version

Summary of OsREG570 (All List)

OrganismOryza sativa  
IDOsREG570  
SequenceCGTGGACC  
Annotation  
PPDB Motif 
PLACE Motif 
Total Entry Count921  

Entry Sequences (921 entries)

LocusGene modelSequenceDescription
Os01g0133500003-118-E04GGTCCACGNONE 
AK101232GGTCCACGNONE 
AK101585GGTCCACGBeta-lactamase-like domain containing protein. 
J033031J06GGTCCACGNONE 
J043016H05GGTCCACGNONE 
J065016F08GGTCCACGNONE 
J065032D01GGTCCACGNONE 
Os01g0250900AK065179GGTCCACGGGCCGGCCCCACHAD superfamily (subfamily IG) hydrolase, 5'-Nucleotidase protein. 
J013002D15GGTCCACGGGCCGGCCCCACNONE 
J013037K03GGTCCACGGGCCGGCCCCACNONE 
J013091F03GGTCCACGGGCCGGCCCCACNONE 
J013127B14GGTCCACGGGCCGGCCCCACNONE 
Os01g0280200J065103B05GGTCCACGNONE 
J065183G15GGTCCACGConserved hypothetical protein. 
Os01g0305900Os01g0305900CGTGGACCSimilar to A-type R2R3 Myb protein (Fragment). 
Os01g0368900AK107858CGTGGACCSimilar to GLUTAREDOXIN. 
J065148B01CGTGGACCNONE 
J065181F23CGTGGACCNONE 
J065201I22CGTGGACCNONE 
J065208K09CGTGGACCNONE 
Os01g0604100AK099765CCCACGTGGACCUspA domain containing protein. 
J013094O21CCCACGTGGACCNONE 
Os01g0612600004-008-D07GGTCCACGNONE 
009-057-C09GGTCCACGNONE 
009-130-C01GGTCCACGNONE 
AK062906GGTCCACGNONE 
AK066561GGTCCACGProtein of unknown function DUF1644 family protein. 
J013065E14GGTCCACGNONE 
J013073D14GGTCCACGNONE 
J023014A21GGTCCACGNONE 
J023073M13GGTCCACGNONE 
J023079F02GGTCCACGNONE 
J023083B16GGTCCACGNONE 
J023090G19GGTCCACGNONE 
J023095F15GGTCCACGNONE 
J023119H11GGTCCACGNONE 
J033040B01GGTCCACGNONE 
J033044F13GGTCCACGNONE 
J033081E23GGTCCACGNONE 
J033121K07GGTCCACGNONE 
J033124D11GGTCCACGNONE 
J033131N22GGTCCACGNONE 
J065179E10GGTCCACGNONE 
J090020A13GGTCCACGNONE 
J090045K17GGTCCACGNONE 
J090047M24GGTCCACGNONE 
J090064G23GGTCCACGNONE 
J090084G08GGTCCACGNONE 
J090086F18GGTCCACGNONE 
J100032D09GGTCCACGNONE 
J100037O18GGTCCACGNONE 
J100042B03GGTCCACGNONE 
J100061D06GGTCCACGNONE 
J100061I03GGTCCACGNONE 
J100063B17GGTCCACGNONE 
Os01g0667200AK067930CGTGGACCSimilar to Glyoxalase II. 
AK104104CGTGGACCNONE 
AK104749CGTGGACCNONE 
J013059D24CGTGGACCNONE 
J013127E08CGTGGACCNONE 
Os01g0701900AK066793GGTCCACGSimilar to Phosphatidylinositol transfer-like protein III. 
Os01g0811100006-061-F11TTATGGGCTCGTGGACCNONE 
AB026562TTATGGGCTCGTGGACCNONE 
AK061784TTATGGGCTCGTGGACCNONE 
AK103541TTATGGGCTCGTGGACCProteasome subunit alpha type 3 (EC 3.4.25.1) (20S proteasome alpha subunit G) (20S proteasome subunit alpha-7). 
J013020B12TTATGGGCTCGTGGACCNONE 
J013022J21TTATGGGCTCGTGGACCNONE 
J013056G19TTATGGGCTCGTGGACCNONE 
J013060O07TTATGGGCTCGTGGACCNONE 
J013110I07TTATGGGCTCGTGGACCNONE 
J013160D19TTATGGGCTCGTGGACCNONE 
J090035A13TTATGGGCTCGTGGACCNONE 
Os01g0817700003-108-A10CGTGGACCNONE 
AK060836CGTGGACCNONE 
AK065059CGTGGACCSimilar to 2,3-bisphosphoglycerate-independent phosphoglycerate mutase (EC 5.4.2.1) (Phosphoglyceromutase) (BPG-independent PGAM) (PGAM-I). 
J013001J10CGTGGACCNONE 
J013047D19CGTGGACCNONE 
J013056K09CGTGGACCNONE 
J013068P20CGTGGACCNONE 
J013108G18CGTGGACCNONE 
J023007N01CGTGGACCNONE 
J023008A22CGTGGACCNONE 
J023010B02CGTGGACCNONE 
J023029O13CGTGGACCNONE 
J023064F21CGTGGACCNONE 
J023073E22CGTGGACCNONE 
J023143E14CGTGGACCNONE 
J033027N20CGTGGACCNONE 
J033032G14CGTGGACCNONE 
J033037E03CGTGGACCNONE 
J033057N19CGTGGACCNONE 
J033065E16CGTGGACCNONE 
J033066B19CGTGGACCNONE 
J033069G01CGTGGACCNONE 
J033071B03CGTGGACCNONE 
J033080C12CGTGGACCNONE 
J033081K19CGTGGACCNONE 
J033096B19CGTGGACCNONE 
J033101E20CGTGGACCNONE 
J033135L21CGTGGACCNONE 
J033139I07CGTGGACCNONE 
J033150A21CGTGGACCNONE 
J043036J05CGTGGACCNONE 
J043039D03CGTGGACCNONE 
J043039F19CGTGGACCNONE 
J090006K04CGTGGACCNONE 
J090017G14CGTGGACCNONE 
J090034E23CGTGGACCNONE 
J090039D07CGTGGACCNONE 
J090039I09CGTGGACCNONE 
J090044F21CGTGGACCNONE 
J090049J12CGTGGACCNONE 
J090053A19CGTGGACCNONE 
J090061E23CGTGGACCNONE 
J090079K09CGTGGACCNONE 
J090092F21CGTGGACCNONE 
J100022E04CGTGGACCNONE 
J100038I01CGTGGACCNONE 
J100066C22CGTGGACCNONE 
J100067C11CGTGGACCNONE 
J100073F07CGTGGACCNONE 
J100084I24CGTGGACCNONE 
Os01g0830000012-056-G03CGTGGACCNONE 
015-092-H05CGTGGACCNONE 
AK121100CGTGGACCSimilar to Plastid sufB (Fragment). 
