inosine-5'-monophosphate dehydrogenase (EC 1.1.1.205) (IMP dehydrogenase) (IMPDH) (IMPD). 
Os03g0844800AK071813GGCCGTGGGACCCGCGCConserved hypothetical protein. 
J023114B14GGCCGTGGGACCCGCGCNONE 
Os04g0556300009-065-A04GGGACCCGNONE 
009-124-C05GGGACCCGNONE 
AK062772GGGACCCGGlutathione peroxidase. 
AY100689GGGACCCGNONE 
J065008N06GGGACCCGNONE 
J065012C13GGGACCCGNONE 
J065017J06GGGACCCGNONE 
J065033M15GGGACCCGNONE 
J065086O21GGGACCCGNONE 
J065102K04GGGACCCGNONE 
J065141D21GGGACCCGNONE 
J065159K20GGGACCCGNONE 
J065164C12GGGACCCGNONE 
J065170F10GGGACCCGNONE 
J065181F20GGGACCCGNONE 
J065205N07GGGACCCGNONE 
J065209N21GGGACCCGNONE 
J075001M12GGGACCCGNONE 
J075007D22GGGACCCGNONE 
J075026H04GGGACCCGNONE 
J075042O08GGGACCCGNONE 
J075044G20GGGACCCGNONE 
J075057D10GGGACCCGNONE 
J075096L23GGGACCCGNONE 
J075104K12GGGACCCGNONE 
J075119H14GGGACCCGNONE 
J075136C14GGGACCCGNONE 
J075172D01GGGACCCGNONE 
J075184M01GGGACCCGNONE 
J075186E06GGGACCCGNONE 
J075192M08GGGACCCGNONE 
J080006D18GGGACCCGNONE 
J080044G16GGGACCCGNONE 
J080087G15GGGACCCGNONE 
J100021I05GGGACCCGNONE 
J100039D10GGGACCCGNONE 
J100073B05GGGACCCGNONE 
J100074M12GGGACCCGNONE 
Os04g0577700AK108703CGGGTCCCProtein of unknown function DUF623, plant domain containing protein. 
Os05g0110100009-015-D08GTGGGACCCGNONE 
009-023-C09GTGGGACCCGNONE 
009-031-B11GTGGGACCCGNONE 
009-034-C02GTGGGACCCGNONE 
009-050-B08GTGGGACCCGNONE 
009-065-D12GTGGGACCCGNONE 
009-090-G08GTGGGACCCGNONE 
009-111-H07GTGGGACCCGNONE 
009-136-F12GTGGGACCCGNONE 
009-138-E06GTGGGACCCGNONE 
009-138-G12GTGGGACCCGNONE 
009-141-D08GTGGGACCCGNONE 
009-143-D01GTGGGACCCGNONE 
009-179-D09GTGGGACCCGNONE 
009-179-E03GTGGGACCCGNONE 
009-196-A09GTGGGACCCGNONE 
009-199-F04GTGGGACCCGNONE 
013-021-E05GTGGGACCCGNONE 
013-076-C04GTGGGACCCGNONE 
013-096-F06GTGGGACCCGNONE 
014-071-A05GTGGGACCCGNONE 
014-077-F09GTGGGACCCGNONE 
AK099779GTGGGACCCGNONE 
AK121142GTGGGACCCGConserved hypothetical protein. 
