
Summary of OsREG571 (All List)

OrganismOryza sativa  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count4229  

Entry Sequences (4229 entries)

LocusGene modelSequenceDescription
AK101133CGCGTGGGCCCGGASimilar to AP2 domain containing protein RAP2.6 (Fragment). 
AK101133GGGTGGGCCCACGCGTSimilar to AP2 domain containing protein RAP2.6 (Fragment). 
Os01g0132800AK068422TGCGGCCCACGTPeptidyl-tRNA hydrolase family protein. 
Os01g0138900AK058378CACGTGGGCCCACATGTCAGTGMandelate racemase/muconate lactonizing enzyme family protein. 
AK060948CCCGTGGGCCCCACAC3-oxo-5-alpha-steroid 4-dehydrogenase, C-terminal domain containing protein. 
Os01g0156300AK107993CCGTGGGCCACACGTCTCSimilar to Cappuccino protein. 
AK109475ACGTGGGCCTTGConserved hypothetical protein. 
AK071324CCGTGGGCCCACACNADH:cytochrome b5 reductase (CBR) family protein. 
AK065125CCCGTGGGCCCACCCGlutamyl-tRNA synthetase, class Ic family protein. 
AK065131CGTGTGGGGCCCACGTGTransferase family protein. 
AK105331CGCGTGGGCCCCConserved hypothetical protein. 
AK058815TCCGGCCCACGASimilar to Acidic ribosomal protein P2a-4 (Fragment). 
Os01g0192550J065164G16GACGGCCCACGGConserved hypothetical protein. 
Os01g0218700AK064992CGCGTGGGCCCGGCABC transporter, transmembrane region, type 1 domain containing protein. 
AK101946GAGGCCCACGTZinc finger, BED-type predicted domain containing protein. 
AK070838ACGTGGGCCGAAATetratricopeptide-like helical domain containing protein. 
AK070838ACGTGGGCCTCTetratricopeptide-like helical domain containing protein. 
Os01g0229200AK066024GAGGCCCACGTVHS domain containing protein. 
AK066024TTTCGGCCCACGTVHS domain containing protein. 
Os01g0239100Os01g0239100CACGGCCCACGCHeat shock protein DnaJ family protein. 
Os01g0253500J100088F12TCTGGGCCCACGAConserved hypothetical protein. 
J075061L04GACGGCCCAGGCCCACGGCCCACAConserved hypothetical protein. 
AK061002ACGTGGGCCGTASimilar to Histidine biosynthesis bifunctional protein hisIE, chloroplast precursor [Includes: Phosphoribosyl-AMP cyclohydrolase (EC (PRA-CH); Phosphoribosyl-ATP pyrophosphatase (EC (PRA-PH)]. 
J075157P20ACCGGCCCACGCMitochondrial import inner membrane translocase, subunit Tim17/22 family protein. 
AK121761GTGTGGGGCCCACGTGGGTCCCAProtein of unknown function DUF846, eukaryotic family protein. 
Os01g0346700AK071793CACGGCCCACGCConserved hypothetical protein. 
Os01g0349000AK108540GTGGGACCCACGTGGGCCCCACGTGTCAGTGConserved hypothetical protein. 
Os01g0352100AK072222GCGTGGGCCAC2OG-Fe(II) oxygenase domain containing protein. 
Os01g0508000AK069177TCCGGCCCACGCSimilar to Beta-glucosidase. 
Os01g0577600Os01g0577600GACACGTGGGCCCCACCProtein kinase-like domain containing protein. 
Os01g0598400AK109846CTGGCCCACGAACyclin-like F-box domain containing protein. 
Os01g0606900AK065697ACCGGCCCACGGHeat shock protein DnaJ, N-terminal domain containing protein. 
AK106203TTGGCCCACGASimilar to Plastid uroporphyrinogen decarboxylase (Fragment). 
AK062051ACGCGTGGGCCAGASimilar to 50S ribosomal protein L31. 
Os01g0679000AK058515CCGTGGGCCGTGRNA polymerase III subunit RPC82, C -terminal domain containing protein. 
Os01g0680400AK067914AAGGCCCACGCGTAFII28-like protein family protein. 
AK109275GTGGGACCCACGTGGGCCCCACAConserved hypothetical protein. 
Os01g0705300AK102719AGATGGGCCGTGGGCCGTGConserved hypothetical protein. 
Os01g0705500AK063120CACGGCCCACGGCCCATCTConserved hypothetical protein. 
J075110D21ACGTGGGCCAGGCCCSimilar to Serine acetyltransferase. 
J075110D21TCCGGGCCCACGCSimilar to Serine acetyltransferase. 
Os01g0727400AK065692AGGGCCCACGGGConserved hypothetical protein. 