J023069G03CGTGGACCNONE 
J090047G13CGTGGACCNONE 
J090059K22CGTGGACCNONE 
Os01g0830100AK069755GGTCCACGPyridine nucleotide-disulphide oxidoreductase, NAD-binding region domain containing protein. 
Os01g0842200003-126-E01GGCCGTGGACCNONE 
AK102593GGCCGTGGACCNONE 
AK119896GGCCGTGGACCSimilar to Scarecrow-like 9 (Fragment). 
J013151G12GGCCGTGGACCNONE 
J033098G15GGCCGTGGACCNONE 
J090041L03GGCCGTGGACCNONE 
J090069J20GGCCGTGGACCNONE 
Os01g0887700AF045571CGTGGACCGGGCCCATGNONE 
AF047428CGTGGACCGGGCCCATGNONE 
AK071139CGTGGACCGGGCCCATGZinc finger, FYVE/PHD-type domain containing protein. 
J023082D05CGTGGACCGGGCCCATGNONE 
J065062L19CGTGGACCGGGCCCATGNONE 
J065116H15CGTGGACCGGGCCCATGNONE 
J065194N09CGTGGACCGGGCCCATGNONE 
J100074C19CGTGGACCGGGCCCATGNONE 
Os01g0888800AK070163GGTCCACGConserved hypothetical protein. 
J065181H02GGTCCACGNONE 
Os01g0955000AK101291GGTCCACGPhosphoesterase family protein. 
AK111280GGTCCACGNONE 
AK119633GGTCCACGNONE 
J023060A17GGTCCACGNONE 
J033033G16GGTCCACGNONE 
J065097E20GGTCCACGNONE 
J065120K07GGTCCACGNONE 
J065158B21GGTCCACGNONE 
J065180G22GGTCCACGNONE 
J065182B08GGTCCACGNONE 
J065193A07GGTCCACGNONE 
J075002N02GGTCCACGNONE 
J075033E10GGTCCACGNONE 
J075047I10GGTCCACGNONE 
J075131G02GGTCCACGNONE 
J075153L21GGTCCACGNONE 
J090006M23GGTCCACGNONE 
J090056B21GGTCCACGNONE 
J090079D02GGTCCACGNONE 
J100027D09GGTCCACGNONE 
J100076M14GGTCCACGNONE 
J100077M06GGTCCACGNONE 
Os01g0963300AK067544CGTGGACCSimilar to Syntaxin 61 (AtSYP61) (Osmotic stess-sensitive mutant 1). 
AK067544GGTCCACGSimilar to Syntaxin 61 (AtSYP61) (Osmotic stess-sensitive mutant 1). 
Os02g0255700AK060468GGTCCACGNONE 
Os02g0461900009-042-C04CGTGGACCNONE 
AF140492CGTGGACCNONE 
AK072619CGTGGACCNONE 
AK104969CGTGGACCConserved hypothetical protein. 
AK119466CGTGGACCNONE 
Os02g0509500009-117-G07GGTCCACGCCNONE 
009-122-G08GGTCCACGCCNONE 
AK105187GGTCCACGCCConserved hypothetical protein. 
J065025C04GGTCCACGCCNONE 
J065030F10GGTCCACGCCNONE 
J065112P22GGTCCACGCCNONE 
J065116I22GGTCCACGCCNONE 
J065127F24GGTCCACGCCNONE 
J065176E11GGTCCACGCCNONE 
J065186F02GGTCCACGCCNONE 
J075041F12GGTCCACGCCNONE 
J075118L20GGTCCACGCCNONE 
J075181D20GGTCCACGCCNONE 
J090023P12GGTCCACGCCNONE 
Os02g0681100AK100584GGTCCACGProtein of unknown function DUF604 family protein. 
J023106A15GGTCCACGNONE 
Os02g0731600AK058271GGTCCACGConserved hypothetical protein. 
Os02g0822100AK099610CGTGGACCNONE 
Os03g0127600AK103695CGTGGACCSMAD/FHA domain containing protein. 
J033136J18CGTGGACCNONE 
J075046D02CGTGGACCNONE 
J075093K04CGTGGACCNONE 
J075116M01CGTGGACCNONE 
Os03g0130400AK070255GGTCCACGCCTCAdenylate kinase, subfamily protein. 
Os03g0131300015-095-G06GGTCCACGTGGGGGCCCACCCNONE 
AK100656GGTCCACGTGGGGGCCCACCCUbiquitin domain containing protein. 
J033140O12GGTCCACGTGGGGGCCCACCCNONE 
J065112C14GGTCCACGTGGGGGCCCACCCNONE 
J090070D10GGTCCACGTGGGGGCCCACCCNONE 
Os03g0160200AK064836GTGACGTGGACCGGACGCGTCCConserved hypothetical protein. 