J013095A16GTGGGACCCGNONE 
J013111A17GTGGGACCCGNONE 
J013132G04GTGGGACCCGNONE 
J023077M04GTGGGACCCGNONE 
J065001B11GTGGGACCCGNONE 
J065001E11GTGGGACCCGNONE 
J065057G10GTGGGACCCGNONE 
J065057L08GTGGGACCCGNONE 
J065080E07GTGGGACCCGNONE 
J065087K10GTGGGACCCGNONE 
J065091M15GTGGGACCCGNONE 
J065167A15GTGGGACCCGNONE 
J075018F02GTGGGACCCGNONE 
J075063F20GTGGGACCCGNONE 
J075064F18GTGGGACCCGNONE 
J075066N19GTGGGACCCGNONE 
J075073I02GTGGGACCCGNONE 
J075080P17GTGGGACCCGNONE 
J075081F11GTGGGACCCGNONE 
J075085E03GTGGGACCCGNONE 
J075101G18GTGGGACCCGNONE 
J075149N08GTGGGACCCGNONE 
J075158I21GTGGGACCCGNONE 
J075161M20GTGGGACCCGNONE 
J075190F12GTGGGACCCGNONE 
J075194K16GTGGGACCCGNONE 
J080001E08GTGGGACCCGNONE 
J080001F21GTGGGACCCGNONE 
J080001H19GTGGGACCCGNONE 
J080001O15GTGGGACCCGNONE 
J080005I22GTGGGACCCGNONE 
J080006K23GTGGGACCCGNONE 
J080014D20GTGGGACCCGNONE 
J080014I05GTGGGACCCGNONE 
J080014K21GTGGGACCCGNONE 
J080017I24GTGGGACCCGNONE 
J080017K11GTGGGACCCGNONE 
J080018F11GTGGGACCCGNONE 
J080022L18GTGGGACCCGNONE 
J080024N23GTGGGACCCGNONE 
J080027J23GTGGGACCCGNONE 
J080029B14GTGGGACCCGNONE 
J080032F14GTGGGACCCGNONE 
J080032K19GTGGGACCCGNONE 
J080032O21GTGGGACCCGNONE 
J080033P17GTGGGACCCGNONE 
J080034I06GTGGGACCCGNONE 
J080039F24GTGGGACCCGNONE 
J080040O13GTGGGACCCGNONE 
J080042B02GTGGGACCCGNONE 
J080043E12GTGGGACCCGNONE 
J080043J15GTGGGACCCGNONE 
J080043N09GTGGGACCCGNONE 
J080052J08GTGGGACCCGNONE 
J080053K01GTGGGACCCGNONE 
J080053K19GTGGGACCCGNONE 
J080055J09GTGGGACCCGNONE 
J080058D07GTGGGACCCGNONE 
J080062F11GTGGGACCCGNONE 
J080063J24GTGGGACCCGNONE 
J080066H04GTGGGACCCGNONE 
J080066I09GTGGGACCCGNONE 
J080067B02GTGGGACCCGNONE 
J080067N09GTGGGACCCGNONE 
J080068D22GTGGGACCCGNONE 
J080068K13GTGGGACCCGNONE 
J080069N19GTGGGACCCGNONE 
J080070D07GTGGGACCCGNONE 
J080070E05GTGGGACCCGNONE 
J080071G04GTGGGACCCGNONE 
J080077G05GTGGGACCCGNONE 
J080077O06GTGGGACCCGNONE 
J080085F05GTGGGACCCGNONE 
J080086E07GTGGGACCCGNONE 
J080089G16GTGGGACCCGNONE 
J080092K15GTGGGACCCGNONE 
J080094A08GTGGGACCCGNONE 
J080097A09GTGGGACCCGNONE 
J080097J07GTGGGACCCGNONE 
J090027N01GTGGGACCCGNONE 
J090081J05GTGGGACCCGNONE 
Os05g0198000J080004C03CGGGTCCCProtein of unknown function DUF247, plant family protein. 
J080004M24CGGGTCCCNONE 
J080004O15CGGGTCCCNONE 
J080006E14CGGGTCCCNONE 
J080006I07CGGGTCCCNONE 
J080007N13CGGGTCCCNONE 
J080009C21CGGGTCCCNONE 
J080009L03CGGGTCCCNONE 
J080010F10CGGGTCCCNONE 
J080015H04CGGGTCCCNONE 
J080015L04CGGGTCCCNONE 
J080018C21CGGGTCCCNONE 
J080022M22CGGGTCCCNONE 
J080027O19CGGGTCCCNONE 
J080030I07CGGGTCCCNONE 
J080037P07CGGGTCCCNONE 
J080044C18CGGGTCCCNONE 
J080049F14CGGGTCCCNONE 
J080050F04CGGGTCCCNONE 
J080052B18CGGGTCCCNONE 
J080081B11CGGGTCCCNONE 
J080083G12CGGGTCCCNONE 
J080086A11CGGGTCCCNONE 
J080087C06CGGGTCCCNONE 
J080088E06CGGGTCCCNONE 
J080091O21CGGGTCCCNONE 
J080094N23CGGGTCCCNONE 
Os05g0358000006-083-G07CGGGTCCCACCNONE 
AK061141CGGGTCCCACCNONE 
AK070900CGGGTCCCACCNONE 
AK101263CGGGTCCCACCDrought induced 19 family protein. 
