version

Summary of OsREG571 (All List)

OrganismOryza sativa  
IDOsREG571  
SequenceCGTGGGCC  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count4229  

Entry Sequences (4229 entries)

LocusGene modelSequenceDescription
Os01g0131600006-030-A03CGCGTGGGCCCGGANONE 
006-030-A03GGGTGGGCCCACGCGTNONE 
006-049-C10CGCGTGGGCCCGGANONE 
006-049-C10GGGTGGGCCCACGCGTNONE 
006-054-E02CGCGTGGGCCCGGANONE 
006-054-E02GGGTGGGCCCACGCGTNONE 
011-035-H02CGCGTGGGCCCGGANONE 
011-035-H02GGGTGGGCCCACGCGTNONE 
011-036-E04CGCGTGGGCCCGGANONE 
011-036-E04GGGTGGGCCCACGCGTNONE 
012-047-C08CGCGTGGGCCCGGANONE 
012-047-C08GGGTGGGCCCACGCGTNONE 
012-079-F08CGCGTGGGCCCGGANONE 
012-079-F08GGGTGGGCCCACGCGTNONE 
012-097-C02CGCGTGGGCCCGGANONE 
012-097-C02GGGTGGGCCCACGCGTNONE 
012-100-A07CGCGTGGGCCCGGANONE 
012-100-A07GGGTGGGCCCACGCGTNONE 
013-015-H05CGCGTGGGCCCGGANONE 
013-015-H05GGGTGGGCCCACGCGTNONE 
013-047-A03CGCGTGGGCCCGGANONE 
013-047-A03GGGTGGGCCCACGCGTNONE 
013-051-B05CGCGTGGGCCCGGANONE 
013-051-B05GGGTGGGCCCACGCGTNONE 
013-061-G02CGCGTGGGCCCGGANONE 
013-061-G02GGGTGGGCCCACGCGTNONE 
013-077-H02CGCGTGGGCCCGGANONE 
013-077-H02GGGTGGGCCCACGCGTNONE 
015-005-D04CGCGTGGGCCCGGANONE 
015-005-D04GGGTGGGCCCACGCGTNONE 
015-064-B06CGCGTGGGCCCGGANONE 
015-064-B06GGGTGGGCCCACGCGTNONE 
015-072-D02CGCGTGGGCCCGGANONE 
015-072-D02GGGTGGGCCCACGCGTNONE 
016-073-E09CGCGTGGGCCCGGANONE 
016-073-E09GGGTGGGCCCACGCGTNONE 
016-088-H03CGCGTGGGCCCGGANONE 
016-088-H03GGGTGGGCCCACGCGTNONE 
AK062063CGCGTGGGCCCGGANONE 
AK062063GGGTGGGCCCACGCGTNONE 
AK101133CGCGTGGGCCCGGASimilar to AP2 domain containing protein RAP2.6 (Fragment). 
AK101133GGGTGGGCCCACGCGTSimilar to AP2 domain containing protein RAP2.6 (Fragment). 
AK102277CGCGTGGGCCCGGANONE 
AK102277GGGTGGGCCCACGCGTNONE 
AK119645CGCGTGGGCCCGGANONE 
AK119645GGGTGGGCCCACGCGTNONE 
AY341828CGCGTGGGCCCGGANONE 
AY341828GGGTGGGCCCACGCGTNONE 
J013036O08CGCGTGGGCCCGGANONE 
J013036O08GGGTGGGCCCACGCGTNONE 
J013037M17CGCGTGGGCCCGGANONE 
J013037M17GGGTGGGCCCACGCGTNONE 
J013039B11CGCGTGGGCCCGGANONE 
J013039B11GGGTGGGCCCACGCGTNONE 
J013039L20CGCGTGGGCCCGGANONE 
J013039L20GGGTGGGCCCACGCGTNONE 
J013047B20CGCGTGGGCCCGGANONE 
J013047B20GGGTGGGCCCACGCGTNONE 
J013048E23CGCGTGGGCCCGGANONE 
J013048E23GGGTGGGCCCACGCGTNONE 
J013051E12CGCGTGGGCCCGGANONE 
J013051E12GGGTGGGCCCACGCGTNONE 
J013051F12CGCGTGGGCCCGGANONE 
J013051F12GGGTGGGCCCACGCGTNONE 
J013056B05CGCGTGGGCCCGGANONE 
J013056B05GGGTGGGCCCACGCGTNONE 
J013057N24CGCGTGGGCCCGGANONE 
J013057N24GGGTGGGCCCACGCGTNONE 
J013064D21CGCGTGGGCCCGGANONE 
J013064D21GGGTGGGCCCACGCGTNONE 
J013065G24CGCGTGGGCCCGGANONE 
J013065G24GGGTGGGCCCACGCGTNONE 
J013075L13CGCGTGGGCCCGGANONE 
J013075L13GGGTGGGCCCACGCGTNONE 
J013075L24CGCGTGGGCCCGGANONE 
J013075L24GGGTGGGCCCACGCGTNONE 
J013092F04CGCGTGGGCCCGGANONE 
J013092F04GGGTGGGCCCACGCGTNONE 
J013092F10CGCGTGGGCCCGGANONE 
J013092F10GGGTGGGCCCACGCGTNONE 
J013092M16CGCGTGGGCCCGGANONE 
J013092M16GGGTGGGCCCACGCGTNONE 
J013096K06CGCGTGGGCCCGGANONE 
J013096K06GGGTGGGCCCACGCGTNONE 
J013111F10CGCGTGGGCCCGGANONE 
J013111F10GGGTGGGCCCACGCGTNONE 
J013120B17CGCGTGGGCCCGGANONE 
J013120B17GGGTGGGCCCACGCGTNONE 
J013120P07CGCGTGGGCCCGGANONE 
J013120P07GGGTGGGCCCACGCGTNONE 
J013122F18CGCGTGGGCCCGGANONE 
J013122F18GGGTGGGCCCACGCGTNONE 
J013122H23CGCGTGGGCCCGGANONE 
J013122H23GGGTGGGCCCACGCGTNONE 
J013126I15CGCGTGGGCCCGGANONE 
J013126I15GGGTGGGCCCACGCGTNONE 
J013126L17CGCGTGGGCCCGGANONE 
J013126L17GGGTGGGCCCACGCGTNONE 
J013129C15CGCGTGGGCCCGGANONE 
J013129C15GGGTGGGCCCACGCGTNONE 
J013146A04CGCGTGGGCCCGGANONE 
J013146A04GGGTGGGCCCACGCGTNONE 
J013146A06CGCGTGGGCCCGGANONE 
J013146A06GGGTGGGCCCACGCGTNONE 
J013153F01CGCGTGGGCCCGGANONE 
J013153F01GGGTGGGCCCACGCGTNONE 
J013156O06CGCGTGGGCCCGGANONE 
J013156O06GGGTGGGCCCACGCGTNONE 
J013162D05CGCGTGGGCCCGGANONE 
J013162D05GGGTGGGCCCACGCGTNONE 
J023008N04CGCGTGGGCCCGGANONE 
J023008N04GGGTGGGCCCACGCGTNONE 
J023010D06CGCGTGGGCCCGGANONE 
J023010D06GGGTGGGCCCACGCGTNONE 
J023011I23CGCGTGGGCCCGGANONE 
J023011I23GGGTGGGCCCACGCGTNONE 
J023023I15CGCGTGGGCCCGGANONE 
J023023I15GGGTGGGCCCACGCGTNONE 
J023025C08CGCGTGGGCCCGGANONE 
J023025C08GGGTGGGCCCACGCGTNONE 
J023029H02CGCGTGGGCCCGGANONE 
J023029H02GGGTGGGCCCACGCGTNONE 
J023033C18CGCGTGGGCCCGGANONE 
J023033C18GGGTGGGCCCACGCGTNONE 
J023037D21CGCGTGGGCCCGGANONE 
J023037D21GGGTGGGCCCACGCGTNONE 
J023049F17CGCGTGGGCCCGGANONE 
J023049F17GGGTGGGCCCACGCGTNONE 
J023052B15CGCGTGGGCCCGGANONE 
J023052B15GGGTGGGCCCACGCGTNONE 
J023061D03CGCGTGGGCCCGGANONE 
J023061D03GGGTGGGCCCACGCGTNONE 
J023062M01CGCGTGGGCCCGGANONE 
J023062M01GGGTGGGCCCACGCGTNONE 
J023089D24CGCGTGGGCCCGGANONE 
J023089D24GGGTGGGCCCACGCGTNONE 
J023109J20CGCGTGGGCCCGGANONE 
J023109J20GGGTGGGCCCACGCGTNONE 
J023109M21CGCGTGGGCCCGGANONE 
J023109M21GGGTGGGCCCACGCGTNONE 
J023120N04CGCGTGGGCCCGGANONE 
J023120N04GGGTGGGCCCACGCGTNONE 
J023122A04CGCGTGGGCCCGGANONE 
J023122A04GGGTGGGCCCACGCGTNONE 
J023134F23CGCGTGGGCCCGGANONE 
J023134F23GGGTGGGCCCACGCGTNONE 
J023149E20CGCGTGGGCCCGGANONE 
J023149E20GGGTGGGCCCACGCGTNONE 
J033022A12CGCGTGGGCCCGGANONE 
J033022A12GGGTGGGCCCACGCGTNONE 
J033022C04CGCGTGGGCCCGGANONE 
J033022C04GGGTGGGCCCACGCGTNONE 
J033024K06CGCGTGGGCCCGGANONE 
J033024K06GGGTGGGCCCACGCGTNONE 
J033026F23CGCGTGGGCCCGGANONE 
J033026F23GGGTGGGCCCACGCGTNONE 
J033029J19CGCGTGGGCCCGGANONE 
J033029J19GGGTGGGCCCACGCGTNONE 
J033040H20CGCGTGGGCCCGGANONE 
J033040H20GGGTGGGCCCACGCGTNONE 
J033042P21CGCGTGGGCCCGGANONE 
J033042P21GGGTGGGCCCACGCGTNONE 
J033043F14CGCGTGGGCCCGGANONE 
J033043F14GGGTGGGCCCACGCGTNONE 
J033044G11CGCGTGGGCCCGGANONE 
J033044G11GGGTGGGCCCACGCGTNONE 
J033052L10CGCGTGGGCCCGGANONE 
J033052L10GGGTGGGCCCACGCGTNONE 
J033052O03CGCGTGGGCCCGGANONE 
J033052O03GGGTGGGCCCACGCGTNONE 
J033052P03CGCGTGGGCCCGGANONE 
J033052P03GGGTGGGCCCACGCGTNONE 
J033079B20CGCGTGGGCCCGGANONE 
J033079B20GGGTGGGCCCACGCGTNONE 
J033089D21CGCGTGGGCCCGGANONE 
J033089D21GGGTGGGCCCACGCGTNONE 
J033094P04CGCGTGGGCCCGGANONE 
J033094P04GGGTGGGCCCACGCGTNONE 
J033103N02CGCGTGGGCCCGGANONE 
J033103N02GGGTGGGCCCACGCGTNONE 
J033110J19CGCGTGGGCCCGGANONE 
J033110J19GGGTGGGCCCACGCGTNONE 
J033114E17CGCGTGGGCCCGGANONE 
J033114E17GGGTGGGCCCACGCGTNONE 
J033115K04CGCGTGGGCCCGGANONE 
J033115K04GGGTGGGCCCACGCGTNONE 
J033119I06CGCGTGGGCCCGGANONE 
J033119I06GGGTGGGCCCACGCGTNONE 
J033121L10CGCGTGGGCCCGGANONE 
J033121L10GGGTGGGCCCACGCGTNONE 
J033123H14CGCGTGGGCCCGGANONE 
J033123H14GGGTGGGCCCACGCGTNONE 
J033136H10CGCGTGGGCCCGGANONE 
J033136H10GGGTGGGCCCACGCGTNONE 
J033139L07CGCGTGGGCCCGGANONE 
J033139L07GGGTGGGCCCACGCGTNONE 
J033143G23CGCGTGGGCCCGGANONE 
J033143G23GGGTGGGCCCACGCGTNONE 
J043021F16CGCGTGGGCCCGGANONE 
J043021F16GGGTGGGCCCACGCGTNONE 
J080304G01CGCGTGGGCCCGGANONE 
J080304G01GGGTGGGCCCACGCGTNONE 
J080305H24CGCGTGGGCCCGGANONE 
J080305H24GGGTGGGCCCACGCGTNONE 
J080309B11CGCGTGGGCCCGGANONE 
J080309B11GGGTGGGCCCACGCGTNONE 
J080315N09CGCGTGGGCCCGGANONE 
J080315N09GGGTGGGCCCACGCGTNONE 
J080319J20CGCGTGGGCCCGGANONE 
J080319J20GGGTGGGCCCACGCGTNONE 
J090014D01CGCGTGGGCCCGGANONE 
J090014D01GGGTGGGCCCACGCGTNONE 
J090067F08CGCGTGGGCCCGGANONE 
J090067F08GGGTGGGCCCACGCGTNONE 
J090079P18CGCGTGGGCCCGGANONE 
J090079P18GGGTGGGCCCACGCGTNONE 
J090082K13CGCGTGGGCCCGGANONE 
J090082K13GGGTGGGCCCACGCGTNONE 
J090093K17CGCGTGGGCCCGGANONE 
J090093K17GGGTGGGCCCACGCGTNONE 
J090099G18CGCGTGGGCCCGGANONE 
J090099G18GGGTGGGCCCACGCGTNONE 
J100022K14CGCGTGGGCCCGGANONE 
J100022K14GGGTGGGCCCACGCGTNONE 
J100052G17CGCGTGGGCCCGGANONE 
J100052G17GGGTGGGCCCACGCGTNONE 
Os01g0132800AK068422TGCGGCCCACGTPeptidyl-tRNA hydrolase family protein. 
Os01g0138900AK058378CACGTGGGCCCACATGTCAGTGMandelate racemase/muconate lactonizing enzyme family protein. 
Os01g0150000006-053-H07CCCGTGGGCCCCACACNONE 
006-081-C11CCCGTGGGCCCCACACNONE 
009-050-D04CCCGTGGGCCCCACACNONE 
AK060948CCCGTGGGCCCCACAC3-oxo-5-alpha-steroid 4-dehydrogenase, C-terminal domain containing protein. 
J023058M18CCCGTGGGCCCCACACNONE 
J023112H22CCCGTGGGCCCCACACNONE 
J065048P05CCCGTGGGCCCCACACNONE 
J100068N20CCCGTGGGCCCCACACNONE 
J100073A02CCCGTGGGCCCCACACNONE 
Os01g0156300AK107993CCGTGGGCCACACGTCTCSimilar to Cappuccino protein. 
Os01g0171200AK107515ACGTGGGCCTTGNONE 
AK109475ACGTGGGCCTTGConserved hypothetical protein. 
Os01g0174300012-006-G02CCGTGGGCCCACACNONE 
AK071324CCGTGGGCCCACACNADH:cytochrome b5 reductase (CBR) family protein. 
AK104306CCGTGGGCCCACACNONE 
J023089J04CCGTGGGCCCACACNONE 
J023107J15CCGTGGGCCCACACNONE 
J033084J16CCGTGGGCCCACACNONE 
J065097O20CCGTGGGCCCACACNONE 
J065099J15CCGTGGGCCCACACNONE 
J090006K02CCGTGGGCCCACACNONE 
J090023L17CCGTGGGCCCACACNONE 
J090088G14CCGTGGGCCCACACNONE 
Os01g0185200009-146-B06CCCGTGGGCCCACCCNONE 
009-163-F01CCCGTGGGCCCACCCNONE 
AK062984CCCGTGGGCCCACCCNONE 
AK065125CCCGTGGGCCCACCCGlutamyl-tRNA synthetase, class Ic family protein. 
AK105222CCCGTGGGCCCACCCNONE 
AK111284CCCGTGGGCCCACCCNONE 
Os01g0185300011-055-A05CGTGTGGGGCCCACGTGNONE 
015-007-B11CGTGTGGGGCCCACGTGNONE 
015-062-F05CGTGTGGGGCCCACGTGNONE 
015-078-C11CGTGTGGGGCCCACGTGNONE 
016-068-F07CGTGTGGGGCCCACGTGNONE 
016-074-F08CGTGTGGGGCCCACGTGNONE 
AK065131CGTGTGGGGCCCACGTGTransferase family protein. 
AK098922CGTGTGGGGCCCACGTGNONE 
J013000G12CGTGTGGGGCCCACGTGNONE 
J013001P14CGTGTGGGGCCCACGTGNONE 
J013002O23CGTGTGGGGCCCACGTGNONE 
J013096L23CGTGTGGGGCCCACGTGNONE 
J013097F24CGTGTGGGGCCCACGTGNONE 
J013120N24CGTGTGGGGCCCACGTGNONE 
J023007C15CGTGTGGGGCCCACGTGNONE 
J023119O12CGTGTGGGGCCCACGTGNONE 
J033039O11CGTGTGGGGCCCACGTGNONE 
J033043L11CGTGTGGGGCCCACGTGNONE 
J033061A07CGTGTGGGGCCCACGTGNONE 
J033076M13CGTGTGGGGCCCACGTGNONE 
J033082B04CGTGTGGGGCCCACGTGNONE 
J033143H15CGTGTGGGGCCCACGTGNONE 
J043013A02CGTGTGGGGCCCACGTGNONE 
J043036N21CGTGTGGGGCCCACGTGNONE 
J065013M09CGTGTGGGGCCCACGTGNONE 
J065082E22CGTGTGGGGCCCACGTGNONE 
J065093G01CGTGTGGGGCCCACGTGNONE 
J065120L06CGTGTGGGGCCCACGTGNONE 
J065135D03CGTGTGGGGCCCACGTGNONE 
J065197C10CGTGTGGGGCCCACGTGNONE 
J100024J10CGTGTGGGGCCCACGTGNONE 
J100042M22CGTGTGGGGCCCACGTGNONE 
J100077E12CGTGTGGGGCCCACGTGNONE 
J100084P03CGTGTGGGGCCCACGTGNONE 
Os01g0186900013-032-B12CGCGTGGGCCCCNONE 
013-069-C11CGCGTGGGCCCCNONE 
AK105323CGCGTGGGCCCCNONE 
AK105331CGCGTGGGCCCCConserved hypothetical protein. 
AK106168CGCGTGGGCCCCNONE 
J065023I10CGCGTGGGCCCCNONE 
J065182I03CGCGTGGGCCCCNONE 
J075116O22CGCGTGGGCCCCNONE 
J090082G13CGCGTGGGCCCCNONE 
J100060H12CGCGTGGGCCCCNONE 
Os01g0191100009-011-A02TCCGGCCCACGANONE 
009-028-D05TCCGGCCCACGANONE 
009-058-B11TCCGGCCCACGANONE 
009-151-D09TCCGGCCCACGANONE 
013-026-G03TCCGGCCCACGANONE 
013-063-F04TCCGGCCCACGANONE 
013-069-B05TCCGGCCCACGANONE 
014-029-E04TCCGGCCCACGANONE 
014-072-H04TCCGGCCCACGANONE 
014-089-E09TCCGGCCCACGANONE 
015-047-G05TCCGGCCCACGANONE 
016-033-G06TCCGGCCCACGANONE 
AK058815TCCGGCCCACGASimilar to Acidic ribosomal protein P2a-4 (Fragment). 
J023069C08TCCGGCCCACGANONE 
J023077K21TCCGGCCCACGANONE 
J023081F19TCCGGCCCACGANONE 
J033052N11TCCGGCCCACGANONE 
J033058N11TCCGGCCCACGANONE 
J033114G05TCCGGCCCACGANONE 
J033114O17TCCGGCCCACGANONE 
J033129L14TCCGGCCCACGANONE 
J053029I12TCCGGCCCACGANONE 
J065067N19TCCGGCCCACGANONE 
J065084I19TCCGGCCCACGANONE 
J065099O03TCCGGCCCACGANONE 
J065201I08TCCGGCCCACGANONE 
J075035B08TCCGGCCCACGANONE 
J075037B22TCCGGCCCACGANONE 
J075054L16TCCGGCCCACGANONE 
J075059D15TCCGGCCCACGANONE 
J075164I08TCCGGCCCACGANONE 
J075185J01TCCGGCCCACGANONE 
J090042O06TCCGGCCCACGANONE 
J090044F12TCCGGCCCACGANONE 
J090063L02TCCGGCCCACGANONE 
J090073I10TCCGGCCCACGANONE 
J090078E18TCCGGCCCACGANONE 
J100072K16TCCGGCCCACGANONE 
Os01g0192550J065164G16GACGGCCCACGGConserved hypothetical protein. 
Os01g0218700AK064992CGCGTGGGCCCGGCABC transporter, transmembrane region, type 1 domain containing protein. 
Os01g0222700012-011-E01GAGGCCCACGTNONE 
AK068883GAGGCCCACGTNONE 
AK101946GAGGCCCACGTZinc finger, BED-type predicted domain containing protein. 
J033075C16GAGGCCCACGTNONE 
J043013D08GAGGCCCACGTNONE 
J065089G19GAGGCCCACGTNONE 
J065197K19GAGGCCCACGTNONE 
J075161L21GAGGCCCACGTNONE 
Os01g0229100006-113-G08ACGTGGGCCGAAANONE 
006-113-G08ACGTGGGCCTCNONE 
011-075-E08ACGTGGGCCGAAANONE 
011-075-E08ACGTGGGCCTCNONE 
AK061285ACGTGGGCCGAAANONE 
AK061285ACGTGGGCCTCNONE 
AK070838ACGTGGGCCGAAATetratricopeptide-like helical domain containing protein. 
AK070838ACGTGGGCCTCTetratricopeptide-like helical domain containing protein. 