AK071081GTGACGTGGACCGGACGCGTCCNONE 
AK100712GTGACGTGGACCGGACGCGTCCNONE 
AK104859GTGACGTGGACCGGACGCGTCCNONE 
J013000F21GTGACGTGGACCGGACGCGTCCNONE 
J013024G05GTGACGTGGACCGGACGCGTCCNONE 
J013035E12GTGACGTGGACCGGACGCGTCCNONE 
J013041A17GTGACGTGGACCGGACGCGTCCNONE 
J013045D10GTGACGTGGACCGGACGCGTCCNONE 
J013045F04GTGACGTGGACCGGACGCGTCCNONE 
J013046F04GTGACGTGGACCGGACGCGTCCNONE 
J013047F10GTGACGTGGACCGGACGCGTCCNONE 
J013051E10GTGACGTGGACCGGACGCGTCCNONE 
J013059J07GTGACGTGGACCGGACGCGTCCNONE 
J013059O17GTGACGTGGACCGGACGCGTCCNONE 
J013060A20GTGACGTGGACCGGACGCGTCCNONE 
J013063J23GTGACGTGGACCGGACGCGTCCNONE 
J013066D19GTGACGTGGACCGGACGCGTCCNONE 
J013069O08GTGACGTGGACCGGACGCGTCCNONE 
J013088K24GTGACGTGGACCGGACGCGTCCNONE 
J013098G04GTGACGTGGACCGGACGCGTCCNONE 
J013100I15GTGACGTGGACCGGACGCGTCCNONE 
J013102E18GTGACGTGGACCGGACGCGTCCNONE 
J013102O09GTGACGTGGACCGGACGCGTCCNONE 
J013119M18GTGACGTGGACCGGACGCGTCCNONE 
J013123I19GTGACGTGGACCGGACGCGTCCNONE 
J013146H15GTGACGTGGACCGGACGCGTCCNONE 
J013149A14GTGACGTGGACCGGACGCGTCCNONE 
J023003A05GTGACGTGGACCGGACGCGTCCNONE 
J023013O19GTGACGTGGACCGGACGCGTCCNONE 
J023044M05GTGACGTGGACCGGACGCGTCCNONE 
J023048O03GTGACGTGGACCGGACGCGTCCNONE 
J023049L17GTGACGTGGACCGGACGCGTCCNONE 
J023060D22GTGACGTGGACCGGACGCGTCCNONE 
J023060F20GTGACGTGGACCGGACGCGTCCNONE 
J023069G09GTGACGTGGACCGGACGCGTCCNONE 
J023086E11GTGACGTGGACCGGACGCGTCCNONE 
J023091I09GTGACGTGGACCGGACGCGTCCNONE 
J023091M19GTGACGTGGACCGGACGCGTCCNONE 
J023101D06GTGACGTGGACCGGACGCGTCCNONE 
J023109B03GTGACGTGGACCGGACGCGTCCNONE 
J023113B14GTGACGTGGACCGGACGCGTCCNONE 
J023114B19GTGACGTGGACCGGACGCGTCCNONE 
J023115H16GTGACGTGGACCGGACGCGTCCNONE 
J023134F22GTGACGTGGACCGGACGCGTCCNONE 
J023139I06GTGACGTGGACCGGACGCGTCCNONE 
J023150C02GTGACGTGGACCGGACGCGTCCNONE 
J033033A14GTGACGTGGACCGGACGCGTCCNONE 
J033058O11GTGACGTGGACCGGACGCGTCCNONE 
J033060H13GTGACGTGGACCGGACGCGTCCNONE 
J033075P14GTGACGTGGACCGGACGCGTCCNONE 
J033084O05GTGACGTGGACCGGACGCGTCCNONE 
J033087G04GTGACGTGGACCGGACGCGTCCNONE 
J033092E18GTGACGTGGACCGGACGCGTCCNONE 
J033101G23GTGACGTGGACCGGACGCGTCCNONE 
J033112I05GTGACGTGGACCGGACGCGTCCNONE 
J033118E14GTGACGTGGACCGGACGCGTCCNONE 
J033118P04GTGACGTGGACCGGACGCGTCCNONE 
J033123C07GTGACGTGGACCGGACGCGTCCNONE 
J043003C01GTGACGTGGACCGGACGCGTCCNONE 
J043024B21GTGACGTGGACCGGACGCGTCCNONE 
J043030N04GTGACGTGGACCGGACGCGTCCNONE 
J043039J02GTGACGTGGACCGGACGCGTCCNONE 
J043039N08GTGACGTGGACCGGACGCGTCCNONE 
J075006N21GTGACGTGGACCGGACGCGTCCNONE 
J075008A16GTGACGTGGACCGGACGCGTCCNONE 
J075018J16GTGACGTGGACCGGACGCGTCCNONE 
J075023G04GTGACGTGGACCGGACGCGTCCNONE 
J075134F18GTGACGTGGACCGGACGCGTCCNONE 
J075181B05GTGACGTGGACCGGACGCGTCCNONE 
J090014O14GTGACGTGGACCGGACGCGTCCNONE 
J090020H22GTGACGTGGACCGGACGCGTCCNONE 
J090022G17GTGACGTGGACCGGACGCGTCCNONE 
J090023J24GTGACGTGGACCGGACGCGTCCNONE 
J090033H01GTGACGTGGACCGGACGCGTCCNONE 
J090038A03GTGACGTGGACCGGACGCGTCCNONE 
J090041O22GTGACGTGGACCGGACGCGTCCNONE 
J090049E10GTGACGTGGACCGGACGCGTCCNONE 
J090063E24GTGACGTGGACCGGACGCGTCCNONE 
J090080N12GTGACGTGGACCGGACGCGTCCNONE 
J100021G23GTGACGTGGACCGGACGCGTCCNONE 
J100028P06GTGACGTGGACCGGACGCGTCCNONE 
J100060L21GTGACGTGGACCGGACGCGTCCNONE 
J100077D16GTGACGTGGACCGGACGCGTCCNONE 
J100088I09GTGACGTGGACCGGACGCGTCCNONE 
Os03g0177100AK068092CGTGGACCConserved hypothetical protein. 
J100036F01CGTGGACCNONE 
J100040N06CGTGGACCNONE 
J100043E08CGTGGACCNONE 
Os03g0196600Os03g0196600GGTCCACGSimilar to Chloroplast serine acetyltransferase. 
Os03g0276500011-014-A06GGTCCACGNONE 
012-043-E04GGTCCACGNONE 
012-096-G01GGTCCACGNONE 
014-005-A07GGTCCACGNONE 
014-031-F09GGTCCACGNONE 
014-040-C09GGTCCACGNONE 
014-092-G02GGTCCACGNONE 
AK072830GGTCCACGNONE 
AK099275GGTCCACGNONE 
AK109474GGTCCACGSimilar to Heat shock protein 70. 
J013036E08GGTCCACGNONE 
J013047P03GGTCCACGNONE 
J013048H14GGTCCACGNONE 
J013060E24GGTCCACGNONE 
J013093N10GGTCCACGNONE 
J013123K11GGTCCACGNONE 
J013153C09GGTCCACGNONE 
J023010D20GGTCCACGNONE 
J023027O13GGTCCACGNONE 
J023029B01GGTCCACGNONE 
J023063G14GGTCCACGNONE 
J023083D09GGTCCACGNONE 
J023091M13GGTCCACGNONE 
J023121M10GGTCCACGNONE 
J023126D10GGTCCACGNONE 
J023139H01GGTCCACGNONE 
J023145B18GGTCCACGNONE 
J033029G15GGTCCACGNONE 
J033050K13GGTCCACGNONE 
J033057L09GGTCCACGNONE 
J033092M15GGTCCACGNONE 
J065007N14GGTCCACGNONE 
J065038E07GGTCCACGNONE 
J065043A09GGTCCACGNONE 
J065100C19GGTCCACGNONE 
J065117C02GGTCCACGNONE 
J065213I04GGTCCACGNONE 
J090001F01GGTCCACGNONE 
J090025D07GGTCCACGNONE 
J090037C11GGTCCACGNONE 
J090047N11GGTCCACGNONE 
J090053O05GGTCCACGNONE 
J090070F11GGTCCACGNONE 
J090082O16GGTCCACGNONE 
J090085F20GGTCCACGNONE 
J090096N08GGTCCACGNONE 
Os03g0309000AK070071GGTCCACGVirulence factor, pectin lyase fold family protein. 