Os01g0730300AK101207CAGGTGGGCCCACGGHAD-superfamily hydrolase subfamily IIB protein. 
Os01g0743400AK059177TCGTGGGCCTTSimilar to Tryptophanyl-tRNA synthetase (Fragment). 
AK067731ACGTGGGCCCCHAD-superfamily hydrolase subfamily IIB protein. 
Os01g0750900AK111087ACGTGGGCCTAConserved hypothetical protein. 
Os01g0764800AK102809GCGGGCCCACGTGSimilar to Nt-gh3 deduced protein. 
Os01g0767600AK070672GGGGCCCACGGGConserved hypothetical protein. 
AK070672GGTGGGGCCCACGGConserved hypothetical protein. 
AK103408GGGGCCCACGCGTCATCCACCRNA polymerase Rpb5, N-terminal domain containing protein. 
AK064237GTGGGGGCCCACGCProtein of unknown function DUF623, plant domain containing protein. 
Os01g0836400AK073540ACGTGGGCCCCASAC3/GANP family protein. 
AK063699GTGGGACCCACGTGGGCCCCACCConserved hypothetical protein. 
AK108582GGGCCGAGAGGCCCACGCGSimilar to MYBY1 protein (Fragment). 
Os01g0870100AK067564GTGGCCCACGGGProtein of unknown function DUF1012 family protein. 
AK121856ACGTGGGCCCCACCemp24/gp25L/p24 family protein. 
Os01g0888700AK073376ACCGGCCCACGCCTCProtein of unknown function RIO1 family protein. 
Os01g0889000AK103621ATGGCCCACGAGGCCCAAATTetratricopeptide-like helical domain containing protein. 
AK120577CCACGGCCCACGGCCCACGGOvarian tumour, otubain domain containing protein. 
AK073805TGTGGGGCCCACGGGTCAGTGGGACGTGGCSimilar to Regulatory protein viviparous-1. 
Os01g0915800AK103859TAGGCCCACGCGSimilar to FK506-binding protein 2-2 precursor (EC (Peptidyl-prolyl cis- trans isomerase) (PPIase) (Rotamase) (15 kDa FKBP) (FKBP-15-2). 
AK062434GGGGCCCACGTSimilar to Ubiquitin-like protein SMT3. 
Os01g0921600AK071344CCCGGGCCCACGTGTCSimilar to Mitochondrial import receptor subunit TOM20 (Translocase of outer membrane 20 kDa subunit). 
AK061690ACGTGGGCCGGASimilar to Chloroplast 50S ribosomal protein L27 (Fragment). 
Os01g0934500AK073211CCGTGGGCCGTAConserved hypothetical protein. 
AK073211GAGGCCCACGAAConserved hypothetical protein. 
AK103090TCGTGGGCCTCATGGGCCGCASimilar to Chloroplast SRP receptor cpFtsY precursor. 
AK103090TCGTGGGCCTCATGGGCCGCASimilar to Chloroplast SRP receptor cpFtsY precursor. 
Os01g0960400AK111512CCCGTGGGCCGTGGProtein kinase-like domain containing protein. 
Os01g0963300AK067544CTGGCCCACGGCCCACTSimilar to Syntaxin 61 (AtSYP61) (Osmotic stess-sensitive mutant 1). 
AK105694ATGGCCCACGTSimilar to Hydroperoxide lyase. 
AK102774TTGGCCCACGTGTCCSimilar to Syntaxin 52 (AtSYP52). 
AK070711CGGGCCCACGCGTConserved hypothetical protein. 
AK101060CTCGCGCGTGCGTGGGCCCCACCBax inhibitor-1 (BI-1) (OsBI-1). 
Os02g0140200AK066454TTCGTGGGCCCCACCACSimilar to Beta-amyrin synthase. 
AK070041CCGTGGGCCCACCACSimilar to Phosphoglycerate kinase, cytosolic (EC 
AK063815TTGGCCCACGAGGCCCATAAProtein transport protein SEC61 gamma subunit. 
Os02g0186700AK064492ATGGCCCACGCConserved hypothetical protein. 
AK061629CCCGTGGGCCGGCSimilar to Thioredoxin peroxidase. 
AK101237TGCGGCCCACGCGHypothetical protein. 
Os02g0205400AK101434GCGGCCCACGTGTCAGTGGWD40-like domain containing protein. 
AK104393ATCGGACGGCCCACGTSimilar to Epstein-Barr nuclear antigen-1 (EBNA-1). 
AK104393CCGTGGGCCCCACCCCCCACACSimilar to Epstein-Barr nuclear antigen-1 (EBNA-1). 
Os02g0226900AK064279CAGGCCCACGAACGGCCCProtein prenyltransferase domain containing protein. 