J013059F08ACGTGGGCCGAAANONE 
J013059F08ACGTGGGCCTCNONE 
J013059G08ACGTGGGCCGAAANONE 
J013059G08ACGTGGGCCTCNONE 
J013059G09ACGTGGGCCGAAANONE 
J013059G09ACGTGGGCCTCNONE 
J013069M12ACGTGGGCCGAAANONE 
J013069M12ACGTGGGCCTCNONE 
J013105A19ACGTGGGCCGAAANONE 
J013105A19ACGTGGGCCTCNONE 
J013149F07ACGTGGGCCGAAANONE 
J013149F07ACGTGGGCCTCNONE 
J023073J07ACGTGGGCCGAAANONE 
J023073J07ACGTGGGCCTCNONE 
J023130F24ACGTGGGCCGAAANONE 
J023130F24ACGTGGGCCTCNONE 
J023147J08ACGTGGGCCGAAANONE 
J023147J08ACGTGGGCCTCNONE 
J033028F13ACGTGGGCCGAAANONE 
J033028F13ACGTGGGCCTCNONE 
J033115A16ACGTGGGCCGAAANONE 
J033115A16ACGTGGGCCTCNONE 
J033135F02ACGTGGGCCGAAANONE 
J033135F02ACGTGGGCCTCNONE 
J065031G16ACGTGGGCCGAAANONE 
J065031G16ACGTGGGCCTCNONE 
J065058A09ACGTGGGCCGAAANONE 
J065058A09ACGTGGGCCTCNONE 
J065089N15ACGTGGGCCGAAANONE 
J065089N15ACGTGGGCCTCNONE 
J065130I09ACGTGGGCCGAAANONE 
J065130I09ACGTGGGCCTCNONE 
J065191P09ACGTGGGCCGAAANONE 
J065191P09ACGTGGGCCTCNONE 
J065197P14ACGTGGGCCGAAANONE 
J065197P14ACGTGGGCCTCNONE 
J080306D15ACGTGGGCCGAAANONE 
J080306D15ACGTGGGCCTCNONE 
J080308M06ACGTGGGCCGAAANONE 
J080308M06ACGTGGGCCTCNONE 
J080315A03ACGTGGGCCGAAANONE 
J080315A03ACGTGGGCCTCNONE 
J080315N11ACGTGGGCCGAAANONE 
J080315N11ACGTGGGCCTCNONE 
J090046E14ACGTGGGCCGAAANONE 
J090046E14ACGTGGGCCTCNONE 
J090058G09ACGTGGGCCGAAANONE 
J090058G09ACGTGGGCCTCNONE 
J090077H05ACGTGGGCCGAAANONE 
J090077H05ACGTGGGCCTCNONE 
J090087O20ACGTGGGCCGAAANONE 
J090087O20ACGTGGGCCTCNONE 
Os01g0229200AK066024GAGGCCCACGTVHS domain containing protein. 
AK066024TTTCGGCCCACGTVHS domain containing protein. 
Os01g0239100Os01g0239100CACGGCCCACGCHeat shock protein DnaJ family protein. 
Os01g0253500J100088F12TCTGGGCCCACGAConserved hypothetical protein. 
Os01g0258600J075028F17GACGGCCCAGGCCCACGGCCCACANONE 
J075061L04GACGGCCCAGGCCCACGGCCCACAConserved hypothetical protein. 
J075071B09GACGGCCCAGGCCCACGGCCCACANONE 
J075093E04GACGGCCCAGGCCCACGGCCCACANONE 
J100033B11GACGGCCCAGGCCCACGGCCCACANONE 
Os01g0271700J065184P16AGGGCCCACGTNONE 
J075182E21AGGGCCCACGTNONE 
J075191M19AGGGCCCACGTNONE 
J090021E22AGGGCCCACGTNONE 
Os01g0276500006-030-E04ACGTGGGCCGTANONE 
AK061002ACGTGGGCCGTASimilar to Histidine biosynthesis bifunctional protein hisIE, chloroplast precursor [Includes: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) (PRA-CH); Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31) (PRA-PH)]. 
AK099335ACGTGGGCCGTANONE 
Os01g0303300J053035N19ACCGGCCCACGCNONE 
J075042F02ACCGGCCCACGCNONE 
J075068E10ACCGGCCCACGCNONE 
J075116E19ACCGGCCCACGCNONE 
J075131C10ACCGGCCCACGCNONE 
J075145J11ACCGGCCCACGCNONE 
J075157P20ACCGGCCCACGCMitochondrial import inner membrane translocase, subunit Tim17/22 family protein. 
J075164G12ACCGGCCCACGCNONE 
Os01g0331900013-026-D04GTGTGGGGCCCACGTGGGTCCCANONE 
AK064784GTGTGGGGCCCACGTGGGTCCCANONE 
AK121761GTGTGGGGCCCACGTGGGTCCCAProtein of unknown function DUF846, eukaryotic family protein. 
J013000B15GTGTGGGGCCCACGTGGGTCCCANONE 
J033090D07GTGTGGGGCCCACGTGGGTCCCANONE 
J090006L21GTGTGGGGCCCACGTGGGTCCCANONE 
Os01g0346700AK071793CACGGCCCACGCConserved hypothetical protein. 
J023114F06CACGGCCCACGCNONE 
Os01g0349000AK108540GTGGGACCCACGTGGGCCCCACGTGTCAGTGConserved hypothetical protein. 
J065059M15GTGGGACCCACGTGGGCCCCACGTGTCAGTGNONE 
Os01g0352100AK072222GCGTGGGCCAC2OG-Fe(II) oxygenase domain containing protein. 
Os01g0508000AK069177TCCGGCCCACGCSimilar to Beta-glucosidase. 
Os01g0577600Os01g0577600GACACGTGGGCCCCACCProtein kinase-like domain containing protein. 
Os01g0598400AK109846CTGGCCCACGAACyclin-like F-box domain containing protein. 
Os01g0606900AK065697ACCGGCCCACGGHeat shock protein DnaJ, N-terminal domain containing protein. 
Os01g0622300006-041-C10TTGGCCCACGANONE 
AK072290TTGGCCCACGANONE 
AK099135TTGGCCCACGANONE 
AK106203TTGGCCCACGASimilar to Plastid uroporphyrinogen decarboxylase (Fragment). 
J065102E05TTGGCCCACGANONE 
J080044C04TTGGCCCACGANONE 
J080046E10TTGGCCCACGANONE 
J080050J18TTGGCCCACGANONE 
J080067B13TTGGCCCACGANONE 
J080072C04TTGGCCCACGANONE 
J080072J09TTGGCCCACGANONE 
J080075A16TTGGCCCACGANONE 
J080093E02TTGGCCCACGANONE 
Os01g0633000006-075-A01ACGCGTGGGCCAGANONE 
009-064-A11ACGCGTGGGCCAGANONE 
009-153-F07ACGCGTGGGCCAGANONE 
AK062051ACGCGTGGGCCAGASimilar to 50S ribosomal protein L31. 
J013073B08ACGCGTGGGCCAGANONE 
J065006K19ACGCGTGGGCCAGANONE 
J065053P08ACGCGTGGGCCAGANONE 
J065057D08ACGCGTGGGCCAGANONE 
J065086P07ACGCGTGGGCCAGANONE 
J065095C14ACGCGTGGGCCAGANONE 
J065116B05ACGCGTGGGCCAGANONE 
J065164L20ACGCGTGGGCCAGANONE 
J065185K19ACGCGTGGGCCAGANONE 
J065191E21ACGCGTGGGCCAGANONE 
J065199P21ACGCGTGGGCCAGANONE 
J065216M12ACGCGTGGGCCAGANONE 
J075002M09ACGCGTGGGCCAGANONE 
J075016N10ACGCGTGGGCCAGANONE 
J075041K05ACGCGTGGGCCAGANONE 
J075094E04ACGCGTGGGCCAGANONE 
J075154O04ACGCGTGGGCCAGANONE 
J075176D22ACGCGTGGGCCAGANONE 
J075186M09ACGCGTGGGCCAGANONE 
J075191H20ACGCGTGGGCCAGANONE 
Os01g0679000AK058515CCGTGGGCCGTGRNA polymerase III subunit RPC82, C -terminal domain containing protein. 
J013149O08CCGTGGGCCGTGNONE 
J033064N24CCGTGGGCCGTGNONE 
J043022M20CCGTGGGCCGTGNONE 
J065075K20CCGTGGGCCGTGNONE 
J065081K04CCGTGGGCCGTGNONE 
J065128K13CCGTGGGCCGTGNONE 
J065131K12CCGTGGGCCGTGNONE 
J065137H20CCGTGGGCCGTGNONE 
J065205A09CCGTGGGCCGTGNONE 
J090030C13CCGTGGGCCGTGNONE 
J090053I08CCGTGGGCCGTGNONE 
J090054O22CCGTGGGCCGTGNONE 
J090082C15CCGTGGGCCGTGNONE 
J090097P12CCGTGGGCCGTGNONE 
Os01g0680400AK067914AAGGCCCACGCGTAFII28-like protein family protein. 
J065039K13AAGGCCCACGCGNONE 
J065042K22AAGGCCCACGCGNONE 
J080016E23AAGGCCCACGCGNONE 
J080064E22AAGGCCCACGCGNONE 
Os01g0694800015-093-H11GTGGGACCCACGTGGGCCCCACANONE 
AK109275GTGGGACCCACGTGGGCCCCACAConserved hypothetical protein. 
Os01g0705300AK102719AGATGGGCCGTGGGCCGTGConserved hypothetical protein. 
AK103903AGATGGGCCGTGGGCCGTGNONE 
J013146O16AGATGGGCCGTGGGCCGTGNONE 
J023024O09AGATGGGCCGTGGGCCGTGNONE 
J033105F22AGATGGGCCGTGGGCCGTGNONE 
J033150L19AGATGGGCCGTGGGCCGTGNONE 
J075008G14AGATGGGCCGTGGGCCGTGNONE 
J090089L03AGATGGGCCGTGGGCCGTGNONE 
J100040H18AGATGGGCCGTGGGCCGTGNONE 
Os01g0705500AK063120CACGGCCCACGGCCCATCTConserved hypothetical protein. 
J065063M12CACGGCCCACGGCCCATCTNONE 
J065165C11CACGGCCCACGGCCCATCTNONE 
Os01g0720700J033124M22ACGTGGGCCAGGCCCNONE 
J033124M22TCCGGGCCCACGCNONE 
J065006G21ACGTGGGCCAGGCCCNONE 
J065006G21TCCGGGCCCACGCNONE 
J065025M24ACGTGGGCCAGGCCCNONE 
J065025M24TCCGGGCCCACGCNONE 
J065041J02ACGTGGGCCAGGCCCNONE 
J065041J02TCCGGGCCCACGCNONE 
J065044B14ACGTGGGCCAGGCCCNONE 
J065044B14TCCGGGCCCACGCNONE 
J065061J06ACGTGGGCCAGGCCCNONE 
J065061J06TCCGGGCCCACGCNONE 
J065116L21ACGTGGGCCAGGCCCNONE 
J065116L21TCCGGGCCCACGCNONE 
J075030F18ACGTGGGCCAGGCCCNONE 
J075030F18TCCGGGCCCACGCNONE 
J075034K17ACGTGGGCCAGGCCCNONE 
J075034K17TCCGGGCCCACGCNONE 
J075063I02ACGTGGGCCAGGCCCNONE 
J075063I02TCCGGGCCCACGCNONE 
J075110D21ACGTGGGCCAGGCCCSimilar to Serine acetyltransferase. 
J075110D21TCCGGGCCCACGCSimilar to Serine acetyltransferase. 
J075188L15ACGTGGGCCAGGCCCNONE 
J075188L15TCCGGGCCCACGCNONE 
J075197B17ACGTGGGCCAGGCCCNONE 
J075197B17TCCGGGCCCACGCNONE 
Os01g0727400AK065692AGGGCCCACGGGConserved hypothetical protein. 
Os01g0730300AK101207CAGGTGGGCCCACGGHAD-superfamily hydrolase subfamily IIB protein. 
AK109542CAGGTGGGCCCACGGNONE 
Os01g0743400AK059177TCGTGGGCCTTSimilar to Tryptophanyl-tRNA synthetase (Fragment). 
AK069114TCGTGGGCCTTNONE 
J065070E07TCGTGGGCCTTNONE 
J065152G11TCGTGGGCCTTNONE 
Os01g0749400AK064990ACGTGGGCCCCNONE 
AK067731ACGTGGGCCCCHAD-superfamily hydrolase subfamily IIB protein. 
AK103775ACGTGGGCCCCNONE 
J023001B06ACGTGGGCCCCNONE 
Os01g0750900AK111087ACGTGGGCCTAConserved hypothetical protein. 
J100042H18ACGTGGGCCTANONE 
J100044L13ACGTGGGCCTANONE 
Os01g0764800AK102809GCGGGCCCACGTGSimilar to Nt-gh3 deduced protein. 
Os01g0767600AK070672GGGGCCCACGGGConserved hypothetical protein. 
AK070672GGTGGGGCCCACGGConserved hypothetical protein. 
J013131M12GGGGCCCACGGGNONE 
J013131M12GGTGGGGCCCACGGNONE 
J023027B15GGGGCCCACGGGNONE 
J023027B15GGTGGGGCCCACGGNONE 
J023059I06GGGGCCCACGGGNONE 
J023059I06GGTGGGGCCCACGGNONE 
J023095L05GGGGCCCACGGGNONE 
J023095L05GGTGGGGCCCACGGNONE 
J033033E20GGGGCCCACGGGNONE 
J033033E20GGTGGGGCCCACGGNONE 
J033105F24GGGGCCCACGGGNONE 
J033105F24GGTGGGGCCCACGGNONE 
J033148N05GGGGCCCACGGGNONE 
J033148N05GGTGGGGCCCACGGNONE 
J065060H14GGGGCCCACGGGNONE 
J065060H14GGTGGGGCCCACGGNONE 
J090093E17GGGGCCCACGGGNONE 
J090093E17GGTGGGGCCCACGGNONE 
Os01g0805800006-057-H04GGGGCCCACGCGTCATCCACCNONE 
006-106-H01GGGGCCCACGCGTCATCCACCNONE 
AK059963GGGGCCCACGCGTCATCCACCNONE 
AK103408GGGGCCCACGCGTCATCCACCRNA polymerase Rpb5, N-terminal domain containing protein. 
Os01g0823500016-059-D03GTGGGGGCCCACGCNONE 
AK064237GTGGGGGCCCACGCProtein of unknown function DUF623, plant domain containing protein. 
Os01g0836400AK073540ACGTGGGCCCCASAC3/GANP family protein. 
J023019D11ACGTGGGCCCCANONE 
J023139O22ACGTGGGCCCCANONE 
J033042J20ACGTGGGCCCCANONE 
J033046M18ACGTGGGCCCCANONE 
J033124J09ACGTGGGCCCCANONE 
J090015E05ACGTGGGCCCCANONE 
J090076J09ACGTGGGCCCCANONE 
Os01g0840900014-051-F06GTGGGACCCACGTGGGCCCCACCNONE 
AK063699GTGGGACCCACGTGGGCCCCACCConserved hypothetical protein. 
Os01g0850400AJ575220GGGCCGAGAGGCCCACGCGNONE 
AK108582GGGCCGAGAGGCCCACGCGSimilar to MYBY1 protein (Fragment). 
Os01g0870100AK067564GTGGCCCACGGGProtein of unknown function DUF1012 family protein. 
AK072312GTGGCCCACGGGNONE 
AK103428GTGGCCCACGGGNONE 
Os01g0874700011-001-F02ACGTGGGCCCCACCNONE 
012-048-H01ACGTGGGCCCCACCNONE 
012-094-B02ACGTGGGCCCCACCNONE 
AK073077ACGTGGGCCCCACCNONE 
AK105447ACGTGGGCCCCACCNONE 
AK121856ACGTGGGCCCCACCemp24/gp25L/p24 family protein. 
J100026G07ACGTGGGCCCCACCNONE 
J100030F07ACGTGGGCCCCACCNONE 
J100066J18ACGTGGGCCCCACCNONE 
J100077G12ACGTGGGCCCCACCNONE 
J100081K23ACGTGGGCCCCACCNONE 
Os01g0888700AK073376ACCGGCCCACGCCTCProtein of unknown function RIO1 family protein. 
J033030B16ACCGGCCCACGCCTCNONE 
J033098D06ACCGGCCCACGCCTCNONE 
J033112A12ACCGGCCCACGCCTCNONE 
J043003L24ACCGGCCCACGCCTCNONE 
Os01g0889000AK103621ATGGCCCACGAGGCCCAAATTetratricopeptide-like helical domain containing protein. 
Os01g0900900009-066-B01CCACGGCCCACGGCCCACGGNONE 
009-137-A03CCACGGCCCACGGCCCACGGNONE 
AK120577CCACGGCCCACGGCCCACGGOvarian tumour, otubain domain containing protein. 
J023133N05CCACGGCCCACGGCCCACGGNONE 
Os01g0911700012-079-H01TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE 
012-088-G05TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE 
012-099-A01TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE 
015-009-H07TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE 
015-035-H12TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE 
016-054-G03TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE 
AK073805TGTGGGGCCCACGGGTCAGTGGGACGTGGCSimilar to Regulatory protein viviparous-1. 
AK105441TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE 
J033069I02TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE 
J033086K01TGTGGGGCCCACGGGTCAGTGGGACGTGGCNONE 
Os01g0915800AK103859TAGGCCCACGCGSimilar to FK506-binding protein 2-2 precursor (EC 5.2.1.8) (Peptidyl-prolyl cis- trans isomerase) (PPIase) (Rotamase) (15 kDa FKBP) (FKBP-15-2). 
J090051E20TAGGCCCACGCGNONE 
J090056H03TAGGCCCACGCGNONE 
J090058L14TAGGCCCACGCGNONE 
J090058P16TAGGCCCACGCGNONE 
J090076C19TAGGCCCACGCGNONE 
J100086P14TAGGCCCACGCGNONE 
Os01g0918200009-034-H02GGGGCCCACGTNONE 
AK062434GGGGCCCACGTSimilar to Ubiquitin-like protein SMT3. 
AK103092GGGGCCCACGTNONE 
J065093P18GGGGCCCACGTNONE 
J065137C15GGGGCCCACGTNONE 
J065156G01GGGGCCCACGTNONE 
J065206H16GGGGCCCACGTNONE 
J065209D03GGGGCCCACGTNONE 
J075073K05GGGGCCCACGTNONE 
J075099B17GGGGCCCACGTNONE 
J075166N04GGGGCCCACGTNONE 
Os01g0921600AK071344CCCGGGCCCACGTGTCSimilar to Mitochondrial import receptor subunit TOM20 (Translocase of outer membrane 20 kDa subunit). 
J013039J22CCCGGGCCCACGTGTCNONE 
J013109E03CCCGGGCCCACGTGTCNONE 
J023081J12CCCGGGCCCACGTGTCNONE 
J023091E24CCCGGGCCCACGTGTCNONE 
J033022A01CCCGGGCCCACGTGTCNONE 
J033074C13CCCGGGCCCACGTGTCNONE 
J065199E03CCCGGGCCCACGTGTCNONE 
J075172O04CCCGGGCCCACGTGTCNONE 
J090007G18CCCGGGCCCACGTGTCNONE 
J090052B17CCCGGGCCCACGTGTCNONE 
J090074H01CCCGGGCCCACGTGTCNONE 
J100043J09CCCGGGCCCACGTGTCNONE 
J100059J05CCCGGGCCCACGTGTCNONE 
Os01g0924000004-020-C09ACGTGGGCCGGANONE 
005-014-A06ACGTGGGCCGGANONE 
009-085-G12ACGTGGGCCGGANONE 
009-123-A08ACGTGGGCCGGANONE 
009-134-A05ACGTGGGCCGGANONE 
009-137-F06ACGTGGGCCGGANONE 
016-016-B08ACGTGGGCCGGANONE 
AF050674ACGTGGGCCGGANONE 
AK061690ACGTGGGCCGGASimilar to Chloroplast 50S ribosomal protein L27 (Fragment). 
AK120797ACGTGGGCCGGANONE 
J013040A15ACGTGGGCCGGANONE 
J013104L20ACGTGGGCCGGANONE 
J013127E12ACGTGGGCCGGANONE 
J013158O05ACGTGGGCCGGANONE 
J023012E09ACGTGGGCCGGANONE 
J023126L23ACGTGGGCCGGANONE 
J023143B03ACGTGGGCCGGANONE 
J065005B16ACGTGGGCCGGANONE 
J065101J15ACGTGGGCCGGANONE 
J065105K16ACGTGGGCCGGANONE 
J065155K16ACGTGGGCCGGANONE 
J065171M17ACGTGGGCCGGANONE 
J065182F07ACGTGGGCCGGANONE 
J065187D10ACGTGGGCCGGANONE 
J065194I24ACGTGGGCCGGANONE 
J065207E24ACGTGGGCCGGANONE 
J075001C24ACGTGGGCCGGANONE 
J075090O10ACGTGGGCCGGANONE 
J075095H17ACGTGGGCCGGANONE 
J075109M24ACGTGGGCCGGANONE 
J075123C18ACGTGGGCCGGANONE 
J075148G22ACGTGGGCCGGANONE 
J090009B09ACGTGGGCCGGANONE 
J090075K17ACGTGGGCCGGANONE 
J090081H23ACGTGGGCCGGANONE 
J090097H21ACGTGGGCCGGANONE 
J100063P14ACGTGGGCCGGANONE 
Os01g0934500AK073211CCGTGGGCCGTAConserved hypothetical protein. 
AK073211GAGGCCCACGAAConserved hypothetical protein. 
Os01g0958100AK058574TCGTGGGCCTCATGGGCCGCANONE 
AK058574TCGTGGGCCTCATGGGCCGCANONE 
AK103090TCGTGGGCCTCATGGGCCGCASimilar to Chloroplast SRP receptor cpFtsY precursor. 
AK103090TCGTGGGCCTCATGGGCCGCASimilar to Chloroplast SRP receptor cpFtsY precursor. 
AK109369TCGTGGGCCTCATGGGCCGCANONE 
AK109369TCGTGGGCCTCATGGGCCGCANONE 
Os01g0960400AK111512CCCGTGGGCCGTGGProtein kinase-like domain containing protein. 
Os01g0963300AK067544CTGGCCCACGGCCCACTSimilar to Syntaxin 61 (AtSYP61) (Osmotic stess-sensitive mutant 1). 
Os02g0110200009-041-B07ATGGCCCACGTNONE 
AK100012ATGGCCCACGTNONE 
AK105694ATGGCCCACGTSimilar to Hydroperoxide lyase. 