Os03g0331600009-025-C11GGTCCACGTGTGCCCAAAANONE 
AK063782GGTCCACGTGTGCCCAAAAConserved hypothetical protein. 
Os03g0335300AK098846ACACGTGGACCACGCGTNONE 
AK098891ACACGTGGACCACGCGTNONE 
AK111509ACACGTGGACCACGCGTSimilar to Vacuolar sorting receptor homolog (Fragment). 
AK111847ACACGTGGACCACGCGTNONE 
AK121413ACACGTGGACCACGCGTNONE 
Os03g0396900015-053-C12GGTCCACGNONE 
AK071398GGTCCACGNONE 
AK103513GGTCCACGSimilar to PIMT. 
J023092N10GGTCCACGNONE 
Os03g0403600016-047-G02CGTGGACCNONE 
AK064220CGTGGACCvon Willebrand factor, type A domain containing protein. 
Os03g0413000009-180-E02GGTCCACGNONE 
009-188-B06GGTCCACGNONE 
AK060225GGTCCACGNONE 
AY062181GGTCCACGSimilar to Potential histone-like transcription factor. 
Os03g0440900006-025-H04CGTGGACCNONE 
006-047-H07CGTGGACCNONE 
006-060-H12CGTGGACCNONE 
006-070-A03CGTGGACCNONE 
006-092-C02CGTGGACCNONE 
006-094-G10CGTGGACCNONE 
014-077-B09CGTGGACCNONE 
AK061730CGTGGACCSimilar to LRR protein. 
AK069710CGTGGACCNONE 
J013027E23CGTGGACCNONE 
J023031G03CGTGGACCNONE 
J065166J18CGTGGACCNONE 
J075034K19CGTGGACCNONE 
J075046I24CGTGGACCNONE 
J075176D13CGTGGACCNONE 
J090060I21CGTGGACCNONE 
J100025G01CGTGGACCNONE 
J100025O12CGTGGACCNONE 
J100041L24CGTGGACCNONE 
J100057B08CGTGGACCNONE 
J100060J12CGTGGACCNONE 
Os03g0581600J065037H09GGTCCACGTGGGCCCCACACNONE 
J065183O12GGTCCACGTGGGCCCCACACNONE 
Os03g0661300004-017-F12GGTCCACGNONE 
013-009-E06GGTCCACGNONE 
013-012-F02GGTCCACGNONE 
AB104733GGTCCACGNONE 
AK121321GGTCCACGBeta-tubulin (Beta-3 tubulin) (Tubulin beta subunit). 
J023038G08GGTCCACGNONE 
J023105M06GGTCCACGNONE 
J023114E06GGTCCACGNONE 
J023129A15GGTCCACGNONE 
Os03g0708800009-180-H07GGTCCACGNONE 
014-021-A05GGTCCACGNONE 
AK063141GGTCCACGNONE 
AK063654GGTCCACGHypothetical protein. 
AK121625GGTCCACGNONE 
J065041G22GGTCCACGNONE 
J065063P10GGTCCACGNONE 
J065158O11GGTCCACGNONE 
Os03g0713100J013039M09GGTCCACGNONE 
J023007K01GGTCCACGNONE 
J023073H01GGTCCACGNONE 
J023087M20GGTCCACGNONE 
J023142E01GGTCCACGNONE 
J033048E03GGTCCACGNONE 
J033048F03GGTCCACGSimilar to Dynamin-related protein 1C (Dynamin-like protein C) (Dynamin-like protein 5) (Dynamin-like protein DLP1). 
J033058C11GGTCCACGNONE 
J033074M20GGTCCACGNONE 
J033084M11GGTCCACGNONE 
J033091I23GGTCCACGNONE 
J033100C08GGTCCACGNONE 
J033123K19GGTCCACGNONE 
J090006P21GGTCCACGNONE 
J090045O16GGTCCACGNONE 
J100087M13GGTCCACGNONE 
Os03g0784000AK067337GGTCCACGNONE 
AK100003GGTCCACGFAD dependent oxidoreductase family protein. 
J013102O14GGTCCACGNONE 
J013135F18GGTCCACGNONE 
Os03g0791800013-037-A12CGTGGACCCACNONE 
AB079798CGTGGACCCACNONE 
AK067703CGTGGACCCACRad6 (Ubiquitin carrier protein). 
AK120251CGTGGACCCACNONE 
J013045G10CGTGGACCCACNONE 
J023102B18CGTGGACCCACNONE 
J065020J23CGTGGACCCACNONE 
J065127I21CGTGGACCCACNONE 
J065151E11CGTGGACCCACNONE 
J075076B05CGTGGACCCACNONE 
J075116C15CGTGGACCCACNONE 
J075136A07CGTGGACCCACNONE 
J100029G21CGTGGACCCACNONE 
J100030K01CGTGGACCCACNONE 
J100041J02CGTGGACCCACNONE 
J100049C22CGTGGACCCACNONE 
J100057G17CGTGGACCCACNONE 
J100086L12CGTGGACCCACNONE 
Os03g0820400009-042-F06CGTGGACCNONE 
009-046-E08CGTGGACCNONE 
009-079-B08CGTGGACCNONE 
009-111-H09CGTGGACCNONE 
009-150-D10CGTGGACCNONE 
015-073-H11CGTGGACCNONE 
AK119690CGTGGACCSimilar to ZPT2-13. 
AY286473CGTGGACCNONE 
AY305864CGTGGACCNONE 
J100051O21CGTGGACCNONE 
Os04g0284600AK071386CGTGGACCSimilar to TAT-binding protein 1 (Fragment). 
Os04g0291000Os04g0291000CGTGGACCGlucose/ribitol dehydrogenase family protein. 
Os04g0405401J013026L01CGTGGACCGTCCGATNONE 
J033141G07CGTGGACCGTCCGATHypothetical protein. 
J033144F10CGTGGACCGTCCGATNONE 
J033145F10CGTGGACCGTCCGATNONE 
J065065C15CGTGGACCGTCCGATNONE 
J065107C14CGTGGACCGTCCGATNONE 
J065140M21CGTGGACCGTCCGATNONE 
J075192C06CGTGGACCGTCCGATNONE 
Os04g0504800AK064269CGTGGACCNONE 
AK067210CGTGGACCSimilar to Poly(A)-binding protein. 
Os04g0526800006-051-F03CGTGGACCNONE 
AK061581CGTGGACCGRAM domain containing protein. 
J065188M01CGTGGACCNONE 
J100043J05CGTGGACCNONE 
Os04g0538400AK108230GGTCCACGSimilar to Nodulin 21 (N-21). 