J023098C13CGGGTCCCACCNONE 
J033032J06CGGGTCCCACCNONE 
J065014A09CGGGTCCCACCNONE 
J065121L01CGGGTCCCACCNONE 
J065130K19CGGGTCCCACCNONE 
J065208B21CGGGTCCCACCNONE 
J075080G14CGGGTCCCACCNONE 
J075135L01CGGGTCCCACCNONE 
J075180J15CGGGTCCCACCNONE 
Os05g0365300AK067015CGGGTCCCNONE 
AK120289CGGGTCCCSimilar to NBS-LRR protein (Fragment). 
J013050D17CGGGTCCCNONE 
Os05g0401300009-111-H03GGGACCCGNONE 
AK060678GGGACCCGTwin-arginine translocation pathway signal domain containing protein. 
Os05g0467300006-113-H02TGGGACCCGNONE 
AK061873TGGGACCCGSelT/selW/selH selenoprotein family protein. 
AK098945TGGGACCCGNONE 
J013050H09TGGGACCCGNONE 
J023108B17TGGGACCCGNONE 
J065189J01TGGGACCCGNONE 
J075011H05TGGGACCCGNONE 
J075019G20TGGGACCCGNONE 
Os05g0490300AK071818CGGGTCCCCyclin-like F-box domain containing protein. 
J023114L14CGGGTCCCNONE 
Os05g0551700AK071216CGGGTCCCCCACTTGtRNA isopentenyltransferase family protein. 
Os05g0586600AB096011GGTGGGCCCAGGGACCCGPlastid sigma factor SIG5. 
AB096071GGTGGGCCCAGGGACCCGNONE 
AK105697GGTGGGCCCAGGGACCCGNONE 
Os06g0233000009-177-C07CGGGTCCCACNONE 
AK063118CGGGTCCCACConserved hypothetical protein. 
Os06g0553100J065130H10CGGGTCCCNONE 
J075102G23CGGGTCCCNONE 
J075147H23CGGGTCCCHeat shock factor (HSF)-type, DNA-binding domain containing protein. 
Os06g0595900AK066655TGAGGGACCCGTranscription elongation factor S-II, central region domain containing protein. 
J075022F02TGAGGGACCCGNONE 
J075055H13TGAGGGACCCGNONE 
J075188H14TGAGGGACCCGNONE 
Os06g0714000AK069538CGGGTCCCACCACProtein of unknown function UPF0183 family protein. 
J023020A02CGGGTCCCACCACNONE 
J023039H03CGGGTCCCACCACNONE 
J100042E23CGGGTCCCACCACNONE 
J100069N01CGGGTCCCACCACNONE 
J100089L13CGGGTCCCACCACNONE 
Os07g0568100AK099778GGGACCCGSimilar to Nodulation receptor kinase precursor (EC 2.7.1.-) (Does not make infections protein 2) (Symbiosis receptor-like kinase) (MtSYMRK). 
Os07g0597625J065130O18CGGGTCCCTCAD-isomer specific 2-hydroxyacid dehydrogenase, catalytic region domain containing protein. 
J065166J07CGGGTCCCTCANONE 
Os08g0100400AK102424TGGGACCCGNONE 
J033093E21TGGGACCCGNONE 
Os08g0113600006-048-G08CCCACGGGTCCCNONE 
AK061571CCCACGGGTCCCConserved hypothetical protein. 
Os08g0158600AK072477GTGGGACCCGSimilar to Cell wall invertase (EC 3.2.1.26). 
J023125I06GTGGGACCCGNONE 
J065194K03GTGGGACCCGNONE 
Os08g0196900J065042C13CGGGTCCCANONE 
J065097A06CGGGTCCCANONE 
J065164E04CGGGTCCCANONE 
J075006N16CGGGTCCCACyclin-like F-box domain containing protein. 
J075007K15CGGGTCCCANONE 
J075025D24CGGGTCCCANONE 
J075165A07CGGGTCCCANONE 
J075176D05CGGGTCCCANONE 
J075181K09CGGGTCCCANONE 
J075199B15CGGGTCCCANONE 
Os08g0461800012-071-E12GGGACCCGNONE 
AK066516GGGACCCGNONE 
AK067364GGGACCCGConserved hypothetical protein. 
AK098966GGGACCCGNONE 
Os08g0490100009-038-D02CTGACAGGTGGGACCCGNONE 
J065152E11CTGACAGGTGGGACCCGSimilar to PBF protein. 