Os02g0119400AK060055TTGGCCCACGTGTCCNONE 
AK102774TTGGCCCACGTGTCCSimilar to Syntaxin 52 (AtSYP52). 
J033107H09TTGGCCCACGTGTCCNONE 
J075175F09TTGGCCCACGTGTCCNONE 
J090011H05TTGGCCCACGTGTCCNONE 
J090091O05TTGGCCCACGTGTCCNONE 
Os02g0121100012-035-F06CGGGCCCACGCGTNONE 
013-031-H05CGGGCCCACGCGTNONE 
013-058-E11CGGGCCCACGCGTNONE 
014-010-D01CGGGCCCACGCGTNONE 
AK070711CGGGCCCACGCGTConserved hypothetical protein. 
AK119758CGGGCCCACGCGTNONE 
J013033G12CGGGCCCACGCGTNONE 
J023007M16CGGGCCCACGCGTNONE 
J023020K20CGGGCCCACGCGTNONE 
J023061H10CGGGCCCACGCGTNONE 
J033027H20CGGGCCCACGCGTNONE 
J033051E18CGGGCCCACGCGTNONE 
J090005F12CGGGCCCACGCGTNONE 
J090017A20CGGGCCCACGCGTNONE 
J090018G11CGGGCCCACGCGTNONE 
J090062C18CGGGCCCACGCGTNONE 
J100027N10CGGGCCCACGCGTNONE 
J100032L14CGGGCCCACGCGTNONE 
J100045C14CGGGCCCACGCGTNONE 
J100061M09CGGGCCCACGCGTNONE 
J100062K11CGGGCCCACGCGTNONE 
J100064H11CGGGCCCACGCGTNONE 
J100074H16CGGGCCCACGCGTNONE 
J100082N01CGGGCCCACGCGTNONE 
Os02g0125300006-047-E06CTCGCGCGTGCGTGGGCCCCACCNONE 
006-088-F09CTCGCGCGTGCGTGGGCCCCACCNONE 
006-106-F10CTCGCGCGTGCGTGGGCCCCACCNONE 
AB025926CTCGCGCGTGCGTGGGCCCCACCNONE 
AK061564CTCGCGCGTGCGTGGGCCCCACCNONE 
AK061953CTCGCGCGTGCGTGGGCCCCACCNONE 
AK101060CTCGCGCGTGCGTGGGCCCCACCBax inhibitor-1 (BI-1) (OsBI-1). 
J013072O21CTCGCGCGTGCGTGGGCCCCACCNONE 
J023097A08CTCGCGCGTGCGTGGGCCCCACCNONE 
J023133F03CTCGCGCGTGCGTGGGCCCCACCNONE 
J033022C21CTCGCGCGTGCGTGGGCCCCACCNONE 
J033073C21CTCGCGCGTGCGTGGGCCCCACCNONE 
J033116O09CTCGCGCGTGCGTGGGCCCCACCNONE 
J033120E01CTCGCGCGTGCGTGGGCCCCACCNONE 
J065088M19CTCGCGCGTGCGTGGGCCCCACCNONE 
J065135O04CTCGCGCGTGCGTGGGCCCCACCNONE 
J080304J03CTCGCGCGTGCGTGGGCCCCACCNONE 
J090001K14CTCGCGCGTGCGTGGGCCCCACCNONE 
J090038D04CTCGCGCGTGCGTGGGCCCCACCNONE 
J090045G09CTCGCGCGTGCGTGGGCCCCACCNONE 
J090076E12CTCGCGCGTGCGTGGGCCCCACCNONE 
J090077D21CTCGCGCGTGCGTGGGCCCCACCNONE 
J100018J19CTCGCGCGTGCGTGGGCCCCACCNONE 
J100029M12CTCGCGCGTGCGTGGGCCCCACCNONE 
J100049D07CTCGCGCGTGCGTGGGCCCCACCNONE 
J100067G21CTCGCGCGTGCGTGGGCCCCACCNONE 
J100090D05CTCGCGCGTGCGTGGGCCCCACCNONE 
Os02g0140200AK066454TTCGTGGGCCCCACCACSimilar to Beta-amyrin synthase. 
Os02g0169300006-023-D12CCGTGGGCCCACCACNONE 
006-062-B01CCGTGGGCCCACCACNONE 
015-049-F11CCGTGGGCCCACCACNONE 
015-057-G02CCGTGGGCCCACCACNONE 
015-092-F04CCGTGGGCCCACCACNONE 
015-095-H02CCGTGGGCCCACCACNONE 
015-097-B07CCGTGGGCCCACCACNONE 
AK070041CCGTGGGCCCACCACSimilar to Phosphoglycerate kinase, cytosolic (EC 2.7.2.3). 
J013042K07CCGTGGGCCCACCACNONE 
J013134H23CCGTGGGCCCACCACNONE 
J013134J23CCGTGGGCCCACCACNONE 
J023036N24CCGTGGGCCCACCACNONE 
J023049C06CCGTGGGCCCACCACNONE 
J023077E10CCGTGGGCCCACCACNONE 
J023077F10CCGTGGGCCCACCACNONE 
J023105N12CCGTGGGCCCACCACNONE 
J033036O12CCGTGGGCCCACCACNONE 
J033064P11CCGTGGGCCCACCACNONE 
J033079F01CCGTGGGCCCACCACNONE 
J033123M22CCGTGGGCCCACCACNONE 
J033143E10CCGTGGGCCCACCACNONE 
J075013D12CCGTGGGCCCACCACNONE 
Os02g0178400009-151-B08TTGGCCCACGAGGCCCATAANONE 
AK063815TTGGCCCACGAGGCCCATAAProtein transport protein SEC61 gamma subunit. 
AK121516TTGGCCCACGAGGCCCATAANONE 
J033026A17TTGGCCCACGAGGCCCATAANONE 
J065011K14TTGGCCCACGAGGCCCATAANONE 
J065056D01TTGGCCCACGAGGCCCATAANONE 
J065061L22TTGGCCCACGAGGCCCATAANONE 
J065076M01TTGGCCCACGAGGCCCATAANONE 
J075092E14TTGGCCCACGAGGCCCATAANONE 
Os02g0186700AK064492ATGGCCCACGCConserved hypothetical protein. 
J065210K09ATGGCCCACGCNONE 
J075006A17ATGGCCCACGCNONE 
J075108C18ATGGCCCACGCNONE 
J075153E08ATGGCCCACGCNONE 
Os02g0192700004-020-H12CCCGTGGGCCGGCNONE 
006-024-H06CCCGTGGGCCGGCNONE 
006-042-F06CCCGTGGGCCGGCNONE 
006-050-D04CCCGTGGGCCGGCNONE 
006-059-E10CCCGTGGGCCGGCNONE 
006-070-B02CCCGTGGGCCGGCNONE 
006-084-A09CCCGTGGGCCGGCNONE 
006-114-E11CCCGTGGGCCGGCNONE 
006-117-E05CCCGTGGGCCGGCNONE 
009-126-D11CCCGTGGGCCGGCNONE 
AK061629CCCGTGGGCCGGCSimilar to Thioredoxin peroxidase. 
AK065909CCCGTGGGCCGGCNONE 
J013043E11CCCGTGGGCCGGCNONE 
J065038I09CCCGTGGGCCGGCNONE 
J065078C12CCCGTGGGCCGGCNONE 
J065122O14CCCGTGGGCCGGCNONE 
J065198H04CCCGTGGGCCGGCNONE 
Os02g0193500009-092-G09TGCGGCCCACGCGNONE 
AK101237TGCGGCCCACGCGHypothetical protein. 
J033031K13TGCGGCCCACGCGNONE 
J033034P12TGCGGCCCACGCGNONE 
J080304L19TGCGGCCCACGCGNONE 
J100059N21TGCGGCCCACGCGNONE 
Os02g0205400AK101434GCGGCCCACGTGTCAGTGGWD40-like domain containing protein. 
J043024M20GCGGCCCACGTGTCAGTGGNONE 
Os02g0208200J023104K09TCCGGCCCACGTNONE 
J033080L20TCCGGCCCACGTNONE 
J033105D08TCCGGCCCACGTNONE 
J090079N16TCCGGCCCACGTNONE 
Os02g0219900004-018-E11ATCGGACGGCCCACGTNONE 
004-018-E11CCGTGGGCCCCACCCCCCACACNONE 
AK060915ATCGGACGGCCCACGTNONE 
AK060915CCGTGGGCCCCACCCCCCACACNONE 
AK099194ATCGGACGGCCCACGTNONE 
AK099194CCGTGGGCCCCACCCCCCACACNONE 
AK104206ATCGGACGGCCCACGTNONE 
AK104206CCGTGGGCCCCACCCCCCACACNONE 
AK104393ATCGGACGGCCCACGTSimilar to Epstein-Barr nuclear antigen-1 (EBNA-1). 
AK104393CCGTGGGCCCCACCCCCCACACSimilar to Epstein-Barr nuclear antigen-1 (EBNA-1). 
J023109D07ATCGGACGGCCCACGTNONE 
J023109D07CCGTGGGCCCCACCCCCCACACNONE 
Os02g0226900AK064279CAGGCCCACGAACGGCCCProtein prenyltransferase domain containing protein. 
Os02g0245000AK119770CCAGGCCCACGANONE 
AK119874CCAGGCCCACGASWAP/Surp domain containing protein. 
J065038L11CCAGGCCCACGANONE 
J100059I06CCAGGCCCACGANONE 
J100076C23CCAGGCCCACGANONE 
J100081P08CCAGGCCCACGANONE 
J100084C13CCAGGCCCACGANONE 
Os02g0251900AK109286CCGTGGGCCCCACASimilar to Tobacco rattle virus-induced protein variant 2. 
Os02g0266200AK099647TAGGCCCACGCGNONE 
AK099647TTCGTGGGCCGGGCCGGTCACTGACANONE 
AK103371TAGGCCCACGCGProtein prenyltransferase domain containing protein. 
AK103371TTCGTGGGCCGGGCCGGTCACTGACAProtein prenyltransferase domain containing protein. 
Os02g0302900AK110752CACTGACACGTGGGCCCCAReticulon family protein. 
Os02g0304800Os02g0304800TGGGGCCCACGTGProtein prenyltransferase domain containing protein. 
Os02g0475300AK072737CCCCCGCGTCGTGGGCCCCACCTGNONE 
AK120516CCCCCGCGTCGTGGGCCCCACCTGMembrane attack complex component/perforin/complement C9 family protein. 
Os02g0499300AK106994CTGGCCCACCAACCGTGGGCCACConserved hypothetical protein. 
Os02g0502500011-068-G11GCTGGGCCCACGTGTCNONE 
AK100111GCTGGGCCCACGTGTCNONE 
AK100315GCTGGGCCCACGTGTCProtein kinase-like domain containing protein. 
J013074C19GCTGGGCCCACGTGTCNONE 
J013153K16GCTGGGCCCACGTGTCNONE 
J023078O21GCTGGGCCCACGTGTCNONE 
J033127M18GCTGGGCCCACGTGTCNONE 
J043038D17GCTGGGCCCACGTGTCNONE 
J065090L08GCTGGGCCCACGTGTCNONE 
J065110P16GCTGGGCCCACGTGTCNONE 
J065163C03GCTGGGCCCACGTGTCNONE 
J065213D23GCTGGGCCCACGTGTCNONE 
J090010M14GCTGGGCCCACGTGTCNONE 
J090016E02GCTGGGCCCACGTGTCNONE 
J090044J20GCTGGGCCCACGTGTCNONE 
J090091M16GCTGGGCCCACGTGTCNONE 
J090099I23GCTGGGCCCACGTGTCNONE 
Os02g0537500AK068689GGCCCGGCCCACGGGSimilar to E2F homolog. 
Os02g0555000015-020-G02CCGTGGGCCTCNONE 
015-020-G02TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
AK065270CCGTGGGCCTCNONE 
AK065270TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
AK121253CCGTGGGCCTCProtein of unknown function, ATP binding family protein. 
AK121253TGTGGGCTCTGGGCCGTGGGCCGTCProtein of unknown function, ATP binding family protein. 
J013002L01CCGTGGGCCTCNONE 
J013002L01TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
J023060A02CCGTGGGCCTCNONE 
J023060A02TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
J023101O11CCGTGGGCCTCNONE 
J023101O11TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
J023140A15CCGTGGGCCTCNONE 
J023140A15TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
J033042H19CCGTGGGCCTCNONE 
J033042H19TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
J033046C02CCGTGGGCCTCNONE 
J033046C02TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
J033080N19CCGTGGGCCTCNONE 
J033080N19TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
J065026I02CCGTGGGCCTCNONE 
J065026I02TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
J065040C18CCGTGGGCCTCNONE 
J065040C18TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
J090004I16CCGTGGGCCTCNONE 
J090004I16TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
Os02g0556700AK073875CACTGACACGTGGGCCCCACGCCTCT-complex 11 family protein. 
Os02g0562700006-035-C05GCCGGCCCACGTCGGCCCATCANONE 
AB110167GCCGGCCCACGTCGGCCCATCANONE 
AK071800GCCGGCCCACGTCGGCCCATCASimilar to Gamma hydroxybutyrate dehydrogenase (EC 1.1.1.61). 
AK104168GCCGGCCCACGTCGGCCCATCANONE 
AK109435GCCGGCCCACGTCGGCCCATCANONE 
AY224558GCCGGCCCACGTCGGCCCATCANONE 
J023013M13GCCGGCCCACGTCGGCCCATCANONE 
J023059I08GCCGGCCCACGTCGGCCCATCANONE 
J023084C06GCCGGCCCACGTCGGCCCATCANONE 
J023114G06GCCGGCCCACGTCGGCCCATCANONE 
J023142A09GCCGGCCCACGTCGGCCCATCANONE 
J033026E14GCCGGCCCACGTCGGCCCATCANONE 
J053042M10GCCGGCCCACGTCGGCCCATCANONE 
J053082K21GCCGGCCCACGTCGGCCCATCANONE 
J065105J15GCCGGCCCACGTCGGCCCATCANONE 
J065150F02GCCGGCCCACGTCGGCCCATCANONE 
J075177H05GCCGGCCCACGTCGGCCCATCANONE 
J080040B16GCCGGCCCACGTCGGCCCATCANONE 
J090077J10GCCGGCCCACGTCGGCCCATCANONE 
Os02g0564100006-072-A11CCGTGGGCCACNONE 
AK073526CCGTGGGCCACSimilar to EL3 protein. 
AK105951CCGTGGGCCACNONE 
J100045C15CCGTGGGCCACNONE 
Os02g0578800009-044-A06CCGTGGGCCCCACANONE 
AK070066CCGTGGGCCCCACAProtein of unknown function DUF962 family protein. 
Os02g0593400016-051-C08CCCGGCCCACGGNONE 
AK064226CCCGGCCCACGGNONE 
AK072362CCCGGCCCACGGConserved hypothetical protein. 
AK109015CCCGGCCCACGGNONE 
J023063B12CCCGGCCCACGGNONE 
J065192M02CCCGGCCCACGGNONE 
J075182N05CCCGGCCCACGGNONE 
Os02g0601800AB060276TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
AK099539TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
AK101873TCGGCCCGGGTGGGGCCCACGCCCAGATBromodomain containing protein. 
AK106801TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
AK121758TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
AK121891TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J013059H01TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J013092F08TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J013146J04TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J023001K12TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J023002H16TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J023013B10TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J023081I22TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J023084K19TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J023150E24TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J033023B18TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J033025F18TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J033048P08TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J033060M24TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J033070G06TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J033088P12TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J033105C13TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J043009N18TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J065103G21TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J075039H15TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090014K10TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090022N02TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090033F18TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090033I04TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090041F11TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090045P20TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090054B01TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090055M12TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090071K09TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090098O16TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J090099P15TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
J100050I16TCGGCCCGGGTGGGGCCCACGCCCAGATNONE 
Os02g0602300AK065609CCGTGGGCCGTGNONE 
AK065609GCCGGCCCACGTGNONE 
AK066929CCGTGGGCCGTGSimilar to Myelin transcription factor 1 (MYT1) (MYTI) (Proteolipid protein binding protein) (PLPB1). 
AK066929GCCGGCCCACGTGSimilar to Myelin transcription factor 1 (MYT1) (MYTI) (Proteolipid protein binding protein) (PLPB1). 
J013092L08CCGTGGGCCGTGNONE 
J013092L08GCCGGCCCACGTGNONE 
J090040I23CCGTGGGCCGTGNONE 
J090040I23GCCGGCCCACGTGNONE 
Os02g0605600016-017-B02AAGGCCCACGANONE 
AK066104AAGGCCCACGALUC7 related family protein. 
J013052G16AAGGCCCACGANONE 
J043022E03AAGGCCCACGANONE 
J065105P10AAGGCCCACGANONE 
Os02g0610700014-008-A03TTCGTGGGCCGGCNONE 
AK059205TTCGTGGGCCGGCConserved hypothetical protein. 
AK100281TTCGTGGGCCGGCNONE 
J023074H03TTCGTGGGCCGGCNONE 
J065002J16TTCGTGGGCCGGCNONE 
J065032I20TTCGTGGGCCGGCNONE 
J065076A07TTCGTGGGCCGGCNONE 
J065142O21TTCGTGGGCCGGCNONE 
J065203A03TTCGTGGGCCGGCNONE 
J075017F24TTCGTGGGCCGGCNONE 
J075017G24TTCGTGGGCCGGCNONE 
Os02g0614600AK058581TCGTGGGCCTCNONE 
Os02g0636300AK100670CCGTGGGCCGTGGDEAD/DEAH box helicase, N-terminal domain containing protein. 
J013149P11CCGTGGGCCGTGGNONE 
J023022F15CCGTGGGCCGTGGNONE 
J023112J15CCGTGGGCCGTGGNONE 
J023145M22CCGTGGGCCGTGGNONE 
J043017P16CCGTGGGCCGTGGNONE 
Os02g0643200AK106784TGCGGCCCACGCYABBY protein family protein. 
J075048L13TGCGGCCCACGCNONE 
Os02g0644000AB081464GTGGCGTGGGCCGTCGGATCNONE 
AK101360GTGGCGTGGGCCGTCGGATCNONE 
AY062178GTGGCGTGGGCCGTCGGATCNONE 
J023043E22GTGGCGTGGGCCGTCGGATCNONE 
J033024F05GTGGCGTGGGCCGTCGGATCNONE 
J033035H01GTGGCGTGGGCCGTCGGATCNONE 
J033042J19GTGGCGTGGGCCGTCGGATCNONE 
J033057G18GTGGCGTGGGCCGTCGGATCNONE 
J033111F09GTGGCGTGGGCCGTCGGATCNONE 
J033115L11GTGGCGTGGGCCGTCGGATCNONE 
J033143I16GTGGCGTGGGCCGTCGGATCNONE 
J033143M21GTGGCGTGGGCCGTCGGATCNONE 
J075072B10GTGGCGTGGGCCGTCGGATCNONE 
J075072L04GTGGCGTGGGCCGTCGGATCNONE 
J075088F01GTGGCGTGGGCCGTCGGATCNONE 
J075196H23GTGGCGTGGGCCGTCGGATCNONE 
Os02g0649300014-043-A05GGTGGGGCCCACGCGTNONE 
AK063685GGTGGGGCCCACGCGTSimilar to Short highly repeated, interspersed DNA (Fragment). 