AK119874CCAGGCCCACGASWAP/Surp domain containing protein. 
Os02g0251900AK109286CCGTGGGCCCCACASimilar to Tobacco rattle virus-induced protein variant 2. 
AK103371TAGGCCCACGCGProtein prenyltransferase domain containing protein. 
AK103371TTCGTGGGCCGGGCCGGTCACTGACAProtein prenyltransferase domain containing protein. 
Os02g0302900AK110752CACTGACACGTGGGCCCCAReticulon family protein. 
Os02g0304800Os02g0304800TGGGGCCCACGTGProtein prenyltransferase domain containing protein. 
AK120516CCCCCGCGTCGTGGGCCCCACCTGMembrane attack complex component/perforin/complement C9 family protein. 
Os02g0499300AK106994CTGGCCCACCAACCGTGGGCCACConserved hypothetical protein. 
AK100315GCTGGGCCCACGTGTCProtein kinase-like domain containing protein. 
Os02g0537500AK068689GGCCCGGCCCACGGGSimilar to E2F homolog. 
AK121253CCGTGGGCCTCProtein of unknown function, ATP binding family protein. 
AK121253TGTGGGCTCTGGGCCGTGGGCCGTCProtein of unknown function, ATP binding family protein. 
Os02g0556700AK073875CACTGACACGTGGGCCCCACGCCTCT-complex 11 family protein. 
AK071800GCCGGCCCACGTCGGCCCATCASimilar to Gamma hydroxybutyrate dehydrogenase (EC 
AK073526CCGTGGGCCACSimilar to EL3 protein. 
AK070066CCGTGGGCCCCACAProtein of unknown function DUF962 family protein. 
AK072362CCCGGCCCACGGConserved hypothetical protein. 
AK101873TCGGCCCGGGTGGGGCCCACGCCCAGATBromodomain containing protein. 
AK066929CCGTGGGCCGTGSimilar to Myelin transcription factor 1 (MYT1) (MYTI) (Proteolipid protein binding protein) (PLPB1). 
AK066929GCCGGCCCACGTGSimilar to Myelin transcription factor 1 (MYT1) (MYTI) (Proteolipid protein binding protein) (PLPB1). 
AK066104AAGGCCCACGALUC7 related family protein. 
AK059205TTCGTGGGCCGGCConserved hypothetical protein. 
Os02g0636300AK100670CCGTGGGCCGTGGDEAD/DEAH box helicase, N-terminal domain containing protein. 
Os02g0643200AK106784TGCGGCCCACGCYABBY protein family protein. 
AK063685GGTGGGGCCCACGCGTSimilar to Short highly repeated, interspersed DNA (Fragment). 
Os02g0673700AB028130AACGGCCCACGCZinc finger, Dof-type family protein. 
AK106041GCGGCCCACGTSimilar to CRT/DRE binding factor 1. 
AK102055TCGTGGGCCCGCSimilar to Carbamoyl phosphate synthetase small subunit (EC 
Os02g0709200AK058999GTCGCGCGCGTGGGCCCCSimilar to Histidinol-phosphate aminotransferase, chloroplast precursor (EC (Imidazole acetol-phosphate transaminase). 
Os02g0721800AK100043CCACTGACGCGTGGGCCCCACASimilar to Phosphatidylinositol transfer-like protein IV. 
Os02g0731500J065098J18GCCACACGGCCCACGGAWPM-19-like family protein. 
AK066446GACACGTGGGCCCCACACSimilar to Starch synthase isoform zSTSII-2 (EC 
Os02g0745400AK072229AGGGCCCACGAGlycosyl transferase, family 8 protein. 
AK105696TATTGGGCCCACGAAmidase family protein. 
AK106639TGTGGGCCCACGTGSimilar to UDP-glucuronosyltransferase. 
AK066823CCCGGCCCACGTConserved hypothetical protein. 
AK072308ACGTGGGCCGAGReplication protein A 70kDa. 
Os02g0787100Os02g0787100GCGGCCCACGCProtein of unknown function DUF676, hydrolase-like domain containing protein. 
Os02g0792800AK105616GCGTGGGCCACSimilar to Rieske iron-sulfur protein Tic55 precursor. 
AK105863GAGGCCCACGAZinc finger, CCCH-type domain containing protein. 
AK105305GAGGCCCACGAASimilar to DEAD box-like RNA helicase (Fragment). 
AK105305TGCGGCCCACGASimilar to DEAD box-like RNA helicase (Fragment). 
Os02g0812500AK106918GTGGCGTGGGCCACCyclin-like F-box domain containing protein. 
Os02g0827300AK069159GGCCCGGCCCACGAGCCCAACCProtein of unknown function DUF382 domain containing protein. 