J090006J20GGTCCACGNONE 
Os04g0559400AK106376GGTCCACGSimilar to Branched-chain-amino-acid aminotransferase 5, chloroplast precursor (EC 2.6.1.42) (Atbcat-5). 
Os04g0566900AK072344GGTCCACGConserved hypothetical protein. 
Os04g0583101005-010-A06CGTGGACCNONE 
AK065769CGTGGACCProtein prenyltransferase domain containing protein. 
J013040G18CGTGGACCNONE 
J023100E21CGTGGACCNONE 
J075041E15CGTGGACCNONE 
J075056L11CGTGGACCNONE 
J075081F19CGTGGACCNONE 
J075126J10CGTGGACCNONE 
J075148G19CGTGGACCNONE 
J075178A14CGTGGACCNONE 
J100085H06CGTGGACCNONE 
Os04g0604250J065063H04CGTGGACCNONE 
J065088F06CGTGGACCConserved hypothetical protein. 
J065098D01CGTGGACCNONE 
J065185P18CGTGGACCNONE 
Os04g0608800003-130-B05GGTCCACGNONE 
J013002N16GGTCCACGNONE 
J013020F07GGTCCACGNONE 
J013096A02GGTCCACGNONE 
J013106I11GGTCCACGNONE 
J013107A05GGTCCACGNONE 
J013128L16GGTCCACGNONE 
J033023K12GGTCCACGNONE 
J033037C11GGTCCACGNONE 
J033067B19GGTCCACGNONE 
J065121L18GGTCCACGNONE 
Os04g0660200AK120239GGCCCGGTCCACGABC-1 domain containing protein. 
Os04g0667800009-032-B03GATCGGACGGTCCACGNONE 
009-175-C09GATCGGACGGTCCACGNONE 
AK119682GATCGGACGGTCCACGUbiquitin-conjugating enzyme (EC 6.3.2.19) (Ubiquitin carrier protein). 
AY083611GATCGGACGGTCCACGNONE 
D50574GATCGGACGGTCCACGNONE 
J013020D04GATCGGACGGTCCACGNONE 
J013126O03GATCGGACGGTCCACGNONE 
J023044K22GATCGGACGGTCCACGNONE 
J023054C17GATCGGACGGTCCACGNONE 
J023131A07GATCGGACGGTCCACGNONE 
J023138F02GATCGGACGGTCCACGNONE 
J033031L18GATCGGACGGTCCACGNONE 
J033092L17GATCGGACGGTCCACGNONE 
J033101J19GATCGGACGGTCCACGNONE 
J033129I17GATCGGACGGTCCACGNONE 
J033135F22GATCGGACGGTCCACGNONE 
J065005G02GATCGGACGGTCCACGNONE 
J065014I11GATCGGACGGTCCACGNONE 
J065026D12GATCGGACGGTCCACGNONE 
J065029D14GATCGGACGGTCCACGNONE 
J065036I19GATCGGACGGTCCACGNONE 
J065044A14GATCGGACGGTCCACGNONE 
J065044J17GATCGGACGGTCCACGNONE 
J065046F15GATCGGACGGTCCACGNONE 
J065061A14GATCGGACGGTCCACGNONE 
J065061I08GATCGGACGGTCCACGNONE 
J065079L11GATCGGACGGTCCACGNONE 
J065087A11GATCGGACGGTCCACGNONE 
J065093D04GATCGGACGGTCCACGNONE 
J065096I01GATCGGACGGTCCACGNONE 
J065096M23GATCGGACGGTCCACGNONE 
J065100K04GATCGGACGGTCCACGNONE 
J065106K02GATCGGACGGTCCACGNONE 
J065130J11GATCGGACGGTCCACGNONE 
J065146N23GATCGGACGGTCCACGNONE 
J065150M20GATCGGACGGTCCACGNONE 
J065160C01GATCGGACGGTCCACGNONE 
J065160M08GATCGGACGGTCCACGNONE 
J065185C17GATCGGACGGTCCACGNONE 
J065185L09GATCGGACGGTCCACGNONE 
J065199P04GATCGGACGGTCCACGNONE 
J065205K13GATCGGACGGTCCACGNONE 
J075007E03GATCGGACGGTCCACGNONE 
J075027H02GATCGGACGGTCCACGNONE 
J075031M24GATCGGACGGTCCACGNONE 
J075047H22GATCGGACGGTCCACGNONE 
J075055G17GATCGGACGGTCCACGNONE 
J075057G04GATCGGACGGTCCACGNONE 
J075060E23GATCGGACGGTCCACGNONE 
J075067G09GATCGGACGGTCCACGNONE 
J075071K19GATCGGACGGTCCACGNONE 
J075071L16GATCGGACGGTCCACGNONE 
J075126P16GATCGGACGGTCCACGNONE 
J075128N12GATCGGACGGTCCACGNONE 
J080006I16GATCGGACGGTCCACGNONE 
J080045P16GATCGGACGGTCCACGNONE 
J080057E18GATCGGACGGTCCACGNONE 
J080078I07GATCGGACGGTCCACGNONE 
J090032G07GATCGGACGGTCCACGNONE 
J090048G17GATCGGACGGTCCACGNONE 
J090092D14GATCGGACGGTCCACGNONE 
J100038E15GATCGGACGGTCCACGNONE 
J100039H02GATCGGACGGTCCACGNONE 
J100069P09GATCGGACGGTCCACGNONE 
Os04g0670800AK073170GGTCCACGNONE 
Os04g0674100J080097J12CGTGGACCThioredoxin-like fold domain containing protein. 
Os04g0674200AK101965GGTCCACGNONE 
AK103795GGTCCACGCoenzyme Q biosynthesis Coq4 family protein. 
J033076F14GGTCCACGNONE 
J065020P20GGTCCACGNONE 
J065057I21GGTCCACGNONE 
J065059P11GGTCCACGNONE 
J065083A22GGTCCACGNONE 
J065093K10GGTCCACGNONE 
J065097D03GGTCCACGNONE 
J065103P05GGTCCACGNONE 
J065113K09GGTCCACGNONE 
J065118F23GGTCCACGNONE 
J065119M06GGTCCACGNONE 
J065146K17GGTCCACGNONE 
J065161N12GGTCCACGNONE 
J065169L02GGTCCACGNONE 
J065189H12GGTCCACGNONE 
J065192E24GGTCCACGNONE 
J065193K17GGTCCACGNONE 
J065197O21GGTCCACGNONE 
J065214D09GGTCCACGNONE 
J065217B11GGTCCACGNONE 
J075132K07GGTCCACGNONE 
J100059D14GGTCCACGNONE 
Os04g0678400AK107524GGTCCACGNONE 
AY461803GGTCCACGZinc finger, Dof-type family protein. 