Os02g0666200006-021-D11CTGGCCCACCAGGGCCCACGCNONE 
006-022-F02CTGGCCCACCAGGGCCCACGCNONE 
006-022-H11CTGGCCCACCAGGGCCCACGCNONE 
006-024-C03CTGGCCCACCAGGGCCCACGCNONE 
006-026-G05CTGGCCCACCAGGGCCCACGCNONE 
006-027-F11CTGGCCCACCAGGGCCCACGCNONE 
006-028-G06CTGGCCCACCAGGGCCCACGCNONE 
006-028-H05CTGGCCCACCAGGGCCCACGCNONE 
006-030-H06CTGGCCCACCAGGGCCCACGCNONE 
006-030-H12CTGGCCCACCAGGGCCCACGCNONE 
006-031-C07CTGGCCCACCAGGGCCCACGCNONE 
006-031-G01CTGGCCCACCAGGGCCCACGCNONE 
006-033-F09CTGGCCCACCAGGGCCCACGCNONE 
006-035-A01CTGGCCCACCAGGGCCCACGCNONE 
006-035-A12CTGGCCCACCAGGGCCCACGCNONE 
006-035-F04CTGGCCCACCAGGGCCCACGCNONE 
006-036-G09CTGGCCCACCAGGGCCCACGCNONE 
006-038-A01CTGGCCCACCAGGGCCCACGCNONE 
006-038-A03CTGGCCCACCAGGGCCCACGCNONE 
006-039-D08CTGGCCCACCAGGGCCCACGCNONE 
006-042-C11CTGGCCCACCAGGGCCCACGCNONE 
006-042-H06CTGGCCCACCAGGGCCCACGCNONE 
006-044-E01CTGGCCCACCAGGGCCCACGCNONE 
006-045-E05CTGGCCCACCAGGGCCCACGCNONE 
006-046-G05CTGGCCCACCAGGGCCCACGCNONE 
006-047-A03CTGGCCCACCAGGGCCCACGCNONE 
006-048-H08CTGGCCCACCAGGGCCCACGCNONE 
006-052-A07CTGGCCCACCAGGGCCCACGCNONE 
006-053-A05CTGGCCCACCAGGGCCCACGCNONE 
006-054-G06CTGGCCCACCAGGGCCCACGCNONE 
006-056-D10CTGGCCCACCAGGGCCCACGCNONE 
006-057-B07CTGGCCCACCAGGGCCCACGCNONE 
006-058-F12CTGGCCCACCAGGGCCCACGCNONE 
006-060-D01CTGGCCCACCAGGGCCCACGCNONE 
006-061-A12CTGGCCCACCAGGGCCCACGCNONE 
006-062-E02CTGGCCCACCAGGGCCCACGCNONE 
006-063-F11CTGGCCCACCAGGGCCCACGCNONE 
006-063-H02CTGGCCCACCAGGGCCCACGCNONE 
006-066-F12CTGGCCCACCAGGGCCCACGCNONE 
006-067-H12CTGGCCCACCAGGGCCCACGCNONE 
006-068-B09CTGGCCCACCAGGGCCCACGCNONE 
006-068-D08CTGGCCCACCAGGGCCCACGCNONE 
006-071-A12CTGGCCCACCAGGGCCCACGCNONE 
006-072-H06CTGGCCCACCAGGGCCCACGCNONE 
006-074-A02CTGGCCCACCAGGGCCCACGCNONE 
006-074-F10CTGGCCCACCAGGGCCCACGCNONE 
006-077-H10CTGGCCCACCAGGGCCCACGCNONE 
006-078-G02CTGGCCCACCAGGGCCCACGCNONE 
006-081-B03CTGGCCCACCAGGGCCCACGCNONE 
006-084-H01CTGGCCCACCAGGGCCCACGCNONE 
006-084-H02CTGGCCCACCAGGGCCCACGCNONE 
006-084-H04CTGGCCCACCAGGGCCCACGCNONE 
006-087-H08CTGGCCCACCAGGGCCCACGCNONE 
006-090-B08CTGGCCCACCAGGGCCCACGCNONE 
006-091-E10CTGGCCCACCAGGGCCCACGCNONE 
006-093-G02CTGGCCCACCAGGGCCCACGCNONE 
006-094-B12CTGGCCCACCAGGGCCCACGCNONE 
006-094-E03CTGGCCCACCAGGGCCCACGCNONE 
006-095-G07CTGGCCCACCAGGGCCCACGCNONE 
006-095-H07CTGGCCCACCAGGGCCCACGCNONE 
006-097-G08CTGGCCCACCAGGGCCCACGCNONE 
006-098-E12CTGGCCCACCAGGGCCCACGCNONE 
006-099-A04CTGGCCCACCAGGGCCCACGCNONE 
006-099-E08CTGGCCCACCAGGGCCCACGCNONE 
006-103-F12CTGGCCCACCAGGGCCCACGCNONE 
006-104-G02CTGGCCCACCAGGGCCCACGCNONE 
006-105-F02CTGGCCCACCAGGGCCCACGCNONE 
006-107-D12CTGGCCCACCAGGGCCCACGCNONE 
006-108-F10CTGGCCCACCAGGGCCCACGCNONE 
006-108-H05CTGGCCCACCAGGGCCCACGCNONE 
006-110-G11CTGGCCCACCAGGGCCCACGCNONE 
006-111-D10CTGGCCCACCAGGGCCCACGCNONE 
006-111-E03CTGGCCCACCAGGGCCCACGCNONE 
006-111-H01CTGGCCCACCAGGGCCCACGCNONE 
006-113-C12CTGGCCCACCAGGGCCCACGCNONE 
006-114-C10CTGGCCCACCAGGGCCCACGCNONE 
006-115-B02CTGGCCCACCAGGGCCCACGCNONE 
006-117-D11CTGGCCCACCAGGGCCCACGCNONE 
006-117-E01CTGGCCCACCAGGGCCCACGCNONE 
009-131-C02CTGGCCCACCAGGGCCCACGCNONE 
009-133-G05CTGGCCCACCAGGGCCCACGCNONE 
009-152-E01CTGGCCCACCAGGGCCCACGCNONE 
009-154-E08CTGGCCCACCAGGGCCCACGCNONE 
009-196-C11CTGGCCCACCAGGGCCCACGCNONE 
012-010-E10CTGGCCCACCAGGGCCCACGCNONE 
013-018-C05CTGGCCCACCAGGGCCCACGCNONE 
013-074-A06CTGGCCCACCAGGGCCCACGCNONE 
013-078-E06CTGGCCCACCAGGGCCCACGCNONE 
AB009665CTGGCCCACCAGGGCCCACGCNONE 
AF022737CTGGCCCACCAGGGCCCACGCNONE 
AJ224327CTGGCCCACCAGGGCCCACGCNONE 
AK061769CTGGCCCACCAGGGCCCACGCNONE 
AK103807CTGGCCCACCAGGGCCCACGCAquaporin. 
AK104658CTGGCCCACCAGGGCCCACGCNONE 
J013065I12CTGGCCCACCAGGGCCCACGCNONE 
J013067L09CTGGCCCACCAGGGCCCACGCNONE 
J013089I10CTGGCCCACCAGGGCCCACGCNONE 
J013095N22CTGGCCCACCAGGGCCCACGCNONE 
J013130E17CTGGCCCACCAGGGCCCACGCNONE 
J013131A06CTGGCCCACCAGGGCCCACGCNONE 
J013154E06CTGGCCCACCAGGGCCCACGCNONE 
J023004D16CTGGCCCACCAGGGCCCACGCNONE 
J023010A15CTGGCCCACCAGGGCCCACGCNONE 
J023010H04CTGGCCCACCAGGGCCCACGCNONE 
J023049K10CTGGCCCACCAGGGCCCACGCNONE 
J023056H24CTGGCCCACCAGGGCCCACGCNONE 
J023064J12CTGGCCCACCAGGGCCCACGCNONE 
J023078I06CTGGCCCACCAGGGCCCACGCNONE 
J023081D05CTGGCCCACCAGGGCCCACGCNONE 
J023099I19CTGGCCCACCAGGGCCCACGCNONE 
J023100F05CTGGCCCACCAGGGCCCACGCNONE 
J023131F16CTGGCCCACCAGGGCCCACGCNONE 
J033025F16CTGGCCCACCAGGGCCCACGCNONE 
J033028F10CTGGCCCACCAGGGCCCACGCNONE 
J033058H13CTGGCCCACCAGGGCCCACGCNONE 
J033064P18CTGGCCCACCAGGGCCCACGCNONE 
J033070H04CTGGCCCACCAGGGCCCACGCNONE 
J033107P20CTGGCCCACCAGGGCCCACGCNONE 
J033114E09CTGGCCCACCAGGGCCCACGCNONE 
J033125G23CTGGCCCACCAGGGCCCACGCNONE 
J033136G05CTGGCCCACCAGGGCCCACGCNONE 
J033147A07CTGGCCCACCAGGGCCCACGCNONE 
J053048M24CTGGCCCACCAGGGCCCACGCNONE 
J053056K02CTGGCCCACCAGGGCCCACGCNONE 
J053057N24CTGGCCCACCAGGGCCCACGCNONE 
J053060C13CTGGCCCACCAGGGCCCACGCNONE 
J065053C22CTGGCCCACCAGGGCCCACGCNONE 
J065067J11CTGGCCCACCAGGGCCCACGCNONE 
J065085A01CTGGCCCACCAGGGCCCACGCNONE 
J065189K01CTGGCCCACCAGGGCCCACGCNONE 
J075024G24CTGGCCCACCAGGGCCCACGCNONE 
J075060O04CTGGCCCACCAGGGCCCACGCNONE 
J075075M07CTGGCCCACCAGGGCCCACGCNONE 
J075090A10CTGGCCCACCAGGGCCCACGCNONE 
J075110P11CTGGCCCACCAGGGCCCACGCNONE 
J075114H02CTGGCCCACCAGGGCCCACGCNONE 
J075127L13CTGGCCCACCAGGGCCCACGCNONE 
J075151B19CTGGCCCACCAGGGCCCACGCNONE 
J075187M17CTGGCCCACCAGGGCCCACGCNONE 
J075198E22CTGGCCCACCAGGGCCCACGCNONE 
J080006J20CTGGCCCACCAGGGCCCACGCNONE 
J080081J10CTGGCCCACCAGGGCCCACGCNONE 
J080087C03CTGGCCCACCAGGGCCCACGCNONE 
J090029E22CTGGCCCACCAGGGCCCACGCNONE 
J090037C19CTGGCCCACCAGGGCCCACGCNONE 
J090037P10CTGGCCCACCAGGGCCCACGCNONE 
J090047M10CTGGCCCACCAGGGCCCACGCNONE 
J090055K05CTGGCCCACCAGGGCCCACGCNONE 
J090057N19CTGGCCCACCAGGGCCCACGCNONE 
J090062M13CTGGCCCACCAGGGCCCACGCNONE 
J090066F22CTGGCCCACCAGGGCCCACGCNONE 
J090066N12CTGGCCCACCAGGGCCCACGCNONE 
J090071K08CTGGCCCACCAGGGCCCACGCNONE 
J090080F16CTGGCCCACCAGGGCCCACGCNONE 
J090081J21CTGGCCCACCAGGGCCCACGCNONE 
J090083F22CTGGCCCACCAGGGCCCACGCNONE 
J090083I12CTGGCCCACCAGGGCCCACGCNONE 
J090088B16CTGGCCCACCAGGGCCCACGCNONE 
J090088E01CTGGCCCACCAGGGCCCACGCNONE 
J090091C11CTGGCCCACCAGGGCCCACGCNONE 
J090091F17CTGGCCCACCAGGGCCCACGCNONE 
J090097A05CTGGCCCACCAGGGCCCACGCNONE 
J090098B15CTGGCCCACCAGGGCCCACGCNONE 
J100018B04CTGGCCCACCAGGGCCCACGCNONE 
J100021J08CTGGCCCACCAGGGCCCACGCNONE 
J100026M12CTGGCCCACCAGGGCCCACGCNONE 
J100032F02CTGGCCCACCAGGGCCCACGCNONE 
J100034B03CTGGCCCACCAGGGCCCACGCNONE 
J100037D13CTGGCCCACCAGGGCCCACGCNONE 
J100041C16CTGGCCCACCAGGGCCCACGCNONE 
J100044D14CTGGCCCACCAGGGCCCACGCNONE 
J100044E21CTGGCCCACCAGGGCCCACGCNONE 
J100047M16CTGGCCCACCAGGGCCCACGCNONE 
J100051D22CTGGCCCACCAGGGCCCACGCNONE 
J100056M13CTGGCCCACCAGGGCCCACGCNONE 
J100061J12CTGGCCCACCAGGGCCCACGCNONE 
J100065A22CTGGCCCACCAGGGCCCACGCNONE 
J100067L12CTGGCCCACCAGGGCCCACGCNONE 
J100068F06CTGGCCCACCAGGGCCCACGCNONE 
J100070C24CTGGCCCACCAGGGCCCACGCNONE 
J100072N09CTGGCCCACCAGGGCCCACGCNONE 
J100073A10CTGGCCCACCAGGGCCCACGCNONE 
J100073B15CTGGCCCACCAGGGCCCACGCNONE 
J100077F05CTGGCCCACCAGGGCCCACGCNONE 
J100078B03CTGGCCCACCAGGGCCCACGCNONE 
J100078F01CTGGCCCACCAGGGCCCACGCNONE 
J100079B08CTGGCCCACCAGGGCCCACGCNONE 
J100083J06CTGGCCCACCAGGGCCCACGCNONE 
Os02g0673700AB028130AACGGCCCACGCZinc finger, Dof-type family protein. 
Os02g0677300006-102-D12GCGGCCCACGTNONE 
AK060550GCGGCCCACGTNONE 
AK106041GCGGCCCACGTSimilar to CRT/DRE binding factor 1. 
Os02g0708100AK059630TCGTGGGCCCGCNONE 
AK102055TCGTGGGCCCGCSimilar to Carbamoyl phosphate synthetase small subunit (EC 6.3.5.5). 
Os02g0709200AK058999GTCGCGCGCGTGGGCCCCSimilar to Histidinol-phosphate aminotransferase, chloroplast precursor (EC 2.6.1.9) (Imidazole acetol-phosphate transaminase). 
AK099074GTCGCGCGCGTGGGCCCCNONE 
Os02g0721800AK100043CCACTGACGCGTGGGCCCCACASimilar to Phosphatidylinositol transfer-like protein IV. 
Os02g0731500J065098J18GCCACACGGCCCACGGAWPM-19-like family protein. 
J065123G07GCCACACGGCCCACGGNONE 
Os02g0744700AF395537GACACGTGGGCCCCACACNONE 
AJ308110GACACGTGGGCCCCACACNONE 
AK066446GACACGTGGGCCCCACACSimilar to Starch synthase isoform zSTSII-2 (EC 2.4.1.21). 
Os02g0745400AK072229AGGGCCCACGAGlycosyl transferase, family 8 protein. 
AK108072AGGGCCCACGANONE 
Os02g0754500AK069965TATTGGGCCCACGANONE 
AK105696TATTGGGCCCACGAAmidase family protein. 
Os02g0755600014-024-D06TGTGGGCCCACGTGNONE 
015-039-F09TGTGGGCCCACGTGNONE 
AK064105TGTGGGCCCACGTGNONE 
AK106639TGTGGGCCCACGTGSimilar to UDP-glucuronosyltransferase. 
Os02g0771200011-006-B07CCCGGCCCACGTNONE 
AK066823CCCGGCCCACGTConserved hypothetical protein. 
AK071059CCCGGCCCACGTNONE 
J013075K03CCCGGCCCACGTNONE 
Os02g0776800AB042415ACGTGGGCCGAGNONE 
AK072308ACGTGGGCCGAGReplication protein A 70kDa. 
AK101212ACGTGGGCCGAGNONE 
J033031B02ACGTGGGCCGAGNONE 
J090004E18ACGTGGGCCGAGNONE 
J090084C24ACGTGGGCCGAGNONE 
Os02g0780800J090080O19ACGTGGGCCGTGGNONE 
J090091I06ACGTGGGCCGTGGNONE 
Os02g0787100Os02g0787100GCGGCCCACGCProtein of unknown function DUF676, hydrolase-like domain containing protein. 
Os02g0792600J090091O08CTGACAGGTGGGGCCCACGCNONE 
Os02g0792800AK105616GCGTGGGCCACSimilar to Rieske iron-sulfur protein Tic55 precursor. 
AK120704GCGTGGGCCACNONE 
J075134O14GCGTGGGCCACNONE 
Os02g0793000AK070242GAGGCCCACGANONE 
AK099173GAGGCCCACGANONE 
AK105863GAGGCCCACGAZinc finger, CCCH-type domain containing protein. 
Os02g0795900012-075-B04GAGGCCCACGAANONE 
012-075-B04TGCGGCCCACGANONE 
AK105305GAGGCCCACGAASimilar to DEAD box-like RNA helicase (Fragment). 
AK105305TGCGGCCCACGASimilar to DEAD box-like RNA helicase (Fragment). 
J090031C21GAGGCCCACGAANONE 
J090031C21TGCGGCCCACGANONE 
Os02g0812500AK106918GTGGCGTGGGCCACCyclin-like F-box domain containing protein. 
Os02g0827300AK069159GGCCCGGCCCACGAGCCCAACCProtein of unknown function DUF382 domain containing protein. 
Os02g0829900009-044-G07AGGTGGGCGTGGGCCTGNONE 
AK120917AGGTGGGCGTGGGCCTGSimilar to BRICK1. 
AY224582AGGTGGGCGTGGGCCTGNONE 
J023034L01AGGTGGGCGTGGGCCTGNONE 
J023034M01AGGTGGGCGTGGGCCTGNONE 
J090010G06AGGTGGGCGTGGGCCTGNONE 
J090020D07AGGTGGGCGTGGGCCTGNONE 
J100041L04AGGTGGGCGTGGGCCTGNONE 
J100061D05AGGTGGGCGTGGGCCTGNONE 
J100070L18AGGTGGGCGTGGGCCTGNONE 
Os03g0100200009-022-G08TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
014-012-C04TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
014-039-F04TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
AK072547TGGGGGGTGCGTGGGCCCATGGGCCTGTranscriptional coactivator/pterin dehydratase family protein. 
AK104982TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J013039N23TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J023131F13TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J065013G18TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J065056M02TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J065197O22TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J075055L17TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J075076F02TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J075085M06TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J075104E21TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J075123P09TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J075125G07TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J075138M13TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J075142J17TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J075152F05TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J075191L23TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
J090074I04TGGGGGGTGCGTGGGCCCATGGGCCTGNONE 
Os03g0119100AK069519CCATGGGCCCACGGCCCATTSimilar to Phospholipase D beta 2. 
J023024E17CCATGGGCCCACGGCCCATTNONE 
J023122B02CCATGGGCCCACGGCCCATTNONE 
J090094E15CCATGGGCCCACGGCCCATTNONE 
Os03g0124300AK069148ACGCGTGGGCCCCACCConserved hypothetical protein. 
AK106076ACGCGTGGGCCCCACCNONE 
J023003G19ACGCGTGGGCCCCACCNONE 
Os03g0126900AK109217GTGGCGTGGGCCAAConserved hypothetical protein. 
J065085G16GTGGCGTGGGCCAANONE 
J100086C03GTGGCGTGGGCCAANONE 
Os03g0130400AK070255TCGTGGGCCCCAdenylate kinase, subfamily protein. 
Os03g0131300015-095-G06CCGTGGGCCCCCACNONE 
AK100656CCGTGGGCCCCCACUbiquitin domain containing protein. 
J033140O12CCGTGGGCCCCCACNONE 
J065112C14CCGTGGGCCCCCACNONE 
J090070D10CCGTGGGCCCCCACNONE 
Os03g0133400AK073032AAGGCCCACGPeptidoglycan-binding LysM domain containing protein. 
J013127B06AAGGCCCACGNONE 
J013151F14AAGGCCCACGNONE 
J023008L05AAGGCCCACGNONE 
J023009I03AAGGCCCACGNONE 
J023041F03AAGGCCCACGNONE 
J023146H06AAGGCCCACGNONE 
J033067A22AAGGCCCACGNONE 
J033109M12AAGGCCCACGNONE 
J065141H14AAGGCCCACGNONE 
J075003N15AAGGCCCACGNONE 
J075072J19AAGGCCCACGNONE 
J075114G10AAGGCCCACGNONE 
J075145H07AAGGCCCACGNONE 
J075160G14AAGGCCCACGNONE 
J075180J01AAGGCCCACGNONE 
J100075D05AAGGCCCACGNONE 
Os03g0151800AK064955CGCGTGGGCCACNONE 
AK098874CGCGTGGGCCACNONE 
AK098980CGCGTGGGCCACNONE 
AK099712CGCGTGGGCCACNONE 
AK099889CGCGTGGGCCACNONE 
AK121641CGCGTGGGCCACSimilar to Cell division control protein 48 homolog A (AtCDC48a). 
J013001A05CGCGTGGGCCACNONE 
J013001D04CGCGTGGGCCACNONE 
J013121O12CGCGTGGGCCACNONE 
Os03g0156500011-075-F02CGGGCCCACGTGNONE 
012-077-G10CGGGCCCACGTGNONE 
AK103466CGGGCCCACGTGLupus La protein family protein. 
J013088H17CGGGCCCACGTGNONE 
J013135G21CGGGCCCACGTGNONE 
J033050E10CGGGCCCACGTGNONE 
J033050J01CGGGCCCACGTGNONE 
J033129N23CGGGCCCACGTGNONE 
J065085L16CGGGCCCACGTGNONE 
J065101B19CGGGCCCACGTGNONE 
J065167N03CGGGCCCACGTGNONE 
J090009O21CGGGCCCACGTGNONE 
J090049D11CGGGCCCACGTGNONE 
J100017F23CGGGCCCACGTGNONE 
J100040E12CGGGCCCACGTGNONE 
J100055O18CGGGCCCACGTGNONE 
J100061K08CGGGCCCACGTGNONE 
J100072M05CGGGCCCACGTGNONE 
J100077B08CGGGCCCACGTGNONE 
J100086G03CGGGCCCACGTGNONE 
Os03g0167000AK107307CCCGTGGGCCGTGGConserved hypothetical protein. 
J100070K07CCCGTGGGCCGTGGNONE 
Os03g0169600004-013-C11CCGTGGGCCCCACCACNONE 
011-035-C04CCGTGGGCCCCACCACNONE 
AK060900CCGTGGGCCCCACCACNONE 
AK099490CCGTGGGCCCCACCACZinc finger, Dof-type family protein. 
AK104523CCGTGGGCCCCACCACNONE 
AY224429CCGTGGGCCCCACCACNONE 
J013026L11CCGTGGGCCCCACCACNONE 
J013026N04CCGTGGGCCCCACCACNONE 
J013030D16CCGTGGGCCCCACCACNONE 
J013049P17CCGTGGGCCCCACCACNONE 
J013099D17CCGTGGGCCCCACCACNONE 
J013114M09CCGTGGGCCCCACCACNONE 
J013124F12CCGTGGGCCCCACCACNONE 
J013131J05CCGTGGGCCCCACCACNONE 
J023025M09CCGTGGGCCCCACCACNONE 
J090042J08CCGTGGGCCCCACCACNONE 
J090094F11CCGTGGGCCCCACCACNONE 
J100051I17CCGTGGGCCCCACCACNONE 
Os03g0180100AK108326TCGTGGGCCCCACCCCACCACProtein of unknown function DUF1677, plant family protein. 
Os03g0182800003-126-E06GCGGCCCACGGNONE 
AJ304840GCGGCCCACGGNONE 
AK073133GCGGCCCACGGNONE 
AY323478GCGGCCCACGGSimilar to Ethylene responsive element binding factor3 (OsERF3). 