AK072547TGGGGGGTGCGTGGGCCCATGGGCCTGTranscriptional coactivator/pterin dehydratase family protein. 
Os03g0119100AK069519CCATGGGCCCACGGCCCATTSimilar to Phospholipase D beta 2. 
Os03g0124300AK069148ACGCGTGGGCCCCACCConserved hypothetical protein. 
Os03g0126900AK109217GTGGCGTGGGCCAAConserved hypothetical protein. 
Os03g0130400AK070255TCGTGGGCCCCAdenylate kinase, subfamily protein. 
AK100656CCGTGGGCCCCCACUbiquitin domain containing protein. 
Os03g0133400AK073032AAGGCCCACGPeptidoglycan-binding LysM domain containing protein. 
AK121641CGCGTGGGCCACSimilar to Cell division control protein 48 homolog A (AtCDC48a). 
AK103466CGGGCCCACGTGLupus La protein family protein. 
Os03g0167000AK107307CCCGTGGGCCGTGGConserved hypothetical protein. 
AK099490CCGTGGGCCCCACCACZinc finger, Dof-type family protein. 
Os03g0180100AK108326TCGTGGGCCCCACCCCACCACProtein of unknown function DUF1677, plant family protein. 
AY323478GCGGCCCACGGSimilar to Ethylene responsive element binding factor3 (OsERF3). 
J065154C08CCGTGGGCCGTCCGATCTarget SNARE coiled-coil region domain containing protein. 
AK069459TCAGGCCCACGTFrigida-like family protein. 
Os03g0206600AK058618GCTGGGCCCACGCProtein of unknown function DUF588 family protein. 
Os03g0210400AK065966ACGTGGGCCGCProtein prenyltransferase domain containing protein. 
Os03g0218400AK069202TCCGGCCCGTGGGCCGCSimilar to Hexose transporter. 
Os03g0238700AK073387TCGTGGGCCGCAGGCCCGCASimilar to Acid phosphatase type 5. 
AB037151GGACGGACGTGGGCCGAASimilar to 26S proteasome non-ATPase regulatory subunit 4 (26S proteasome regulatory subunit S5A) (Multiubiquitin chain binding protein). 
J065046A15TTCGGCCCACGTCCGTCCHypothetical protein. 
Os03g0260100AK066143GTGGCCCACGGCCCACCAConserved hypothetical protein. 
AK102826TCGGCCCACGTSplicing factor PWI domain containing protein. 
AK060821TCCGGCCCACGASimilar to Sigma factor SIG2B. 
Os03g0275700AK111329GTGGCCCACGCConserved hypothetical protein. 
Os03g0277000AK100522GTGGCCCACGGSimilar to GDP dissociation inhibitor protein OsGDI1. 
Os03g0284000Os03g0284000CACGTGGGCCGGAACGGCCCGConserved hypothetical protein. 
Os03g0294200AK069285CCCGTGGGCCCCACASimilar to Fructose-6-phosphate-2-kinase/fructose-2, 6-bisphosphatase. 
AK112010TCCGGCCCACGTZinc finger, RING-type domain containing protein. 
Os03g0306900AK073626CACGTGGGGTCGTGGGCCCCAGTENA/THI-4 protein domain containing protein. 
Os03g0307000J065032I03CTGGGGCCCACGACCCCACGTGHypothetical protein. 
AK100355CGACACGTGGGCCCAACAUbiquitin-conjugating enzyme, E2 domain containing protein. 
Os03g0309000AK070071GGCCGTGGGCCGTGVirulence factor, pectin lyase fold family protein. 
AK099476CACGTGGGCCACSimilar to Hypersensitive reaction associated Ca2+-binding protein. 
Os03g0312500AK106657CCCACGTGGGCCCCASimilar to Inhibitor of apoptosis-like protein. 
AK111447GGCCGTGGGCCGAGASimilar to WRKY transcription factor 55. 
Os03g0326600AK107632TCTGGGCCGTGGGCCCTTGGTGGGCCAARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
AK070859ACGTGGGCCGASimilar to Uroporphyrinogen decarboxylase (EC (URO-D) (UPD) (Fragment). 
AK102158CACGTGGGCCATSimilar to Sucrose synthase (EC 
AK102158TGTGGGGCCCACGGGTCAGTGGSimilar to Sucrose synthase (EC 
AK064815CACGTGGGCCTCDormancyauxin associated family protein. 
AK064815CCCGTGGGCCCCACDormancyauxin associated family protein. 
AK065547ACGTGGGCCTTSimilar to ASF/SF2-like pre-mRNA splicing factor SRP32''. 
Os03g0373300AK107897TCGTGGGCCCCACGTCTCProtein of unknown function DUF1110 family protein. 