J075040H14GGTCCACGNONE 
J075066J21GGTCCACGNONE 
J075135K05GGTCCACGNONE 
Os05g0168500AK100711CGTGGACCNonaspanin (TM9SF) family protein. 
J013034G08CGTGGACCNONE 
J013039B03CGTGGACCNONE 
J013056H15CGTGGACCNONE 
J023003H09CGTGGACCNONE 
J023012B03CGTGGACCNONE 
J023115H14CGTGGACCNONE 
J023150N08CGTGGACCNONE 
J033055J19CGTGGACCNONE 
J053063M15CGTGGACCNONE 
J065013M18CGTGGACCNONE 
J065089N08CGTGGACCNONE 
J065209C13CGTGGACCNONE 
J100072F03CGTGGACCNONE 
Os05g0203900AK069504GGTCCACGGCCConserved hypothetical protein. 
J023019E20GGTCCACGGCCNONE 
Os05g0208500011-092-B12GGTCCACGNONE 
AK100789GGTCCACGNONE 
AK108343GGTCCACGConserved hypothetical protein. 
AK119570GGTCCACGNONE 
J023121A18GGTCCACGNONE 
J100067K07GGTCCACGNONE 
J100085E23GGTCCACGNONE 
Os05g0332600AK098926CGTGGACCNONE 
Os05g0346300009-033-C06CGTGGACCGGGCCNONE 
AF529175CGTGGACCGGGCCNONE 
AK061627CGTGGACCGGGCCSimilar to 40S ribosomal protein S7. 
AK103081CGTGGACCGGGCCNONE 
AK104191CGTGGACCGGGCCNONE 
J013049B09CGTGGACCGGGCCNONE 
J023142E24CGTGGACCGGGCCNONE 
J033052M14CGTGGACCGGGCCNONE 
J033089N04CGTGGACCGGGCCNONE 
J033118F01CGTGGACCGGGCCNONE 
J065054E07CGTGGACCGGGCCNONE 
J065066L18CGTGGACCGGGCCNONE 
J065078C21CGTGGACCGGGCCNONE 
J065127G23CGTGGACCGGGCCNONE 
J065128N24CGTGGACCGGGCCNONE 
J065144P17CGTGGACCGGGCCNONE 
J065147P14CGTGGACCGGGCCNONE 
J065170E16CGTGGACCGGGCCNONE 
J065175D17CGTGGACCGGGCCNONE 
J065176M05CGTGGACCGGGCCNONE 
J065218G20CGTGGACCGGGCCNONE 
J090074J12CGTGGACCGGGCCNONE 
J100019H16CGTGGACCGGGCCNONE 
J100031N24CGTGGACCGGGCCNONE 
J100072G08CGTGGACCGGGCCNONE 
J100086I23CGTGGACCGGGCCNONE 
Os05g0346400AK058872GGCCCGGTCCACGNONE 
AK102727GGCCCGGTCCACGProtein of unknown function DUF538 family protein. 
J033105N07GGCCCGGTCCACGNONE 
J100077I17GGCCCGGTCCACGNONE 
Os05g0357200014-046-H09CCACTGACACGTGGACCNONE 
014-046-H09GGTCCACGNONE 
AK064069CCACTGACACGTGGACCNONE 
AK064069GGTCCACGNONE 
AK072064CCACTGACACGTGGACCMitochondrial substrate carrier family protein. 
AK072064GGTCCACGMitochondrial substrate carrier family protein. 
J065038M01CCACTGACACGTGGACCNONE 
J065038M01GGTCCACGNONE 
J065121C16CCACTGACACGTGGACCNONE 
J065121C16GGTCCACGNONE 
J075173E09CCACTGACACGTGGACCNONE 
J075173E09GGTCCACGNONE 
J080307A20CCACTGACACGTGGACCNONE 
J080307A20GGTCCACGNONE 
J090046B19CCACTGACACGTGGACCNONE 
J090046B19GGTCCACGNONE 
J100033N12CCACTGACACGTGGACCNONE 
J100033N12GGTCCACGNONE 
J100036G01CCACTGACACGTGGACCNONE 
J100036G01GGTCCACGNONE 
J100057B19CCACTGACACGTGGACCNONE 
J100057B19GGTCCACGNONE 
Os05g0358000006-083-G07GGTCCACGNONE 
AK061141GGTCCACGNONE 
AK070900GGTCCACGNONE 
AK101263GGTCCACGDrought induced 19 family protein. 
J023098C13GGTCCACGNONE 
J033032J06GGTCCACGNONE 
J065014A09GGTCCACGNONE 
J065121L01GGTCCACGNONE 
J065130K19GGTCCACGNONE 
J065208B21GGTCCACGNONE 
J075080G14GGTCCACGNONE 
J075135L01GGTCCACGNONE 
J075180J15GGTCCACGNONE 
Os05g0430200J090095K16GGTCCACGGCCNONE 
Os05g0494100AK068320GGTCCACGGAACGHistone-fold domain containing protein. 
Os05g0506900AK106697CGTGGACCGTCCGATCBrix domain containing protein. 
Os05g0529200AK065770GGTCCACGEnoyl-CoA hydratase/isomerase domain containing protein. 
AK101348GGTCCACGNONE 
Os05g0529300AK102648GGTCCACGSimilar to ER lumen protein retaining receptor (HDEL receptor). 
AK102648GGTCCACGSimilar to ER lumen protein retaining receptor (HDEL receptor). 
Os05g0529400009-126-H06CGTGGACCNONE 
AK063846CGTGGACCConserved hypothetical protein. 
AK122038CGTGGACCNONE 
J033113C01CGTGGACCNONE 
Os06g0114700AK061552GGTCCACGProtein of unknown function DUF1218 family protein. 
AK098848GGTCCACGNONE 
AK122142GGTCCACGNONE 
J013000D16GGTCCACGNONE 
Os06g0152800003-125-D04GGTCCACGNONE 
AK099578GGTCCACGConserved hypothetical protein. 
Os06g0194000006-041-H12CCACCTGTCCCACGTGGACCNONE 
006-077-B02CCACCTGTCCCACGTGGACCNONE 
013-029-A09CCACCTGTCCCACGTGGACCNONE 
AF190770CCACCTGTCCCACGTGGACCNONE 
AK060742CCACCTGTCCCACGTGGACCNONE 
AK069833CCACCTGTCCCACGTGGACCSimilar to Ethylene-responsive transcription factor 3 (Ethylene-responsive element binding factor 3 homolog) (EREBP-5) (NtERF5). 