J033023E13GCGGCCCACGGNONE 
J033028C22GCGGCCCACGGNONE 
J033042J03GCGGCCCACGGNONE 
J065022E13GCGGCCCACGGNONE 
J065208N24GCGGCCCACGGNONE 
J100034B17GCGGCCCACGGNONE 
J100035J21GCGGCCCACGGNONE 
J100039L16GCGGCCCACGGNONE 
J100040A02GCGGCCCACGGNONE 
J100051L11GCGGCCCACGGNONE 
J100064F07GCGGCCCACGGNONE 
J100070J12GCGGCCCACGGNONE 
Os03g0183300003-107-A07CCCCCGCGTGGGCCCCACCCACCTGNONE 
003-113-H10CCCCCGCGTGGGCCCCACCCACCTGNONE 
003-118-G01CCCCCGCGTGGGCCCCACCCACCTGNONE 
006-028-A09CCCCCGCGTGGGCCCCACCCACCTGNONE 
006-047-D01CCCCCGCGTGGGCCCCACCCACCTGNONE 
006-052-D04CCCCCGCGTGGGCCCCACCCACCTGNONE 
006-087-H06CCCCCGCGTGGGCCCCACCCACCTGNONE 
006-089-B03CCCCCGCGTGGGCCCCACCCACCTGNONE 
006-092-D08CCCCCGCGTGGGCCCCACCCACCTGNONE 
006-093-E07CCCCCGCGTGGGCCCCACCCACCTGNONE 
009-029-H07CCCCCGCGTGGGCCCCACCCACCTGNONE 
009-067-B05CCCCCGCGTGGGCCCCACCCACCTGNONE 
009-091-F04CCCCCGCGTGGGCCCCACCCACCTGNONE 
009-101-C10CCCCCGCGTGGGCCCCACCCACCTGNONE 
009-113-A06CCCCCGCGTGGGCCCCACCCACCTGNONE 
009-140-E12CCCCCGCGTGGGCCCCACCCACCTGNONE 
009-145-E10CCCCCGCGTGGGCCCCACCCACCTGNONE 
009-196-F02CCCCCGCGTGGGCCCCACCCACCTGNONE 
011-054-E07CCCCCGCGTGGGCCCCACCCACCTGNONE 
012-074-E10CCCCCGCGTGGGCCCCACCCACCTGNONE 
012-076-E11CCCCCGCGTGGGCCCCACCCACCTGNONE 
014-006-C07CCCCCGCGTGGGCCCCACCCACCTGNONE 
014-085-G11CCCCCGCGTGGGCCCCACCCACCTGNONE 
015-049-C04CCCCCGCGTGGGCCCCACCCACCTGNONE 
015-062-E10CCCCCGCGTGGGCCCCACCCACCTGNONE 
016-063-E02CCCCCGCGTGGGCCCCACCCACCTGNONE 
AK058349CCCCCGCGTGGGCCCCACCCACCTGHypothetical protein. 
AK105922CCCCCGCGTGGGCCCCACCCACCTGNONE 
AK106163CCCCCGCGTGGGCCCCACCCACCTGNONE 
AK119553CCCCCGCGTGGGCCCCACCCACCTGNONE 
AY831395CCCCCGCGTGGGCCCCACCCACCTGNONE 
Os03g0187700009-155-F05CCGTGGGCCGTCCGATCNONE 
J033140E21CCGTGGGCCGTCCGATCNONE 
J033142E21CCGTGGGCCGTCCGATCNONE 
J065014P17CCGTGGGCCGTCCGATCNONE 
J065083L20CCGTGGGCCGTCCGATCNONE 
J065092E08CCGTGGGCCGTCCGATCNONE 
J065154C08CCGTGGGCCGTCCGATCTarget SNARE coiled-coil region domain containing protein. 
J075142H08CCGTGGGCCGTCCGATCNONE 
J075175K21CCGTGGGCCGTCCGATCNONE 
J090070B20CCGTGGGCCGTCCGATCNONE 
J100071M06CCGTGGGCCGTCCGATCNONE 
Os03g0193225012-084-B12TCAGGCCCACGTNONE 
AK069459TCAGGCCCACGTFrigida-like family protein. 
J023019D20TCAGGCCCACGTNONE 
Os03g0206600AK058618GCTGGGCCCACGCProtein of unknown function DUF588 family protein. 
Os03g0210400AK065966ACGTGGGCCGCProtein prenyltransferase domain containing protein. 
Os03g0218400AK069202TCCGGCCCGTGGGCCGCSimilar to Hexose transporter. 
AK099306TCCGGCCCGTGGGCCGCNONE 
AY342321TCCGGCCCGTGGGCCGCNONE 
J023066K08TCCGGCCCGTGGGCCGCNONE 
J100032N19TCCGGCCCGTGGGCCGCNONE 
Os03g0238700AK073387TCGTGGGCCGCAGGCCCGCASimilar to Acid phosphatase type 5. 
J033043K11TCGTGGGCCGCAGGCCCGCANONE 
Os03g0243300013-024-B05GGACGGACGTGGGCCGAANONE 
AB010740GGACGGACGTGGGCCGAANONE 
AB037151GGACGGACGTGGGCCGAASimilar to 26S proteasome non-ATPase regulatory subunit 4 (26S proteasome regulatory subunit S5A) (Multiubiquitin chain binding protein). 
AK073601GGACGGACGTGGGCCGAANONE 
J023010M13GGACGGACGTGGGCCGAANONE 
J023030M11GGACGGACGTGGGCCGAANONE 
J023066I02GGACGGACGTGGGCCGAANONE 
J023080H21GGACGGACGTGGGCCGAANONE 
J023123O15GGACGGACGTGGGCCGAANONE 
J033029N24GGACGGACGTGGGCCGAANONE 
J033031G18GGACGGACGTGGGCCGAANONE 
J033046D23GGACGGACGTGGGCCGAANONE 
J033046P11GGACGGACGTGGGCCGAANONE 
J033079C14GGACGGACGTGGGCCGAANONE 
J033125G12GGACGGACGTGGGCCGAANONE 
J033133I21GGACGGACGTGGGCCGAANONE 
J033141F22GGACGGACGTGGGCCGAANONE 
J065035O21GGACGGACGTGGGCCGAANONE 
J090008P15GGACGGACGTGGGCCGAANONE 
J090033F15GGACGGACGTGGGCCGAANONE 
J090059A16GGACGGACGTGGGCCGAANONE 
J090080N01GGACGGACGTGGGCCGAANONE 
J100022C16GGACGGACGTGGGCCGAANONE 
J100023K05GGACGGACGTGGGCCGAANONE 
J100043B19GGACGGACGTGGGCCGAANONE 
J100046G11GGACGGACGTGGGCCGAANONE 
J100049L11GGACGGACGTGGGCCGAANONE 
J100054M01GGACGGACGTGGGCCGAANONE 
J100068G15GGACGGACGTGGGCCGAANONE 
J100085A18GGACGGACGTGGGCCGAANONE 
Os03g0243350J065025D24TTCGGCCCACGTCCGTCCNONE 
J065046A15TTCGGCCCACGTCCGTCCHypothetical protein. 
J065064E08TTCGGCCCACGTCCGTCCNONE 
Os03g0260100AK066143GTGGCCCACGGCCCACCAConserved hypothetical protein. 
Os03g0270200012-009-A03TCGGCCCACGTNONE 
AK066896TCGGCCCACGTNONE 
AK102826TCGGCCCACGTSplicing factor PWI domain containing protein. 
J013042L05TCGGCCCACGTNONE 
J013091L22TCGGCCCACGTNONE 
J013096P13TCGGCCCACGTNONE 
J013118M15TCGGCCCACGTNONE 
J013151N20TCGGCCCACGTNONE 
J033061D07TCGGCCCACGTNONE 
J033086L04TCGGCCCACGTNONE 
J033099J11TCGGCCCACGTNONE 
J033109C10TCGGCCCACGTNONE 
J033116F13TCGGCCCACGTNONE 
J065019F13TCGGCCCACGTNONE 
J065089O14TCGGCCCACGTNONE 
J065158D07TCGGCCCACGTNONE 
J065160G19TCGGCCCACGTNONE 
J065168N10TCGGCCCACGTNONE 
J065208E17TCGGCCCACGTNONE 
J075001A15TCGGCCCACGTNONE 
J075010G15TCGGCCCACGTNONE 
J075016L23TCGGCCCACGTNONE 
J075019A06TCGGCCCACGTNONE 
J075023B13TCGGCCCACGTNONE 
J075032P15TCGGCCCACGTNONE 
J075045F05TCGGCCCACGTNONE 
J075053O13TCGGCCCACGTNONE 
J075057P06TCGGCCCACGTNONE 
J075061C19TCGGCCCACGTNONE 
J075078B10TCGGCCCACGTNONE 
J075086A20TCGGCCCACGTNONE 
J075127A16TCGGCCCACGTNONE 
J075128E07TCGGCCCACGTNONE 
J075129C06TCGGCCCACGTNONE 
J075130M14TCGGCCCACGTNONE 
J075136H13TCGGCCCACGTNONE 
J075149M17TCGGCCCACGTNONE 
J075156L08TCGGCCCACGTNONE 
J075160P12TCGGCCCACGTNONE 
J075164J01TCGGCCCACGTNONE 
J075173N05TCGGCCCACGTNONE 
J075177O03TCGGCCCACGTNONE 
J075188K11TCGGCCCACGTNONE 
J090009A02TCGGCCCACGTNONE 
J090019O12TCGGCCCACGTNONE 
J090065H05TCGGCCCACGTNONE 
J090067E24TCGGCCCACGTNONE 
J090080C03TCGGCCCACGTNONE 
J090090A04TCGGCCCACGTNONE 
J090098D13TCGGCCCACGTNONE 
J100060D03TCGGCCCACGTNONE 
J100062D05TCGGCCCACGTNONE 
J100074A08TCGGCCCACGTNONE 
Os03g0271100AB095095TCCGGCCCACGANONE 
AK060821TCCGGCCCACGASimilar to Sigma factor SIG2B. 
AK067693TCCGGCCCACGANONE 
AK099036TCCGGCCCACGANONE 
Os03g0275700AK111329GTGGCCCACGCConserved hypothetical protein. 
Os03g0277000AK100522GTGGCCCACGGSimilar to GDP dissociation inhibitor protein OsGDI1. 
Os03g0284000Os03g0284000CACGTGGGCCGGAACGGCCCGConserved hypothetical protein. 
Os03g0294200AK069285CCCGTGGGCCCCACASimilar to Fructose-6-phosphate-2-kinase/fructose-2, 6-bisphosphatase. 
Os03g0295800006-107-F02CACGTGGGCCCAACTNONE 
AK106050CACGTGGGCCCAACTNONE 
Os03g0302700006-099-F12TCCGGCCCACGTNONE 
AK112010TCCGGCCCACGTZinc finger, RING-type domain containing protein. 
AK121656TCCGGCCCACGTNONE 
J075090A19TCCGGCCCACGTNONE 
J075148M06TCCGGCCCACGTNONE 
Os03g0302900011-005-H01CGACACGTGGGACCCACCCGCGCGTGGGGCCCACGCGTNONE 
AK069222CGACACGTGGGACCCACCCGCGCGTGGGGCCCACGCGTConserved hypothetical protein. 
J023014L15CGACACGTGGGACCCACCCGCGCGTGGGGCCCACGCGTNONE 
J033023G12CGACACGTGGGACCCACCCGCGCGTGGGGCCCACGCGTNONE 
J090008H16CGACACGTGGGACCCACCCGCGCGTGGGGCCCACGCGTNONE 
Os03g0306900AK073626CACGTGGGGTCGTGGGCCCCAGTENA/THI-4 protein domain containing protein. 
J033050J24CACGTGGGGTCGTGGGCCCCAGNONE 
J075180K24CACGTGGGGTCGTGGGCCCCAGNONE 
Os03g0307000J065032I03CTGGGGCCCACGACCCCACGTGHypothetical protein. 
J065110H17CTGGGGCCCACGACCCCACGTGNONE 
J065156H13CTGGGGCCCACGACCCCACGTGNONE 
J065175P03CTGGGGCCCACGACCCCACGTGNONE 
J075007D24CTGGGGCCCACGACCCCACGTGNONE 
J100040M24CTGGGGCCCACGACCCCACGTGNONE 
Os03g0308000016-023-H09CGACACGTGGGCCCAACANONE 
AK100355CGACACGTGGGCCCAACAUbiquitin-conjugating enzyme, E2 domain containing protein. 
J023013H05CGACACGTGGGCCCAACANONE 
J023043K04CGACACGTGGGCCCAACANONE 
J023083I20CGACACGTGGGCCCAACANONE 
J033068F22CGACACGTGGGCCCAACANONE 
J033125P21CGACACGTGGGCCCAACANONE 
J065207A22CGACACGTGGGCCCAACANONE 
J100018D20CGACACGTGGGCCCAACANONE 
J100026L17CGACACGTGGGCCCAACANONE 
J100055D14CGACACGTGGGCCCAACANONE 
J100060P03CGACACGTGGGCCCAACANONE 
J100078A20CGACACGTGGGCCCAACANONE 
Os03g0309000AK070071GGCCGTGGGCCGTGVirulence factor, pectin lyase fold family protein. 
Os03g0310800009-126-C10CACGTGGGCCACNONE 
009-156-D02CACGTGGGCCACNONE 
AK058663CACGTGGGCCACNONE 
AK099476CACGTGGGCCACSimilar to Hypersensitive reaction associated Ca2+-binding protein. 
J065084G15CACGTGGGCCACNONE 
J075046C12CACGTGGGCCACNONE 
J075058D24CACGTGGGCCACNONE 
J075151M03CACGTGGGCCACNONE 
J075151M04CACGTGGGCCACNONE 
J075153I20CACGTGGGCCACNONE 
J075167J05CACGTGGGCCACNONE 
J075179G06CACGTGGGCCACNONE 
J100025I19CACGTGGGCCACNONE 
J100025L21CACGTGGGCCACNONE 
J100029C06CACGTGGGCCACNONE 
J100068E24CACGTGGGCCACNONE 
J100070F10CACGTGGGCCACNONE 
J100083H23CACGTGGGCCACNONE 
J100089H10CACGTGGGCCACNONE 
Os03g0312500AK106657CCCACGTGGGCCCCASimilar to Inhibitor of apoptosis-like protein. 
AK109328CCCACGTGGGCCCCANONE 
Os03g0321800006-065-G02GGCCGTGGGCCGAGANONE 
AK061075GGCCGTGGGCCGAGANONE 
AK111447GGCCGTGGGCCGAGASimilar to WRKY transcription factor 55. 
J065122E07GGCCGTGGGCCGAGANONE 
J065187N05GGCCGTGGGCCGAGANONE 
J065214K09GGCCGTGGGCCGAGANONE 
J090050M01GGCCGTGGGCCGAGANONE 
Os03g0326600AK107632TCTGGGCCGTGGGCCCTTGGTGGGCCAARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os03g0337600AF119232ACGTGGGCCGANONE 
AK070859ACGTGGGCCGASimilar to Uroporphyrinogen decarboxylase (EC 4.1.1.37) (URO-D) (UPD) (Fragment). 
J013110I18ACGTGGGCCGANONE 
J013147M17ACGTGGGCCGANONE 
J065083M01ACGTGGGCCGANONE 
J065199H24ACGTGGGCCGANONE 
Os03g0340500012-007-F10CACGTGGGCCATNONE 
012-007-F10TGTGGGGCCCACGGGTCAGTGGNONE 
AK099406CACGTGGGCCATNONE 
AK099406TGTGGGGCCCACGGGTCAGTGGNONE 
AK102158CACGTGGGCCATSimilar to Sucrose synthase (EC 2.4.1.13). 
AK102158TGTGGGGCCCACGGGTCAGTGGSimilar to Sucrose synthase (EC 2.4.1.13). 
J013030N13CACGTGGGCCATNONE 
J013030N13TGTGGGGCCCACGGGTCAGTGGNONE 
J013063E02CACGTGGGCCATNONE 
J013063E02TGTGGGGCCCACGGGTCAGTGGNONE 
J013063I02CACGTGGGCCATNONE 
J013063I02TGTGGGGCCCACGGGTCAGTGGNONE 
J013157O07CACGTGGGCCATNONE 
J013157O07TGTGGGGCCCACGGGTCAGTGGNONE 
J023131N05CACGTGGGCCATNONE 
J023131N05TGTGGGGCCCACGGGTCAGTGGNONE 
J033033P05CACGTGGGCCATNONE 
J033033P05TGTGGGGCCCACGGGTCAGTGGNONE 
J033040N16CACGTGGGCCATNONE 
J033040N16TGTGGGGCCCACGGGTCAGTGGNONE 
J033044M19CACGTGGGCCATNONE 
J033044M19TGTGGGGCCCACGGGTCAGTGGNONE 
J033086F24CACGTGGGCCATNONE 
J033086F24TGTGGGGCCCACGGGTCAGTGGNONE 
J033097H01CACGTGGGCCATNONE 
J033097H01TGTGGGGCCCACGGGTCAGTGGNONE 
J033106C22CACGTGGGCCATNONE 
J033106C22TGTGGGGCCCACGGGTCAGTGGNONE 
J033128M13CACGTGGGCCATNONE 
J033128M13TGTGGGGCCCACGGGTCAGTGGNONE 
J033133I15CACGTGGGCCATNONE 
J033133I15TGTGGGGCCCACGGGTCAGTGGNONE 
J043027A21CACGTGGGCCATNONE 
J043027A21TGTGGGGCCCACGGGTCAGTGGNONE 
J090028A09CACGTGGGCCATNONE 
J090028A09TGTGGGGCCCACGGGTCAGTGGNONE 
J090053D06CACGTGGGCCATNONE 
J090053D06TGTGGGGCCCACGGGTCAGTGGNONE 
J090083O17CACGTGGGCCATNONE 
J090083O17TGTGGGGCCCACGGGTCAGTGGNONE 
J090099H10CACGTGGGCCATNONE 
J090099H10TGTGGGGCCCACGGGTCAGTGGNONE 
J100036M05CACGTGGGCCATNONE 
J100036M05TGTGGGGCCCACGGGTCAGTGGNONE 
Os03g0342900006-032-D01CACGTGGGCCTCNONE 
006-032-D01CCCGTGGGCCCCACNONE 
006-033-E10CACGTGGGCCTCNONE 
006-033-E10CCCGTGGGCCCCACNONE 
006-051-G06CACGTGGGCCTCNONE 
006-051-G06CCCGTGGGCCCCACNONE 
006-053-E05CACGTGGGCCTCNONE 
006-053-E05CCCGTGGGCCCCACNONE 
006-056-B05CACGTGGGCCTCNONE 
006-056-B05CCCGTGGGCCCCACNONE 
006-058-F04CACGTGGGCCTCNONE 
006-058-F04CCCGTGGGCCCCACNONE 
006-059-E05CACGTGGGCCTCNONE 
006-059-E05CCCGTGGGCCCCACNONE 
006-060-F10CACGTGGGCCTCNONE 
006-060-F10CCCGTGGGCCCCACNONE 
006-104-D12CACGTGGGCCTCNONE 
006-104-D12CCCGTGGGCCCCACNONE 
009-129-C12CACGTGGGCCTCNONE 
009-129-C12CCCGTGGGCCCCACNONE 
AK060136CACGTGGGCCTCNONE 
AK060136CCCGTGGGCCCCACNONE 
AK060980CACGTGGGCCTCNONE 
AK060980CCCGTGGGCCCCACNONE 
AK064815CACGTGGGCCTCDormancyauxin associated family protein. 
AK064815CCCGTGGGCCCCACDormancyauxin associated family protein. 
AK104244CACGTGGGCCTCNONE 
AK104244CCCGTGGGCCCCACNONE 
AK104391CACGTGGGCCTCNONE 
AK104391CCCGTGGGCCCCACNONE 
AK104590CACGTGGGCCTCNONE 
AK104590CCCGTGGGCCCCACNONE 
AK104744CACGTGGGCCTCNONE 
AK104744CCCGTGGGCCCCACNONE 
AK106100CACGTGGGCCTCNONE 
AK106100CCCGTGGGCCCCACNONE 
J013000E10CACGTGGGCCTCNONE 
J013000E10CCCGTGGGCCCCACNONE 
J075027O22CACGTGGGCCTCNONE 
J075027O22CCCGTGGGCCCCACNONE 
J075052J03CACGTGGGCCTCNONE 
J075052J03CCCGTGGGCCCCACNONE 
J075066E15CACGTGGGCCTCNONE 
J075066E15CCCGTGGGCCCCACNONE 
J075095C17CACGTGGGCCTCNONE 
J075095C17CCCGTGGGCCCCACNONE 
J075118N05CACGTGGGCCTCNONE 
J075118N05CCCGTGGGCCCCACNONE 
J075187K22CACGTGGGCCTCNONE 
J075187K22CCCGTGGGCCCCACNONE 
J090026L04CACGTGGGCCTCNONE 
J090026L04CCCGTGGGCCCCACNONE 
J090059G16CACGTGGGCCTCNONE 
J090059G16CCCGTGGGCCCCACNONE 
J100055P20CACGTGGGCCTCNONE 
J100055P20CCCGTGGGCCCCACNONE 
J100062A10CACGTGGGCCTCNONE 
J100062A10CCCGTGGGCCCCACNONE 
J100068G20CACGTGGGCCTCNONE 
J100068G20CCCGTGGGCCCCACNONE 
Os03g0344100009-166-F10ACGTGGGCCTTNONE 
AK061903ACGTGGGCCTTNONE 
AK065547ACGTGGGCCTTSimilar to ASF/SF2-like pre-mRNA splicing factor SRP32''. 
J023095G24ACGTGGGCCTTNONE 
J033087C06ACGTGGGCCTTNONE 
J053073I09ACGTGGGCCTTNONE 
J065189D11ACGTGGGCCTTNONE 
J090032B15ACGTGGGCCTTNONE 
Os03g0373300AK107897TCGTGGGCCCCACGTCTCProtein of unknown function DUF1110 family protein. 
Os03g0376000AK059565TGGATGGGCCCACGAemp24/gp25L/p24 family protein. 
Os03g0386000AK072984TGCGGCCCCCACCACCCGTGGGCCCACCTSimilar to WD domain protein-like. 
J065009K18TGCGGCCCCCACCACCCGTGGGCCCACCTNONE 
J065165P09TGCGGCCCCCACCACCCGTGGGCCCACCTNONE 
Os03g0387100AB026559ATCGGACGGCCCACGTGNONE 
AF022735ATCGGACGGCCCACGTGNONE 
AK058567ATCGGACGGCCCACGTGProteasome subunit alpha type 2 (EC 3.4.25.1) (20S proteasome alpha subunit B) (20S proteasome subunit alpha-2). 
AK101195ATCGGACGGCCCACGTGNONE 
J033030J15ATCGGACGGCCCACGTGNONE 
J033102N16ATCGGACGGCCCACGTGNONE 
J065056E08ATCGGACGGCCCACGTGNONE 
J065112M11ATCGGACGGCCCACGTGNONE 
J065170H07ATCGGACGGCCCACGTGNONE 
J075003P17ATCGGACGGCCCACGTGNONE 
J075074D06ATCGGACGGCCCACGTGNONE 
J075127F20ATCGGACGGCCCACGTGNONE 
J075129I01ATCGGACGGCCCACGTGNONE 
J075178A10ATCGGACGGCCCACGTGNONE 
J090071P12ATCGGACGGCCCACGTGNONE 
J100090D18ATCGGACGGCCCACGTGNONE 
Os03g0405100AK108624CCGTGGGCCCAACCRpsU-divergently transcribed family protein. 