Os03g0376000AK059565TGGATGGGCCCACGAemp24/gp25L/p24 family protein. 
Os03g0386000AK072984TGCGGCCCCCACCACCCGTGGGCCCACCTSimilar to WD domain protein-like. 
AK058567ATCGGACGGCCCACGTGProteasome subunit alpha type 2 (EC (20S proteasome alpha subunit B) (20S proteasome subunit alpha-2). 
Os03g0405100AK108624CCGTGGGCCCAACCRpsU-divergently transcribed family protein. 
J100029F12TCGTGGGCCGGGLike-Sm ribonucleoprotein, core family protein. 
AK120432TCGTGGGCCCAAGConserved hypothetical protein. 
AK063765TTCGTGGGCCTASimilar to Lysyl-tRNA synthetase (EC (Lysine--tRNA ligase) (LysRS). 
AB055076TCTGGCCCACGTGMitochondrial ATP synthase 6 KD subunit. 
AK070268GCGTGGGCCACGibberellin regulated protein family protein. 
AK112092GGGTGGGCTGTTCGTGGGCCTCCalcineurin B protein. 
Os03g0633900AK059181ACGTGGGCCCCACASingle-strand binding protein family protein. 
AK062094GGGCCGGCCCACGASimilar to RGP-3 (Fragment). 
Os03g0690000AK062756GATCGGACGGCCCACGCConserved hypothetical protein. 
AK073303TCGTGGGCCACGTCAlkaline phytoceramidase family protein. 
AK065161CCCGTGGGCCACSimilar to Ethylene receptor. 
AK103705CGCGTGGGCCTGGCCCACTHypothetical protein. 
AK063969TAGGCCCACGAASimilar to Dbr1-prov protein. 
Os03g0746600AK069559ACGTGGGCCACWD40-like domain containing protein. 
AK120423CCGTGGGCCGGTGGGCCCGProtein of unknown function UPF0139 family protein. 
AK102002CACGTGGGCCCCPlastocyanin-like domain containing protein. 
Os03g0758700AK106620TGCGGCCCACGGWD40-like domain containing protein. 
AK101534GAGGCCCACGTAnkyrin repeat containing protein. 
Os03g0774600AK066871CAGGCCCACGGHypothetical protein. 
Os03g0776900AK107941GCGGCCCACGASimilar to DNAJ protein-like. 
D13224CCCGTGGGCCCCACGTTubulin beta-1 chain (Beta-1 tubulin). 
Os03g0788800AK071670GTGGGGCCCACGCZinc finger, RING-type domain containing protein. 
Os03g0793100AK067897GTGGGACCCACGTGGGCCCCACAGlycosyl transferase, family 43 protein. 
AK105257TCGTGGGCCCCACCProtein of unknown function DUF506, plant family protein. 
Os03g0796800J065024O22CACGTGGGCCCCATCCAConserved hypothetical protein. 
J065024O22GCCACGTGGGCCCGGGConserved hypothetical protein. 
AK067446GGACGGCCCACGTACAGCCCATCAAGGCCCATATSimilar to Helix-loop-helix protein homolog. 
Os03g0798600AK121716GGCCGGGCCGGAACACGTGGGCCTASimilar to 40S ribosomal protein S15 (Fragment). 
AK104298TACGGCCCACGCTGCGGCCCSimilar to Dolichol-phosphate mannosyltransferase (EC (Dolichol- phosphate mannose synthase) (Dolichyl-phosphate beta-D- mannosyltransferase) (Mannose-P-dolichol synthase) (MPD synthase) (DPM synthase). 
Os03g0832200AK070712CCCGTGGGCCAGSimilar to Calcium-binding protein precursor (Calreticulin). 
AK070712GGCCGTGGGCCATSimilar to Calcium-binding protein precursor (Calreticulin). 
Os03g0833500AK119356GAGGCGTGGGCCTGSimilar to 98kDa HDM allergen. 
AK121918GAGGCCCACGAARNA 3'-terminal phosphate cyclase family protein. 
Os03g0843700AK070364ACACGTGGGCCTAFAR1 domain containing protein. 
AK063101AAGGCCCACGAProtein of unknown function DUF565 family protein. 
AK061374GGCTGGGCCCACGCGProtein of unknown function UPF0131 family protein. 
AK070523ACGTGGGCCGAAD111/G-patch domain containing protein. 
Os04g0122000AK065510CCGTGGGCCGCACGTGGGCTTTTLeucine rich repeat, N-terminal domain containing protein. 
Os04g0126800AK107895CCCGGGCCCACGGGHypothetical protein. 
Os04g0196600AK121999GGCCCACGAProtein of unknown function DUF563 family protein. 
Os04g0208400AK069629CACGTGGGCCGGCCyclin-like F-box domain containing protein. 