J013021K18CCACCTGTCCCACGTGGACCNONE 
J013060G01CCACCTGTCCCACGTGGACCNONE 
J013069I06CCACCTGTCCCACGTGGACCNONE 
J013134D15CCACCTGTCCCACGTGGACCNONE 
J013149A16CCACCTGTCCCACGTGGACCNONE 
J023031B06CCACCTGTCCCACGTGGACCNONE 
J023074E17CCACCTGTCCCACGTGGACCNONE 
J023091C14CCACCTGTCCCACGTGGACCNONE 
J023101P18CCACCTGTCCCACGTGGACCNONE 
J023106O14CCACCTGTCCCACGTGGACCNONE 
J023110J17CCACCTGTCCCACGTGGACCNONE 
J023110N02CCACCTGTCCCACGTGGACCNONE 
J023128D07CCACCTGTCCCACGTGGACCNONE 
J033024O19CCACCTGTCCCACGTGGACCNONE 
J033068G19CCACCTGTCCCACGTGGACCNONE 
J033095G01CCACCTGTCCCACGTGGACCNONE 
J033108C12CCACCTGTCCCACGTGGACCNONE 
J033114C23CCACCTGTCCCACGTGGACCNONE 
J043003E04CCACCTGTCCCACGTGGACCNONE 
J053023J03CCACCTGTCCCACGTGGACCNONE 
J053026B01CCACCTGTCCCACGTGGACCNONE 
J065172F15CCACCTGTCCCACGTGGACCNONE 
J075036K13CCACCTGTCCCACGTGGACCNONE 
J090020A10CCACCTGTCCCACGTGGACCNONE 
J090073E10CCACCTGTCCCACGTGGACCNONE 
J100034P18CCACCTGTCCCACGTGGACCNONE 
J100048O18CCACCTGTCCCACGTGGACCNONE 
J100064K09CCACCTGTCCCACGTGGACCNONE 
Os06g0324000AK109614GTGGGACCCACGTGGACCConserved hypothetical protein. 
Os06g0337100006-100-G05GGTCCACGCCGTTGGNONE 
AK061222GGTCCACGCCGTTGGConserved hypothetical protein. 
Os06g0621300AK068751TGGGACCCACGTGGACCConserved hypothetical protein. 
J013159I20TGGGACCCACGTGGACCNONE 
Os06g0646900AY222862CGTGGACCNONE 
Os06g0716700AB037681CCCCCGCGTGGACCSimilar to Endoplasmin homolog precursor (GRP94 homolog). 
AK063385CCCCCGCGTGGACCNONE 
AK102478CCCCCGCGTGGACCNONE 
J013030D18CCCCCGCGTGGACCNONE 
J090091L06CCCCCGCGTGGACCNONE 
Os07g0124100014-015-G11CCCCCGCGTGGACCNONE 
014-015-G11CGTGGACCNONE 
AJ276693CCCCCGCGTGGACCPhytosulfokines 4 precursor [Contains: Phytosulfokine-alpha (PSK- alpha) (Phytosulfokine-a); Phytosulfokine-beta (PSK-beta) (Phytosulfokine-b)]. 
AJ276693CGTGGACCPhytosulfokines 4 precursor [Contains: Phytosulfokine-alpha (PSK- alpha) (Phytosulfokine-a); Phytosulfokine-beta (PSK-beta) (Phytosulfokine-b)]. 
AK063647CCCCCGCGTGGACCNONE 
AK063647CGTGGACCNONE 
Os07g0483400AK108064GGCGTGGACCConserved hypothetical protein. 
Os07g0504601J065068H15CGTGGACCConserved hypothetical protein. 
J065095H08CGTGGACCNONE 
Os07g0544800009-021-C02GGTCCACGTGGCGNONE 
009-170-G02GGTCCACGTGGCGNONE 
009-178-H12GGTCCACGTGGCGNONE 
AK069170GGTCCACGTGGCGSimilar to Oxygen-evolving enhancer protein 3-2, chloroplast precursor (OEE3) (16 kDa subunit of oxygen evolving system of photosystem II) (OEC 16 kDa subunit) (Ferredoxin-NADP reductase binding protein) (BP). 
AK099127GGTCCACGTGGCGNONE 
J065088D21GGTCCACGTGGCGNONE 
J065106G19GGTCCACGTGGCGNONE 
J065156I24GGTCCACGTGGCGNONE 
J065162C10GGTCCACGTGGCGNONE 
J065211G14GGTCCACGTGGCGNONE 
J075003F05GGTCCACGTGGCGNONE 
J075046I10GGTCCACGTGGCGNONE 
J075055M11GGTCCACGTGGCGNONE 
J075074I12GGTCCACGTGGCGNONE 
J075088B06GGTCCACGTGGCGNONE 
J075091K13GGTCCACGTGGCGNONE 
J075093I10GGTCCACGTGGCGNONE 
J075097M09GGTCCACGTGGCGNONE 
J075106H11GGTCCACGTGGCGNONE 
J075121C22GGTCCACGTGGCGNONE 
J075145F05GGTCCACGTGGCGNONE 
J075173H16GGTCCACGTGGCGNONE 
J075190L07GGTCCACGTGGCGNONE 
J100063N21GGTCCACGTGGCGNONE 
J100073C24GGTCCACGTGGCGNONE 
J100085E01GGTCCACGTGGCGNONE 
J100088I23GGTCCACGTGGCGNONE 
Os07g0561500J090084P16GGTCCACGGlucose/ribitol dehydrogenase family protein. 
Os07g0574800006-097-G09GGTCCACGNONE 
013-077-E02GGTCCACGNONE 
014-010-B04GGTCCACGNONE 
AK067721GGTCCACGTubulin alpha-1 chain. 
AK069140GGTCCACGNONE 
AK104900GGTCCACGNONE 
J013037J23GGTCCACGNONE 
J013045O05GGTCCACGNONE 
J013056A21GGTCCACGNONE 
J013119N24GGTCCACGNONE 
J023036H19GGTCCACGNONE 
J023036K16GGTCCACGNONE 
J023067J23GGTCCACGNONE 
J023075H08GGTCCACGNONE 
J023084K13GGTCCACGNONE 
J023097O10GGTCCACGNONE 
J033093K22GGTCCACGNONE 
J033105L08GGTCCACGNONE 
J065219H05GGTCCACGNONE 
J075010N07GGTCCACGNONE 
J075130I08GGTCCACGNONE 
J090014E16GGTCCACGNONE 
J090025K17GGTCCACGNONE 
J090030L19GGTCCACGNONE 
J090035J05GGTCCACGNONE 
J090036B17GGTCCACGNONE 
J090037A15GGTCCACGNONE 
J090064C17GGTCCACGNONE 
J090069L18GGTCCACGNONE 
J090073N11GGTCCACGNONE 
J090077F23GGTCCACGNONE 
J090099F02GGTCCACGNONE 
J100029N06GGTCCACGNONE 
J100056I04GGTCCACGNONE 
J100061A13GGTCCACGNONE 
J100062B10GGTCCACGNONE 
J100062J17GGTCCACGNONE 
J100072F22GGTCCACGNONE 
J100072J22GGTCCACGNONE 
J100076C03GGTCCACGNONE 
X91808GGTCCACGNONE 
Z11931GGTCCACGNONE 
Os07g0622900006-108-G01GGTCCACGNONE 
AK059960GGTCCACGConserved hypothetical protein. 