Os03g0410700J065102A22CCCGGCCCACGANONE 
Os03g0410900J065067F10TCGTGGGCCGGGNONE 
J065073D08TCGTGGGCCGGGNONE 
J065176C06TCGTGGGCCGGGNONE 
J065189O13TCGTGGGCCGGGNONE 
J065214E05TCGTGGGCCGGGNONE 
J080007H09TCGTGGGCCGGGNONE 
J080012B19TCGTGGGCCGGGNONE 
J080020J16TCGTGGGCCGGGNONE 
J080038J22TCGTGGGCCGGGNONE 
J080045I09TCGTGGGCCGGGNONE 
J080059M16TCGTGGGCCGGGNONE 
J080060C19TCGTGGGCCGGGNONE 
J080080P22TCGTGGGCCGGGNONE 
J080083C03TCGTGGGCCGGGNONE 
J080093M17TCGTGGGCCGGGNONE 
J100029F12TCGTGGGCCGGGLike-Sm ribonucleoprotein, core family protein. 
Os03g0578200003-117-B07TCGTGGGCCCAAGNONE 
009-175-C06TCGTGGGCCCAAGNONE 
009-179-H05TCGTGGGCCCAAGNONE 
013-078-G11TCGTGGGCCCAAGNONE 
AK062224TCGTGGGCCCAAGNONE 
AK120432TCGTGGGCCCAAGConserved hypothetical protein. 
J013096L16TCGTGGGCCCAAGNONE 
J100042G12TCGTGGGCCCAAGNONE 
J100069F04TCGTGGGCCCAAGNONE 
J100073H14TCGTGGGCCCAAGNONE 
Os03g0581600J065037H09GGTCCACGTGGGCCCCACACNONE 
J065183O12GGTCCACGTGGGCCCCACACNONE 
Os03g0586800003-114-H11TTCGTGGGCCTANONE 
AK063765TTCGTGGGCCTASimilar to Lysyl-tRNA synthetase (EC 6.1.1.6) (Lysine--tRNA ligase) (LysRS). 
AK099302TTCGTGGGCCTANONE 
J090004H06TTCGTGGGCCTANONE 
J090022N15TTCGTGGGCCTANONE 
J100035E05TTCGTGGGCCTANONE 
J100041L05TTCGTGGGCCTANONE 
J100041M18TTCGTGGGCCTANONE 
J100057P04TTCGTGGGCCTANONE 
J100089H06TTCGTGGGCCTANONE 
J100090C23TTCGTGGGCCTANONE 
Os03g0606200009-030-E09TCTGGCCCACGTGNONE 
009-076-H10TCTGGCCCACGTGNONE 
009-122-H12TCTGGCCCACGTGNONE 
009-153-F09TCTGGCCCACGTGNONE 
AB055076TCTGGCCCACGTGMitochondrial ATP synthase 6 KD subunit. 
AK072384TCTGGCCCACGTGNONE 
AK107928TCTGGCCCACGTGNONE 
J023078E13TCTGGCCCACGTGNONE 
J053031N01TCTGGCCCACGTGNONE 
J053046K19TCTGGCCCACGTGNONE 
J053062P07TCTGGCCCACGTGNONE 
J053091C23TCTGGCCCACGTGNONE 
J053099N19TCTGGCCCACGTGNONE 
J065005E06TCTGGCCCACGTGNONE 
J065030N03TCTGGCCCACGTGNONE 
J065138O21TCTGGCCCACGTGNONE 
J065159K03TCTGGCCCACGTGNONE 
J075030M08TCTGGCCCACGTGNONE 
J080006E23TCTGGCCCACGTGNONE 
J080010D10TCTGGCCCACGTGNONE 
J080016N17TCTGGCCCACGTGNONE 
J080024N09TCTGGCCCACGTGNONE 
J080028E23TCTGGCCCACGTGNONE 
J080035I11TCTGGCCCACGTGNONE 
J080038D15TCTGGCCCACGTGNONE 
J080040H08TCTGGCCCACGTGNONE 
J080043L04TCTGGCCCACGTGNONE 
J080047C06TCTGGCCCACGTGNONE 
J080061G04TCTGGCCCACGTGNONE 
J080066E10TCTGGCCCACGTGNONE 
J080067P03TCTGGCCCACGTGNONE 
J080082D07TCTGGCCCACGTGNONE 
J080089M13TCTGGCCCACGTGNONE 
J080094O09TCTGGCCCACGTGNONE 
J080095C24TCTGGCCCACGTGNONE 
J080309E21TCTGGCCCACGTGNONE 
J090016G15TCTGGCCCACGTGNONE 
J090031C20TCTGGCCCACGTGNONE 
J090033A15TCTGGCCCACGTGNONE 
J090037L07TCTGGCCCACGTGNONE 
J090038I10TCTGGCCCACGTGNONE 
J090072P19TCTGGCCCACGTGNONE 
J100040J02TCTGGCCCACGTGNONE 
J100047N05TCTGGCCCACGTGNONE 
J100048M10TCTGGCCCACGTGNONE 
J100076C02TCTGGCCCACGTGNONE 
J100077G23TCTGGCCCACGTGNONE 
J100080O08TCTGGCCCACGTGNONE 
J100085C06TCTGGCCCACGTGNONE 
J100085F16TCTGGCCCACGTGNONE 
Os03g0607200013-002-F05GCGTGGGCCACNONE 
013-021-H08GCGTGGGCCACNONE 
013-038-E10GCGTGGGCCACNONE 
014-009-E05GCGTGGGCCACNONE 
014-034-H01GCGTGGGCCACNONE 
014-038-A08GCGTGGGCCACNONE 
014-072-G08GCGTGGGCCACNONE 
014-083-B06GCGTGGGCCACNONE 
014-088-G10GCGTGGGCCACNONE 
AK070268GCGTGGGCCACGibberellin regulated protein family protein. 
J023044E14GCGTGGGCCACNONE 
J065199F02GCGTGGGCCACNONE 
J075001C09GCGTGGGCCACNONE 
J075019F02GCGTGGGCCACNONE 
J075061J21GCGTGGGCCACNONE 
J075068G03GCGTGGGCCACNONE 
J075126F10GCGTGGGCCACNONE 
J075153F19GCGTGGGCCACNONE 
J080305I04GCGTGGGCCACNONE 
J080307F24GCGTGGGCCACNONE 
J080312E23GCGTGGGCCACNONE 
J080315M20GCGTGGGCCACNONE 
J080317E18GCGTGGGCCACNONE 
J090043I11GCGTGGGCCACNONE 
Os03g0626800015-067-B09GGGTGGGCTGTTCGTGGGCCTCNONE 
AK111916GGGTGGGCTGTTCGTGGGCCTCNONE 
AK112092GGGTGGGCTGTTCGTGGGCCTCCalcineurin B protein. 
J075016C21GGGTGGGCTGTTCGTGGGCCTCNONE 
Os03g0633900AK059181ACGTGGGCCCCACASingle-strand binding protein family protein. 
AK068169ACGTGGGCCCCACANONE 
Os03g0643300AK099445GCCCACGCCCACGCCCACGCCCACGGCCCACGGSimilar to AER123Wp. 
AK108010GCCCACGCCCACGCCCACGCCCACGGCCCACGGNONE 
Os03g0667100012-045-B01CACTGACACGTGGGCCCCACACGCCACACACCNONE 
AK065363CACTGACACGTGGGCCCCACACGCCACACACCBTB domain containing protein. 
AK065952CACTGACACGTGGGCCCCACACGCCACACACCNONE 
J013045I05CACTGACACGTGGGCCCCACACGCCACACACCNONE 
J013129F20CACTGACACGTGGGCCCCACACGCCACACACCNONE 
Os03g0681900006-042-F08GGGCCGGCCCACGANONE 
009-043-F12GGGCCGGCCCACGANONE 
AK061750GGGCCGGCCCACGANONE 
AK062094GGGCCGGCCCACGASimilar to RGP-3 (Fragment). 
J033034F01GGGCCGGCCCACGANONE 
J033131F11GGGCCGGCCCACGANONE 
J033143N03GGGCCGGCCCACGANONE 
Os03g0690000AK062756GATCGGACGGCCCACGCConserved hypothetical protein. 
J080302F19GATCGGACGGCCCACGCNONE 
J080303J23GATCGGACGGCCCACGCNONE 
J080303K16GATCGGACGGCCCACGCNONE 
J080306B15GATCGGACGGCCCACGCNONE 
J080309C02GATCGGACGGCCCACGCNONE 
J080312F13GATCGGACGGCCCACGCNONE 
J080312M04GATCGGACGGCCCACGCNONE 
J080315L20GATCGGACGGCCCACGCNONE 
Os03g0698900013-074-A08TCGTGGGCCACGTCNONE 
AK073303TCGTGGGCCACGTCAlkaline phytoceramidase family protein. 
AK103953TCGTGGGCCACGTCNONE 
J033024P22TCGTGGGCCACGTCNONE 
J065194N16TCGTGGGCCACGTCNONE 
J065195O11TCGTGGGCCACGTCNONE 
J075020F03TCGTGGGCCACGTCNONE 
J075032P18TCGTGGGCCACGTCNONE 
J075037H13TCGTGGGCCACGTCNONE 
J075147I01TCGTGGGCCACGTCNONE 
J075187B13TCGTGGGCCACGTCNONE 
J100043G08TCGTGGGCCACGTCNONE 
J100060L06TCGTGGGCCACGTCNONE 
J100063O21TCGTGGGCCACGTCNONE 
J100066O13TCGTGGGCCACGTCNONE 
J100072K20TCGTGGGCCACGTCNONE 
J100083G21TCGTGGGCCACGTCNONE 
J100085D07TCGTGGGCCACGTCNONE 
Os03g0701700011-034-E06CCCGTGGGCCACNONE 
AF013979CCCGTGGGCCACNONE 
AK065161CCCGTGGGCCACSimilar to Ethylene receptor. 
AK067813CCCGTGGGCCACNONE 
J013002C04CCCGTGGGCCACNONE 
J013035M07CCCGTGGGCCACNONE 
J013049B10CCCGTGGGCCACNONE 
J013065F11CCCGTGGGCCACNONE 
J013072K18CCCGTGGGCCACNONE 
J013073P08CCCGTGGGCCACNONE 
J013098F08CCCGTGGGCCACNONE 
J013154M13CCCGTGGGCCACNONE 
J023001H02CCCGTGGGCCACNONE 
J023003D16CCCGTGGGCCACNONE 
J023014P17CCCGTGGGCCACNONE 
J023036A22CCCGTGGGCCACNONE 
J023038N01CCCGTGGGCCACNONE 
J023042E11CCCGTGGGCCACNONE 
J023058O05CCCGTGGGCCACNONE 
J023084D05CCCGTGGGCCACNONE 
J023088O17CCCGTGGGCCACNONE 
J023138O11CCCGTGGGCCACNONE 
J023147A10CCCGTGGGCCACNONE 
J033029G18CCCGTGGGCCACNONE 
J033031N13CCCGTGGGCCACNONE 
J033090D09CCCGTGGGCCACNONE 
J033091I06CCCGTGGGCCACNONE 
J033096B20CCCGTGGGCCACNONE 
J033101A19CCCGTGGGCCACNONE 
J033135D03CCCGTGGGCCACNONE 
J043001L13CCCGTGGGCCACNONE 
J043020A13CCCGTGGGCCACNONE 
J053071K24CCCGTGGGCCACNONE 
J053092L14CCCGTGGGCCACNONE 
J053099F19CCCGTGGGCCACNONE 
J065009P22CCCGTGGGCCACNONE 
J065046A22CCCGTGGGCCACNONE 
J065099K22CCCGTGGGCCACNONE 
J065112O22CCCGTGGGCCACNONE 
J065119K11CCCGTGGGCCACNONE 
J065212B11CCCGTGGGCCACNONE 
J090022A11CCCGTGGGCCACNONE 
J090054F15CCCGTGGGCCACNONE 
J090076B20CCCGTGGGCCACNONE 
J090099M22CCCGTGGGCCACNONE 
J100032L01CCCGTGGGCCACNONE 
J100065H13CCCGTGGGCCACNONE 
Os03g0712600015-008-G03CGCGTGGGCCTGGCCCACTNONE 
AK103705CGCGTGGGCCTGGCCCACTHypothetical protein. 
J033136N14CGCGTGGGCCTGGCCCACTNONE 
Os03g0725300011-085-E09TAGGCCCACGAANONE 
AK063969TAGGCCCACGAASimilar to Dbr1-prov protein. 
AK073636TAGGCCCACGAANONE 
J033050L15TAGGCCCACGAANONE 
J053082G03TAGGCCCACGAANONE 
Os03g0746600AK069559ACGTGGGCCACWD40-like domain containing protein. 
J023141K22ACGTGGGCCACNONE 
Os03g0756800009-100-H11CCGTGGGCCGGTGGGCCCGNONE 
AK120423CCGTGGGCCGGTGGGCCCGProtein of unknown function UPF0139 family protein. 
J013095D02CCGTGGGCCGGTGGGCCCGNONE 
J023091G12CCGTGGGCCGGTGGGCCCGNONE 
J065207J17CCGTGGGCCGGTGGGCCCGNONE 
J100067G13CCGTGGGCCGGTGGGCCCGNONE 
J100089L11CCGTGGGCCGGTGGGCCCGNONE 
Os03g0758500016-015-D02CACGTGGGCCCCNONE 
AK059403CACGTGGGCCCCNONE 
AK102002CACGTGGGCCCCPlastocyanin-like domain containing protein. 
J033079N03CACGTGGGCCCCNONE 
J065012M05CACGTGGGCCCCNONE 
J065045H19CACGTGGGCCCCNONE 
J065050J08CACGTGGGCCCCNONE 
J075189D02CACGTGGGCCCCNONE 
J090018L03CACGTGGGCCCCNONE 
J100043O22CACGTGGGCCCCNONE 
J100088G17CACGTGGGCCCCNONE 
Os03g0758700AK106620TGCGGCCCACGGWD40-like domain containing protein. 
Os03g0761200011-038-H02GAGGCCCACGTNONE 
015-055-D12GAGGCCCACGTNONE 
016-032-B01GAGGCCCACGTNONE 
AK064205GAGGCCCACGTNONE 
AK101534GAGGCCCACGTAnkyrin repeat containing protein. 
J075033L23GAGGCCCACGTNONE 
J075046K09GAGGCCCACGTNONE 
J075134K18GAGGCCCACGTNONE 
J075157I10GAGGCCCACGTNONE 
Os03g0774600AK066871CAGGCCCACGGHypothetical protein. 
J053033J17CAGGCCCACGGNONE 
Os03g0776900AK107941GCGGCCCACGASimilar to DNAJ protein-like. 
J053100E14GCGGCCCACGANONE 
J075111A12GCGGCCCACGANONE 
Os03g0780600AK120180CCCGTGGGCCCCACGTNONE 
D13224CCCGTGGGCCCCACGTTubulin beta-1 chain (Beta-1 tubulin). 
J013033M18CCCGTGGGCCCCACGTNONE 
J033022G05CCCGTGGGCCCCACGTNONE 
J033028A16CCCGTGGGCCCCACGTNONE 
J033050M08CCCGTGGGCCCCACGTNONE 
J090053F04CCCGTGGGCCCCACGTNONE 
J090064E19CCCGTGGGCCCCACGTNONE 
J090083J24CCCGTGGGCCCCACGTNONE 
J100024I23CCCGTGGGCCCCACGTNONE 
Os03g0788800AK071670GTGGGGCCCACGCZinc finger, RING-type domain containing protein. 
J013090J22GTGGGGCCCACGCNONE 
J023050M06GTGGGGCCCACGCNONE 
J023073A12GTGGGGCCCACGCNONE 
J023075P21GTGGGGCCCACGCNONE 
J023106F04GTGGGGCCCACGCNONE 
J075181H19GTGGGGCCCACGCNONE 
J090009C24GTGGGGCCCACGCNONE 
J100027L24GTGGGGCCCACGCNONE 
J100055F06GTGGGGCCCACGCNONE 
J100081C22GTGGGGCCCACGCNONE 
J100084I21GTGGGGCCCACGCNONE 
Os03g0793100AK067897GTGGGACCCACGTGGGCCCCACAGlycosyl transferase, family 43 protein. 
J033125G24GTGGGACCCACGTGGGCCCCACANONE 
J065132N21GTGGGACCCACGTGGGCCCCACANONE 
Os03g0796600003-113-D10TCGTGGGCCCCACCNONE 
011-076-B12TCGTGGGCCCCACCNONE 
AK105257TCGTGGGCCCCACCProtein of unknown function DUF506, plant family protein. 
J075105C03TCGTGGGCCCCACCNONE 
J080036O17TCGTGGGCCCCACCNONE 
J080064E16TCGTGGGCCCCACCNONE 
J080069E03TCGTGGGCCCCACCNONE 
J080079E23TCGTGGGCCCCACCNONE 
J090036H20TCGTGGGCCCCACCNONE 
J100029L10TCGTGGGCCCCACCNONE 
J100055G09TCGTGGGCCCCACCNONE 
Os03g0796800J065024O22CACGTGGGCCCCATCCAConserved hypothetical protein. 
J065024O22GCCACGTGGGCCCGGGConserved hypothetical protein. 
Os03g0797600006-034-B06GGACGGCCCACGTACAGCCCATCAAGGCCCATATNONE 
009-066-A01GGACGGCCCACGTACAGCCCATCAAGGCCCATATNONE 
014-035-H08GGACGGCCCACGTACAGCCCATCAAGGCCCATATNONE 
AK067446GGACGGCCCACGTACAGCCCATCAAGGCCCATATSimilar to Helix-loop-helix protein homolog. 
AK068388GGACGGCCCACGTACAGCCCATCAAGGCCCATATNONE 
AK104412GGACGGCCCACGTACAGCCCATCAAGGCCCATATNONE 
Os03g0798600AK121716GGCCGGGCCGGAACACGTGGGCCTASimilar to 40S ribosomal protein S15 (Fragment). 
J013120B18GGCCGGGCCGGAACACGTGGGCCTANONE 
J033079G18GGCCGGGCCGGAACACGTGGGCCTANONE 
J043038B19GGCCGGGCCGGAACACGTGGGCCTANONE 
J065091E15GGCCGGGCCGGAACACGTGGGCCTANONE 
J065092P10GGCCGGGCCGGAACACGTGGGCCTANONE 
J065189F18GGCCGGGCCGGAACACGTGGGCCTANONE 
J065189L12GGCCGGGCCGGAACACGTGGGCCTANONE 
J075021B11GGCCGGGCCGGAACACGTGGGCCTANONE 
J075022L15GGCCGGGCCGGAACACGTGGGCCTANONE 
J075046G12GGCCGGGCCGGAACACGTGGGCCTANONE 
J075080H15GGCCGGGCCGGAACACGTGGGCCTANONE 
J090045H01GGCCGGGCCGGAACACGTGGGCCTANONE 
J090077H16GGCCGGGCCGGAACACGTGGGCCTANONE 
J090083D22GGCCGGGCCGGAACACGTGGGCCTANONE 
J100021D24GGCCGGGCCGGAACACGTGGGCCTANONE 
J100023G04GGCCGGGCCGGAACACGTGGGCCTANONE 
J100049J23GGCCGGGCCGGAACACGTGGGCCTANONE 
J100075K23GGCCGGGCCGGAACACGTGGGCCTANONE 
J100077G22GGCCGGGCCGGAACACGTGGGCCTANONE 
Os03g0799100AK058959ACACGTGGGCCCTNONE 
AK102772ACACGTGGGCCCTSimilar to WAVE-DAMPENED2. 
J023093D03ACACGTGGGCCCTNONE 
J033099D22ACACGTGGGCCCTNONE 
J090054G18ACACGTGGGCCCTNONE 
J100031H24ACACGTGGGCCCTNONE 
J100065H09ACACGTGGGCCCTNONE 
J100082G10ACACGTGGGCCCTNONE 
Os03g0824400AK070153TACGGCCCACGCTGCGGCCCNONE 
AK104298TACGGCCCACGCTGCGGCCCSimilar to Dolichol-phosphate mannosyltransferase (EC 2.4.1.83) (Dolichol- phosphate mannose synthase) (Dolichyl-phosphate beta-D- mannosyltransferase) (Mannose-P-dolichol synthase) (MPD synthase) (DPM synthase). 
Os03g0832200AK070712CCCGTGGGCCAGSimilar to Calcium-binding protein precursor (Calreticulin). 
AK070712GGCCGTGGGCCATSimilar to Calcium-binding protein precursor (Calreticulin). 
Os03g0833500AK119356GAGGCGTGGGCCTGSimilar to 98kDa HDM allergen. 
Os03g0833700011-060-A10GAGGCCCACGAANONE 
AK121918GAGGCCCACGAARNA 3'-terminal phosphate cyclase family protein. 
Os03g0843700AK070364ACACGTGGGCCTAFAR1 domain containing protein. 
J013146A20ACACGTGGGCCTANONE 
J023050I08ACACGTGGGCCTANONE 
J033058E14ACACGTGGGCCTANONE 
J033111G20ACACGTGGGCCTANONE 
J033141H24ACACGTGGGCCTANONE 
J065021K13ACACGTGGGCCTANONE 
J065082M21ACACGTGGGCCTANONE 
J075106L22ACACGTGGGCCTANONE 
J075150L05ACACGTGGGCCTANONE 
J075172H24ACACGTGGGCCTANONE 
J075199F06ACACGTGGGCCTANONE 
Os03g0852600009-174-G04AAGGCCCACGANONE 
AK063101AAGGCCCACGAProtein of unknown function DUF565 family protein. 
J065131H12AAGGCCCACGANONE 
J090046K24AAGGCCCACGANONE 
Os03g0854000009-186-C03GGCTGGGCCCACGCGNONE 
AK061374GGCTGGGCCCACGCGProtein of unknown function UPF0131 family protein. 
J065138B11GGCTGGGCCCACGCGNONE 
Os03g0854800J090007D13GCCGGCCCACGGGNONE 
J090085N22GCCGGCCCACGGGNONE 
Os04g0115400015-048-B05ACGTGGGCCGAANONE 
AK070523ACGTGGGCCGAAD111/G-patch domain containing protein. 