AK062814GCGTGGGCCCACGCCACACGACGCGTCCSimilar to Quinone-oxidoreductase QR1 (Fragment). 
AK063862CCCGTGGGGCCCACGCConserved hypothetical protein. 
AK101115ACGTGGGCCTGAProtein prenyltransferase domain containing protein. 
AK063700GTGGCCCACGASimilar to 22.7 kDa class IV heat shock protein precursor. 
Os04g0476000Os04g0476000TTCGTGGGCCCCACACGTetratricopeptide-like helical domain containing protein. 
Os04g0506300AK063591TCGTGGGCCCCACCCGTMS membrane protein/tumour differentially expressed protein family protein. 
AK063584CACGGCCCACGGC2 calcium/lipid-binding region, CaLB domain containing protein. 
AK062772CGCGTGGGCCACACGGlutathione peroxidase. 
Os04g0559400AK106376CCTGGGCCCACGCSimilar to Branched-chain-amino-acid aminotransferase 5, chloroplast precursor (EC (Atbcat-5). 
Os04g0563300AK100487CCCGGCCCACGCCyclin-like F-box domain containing protein. 
AK120614CCCGGCCCATAAGGCCCACGTSimilar to HMG1 protein. 
AK058888CCAGGCCCACGTAmino acid/polyamine transporter II family protein. 
AK065648TCTGGGCCCACGATatD-related deoxyribonuclease family protein. 
AK063093ATGGCCCACGCCACAAGCCCACAASimilar to Mitochondrial import inner membrane translocase subunit TIM13. 
AK063036CGCGTGGGCCTCConserved hypothetical protein. 
Os04g0640800AK065522GTGGCCCACGTGProgrammed cell death protein 2, C-terminal domain containing protein. 
AK065522TTTCGGCCCACGTTCCGTProgrammed cell death protein 2, C-terminal domain containing protein. 
Os04g0652900AK071125GTGGGGCCCACGGPeptidyl-tRNA hydrolase, PTH2 domain containing protein. 
AK119253CCACGGCCCACGGNucleolar, Nop52 family protein. 
Os04g0661200AK102842GCCACGTGGGCCCGCACCGCProtein of unknown function DUF941 family protein. 
AK103099TACGGCCCGGCCCATTTGGCCCACGAAOvarian tumour, otubain domain containing protein. 
Os04g0670500AK107506TTCGTGGGCCAAATGGGCCGGGCCGTACysteine protease 1 precursor (EC 3.4.22.-) (OsCP1). 
AK109377GCGGGCCCACGCConserved hypothetical protein. 
Os04g0675400AK068186CCGTGGGCCGTGSimilar to Chaperone protein dnaJ. 
AK106193GGGGCCCACGCGTProtein of unknown function DUF1218 family protein. 
Os04g0679800AK060662CCGTGGGCCCCACGSimilar to RNA-binding protein-like protein. 
Os04g0685100AK065262CCGTGGGCCGTCRibosomal biogenesis regulatory protein family protein. 
Os04g0685600AK067506GCGGCCCACGCGExo70 exocyst complex subunit family protein. 
AK101693ACGCGTGGGCCACSimilar to Amino acid selective channel protein. 
Os05g0119000AK069359GCGTGGGCCCCACCConserved hypothetical protein 245 family protein. 
Os05g0121800AK101222CCCACGCGTGGGCCCTConserved hypothetical protein. 
Os05g0145100AK107957CCGTGGGCCATCCCCCConserved hypothetical protein. 
AK121187CCACGGCCCACGCCCACTCCConserved hypothetical protein. 
AK072977CCACTGACAGCGTGGGCCCACAATP-dependent DNA helicase RecQ family protein. 
AK120877CCCACCACTCCGGCCCACGAGGCCCACCACSimilar to 60S ribosomal protein L18. 
AK120877CCGTGGGCCGGASimilar to 60S ribosomal protein L18. 
Os05g0163700AK071561CACTGACAGGTGGGGCCCACGCSimilar to Acyl-coenzyme A oxidase 4, peroxisomal (EC (AOX 4) (Short- chain acyl-CoA oxidase) (SAOX) (AtCX4) (G6p) (AtG6). 
AK072243CCCCCGCGTGGGCCCCACCCGSimilar to Fructose-6-phosphate 2-kinase/fructose-2,6-bisphosphatase (EC (EC (Fragment). 
AK072243GGCCCACGTSimilar to Fructose-6-phosphate 2-kinase/fructose-2,6-bisphosphatase (EC (EC (Fragment). 
Os05g0184901Os05g0184901CGCGTGGGCCGTASigma factor, regions 3 and 4 domain containing protein. 