J065176B03GGTCCACGNONE 
J080005P16GGTCCACGNONE 
J080009F09GGTCCACGNONE 
J080013F07GGTCCACGNONE 
J080016L01GGTCCACGNONE 
J080021K23GGTCCACGNONE 
J080023D15GGTCCACGNONE 
J080025D04GGTCCACGNONE 
J080039C01GGTCCACGNONE 
J080039G22GGTCCACGNONE 
J080043K06GGTCCACGNONE 
J080049H15GGTCCACGNONE 
J080051K09GGTCCACGNONE 
J080053I18GGTCCACGNONE 
J080067C12GGTCCACGNONE 
J080067G19GGTCCACGNONE 
J080068L22GGTCCACGNONE 
J080068M23GGTCCACGNONE 
J080077I06GGTCCACGNONE 
J080077J19GGTCCACGNONE 
J080080A18GGTCCACGNONE 
J080092J08GGTCCACGNONE 
Os07g0682800AK066262ACGCGTGGACCSimilar to Apyrase-like protein. 
Os07g0685300AK067645GGTCCACGSimilar to Phosphate starvation regulator protein (Regulatory protein of P- starvation acclimation response Psr1). 
Os08g0135900AK072535GGTCCACGSimilar to Tryptophan synthase beta chain 1 (EC 4.2.1.20) (Orange pericarp 1) (Fragment). 
Os08g0243900011-052-H03GGTCCACGNONE 
AK102707GGTCCACGNONE 
AK121452GGTCCACGMu2 adaptin subunit (AP50) of AP2 domain containing protein. 
J023142L20GGTCCACGNONE 
J065168E04GGTCCACGNONE 
Os08g0280100AK072150GGTCCACGNONE 
AK119420GGTCCACGSimilar to Phytase. 
Os08g0280200AK069036GCCACGTGGACCC2 calcium/lipid-binding region, CaLB domain containing protein. 
Os08g0398000AK101910GGTCCACGABC transporter related domain containing protein. 
Os08g0425700AK059408GGTCCACGSimilar to Annexin-like protein. 
AK104119GGTCCACGNONE 
J065063J06GGTCCACGNONE 
Os08g0457600AB095096GGTCCACGNONE 
AK065020GGTCCACGSimilar to RSH2. 
AK099624GGTCCACGNONE 
Os08g0535600AK121683GAGGCGTGGACCZinc finger, Tim10/DDP-type family protein. 
J065077E05GAGGCGTGGACCNONE 
J075088M24GAGGCGTGGACCNONE 
J075140B03GAGGCGTGGACCNONE 
J090014B14GAGGCGTGGACCNONE 
Os08g0541400003-128-C08AGTGACACGTGGACCNONE 
AK068255AGTGACACGTGGACCPeptidylprolyl isomerase, FKBP-type domain containing protein. 
AK104009AGTGACACGTGGACCNONE 
J013129J12AGTGACACGTGGACCNONE 
J013149F15AGTGACACGTGGACCNONE 
J065187N18AGTGACACGTGGACCNONE 
Os09g0135501J090008H08GGTCCACGConserved hypothetical protein. 
Os09g0394300AK105580GGCGTGGACCGlycoside hydrolase, family 9 protein. 
J100046E13GGCGTGGACCNONE 
J100049L10GGCGTGGACCNONE 
J100074H21GGCGTGGACCNONE 
J100090G03GGCGTGGACCNONE 
Os09g0394900AK061821GGTCCACGSimilar to Annexin-like protein. 
AK099102GGTCCACGNONE 
J013089B01GGTCCACGNONE 
J023112N20GGTCCACGNONE 
J100065I03GGTCCACGNONE 
Os09g0472900009-179-B12GGTCCACGNONE 
AK063132GGTCCACGSimilar to Blight-associated protein p12 precursor. 
J065022E01GGTCCACGNONE 
J065034L01GGTCCACGNONE 
J065073P13GGTCCACGNONE 
J065079I12GGTCCACGNONE 
J065144L22GGTCCACGNONE 
J065180K05GGTCCACGNONE 
J100063O18GGTCCACGNONE 
Os09g0527900AK122172CGTGGACCSimilar to Hd1-like protein. 
J033148H23CGTGGACCNONE 
J080070L07CGTGGACCNONE 
J090088G19CGTGGACCNONE 
Os11g0159000AK065738GGTCCACGConserved hypothetical protein. 
Os11g0283500AK101066GGTCCACGNONE 
AK105635GGTCCACGTGF-beta receptor, type I/II extracellular region family protein. 
J033023F23GGTCCACGNONE 
J065072H02GGTCCACGNONE 
J065085N15GGTCCACGNONE 
J065140C05GGTCCACGNONE 
J065168F02GGTCCACGNONE 
J100083G04GGTCCACGNONE 
Os11g0575900J100044H01CGTGGACCHypothetical protein. 
J100064A02CGTGGACCNONE 
Os12g0134000AK066940GGTCCACGCGCGACSimilar to Hydroxymethylglutaryl-CoA lyase. 
Os12g0180900AK110994CGTGGACCHypothetical protein. 
Os12g0616900AK063753GGTCCACGSimilar to Pyruvate dehydrogenase E1 beta subunit (Fragment). 
AK101464GGTCCACGNONE 
J033126J16GGTCCACGNONE 
J065140B05GGTCCACGNONE 
Os12g0625000006-117-H03CGTGGACCNONE 
006-117-H03GGTCCACGNONE 
AF073695CGTGGACCNONE 
AF073695GGTCCACGNONE 
AK061993CGTGGACCNONE 
AK061993GGTCCACGNONE 
AK099598CGTGGACCCysteine synthase (EC 2.5.1.47) (O-acetylserine sulfhydrylase) (O- acetylserine (Thiol)-lyase) (CSase) (OAS-TL). 
AK099598GGTCCACGCysteine synthase (EC 2.5.1.47) (O-acetylserine sulfhydrylase) (O- acetylserine (Thiol)-lyase) (CSase) (OAS-TL). 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.