Os04g0122000AK065510CCGTGGGCCGCACGTGGGCTTTTLeucine rich repeat, N-terminal domain containing protein. 
AK072577CCGTGGGCCGCACGTGGGCTTTTNONE 
AK099773CCGTGGGCCGCACGTGGGCTTTTNONE 
J013030L03CCGTGGGCCGCACGTGGGCTTTTNONE 
J013042D23CCGTGGGCCGCACGTGGGCTTTTNONE 
J013050E17CCGTGGGCCGCACGTGGGCTTTTNONE 
J013051J21CCGTGGGCCGCACGTGGGCTTTTNONE 
J013055L09CCGTGGGCCGCACGTGGGCTTTTNONE 
J013064A03CCGTGGGCCGCACGTGGGCTTTTNONE 
J013095E06CCGTGGGCCGCACGTGGGCTTTTNONE 
J013111A06CCGTGGGCCGCACGTGGGCTTTTNONE 
J013118K01CCGTGGGCCGCACGTGGGCTTTTNONE 
J013119A03CCGTGGGCCGCACGTGGGCTTTTNONE 
J013134F07CCGTGGGCCGCACGTGGGCTTTTNONE 
J033132N23CCGTGGGCCGCACGTGGGCTTTTNONE 
Os04g0126800AK107895CCCGGGCCCACGGGHypothetical protein. 
Os04g0196600AK121999GGCCCACGAProtein of unknown function DUF563 family protein. 
Os04g0208400AK069629CACGTGGGCCGGCCyclin-like F-box domain containing protein. 
Os04g0346800AK101242AAATGGGCCTATCGTGGGCCCGCGCGGCCCAATTNONE 
AK109486AAATGGGCCTATCGTGGGCCCGCGCGGCCCAATTEAR repeat containing protein. 
J080306O15AAATGGGCCTATCGTGGGCCCGCGCGGCCCAATTNONE 
J080317H19AAATGGGCCTATCGTGGGCCCGCGCGGCCCAATTNONE 
Os04g0372700009-110-D07GCGTGGGCCCACGCCACACGACGCGTCCNONE 
AK062814GCGTGGGCCCACGCCACACGACGCGTCCSimilar to Quinone-oxidoreductase QR1 (Fragment). 
J065021E21GCGTGGGCCCACGCCACACGACGCGTCCNONE 
J065099E23GCGTGGGCCCACGCCACACGACGCGTCCNONE 
J065120F10GCGTGGGCCCACGCCACACGACGCGTCCNONE 
J065165P14GCGTGGGCCCACGCCACACGACGCGTCCNONE 
J065208L18GCGTGGGCCCACGCCACACGACGCGTCCNONE 
Os04g0387600009-148-E01CCCGTGGGGCCCACGCNONE 
009-155-A11CCCGTGGGGCCCACGCNONE 
009-175-F04CCCGTGGGGCCCACGCNONE 
AK063862CCCGTGGGGCCCACGCConserved hypothetical protein. 
J065035F12CCCGTGGGGCCCACGCNONE 
J065162C13CCCGTGGGGCCCACGCNONE 
J065169L19CCCGTGGGGCCCACGCNONE 
Os04g0436800015-053-A06ACGTGGGCCTGANONE 
AK101115ACGTGGGCCTGAProtein prenyltransferase domain containing protein. 
J033025G14ACGTGGGCCTGANONE 
J033073N23ACGTGGGCCTGANONE 
J033097L19ACGTGGGCCTGANONE 
Os04g0445100014-052-B04GTGGCCCACGANONE 
AK063700GTGGCCCACGASimilar to 22.7 kDa class IV heat shock protein precursor. 
Os04g0476000Os04g0476000TTCGTGGGCCCCACACGTetratricopeptide-like helical domain containing protein. 
Os04g0504600J065162K24CCGTGGGCCTTNONE 
Os04g0506300AK063591TCGTGGGCCCCACCCGTMS membrane protein/tumour differentially expressed protein family protein. 
J090099F08TCGTGGGCCCCACCCGNONE 
Os04g0531100013-046-D02CACGGCCCACGGNONE 
AF090698CACGGCCCACGGNONE 
AK063584CACGGCCCACGGC2 calcium/lipid-binding region, CaLB domain containing protein. 
J065025M20CACGGCCCACGGNONE 
J065028L15CACGGCCCACGGNONE 
J065048O03CACGGCCCACGGNONE 
J065053K10CACGGCCCACGGNONE 
J065072H10CACGGCCCACGGNONE 
J065081H10CACGGCCCACGGNONE 
J065082N17CACGGCCCACGGNONE 
J065104K08CACGGCCCACGGNONE 
J065106M03CACGGCCCACGGNONE 
J065119I05CACGGCCCACGGNONE 
J065122F04CACGGCCCACGGNONE 
J065140N24CACGGCCCACGGNONE 
J065153G09CACGGCCCACGGNONE 
J065171H07CACGGCCCACGGNONE 
J065172M23CACGGCCCACGGNONE 
J065173K13CACGGCCCACGGNONE 
J065177D22CACGGCCCACGGNONE 
J065189H10CACGGCCCACGGNONE 
J065198H24CACGGCCCACGGNONE 
J065204D19CACGGCCCACGGNONE 
J075006C08CACGGCCCACGGNONE 
J075029I08CACGGCCCACGGNONE 
J075039A16CACGGCCCACGGNONE 
J075107I24CACGGCCCACGGNONE 
J075135M22CACGGCCCACGGNONE 
J075181P06CACGGCCCACGGNONE 
J075190O11CACGGCCCACGGNONE 
J075193F04CACGGCCCACGGNONE 
Os04g0556300009-065-A04CGCGTGGGCCACACGNONE 
009-124-C05CGCGTGGGCCACACGNONE 
AK062772CGCGTGGGCCACACGGlutathione peroxidase. 
AY100689CGCGTGGGCCACACGNONE 
J065008N06CGCGTGGGCCACACGNONE 
J065012C13CGCGTGGGCCACACGNONE 
J065017J06CGCGTGGGCCACACGNONE 
J065033M15CGCGTGGGCCACACGNONE 
J065086O21CGCGTGGGCCACACGNONE 
J065102K04CGCGTGGGCCACACGNONE 
J065141D21CGCGTGGGCCACACGNONE 
J065159K20CGCGTGGGCCACACGNONE 
J065164C12CGCGTGGGCCACACGNONE 
J065170F10CGCGTGGGCCACACGNONE 
J065181F20CGCGTGGGCCACACGNONE 
J065205N07CGCGTGGGCCACACGNONE 
J065209N21CGCGTGGGCCACACGNONE 
J075001M12CGCGTGGGCCACACGNONE 
J075007D22CGCGTGGGCCACACGNONE 
J075026H04CGCGTGGGCCACACGNONE 
J075042O08CGCGTGGGCCACACGNONE 
J075044G20CGCGTGGGCCACACGNONE 
J075057D10CGCGTGGGCCACACGNONE 
J075096L23CGCGTGGGCCACACGNONE 
J075104K12CGCGTGGGCCACACGNONE 
J075119H14CGCGTGGGCCACACGNONE 
J075136C14CGCGTGGGCCACACGNONE 
J075172D01CGCGTGGGCCACACGNONE 
J075184M01CGCGTGGGCCACACGNONE 
J075186E06CGCGTGGGCCACACGNONE 
J075192M08CGCGTGGGCCACACGNONE 
J080006D18CGCGTGGGCCACACGNONE 
J080044G16CGCGTGGGCCACACGNONE 
J080087G15CGCGTGGGCCACACGNONE 
J100021I05CGCGTGGGCCACACGNONE 
J100039D10CGCGTGGGCCACACGNONE 
J100073B05CGCGTGGGCCACACGNONE 
J100074M12CGCGTGGGCCACACGNONE 
Os04g0559400AK106376CCTGGGCCCACGCSimilar to Branched-chain-amino-acid aminotransferase 5, chloroplast precursor (EC 2.6.1.42) (Atbcat-5). 
Os04g0563300AK100487CCCGGCCCACGCCyclin-like F-box domain containing protein. 
J023097O18CCCGGCCCACGCNONE 
J065100E16CCCGGCCCACGCNONE 
J075022C23CCCGGCCCACGCNONE 
J075023L18CCCGGCCCACGCNONE 
J075040N10CCCGGCCCACGCNONE 
J075061L14CCCGGCCCACGCNONE 
J075069B15CCCGGCCCACGCNONE 
J075106C16CCCGGCCCACGCNONE 
J075138P13CCCGGCCCACGCNONE 
J075139H18CCCGGCCCACGCNONE 
J075139L06CCCGGCCCACGCNONE 
J075149B07CCCGGCCCACGCNONE 
J075177N21CCCGGCCCACGCNONE 
Os04g0564600009-038-A02CCCGGCCCATAAGGCCCACGTNONE 
AK105145CCCGGCCCATAAGGCCCACGTNONE 
AK120614CCCGGCCCATAAGGCCCACGTSimilar to HMG1 protein. 
J013102D16CCCGGCCCATAAGGCCCACGTNONE 
J013151P06CCCGGCCCATAAGGCCCACGTNONE 
J033082C11CCCGGCCCATAAGGCCCACGTNONE 
J065073N13CCCGGCCCATAAGGCCCACGTNONE 
J065142E11CCCGGCCCATAAGGCCCACGTNONE 
J065187I19CCCGGCCCATAAGGCCCACGTNONE 
J065204K02CCCGGCCCATAAGGCCCACGTNONE 
J090089P22CCCGGCCCATAAGGCCCACGTNONE 
J100060B16CCCGGCCCATAAGGCCCACGTNONE 
Os04g0565500006-022-C06CCAGGCCCACGTNONE 
AK058888CCAGGCCCACGTAmino acid/polyamine transporter II family protein. 
AK071118CCAGGCCCACGTNONE 
AK105902CCAGGCCCACGTNONE 
J023052I22CCAGGCCCACGTNONE 
J023082L01CCAGGCCCACGTNONE 
J023112P14CCAGGCCCACGTNONE 
J065043O12CCAGGCCCACGTNONE 
J065045B08CCAGGCCCACGTNONE 
J065059N01CCAGGCCCACGTNONE 
J065073A04CCAGGCCCACGTNONE 
J065078K06CCAGGCCCACGTNONE 
J065124J08CCAGGCCCACGTNONE 
J065140G16CCAGGCCCACGTNONE 
J065185E13CCAGGCCCACGTNONE 
J065197N09CCAGGCCCACGTNONE 
J100024A03CCAGGCCCACGTNONE 
J100042E11CCAGGCCCACGTNONE 
J100069L15CCAGGCCCACGTNONE 
J100078K13CCAGGCCCACGTNONE 
Os04g0577500006-039-C03TCTGGGCCCACGANONE 
006-043-H01TCTGGGCCCACGANONE 
AK061538TCTGGGCCCACGANONE 
AK065648TCTGGGCCCACGATatD-related deoxyribonuclease family protein. 
AK104763TCTGGGCCCACGANONE 
J013035E21TCTGGGCCCACGANONE 
J013066M11TCTGGGCCCACGANONE 
J100026B02TCTGGGCCCACGANONE 
Os04g0581300009-171-H01ATGGCCCACGCCACAAGCCCACAANONE 
AK063093ATGGCCCACGCCACAAGCCCACAASimilar to Mitochondrial import inner membrane translocase subunit TIM13. 
Os04g0639100009-158-D03CGCGTGGGCCTCNONE 
AK063036CGCGTGGGCCTCConserved hypothetical protein. 
J075045D14CGCGTGGGCCTCNONE 
J075047L16CGCGTGGGCCTCNONE 
J075048D20CGCGTGGGCCTCNONE 
J075056E20CGCGTGGGCCTCNONE 
J075074E14CGCGTGGGCCTCNONE 
J075108F16CGCGTGGGCCTCNONE 
J075143L19CGCGTGGGCCTCNONE 
J075146L07CGCGTGGGCCTCNONE 
J075158I04CGCGTGGGCCTCNONE 
J075172B20CGCGTGGGCCTCNONE 
J090061M08CGCGTGGGCCTCNONE 
Os04g0640800AK065522GTGGCCCACGTGProgrammed cell death protein 2, C-terminal domain containing protein. 
AK065522TTTCGGCCCACGTTCCGTProgrammed cell death protein 2, C-terminal domain containing protein. 
Os04g0652900AK071125GTGGGGCCCACGGPeptidyl-tRNA hydrolase, PTH2 domain containing protein. 
J023082K03GTGGGGCCCACGGNONE 
J075142E01GTGGGGCCCACGGNONE 
Os04g0658600AK064729CCACGGCCCACGGNONE 
AK119253CCACGGCCCACGGNucleolar, Nop52 family protein. 
J075132J07CCACGGCCCACGGNONE 
J075157N21CCACGGCCCACGGNONE 
Os04g0661200AK102842GCCACGTGGGCCCGCACCGCProtein of unknown function DUF941 family protein. 
J033075E19GCCACGTGGGCCCGCACCGCNONE 
J033109O19GCCACGTGGGCCCGCACCGCNONE 
J065002J12GCCACGTGGGCCCGCACCGCNONE 
J065026E22GCCACGTGGGCCCGCACCGCNONE 
J065061F05GCCACGTGGGCCCGCACCGCNONE 
J065068D22GCCACGTGGGCCCGCACCGCNONE 
J065072N14GCCACGTGGGCCCGCACCGCNONE 
J065085F02GCCACGTGGGCCCGCACCGCNONE 
J075055G19GCCACGTGGGCCCGCACCGCNONE 
J075105B14GCCACGTGGGCCCGCACCGCNONE 
J075118M17GCCACGTGGGCCCGCACCGCNONE 
J075193H02GCCACGTGGGCCCGCACCGCNONE 
J100040O05GCCACGTGGGCCCGCACCGCNONE 
J100064I04GCCACGTGGGCCCGCACCGCNONE 
Os04g0670400012-048-A10TACGGCCCGGCCCATTTGGCCCACGAANONE 
AK103099TACGGCCCGGCCCATTTGGCCCACGAAOvarian tumour, otubain domain containing protein. 
J033118N06TACGGCCCGGCCCATTTGGCCCACGAANONE 
J100019K03TACGGCCCGGCCCATTTGGCCCACGAANONE 
Os04g0670500AK107506TTCGTGGGCCAAATGGGCCGGGCCGTACysteine protease 1 precursor (EC 3.4.22.-) (OsCP1). 
Os04g0670600AK064255TCAGGCCCACGAANONE 
Os04g0670800AK073170GAGGCCCACGGNONE 
Os04g0674000006-093-C01GCGGGCCCACGCNONE 
009-040-F06GCGGGCCCACGCNONE 
AK071276GCGGGCCCACGCNONE 
AK109377GCGGGCCCACGCConserved hypothetical protein. 
AK119671GCGGGCCCACGCNONE 
J023084J11GCGGGCCCACGCNONE 
J023088F18GCGGGCCCACGCNONE 
J065099M12GCGGGCCCACGCNONE 
J065136J08GCGGGCCCACGCNONE 
J065167H22GCGGGCCCACGCNONE 
J075046L21GCGGGCCCACGCNONE 
J080029F17GCGGGCCCACGCNONE 
J080053C16GCGGGCCCACGCNONE 
J080053E24GCGGGCCCACGCNONE 
J080074D14GCGGGCCCACGCNONE 
J100029C12GCGGGCCCACGCNONE 
J100030D01GCGGGCCCACGCNONE 
J100044E16GCGGGCCCACGCNONE 
J100065N18GCGGGCCCACGCNONE 
J100077D18GCGGGCCCACGCNONE 
J100090P13GCGGGCCCACGCNONE 
Os04g0675400AK068186CCGTGGGCCGTGSimilar to Chaperone protein dnaJ. 
J013029J20CCGTGGGCCGTGNONE 
J013072I16CCGTGGGCCGTGNONE 
J013134H18CCGTGGGCCGTGNONE 
J013159H06CCGTGGGCCGTGNONE 
Os04g0678200006-037-E05GGGGCCCACGCGTNONE 
006-059-G04GGGGCCCACGCGTNONE 
006-097-A11GGGGCCCACGCGTNONE 
006-098-D11GGGGCCCACGCGTNONE 
009-154-H11GGGGCCCACGCGTNONE 
AK106193GGGGCCCACGCGTProtein of unknown function DUF1218 family protein. 
J013064K07GGGGCCCACGCGTNONE 
Os04g0679800AK060662CCGTGGGCCCCACGSimilar to RNA-binding protein-like protein. 
AK099987CCGTGGGCCCCACGNONE 
J013130B11CCGTGGGCCCCACGNONE 
J065049C17CCGTGGGCCCCACGNONE 
J075191N12CCGTGGGCCCCACGNONE 
J075191P12CCGTGGGCCCCACGNONE 
J100031C07CCGTGGGCCCCACGNONE 
Os04g0685100AK065262CCGTGGGCCGTCRibosomal biogenesis regulatory protein family protein. 
J013002J24CCGTGGGCCGTCNONE 
J013030M11CCGTGGGCCGTCNONE 
J033139J12CCGTGGGCCGTCNONE 
J065013D12CCGTGGGCCGTCNONE 
J065117J01CCGTGGGCCGTCNONE 
J065143K20CCGTGGGCCGTCNONE 
J065181E12CCGTGGGCCGTCNONE 
J065184A17CCGTGGGCCGTCNONE 
J065193B13CCGTGGGCCGTCNONE 
J065196H01CCGTGGGCCGTCNONE 
J075072G17CCGTGGGCCGTCNONE 
J075077B02CCGTGGGCCGTCNONE 
J075088A06CCGTGGGCCGTCNONE 
J075099H13CCGTGGGCCGTCNONE 
J075111O04CCGTGGGCCGTCNONE 
J075131F20CCGTGGGCCGTCNONE 
J075139K01CCGTGGGCCGTCNONE 
J075194I16CCGTGGGCCGTCNONE 
Os04g0685600AK067506GCGGCCCACGCGExo70 exocyst complex subunit family protein. 
J013108D21GCGGCCCACGCGNONE 
J023041E19GCGGCCCACGCGNONE 
J065006M21GCGGCCCACGCGNONE 
J065060B21GCGGCCCACGCGNONE 
J065086K07GCGGCCCACGCGNONE 
J065121N03GCGGCCCACGCGNONE 
J065201M22GCGGCCCACGCGNONE 
J075004H05GCGGCCCACGCGNONE 
J075005G06GCGGCCCACGCGNONE 
J075032N07GCGGCCCACGCGNONE 
J075055M01GCGGCCCACGCGNONE 
J075057A20GCGGCCCACGCGNONE 
J075078L23GCGGCCCACGCGNONE 
J075137G04GCGGCCCACGCGNONE 
J090026N09GCGGCCCACGCGNONE 
J090044L05GCGGCCCACGCGNONE 
Os05g0111200009-033-A06ACGCGTGGGCCACNONE 
AK101693ACGCGTGGGCCACSimilar to Amino acid selective channel protein. 
J065006E13ACGCGTGGGCCACNONE 
J075001D12ACGCGTGGGCCACNONE 
J075005J18ACGCGTGGGCCACNONE 
J075009L08ACGCGTGGGCCACNONE 
J075012M21ACGCGTGGGCCACNONE 
J075019K17ACGCGTGGGCCACNONE 
J075020D07ACGCGTGGGCCACNONE 
J075041D11ACGCGTGGGCCACNONE 
J075051C03ACGCGTGGGCCACNONE 
J075060C05ACGCGTGGGCCACNONE 
J075079N09ACGCGTGGGCCACNONE 
J075094B04ACGCGTGGGCCACNONE 
J075108E08ACGCGTGGGCCACNONE 
J075115G05ACGCGTGGGCCACNONE 
J075147L21ACGCGTGGGCCACNONE 
J075161G12ACGCGTGGGCCACNONE 
J075168J11ACGCGTGGGCCACNONE 
J075168L11ACGCGTGGGCCACNONE 
J075174F22ACGCGTGGGCCACNONE 
Os05g0119000AK069359GCGTGGGCCCCACCConserved hypothetical protein 245 family protein. 
J065020A09GCGTGGGCCCCACCNONE 
J065043F11GCGTGGGCCCCACCNONE 
J065182D16GCGTGGGCCCCACCNONE 
J065211L04GCGTGGGCCCCACCNONE 
Os05g0121800AK101222CCCACGCGTGGGCCCTConserved hypothetical protein. 
J033031D02CCCACGCGTGGGCCCTNONE 
J065078F10CCCACGCGTGGGCCCTNONE 
J065151J16CCCACGCGTGGGCCCTNONE 
J065151K04CCCACGCGTGGGCCCTNONE 
J090057E18CCCACGCGTGGGCCCTNONE 
Os05g0145100AK107957CCGTGGGCCATCCCCCConserved hypothetical protein. 
Os05g0145900006-095-D04CCACGGCCCACGCCCACTCCNONE 
006-104-B04CCACGGCCCACGCCCACTCCNONE 
AK121187CCACGGCCCACGCCCACTCCConserved hypothetical protein. 
J043034M11CCACGGCCCACGCCCACTCCNONE 
J053032K19CCACGGCCCACGCCCACTCCNONE 
J090096F20CCACGGCCCACGCCCACTCCNONE 
Os05g0150600011-043-D06CCACTGACAGCGTGGGCCCACANONE 
AK072977CCACTGACAGCGTGGGCCCACAATP-dependent DNA helicase RecQ family protein. 
AY180331CCACTGACAGCGTGGGCCCACANONE 
J090053A16CCACTGACAGCGTGGGCCCACANONE 
Os05g0155100006-075-B02CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
006-075-B02CCGTGGGCCGGANONE 
AK061929CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
AK061929CCGTGGGCCGGANONE 
AK102810CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
AK102810CCGTGGGCCGGANONE 
AK120877CCCACCACTCCGGCCCACGAGGCCCACCACSimilar to 60S ribosomal protein L18. 
AK120877CCGTGGGCCGGASimilar to 60S ribosomal protein L18. 