Os05g0194550J075140P14GGACCCACGTGGGCCCCACAConserved hypothetical protein. 
Os05g0283600AK100359GCGTGGGCCGGTConserved hypothetical protein. 
Os05g0320700AK100598TCCGGGCCCACGTSimilar to Cytochrome P450. 
AK066255CGCGTGGGCCGCSimilar to WRKY transcription factor 45. 
Os05g0331200AK100884CCACGGCCCACGCSimilar to External rotenone-insensitive NADPH dehydrogenase. 
AK060058CCGTGGGCCTCConserved hypothetical protein. 
AK072064GCCCCACGTGGGCCCCACGCCTCMitochondrial substrate carrier family protein. 
AK072064TCGTGGGCCCCACGGCCMitochondrial substrate carrier family protein. 
AK101263CCCGTGGGCCCCACCDrought induced 19 family protein. 
AK071469ACGTGGGCCAGSimilar to Hydroxyisourate hydrolase. 
Os05g0392801J090025K15GTGGGACCCACGTGGGCCCCACGTConserved hypothetical protein. 
AK070832GGGGCCCACGGCCConserved hypothetical protein. 
AK070832TTCGTGGGGCCCACGAConserved hypothetical protein. 
AK060678CCGTGGGCCGTGGGCCGTGTwin-arginine translocation pathway signal domain containing protein. 
AK071931ACGTGGGCCCCACGTGTCConserved hypothetical protein. 
AK071931CCGTGGGCCCGConserved hypothetical protein. 
AK066000CACGTGGGCCCACCTProtein kinase-like domain containing protein. 
AK103559TCGTGGGCCCCACCACC2 calcium/lipid-binding region, CaLB domain containing protein. 
AK102786TACGGCCCACGCHistone deacetylase superfamily protein. 
AK121459TCCGGCCCATGGGCCGTGGGCCTCSimilar to 60S acidic ribosomal protein P2B. 
Os05g0451200AK073037ACCGGCCCACGTConserved hypothetical protein. 
Os05g0454400AK107942GCGTGGGCCCCACAConserved hypothetical protein. 
Os05g0463400AK100354CCGTGGGCCCCACAPWWP domain containing protein. 
Os05g0468700AB051864CCCGTGGGCCATAmmonium transporter. 
AK121022AGTGGGCCCTTCATGGGCCCACGCCACConserved hypothetical protein. 
Os05g0500500AK110627GCGGCCCACGGHSP20-like chaperone domain containing protein. 
Os05g0514300AK061747GCGTGGGCCCGSimilar to Tubby-like protein 3. 
AK105433TCGTGGGCCCCACAHeat shock protein 101. 
Os05g0529300AK102648GCGGGCCCACGTSimilar to ER lumen protein retaining receptor (HDEL receptor). 
AK063846ACGTGGGCCCGCConserved hypothetical protein. 
Os05g0535200AK070696TCTCGGCCCACGGCGTGGACyclin-like F-box domain containing protein. 
Os05g0537200AK121713GGCCGTGGGCCGTGGSimilar to Myosin XI (Fragment). 
AK103819CACGTGGGCCGCAFlap endonuclease-1a (EC 3.-.-.-) (OsFEN-1a). 
Os05g0542900AK102925GTGGCCCACGGCCCACGGCCCACGTGTVirulence factor, pectin lyase fold family protein. 
AK062890CGCGTGCGCTGGCCCACGGFerredoxin domain containing protein. 
AK102111CGTGTGGGGCCCACGCGArmadillo-like helical domain containing protein. 
AK099313CCAGGCCCACGTBeta-Ig-H3/fasciclin domain containing protein. 
Os05g0566800AK065748TCGTGGGCCGTCCold acclimation protein COR413-TM1. 
AK121133CGGGTGGGCCCACGCGDNA glycosylase family protein. 
AK063781TCATGGGCCCACGCProtein of unknown function DUF1645 family protein. 
Os05g0579500AK121528CCTGGGCCCACGAConserved hypothetical protein. 
Os05g0583400AK101992TGTGGGGCCCACGTGGGTCCCACSimilar to Mitochondrial import receptor subunit TOM7 (Translocase of outer membrane 7 kDa subunit). 
AK121601GCGTGGGCCCATGGSimilar to CONSTANS-like protein. 
AK070447AAGGCCCACGTPlastocyanin, chloroplast precursor. 
AK101235ACGTGGGCCAGCyclin-like F-box domain containing protein. 
Os06g0122200AK109712CCCGTGGGCCGAACGGCCCATGTConserved hypothetical protein. 
Os06g0129000Os06g0129000GACACGTGGGCCCTConserved hypothetical protein. 
Os06g0134900AK103205TCGTGGGCCTTConserved hypothetical protein. 