J090050K03CTGACAGGTGGGACCCGNONE 
J090053L01CTGACAGGTGGGACCCGNONE 
Os08g0544800009-168-G01CGGGTCCCNONE 
009-168-G01CGGGTCCCCACCACNONE 
011-046-D09CGGGTCCCNONE 
011-046-D09CGGGTCCCCACCACNONE 
012-003-C08CGGGTCCCNONE 
012-003-C08CGGGTCCCCACCACNONE 
012-042-B06CGGGTCCCNONE 
012-042-B06CGGGTCCCCACCACNONE 
013-035-H12CGGGTCCCNONE 
013-035-H12CGGGTCCCCACCACNONE 
013-072-A10CGGGTCCCNONE 
013-072-A10CGGGTCCCCACCACNONE 
014-010-B11CGGGTCCCNONE 
014-010-B11CGGGTCCCCACCACNONE 
014-097-E06CGGGTCCCNONE 
014-097-E06CGGGTCCCCACCACNONE 
015-003-E12CGGGTCCCNONE 
015-003-E12CGGGTCCCCACCACNONE 
015-040-B04CGGGTCCCNONE 
015-040-B04CGGGTCCCCACCACNONE 
AK060536CGGGTCCCNONE 
AK060536CGGGTCCCCACCACNONE 
AK102666CGGGTCCCNONE 
AK102666CGGGTCCCCACCACNONE 
AK119660CGGGTCCCPCF2. 
AK119660CGGGTCCCCACCACPCF2. 
D87261CGGGTCCCNONE 
D87261CGGGTCCCCACCACNONE 
J090049N23CGGGTCCCNONE 
J090049N23CGGGTCCCCACCACNONE 
J090084G06CGGGTCCCNONE 
J090084G06CGGGTCCCCACCACNONE 
Os09g0108400016-081-D07GTGGGACCCGCGCNONE 
AK071505GTGGGACCCGCGCConserved hypothetical protein. 
AK106506GTGGGACCCGCGCNONE 
Os09g0392000AK120392GTGGGACCCGConserved hypothetical protein. 
J013074N02GTGGGACCCGNONE 
Os09g0439100AK110960CGGGTCCCASimilar to Cellulose synthase-like A4. 
J065015H17CGGGTCCCANONE 
J065111P09CGGGTCCCANONE 
J065148I01CGGGTCCCANONE 
J080050I03CGGGTCCCANONE 
J080084D18CGGGTCCCANONE 
Os09g0527700AK111128CGGGTCCCACSimilar to Auxin-induced protein IAA4. 
J065124H12CGGGTCCCACNONE 
J065181I07CGGGTCCCACNONE 
J065207G14CGGGTCCCACNONE 
Os11g0591800J043024N06TGGGACCCGNONE 
J053056L17TGGGACCCGNONE 
J053077L16TGGGACCCGNONE 
J065007A12TGGGACCCGNONE 
J065132I12TGGGACCCGNONE 
J065192M16TGGGACCCGNONE 
J100042F02TGGGACCCGNONE 
J100053D19TGGGACCCGBarwin-related endoglucanase domain containing protein. 
J100074P06TGGGACCCGNONE 
Os12g0134000AK066940CGGGTCCCSimilar to Hydroxymethylglutaryl-CoA lyase. 
Os12g0210200AF309381CGGGTCCCNONE 
AK069105CGGGTCCCSimilar to Glutathione S-transferase GST 18 (EC 2.5.1.18). 
J023004I03CGGGTCCCNONE 
J033069C11CGGGTCCCNONE 
J065087E20CGGGTCCCNONE 
J065097G21CGGGTCCCNONE 
Os12g0277000AK066847GGGACCCGNONE 
Os12g0509300AK108497GGGACCCGConserved hypothetical protein. 
Os12g0532600AK066369CGGGTCCCAHypothetical protein. 
J013059K17CGGGTCCCANONE 
J065082J04CGGGTCCCANONE 
J065158C15CGGGTCCCANONE 
J090017A09CGGGTCCCANONE 
Os12g0601400009-057-A09GGGACCCGNONE 
AK073361GGGACCCGSimilar to Auxin-responsive protein (Aux/IAA) (Fragment). 
J065037G12GGGACCCGNONE 
J065099K06GGGACCCGNONE 
J065156F11GGGACCCGNONE 
J100025G04GGGACCCGNONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.