Os06g0144000AK068998TGTGGGCCCACGTGBRCT domain containing protein. 
Os06g0210500AK066979GGACGGCTGGGCCGTGGGCCCCCGTGGGCTGCCGTGGGCCTTSimilar to Mitochondrial phosphate transporter. 
Os06g0291600AK100261GACACGTGGGCCACSimilar to Protein kinase G11A (EC 2.7.1.-) (Fragment). 
Os06g0298500AK108252TAGGCCCACGGConserved hypothetical protein. 
Os06g0334600AK064993CCCGGCCCACGCGHypothetical protein. 
AK061222CTGGCCCACGGGTCAGTGGConserved hypothetical protein. 
Os06g0495500AK109873GCGTGGGCCATMulti antimicrobial extrusion protein MatE family protein. 
Os06g0542200AK058589TCGTGGGCCCTNADP oxidoreductase, coenzyme F420-dependent family protein. 
AK101229GCCACGTGGGCCCCACCBZR1, transcriptional repressor family protein. 
Os06g0562700AK109753GACGGCCCACGTConserved hypothetical protein. 
AK121337ATCCAACGGCCCACGGGProtein of unknown function UPF0197 family protein. 
AK106549AACGGCCCGTGGGCCGCAConserved hypothetical protein. 
Os06g0589500AK073322CACTGACACGTGGGCCCACGGConserved hypothetical protein. 
AK073322CCCGTGGGCCCCConserved hypothetical protein. 
Os06g0606800AK066355ACGTGGGCCACTargeting for Xklp2 family protein. 
Os06g0618000AK110866CACTGACACGTGGGCCCACCCGGTGTGGGGCCCACGCGTConserved hypothetical protein. 
Os06g0622700AK107021CGCGTGGGCCCCACCACEukaryotic transcription factor, DNA-binding domain containing protein. 
Os06g0642900AK073896GCCCACCCGGCCCACGCUbiquitin system component Cue domain containing protein. 
Os06g0648500AK106895CGGGTGGGGCCCACGGConserved hypothetical protein. 
AK062934GTGGCCCACGGHypothetical protein. 
Os06g0704300AK107008TCGTGGGCCGAAZinc finger, CCCH-type domain containing protein. 
AK071749GCCGGCCCACGASimilar to Sterol 4-alpha-methyl-oxidase (Fragment). 
Os07g0105300AK107419GCCGGCCCACGGGConserved hypothetical protein. 
Os07g0112600AK109561CACGTGGGCCTCConserved hypothetical protein. 
AJ276693GTTGGGCCCACGTGTPhytosulfokines 4 precursor [Contains: Phytosulfokine-alpha (PSK- alpha) (Phytosulfokine-a); Phytosulfokine-beta (PSK-beta) (Phytosulfokine-b)]. 
Os07g0136300AK064609GTCGCGCGTGGGCCGAGAConserved hypothetical protein. 
AK065558CGCGTGGGCCCCACTCCUDP-glucose 4-epimerase family protein. 
AK065248GATCCGACGTGGGCCAASimilar to 23 kDa polypeptide of photosystem II. 
Os07g0152800AK065458TACTGGGCCCACGTGTConserved hypothetical protein. 
AK062969GGGGCCCACGTGGGCCCCACGTGTCConserved hypothetical protein. 
AK106274TCGTGGGCCCGGAEsterase/lipase/thioesterase domain containing protein. 
Os07g0173200AK061624ACCGGGCCCACGTFrigida-like family protein. 
AK119398TTCGGCCCATTAAAGCCCATATAGGCCCACGAProtein prenyltransferase domain containing protein. 
AK070572AGGGCCCACGGGCCCATCGConserved hypothetical protein. 
Os07g0187300AK103069AAGGCCCACGAARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
AK103069CCCGTGGGCCGGARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os07g0191700AK066389ACCCGCGCGACGTGGGGCCCACGCSimilar to AT.I.24-9 protein (Fragment). 
AK062273CCGTGGGCCAGConserved hypothetical protein. 
Os07g0300900AK061941GCGTGGGCCTCSimilar to Lysine-sensitive aspartate kinase. 
AK073463CACGTGGGCCGGCSimilar to RNA helicase (Fragment). 
AK061383ACGTGGGCCTCSimilar to 26S proteasome subunit RPN12. 
AK120365TTGTGGGCTCGTGGGCCACSimilar to Thylakoid membrane phosphoprotein 14 kDa, chloroplast precursor. 
AK058326GAGGCCCACGCSimilar to SL15-like (Fragment). 
Os07g0486000AK069343AGGTGGGCCCACGTGSimilar to MSH4. 
Os07g0486500AK063998CGGGCCCACGTGTCGRho GTPase activation protein domain containing protein. 