J013023E03CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J013023E03CCGTGGGCCGGANONE 
J013038C16CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J013038C16CCGTGGGCCGGANONE 
J013120M14CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J013120M14CCGTGGGCCGGANONE 
J013153B04CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J013153B04CCGTGGGCCGGANONE 
J013159B07CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J013159B07CCGTGGGCCGGANONE 
J023012A02CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J023012A02CCGTGGGCCGGANONE 
J023027F08CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J023027F08CCGTGGGCCGGANONE 
J023027I12CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J023027I12CCGTGGGCCGGANONE 
J023120F05CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J023120F05CCGTGGGCCGGANONE 
J023138O03CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J023138O03CCGTGGGCCGGANONE 
J023142H13CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J023142H13CCGTGGGCCGGANONE 
J023143P06CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J023143P06CCGTGGGCCGGANONE 
J033023P09CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033023P09CCGTGGGCCGGANONE 
J033035O14CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033035O14CCGTGGGCCGGANONE 
J033042N19CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033042N19CCGTGGGCCGGANONE 
J033043B12CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033043B12CCGTGGGCCGGANONE 
J033065D10CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033065D10CCGTGGGCCGGANONE 
J033081A12CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033081A12CCGTGGGCCGGANONE 
J033084N05CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033084N05CCGTGGGCCGGANONE 
J033085M03CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033085M03CCGTGGGCCGGANONE 
J033112D15CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033112D15CCGTGGGCCGGANONE 
J033114O07CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033114O07CCGTGGGCCGGANONE 
J033119D15CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033119D15CCGTGGGCCGGANONE 
J033140E06CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033140E06CCGTGGGCCGGANONE 
J033141K23CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J033141K23CCGTGGGCCGGANONE 
J043040I22CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J043040I22CCGTGGGCCGGANONE 
J053050B21CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J053050B21CCGTGGGCCGGANONE 
J053065I18CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J053065I18CCGTGGGCCGGANONE 
J053074O16CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J053074O16CCGTGGGCCGGANONE 
J065072K13CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J065072K13CCGTGGGCCGGANONE 
J065211I09CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J065211I09CCGTGGGCCGGANONE 
J090004K04CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J090004K04CCGTGGGCCGGANONE 
J090016L06CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J090016L06CCGTGGGCCGGANONE 
J090040F22CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J090040F22CCGTGGGCCGGANONE 
J090063F22CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J090063F22CCGTGGGCCGGANONE 
J090081J09CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J090081J09CCGTGGGCCGGANONE 
J100032A10CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J100032A10CCGTGGGCCGGANONE 
J100037G20CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J100037G20CCGTGGGCCGGANONE 
J100056O10CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J100056O10CCGTGGGCCGGANONE 
J100071D10CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J100071D10CCGTGGGCCGGANONE 
J100075K13CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J100075K13CCGTGGGCCGGANONE 
J100079F16CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J100079F16CCGTGGGCCGGANONE 
J100080O16CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J100080O16CCGTGGGCCGGANONE 
J100086N05CCCACCACTCCGGCCCACGAGGCCCACCACNONE 
J100086N05CCGTGGGCCGGANONE 
Os05g0163700AK071561CACTGACAGGTGGGGCCCACGCSimilar to Acyl-coenzyme A oxidase 4, peroxisomal (EC 1.3.3.6) (AOX 4) (Short- chain acyl-CoA oxidase) (SAOX) (AtCX4) (G6p) (AtG6). 
Os05g0164100AF456329CCCCCGCGTGGGCCCCACCCGNONE 
AF456329GGCCCACGTNONE 
AK065086CCCCCGCGTGGGCCCCACCCGNONE 
AK065086GGCCCACGTNONE 
AK072243CCCCCGCGTGGGCCCCACCCGSimilar to Fructose-6-phosphate 2-kinase/fructose-2,6-bisphosphatase (EC 2.7.1.105) (EC 3.1.3.46) (Fragment). 
AK072243GGCCCACGTSimilar to Fructose-6-phosphate 2-kinase/fructose-2,6-bisphosphatase (EC 2.7.1.105) (EC 3.1.3.46) (Fragment). 
J013001L18CCCCCGCGTGGGCCCCACCCGNONE 
J013001L18GGCCCACGTNONE 
J013132O12CCCCCGCGTGGGCCCCACCCGNONE 
J013132O12GGCCCACGTNONE 
J023003N09CCCCCGCGTGGGCCCCACCCGNONE 
J023003N09GGCCCACGTNONE 
Os05g0184901Os05g0184901CGCGTGGGCCGTASigma factor, regions 3 and 4 domain containing protein. 
Os05g0194550J075140P14GGACCCACGTGGGCCCCACAConserved hypothetical protein. 
Os05g0283600AK100359GCGTGGGCCGGTConserved hypothetical protein. 
AK106958GCGTGGGCCGGTNONE 
AK109539GCGTGGGCCGGTNONE 
J023083K23GCGTGGGCCGGTNONE 
Os05g0320700AK100598TCCGGGCCCACGTSimilar to Cytochrome P450. 
AK104994TCCGGGCCCACGTNONE 
Os05g0322900006-057-H12CGCGTGGGCCGCNONE 
014-051-A08CGCGTGGGCCGCNONE 
AK063697CGCGTGGGCCGCNONE 
AK066255CGCGTGGGCCGCSimilar to WRKY transcription factor 45. 
AK103959CGCGTGGGCCGCNONE 
AY870611CGCGTGGGCCGCNONE 
J100068H13CGCGTGGGCCGCNONE 
Os05g0331200AK100884CCACGGCCCACGCSimilar to External rotenone-insensitive NADPH dehydrogenase. 
Os05g0344200006-022-E04CCGTGGGCCTCNONE 
006-080-D01CCGTGGGCCTCNONE 
009-021-D03CCGTGGGCCTCNONE 
009-026-A10CCGTGGGCCTCNONE 
009-054-B12CCGTGGGCCTCNONE 
009-059-H03CCGTGGGCCTCNONE 
009-077-C02CCGTGGGCCTCNONE 
009-095-H12CCGTGGGCCTCNONE 
009-106-B08CCGTGGGCCTCNONE 
009-138-D10CCGTGGGCCTCNONE 
009-140-G06CCGTGGGCCTCNONE 
009-146-E09CCGTGGGCCTCNONE 
009-161-F04CCGTGGGCCTCNONE 
009-176-F05CCGTGGGCCTCNONE 
013-047-C03CCGTGGGCCTCNONE 
013-052-E07CCGTGGGCCTCNONE 
013-054-G04CCGTGGGCCTCNONE 
013-095-D10CCGTGGGCCTCNONE 
014-003-D06CCGTGGGCCTCNONE 
014-020-C09CCGTGGGCCTCNONE 
014-043-E01CCGTGGGCCTCNONE 
014-080-G09CCGTGGGCCTCNONE 
014-081-H05CCGTGGGCCTCNONE 
AK060058CCGTGGGCCTCConserved hypothetical protein. 
AK098850CCGTGGGCCTCNONE 
AK104716CCGTGGGCCTCNONE 
AK119727CCGTGGGCCTCNONE 
J013000G04CCGTGGGCCTCNONE 
J013155L11CCGTGGGCCTCNONE 
J033138J22CCGTGGGCCTCNONE 
J065112E22CCGTGGGCCTCNONE 
J065124M06CCGTGGGCCTCNONE 
J065130M01CCGTGGGCCTCNONE 
J065137I03CCGTGGGCCTCNONE 
J065157O12CCGTGGGCCTCNONE 
J065171B12CCGTGGGCCTCNONE 
J075003O16CCGTGGGCCTCNONE 
J075026G12CCGTGGGCCTCNONE 
J075032K07CCGTGGGCCTCNONE 
J075070I11CCGTGGGCCTCNONE 
J075093K06CCGTGGGCCTCNONE 
J075148C12CCGTGGGCCTCNONE 
J075148L08CCGTGGGCCTCNONE 
J075152G13CCGTGGGCCTCNONE 
J075177G07CCGTGGGCCTCNONE 
J100026I09CCGTGGGCCTCNONE 
J100083L11CCGTGGGCCTCNONE 
J100086F04CCGTGGGCCTCNONE 
Os05g0357200014-046-H09GCCCCACGTGGGCCCCACGCCTCNONE 
014-046-H09TCGTGGGCCCCACGGCCNONE 
AK064069GCCCCACGTGGGCCCCACGCCTCNONE 
AK064069TCGTGGGCCCCACGGCCNONE 
AK072064GCCCCACGTGGGCCCCACGCCTCMitochondrial substrate carrier family protein. 
AK072064TCGTGGGCCCCACGGCCMitochondrial substrate carrier family protein. 
J065038M01GCCCCACGTGGGCCCCACGCCTCNONE 
J065038M01TCGTGGGCCCCACGGCCNONE 
J065121C16GCCCCACGTGGGCCCCACGCCTCNONE 
J065121C16TCGTGGGCCCCACGGCCNONE 
J075173E09GCCCCACGTGGGCCCCACGCCTCNONE 
J075173E09TCGTGGGCCCCACGGCCNONE 
J080307A20GCCCCACGTGGGCCCCACGCCTCNONE 
J080307A20TCGTGGGCCCCACGGCCNONE 
J090046B19GCCCCACGTGGGCCCCACGCCTCNONE 
J090046B19TCGTGGGCCCCACGGCCNONE 
J100033N12GCCCCACGTGGGCCCCACGCCTCNONE 
J100033N12TCGTGGGCCCCACGGCCNONE 
J100036G01GCCCCACGTGGGCCCCACGCCTCNONE 
J100036G01TCGTGGGCCCCACGGCCNONE 
J100057B19GCCCCACGTGGGCCCCACGCCTCNONE 
J100057B19TCGTGGGCCCCACGGCCNONE 
Os05g0358000006-083-G07CCCGTGGGCCCCACCNONE 
AK061141CCCGTGGGCCCCACCNONE 
AK070900CCCGTGGGCCCCACCNONE 
AK101263CCCGTGGGCCCCACCDrought induced 19 family protein. 
J023098C13CCCGTGGGCCCCACCNONE 
J033032J06CCCGTGGGCCCCACCNONE 
J065014A09CCCGTGGGCCCCACCNONE 
J065121L01CCCGTGGGCCCCACCNONE 
J065130K19CCCGTGGGCCCCACCNONE 
J065208B21CCCGTGGGCCCCACCNONE 
J075080G14CCCGTGGGCCCCACCNONE 
J075135L01CCCGTGGGCCCCACCNONE 
J075180J15CCCGTGGGCCCCACCNONE 
Os05g0366600015-093-D12ACGTGGGCCAGNONE 
AK071469ACGTGGGCCAGSimilar to Hydroxyisourate hydrolase. 
Os05g0392801J090025K15GTGGGACCCACGTGGGCCCCACGTConserved hypothetical protein. 
J090053E06GTGGGACCCACGTGGGCCCCACGTNONE 
Os05g0397300009-051-E02GGGGCCCACGGCCNONE 
009-051-E02TTCGTGGGGCCCACGANONE 
009-060-E03GGGGCCCACGGCCNONE 
009-060-E03TTCGTGGGGCCCACGANONE 
009-075-B01GGGGCCCACGGCCNONE 
009-075-B01TTCGTGGGGCCCACGANONE 
009-082-B11GGGGCCCACGGCCNONE 
009-082-B11TTCGTGGGGCCCACGANONE 
009-136-D05GGGGCCCACGGCCNONE 
009-136-D05TTCGTGGGGCCCACGANONE 
AK062621GGGGCCCACGGCCNONE 
AK062621TTCGTGGGGCCCACGANONE 
AK066003GGGGCCCACGGCCNONE 
AK066003TTCGTGGGGCCCACGANONE 
AK070832GGGGCCCACGGCCConserved hypothetical protein. 
AK070832TTCGTGGGGCCCACGAConserved hypothetical protein. 
J023066C05GGGGCCCACGGCCNONE 
J023066C05TTCGTGGGGCCCACGANONE 
Os05g0401300009-111-H03CCGTGGGCCGTGGGCCGTGNONE 
AK060678CCGTGGGCCGTGGGCCGTGTwin-arginine translocation pathway signal domain containing protein. 
Os05g0411300014-098-D05ACGTGGGCCCCACGTGTCNONE 
014-098-D05CCGTGGGCCCGNONE 
015-093-F04ACGTGGGCCCCACGTGTCNONE 
015-093-F04CCGTGGGCCCGNONE 
AK071931ACGTGGGCCCCACGTGTCConserved hypothetical protein. 
AK071931CCGTGGGCCCGConserved hypothetical protein. 
AK073142ACGTGGGCCCCACGTGTCNONE 
AK073142CCGTGGGCCCGNONE 
Os05g0423500015-048-C11CACGTGGGCCCACCTNONE 
AK066000CACGTGGGCCCACCTProtein kinase-like domain containing protein. 
J013049L02CACGTGGGCCCACCTNONE 
Os05g0429700AK069203TCGTGGGCCCCACCACNONE 
AK103559TCGTGGGCCCCACCACC2 calcium/lipid-binding region, CaLB domain containing protein. 
Os05g0440100015-006-F06TACGGCCCACGCNONE 
015-076-D04TACGGCCCACGCNONE 
AK073094TACGGCCCACGCNONE 
AK102786TACGGCCCACGCHistone deacetylase superfamily protein. 
J033107M16TACGGCCCACGCNONE 
Os05g0445500009-021-C05TCCGGCCCATGGGCCGTGGGCCTCNONE 
009-129-D11TCCGGCCCATGGGCCGTGGGCCTCNONE 
009-147-E04TCCGGCCCATGGGCCGTGGGCCTCNONE 
009-169-C11TCCGGCCCATGGGCCGTGGGCCTCNONE 
AK121459TCCGGCCCATGGGCCGTGGGCCTCSimilar to 60S acidic ribosomal protein P2B. 
D21114TCCGGCCCATGGGCCGTGGGCCTCNONE 
J023001K23TCCGGCCCATGGGCCGTGGGCCTCNONE 
J023107J19TCCGGCCCATGGGCCGTGGGCCTCNONE 
J023143J09TCCGGCCCATGGGCCGTGGGCCTCNONE 
J065049D04TCCGGCCCATGGGCCGTGGGCCTCNONE 
J065092I06TCCGGCCCATGGGCCGTGGGCCTCNONE 
J065188H04TCCGGCCCATGGGCCGTGGGCCTCNONE 
Os05g0451200AK073037ACCGGCCCACGTConserved hypothetical protein. 
Os05g0454400AK107942GCGTGGGCCCCACAConserved hypothetical protein. 
Os05g0463400AK100354CCGTGGGCCCCACAPWWP domain containing protein. 
J013022B18CCGTGGGCCCCACANONE 
J023083G23CCGTGGGCCCCACANONE 
Os05g0468700AB051864CCCGTGGGCCATAmmonium transporter. 
AK065288CCCGTGGGCCATNONE 
J013002M22CCCGTGGGCCATNONE 
Os05g0486200009-099-B03AGTGGGCCCTTCATGGGCCCACGCCACNONE 
AK121022AGTGGGCCCTTCATGGGCCCACGCCACConserved hypothetical protein. 
J023049I09AGTGGGCCCTTCATGGGCCCACGCCACNONE 
J033029N07AGTGGGCCCTTCATGGGCCCACGCCACNONE 
J075074I18AGTGGGCCCTTCATGGGCCCACGCCACNONE 
Os05g0487600AK100817TGTGGGGCCCACGTGNONE 
AK103104TGTGGGGCCCACGTGNONE 
J043027P10TGTGGGGCCCACGTGNONE 
J065183N17TGTGGGGCCCACGTGNONE 
Os05g0500500AK110627GCGGCCCACGGHSP20-like chaperone domain containing protein. 
Os05g0514300AK061747GCGTGGGCCCGSimilar to Tubby-like protein 3. 
AK098851GCGTGGGCCCGNONE 
Os05g0519700014-100-B04TCGTGGGCCCCACANONE 
AF332981TCGTGGGCCCCACANONE 
AK100903TCGTGGGCCCCACANONE 
AK105433TCGTGGGCCCCACAHeat shock protein 101. 
Os05g0529300AK102648GCGGGCCCACGTSimilar to ER lumen protein retaining receptor (HDEL receptor). 
Os05g0529400009-126-H06ACGTGGGCCCGCNONE 
AK063846ACGTGGGCCCGCConserved hypothetical protein. 
AK122038ACGTGGGCCCGCNONE 
J033113C01ACGTGGGCCCGCNONE 
Os05g0535200AK070696TCTCGGCCCACGGCGTGGACyclin-like F-box domain containing protein. 
J023057L12TCTCGGCCCACGGCGTGGANONE 
Os05g0537200AK121713GGCCGTGGGCCGTGGSimilar to Myosin XI (Fragment). 
Os05g0540100AB021666CACGTGGGCCGCANONE 
AK060623CACGTGGGCCGCANONE 
AK103819CACGTGGGCCGCAFlap endonuclease-1a (EC 3.-.-.-) (OsFEN-1a). 
Os05g0541900009-130-F05AACTGGGCTGGGCCTCCGTGGGCCGCNONE 
009-200-E07AACTGGGCTGGGCCTCCGTGGGCCGCNONE 
013-057-G09AACTGGGCTGGGCCTCCGTGGGCCGCNONE 
Os05g0542900AK102925GTGGCCCACGGCCCACGGCCCACGTGTVirulence factor, pectin lyase fold family protein. 
Os05g0555300009-032-C03CGCGTGCGCTGGCCCACGGNONE 
009-125-E08CGCGTGCGCTGGCCCACGGNONE 
009-149-C12CGCGTGCGCTGGCCCACGGNONE 
009-172-C01CGCGTGCGCTGGCCCACGGNONE 
AK062890CGCGTGCGCTGGCCCACGGFerredoxin domain containing protein. 
AK062997CGCGTGCGCTGGCCCACGGNONE 
Os05g0557200AK062090CGTGTGGGGCCCACGCGNONE 
AK102111CGTGTGGGGCCCACGCGArmadillo-like helical domain containing protein. 
J013047E13CGTGTGGGGCCCACGCGNONE 
J013089P04CGTGTGGGGCCCACGCGNONE 
J013130H17CGTGTGGGGCCCACGCGNONE 
J013132C20CGTGTGGGGCCCACGCGNONE 
J023001E06CGTGTGGGGCCCACGCGNONE 
J023108C09CGTGTGGGGCCCACGCGNONE 
J023125C12CGTGTGGGGCCCACGCGNONE 
J033023O10CGTGTGGGGCCCACGCGNONE 
J033033K16CGTGTGGGGCCCACGCGNONE 
J033064C11CGTGTGGGGCCCACGCGNONE 
J033071P07CGTGTGGGGCCCACGCGNONE 
J033072H14CGTGTGGGGCCCACGCGNONE 
J033084F06CGTGTGGGGCCCACGCGNONE 
J033084H11CGTGTGGGGCCCACGCGNONE 
J033097C05CGTGTGGGGCCCACGCGNONE 
J043009E20CGTGTGGGGCCCACGCGNONE 
J053035M10CGTGTGGGGCCCACGCGNONE 
J053043J22CGTGTGGGGCCCACGCGNONE 
J053082K10CGTGTGGGGCCCACGCGNONE 
J053094N13CGTGTGGGGCCCACGCGNONE 
Os05g0563600009-152-H06CCAGGCCCACGTNONE 
AK058836CCAGGCCCACGTNONE 
AK099313CCAGGCCCACGTBeta-Ig-H3/fasciclin domain containing protein. 
Os05g0566800AK065748TCGTGGGCCGTCCold acclimation protein COR413-TM1. 
AY181210TCGTGGGCCGTCNONE 
Os05g0567500AK073046CGGGTGGGCCCACGCGNONE 
AK121133CGGGTGGGCCCACGCGDNA glycosylase family protein. 
J023075P20CGGGTGGGCCCACGCGNONE 
Os05g0568600009-024-B09TCATGGGCCCACGCNONE 
AK063781TCATGGGCCCACGCProtein of unknown function DUF1645 family protein. 
J080049H14TCATGGGCCCACGCNONE 
J080062M08TCATGGGCCCACGCNONE 
J080064I07TCATGGGCCCACGCNONE 
J080068A12TCATGGGCCCACGCNONE 
J080086J10TCATGGGCCCACGCNONE 
Os05g0579500AK121528CCTGGGCCCACGAConserved hypothetical protein. 
J033030I07CCTGGGCCCACGANONE 
Os05g0583400AK101992TGTGGGGCCCACGTGGGTCCCACSimilar to Mitochondrial import receptor subunit TOM7 (Translocase of outer membrane 7 kDa subunit). 
Os05g0595300011-076-H02GCGTGGGCCCATGGNONE 
012-009-E07GCGTGGGCCCATGGNONE 
012-096-B01GCGTGGGCCCATGGNONE 
AK059614GCGTGGGCCCATGGNONE 
AK121601GCGTGGGCCCATGGSimilar to CONSTANS-like protein. 
J033040P21GCGTGGGCCCATGGNONE 
Os06g0101600AF093636AAGGCCCACGTNONE 
AK070447AAGGCCCACGTPlastocyanin, chloroplast precursor. 
J065001A20AAGGCCCACGTNONE 
J065019M17AAGGCCCACGTNONE 
J065021H18AAGGCCCACGTNONE 
J065061A17AAGGCCCACGTNONE 
J065073L02AAGGCCCACGTNONE 
J065099F17AAGGCCCACGTNONE 
J065101C23AAGGCCCACGTNONE 
J065121E23AAGGCCCACGTNONE 
J065122N04AAGGCCCACGTNONE 
J065141N05AAGGCCCACGTNONE 
J065143N21AAGGCCCACGTNONE 
J065161H09AAGGCCCACGTNONE 
J065161J04AAGGCCCACGTNONE 
J065162P20AAGGCCCACGTNONE 
J065182K10AAGGCCCACGTNONE 
J065184M05AAGGCCCACGTNONE 
J065186H24AAGGCCCACGTNONE 
J065189G21AAGGCCCACGTNONE 
J065190N14AAGGCCCACGTNONE 
J065191H08AAGGCCCACGTNONE 
J065205H17AAGGCCCACGTNONE 
J075001E03AAGGCCCACGTNONE 
J075001H21AAGGCCCACGTNONE 
J075003J23AAGGCCCACGTNONE 
J075003K01AAGGCCCACGTNONE 
J075005I11AAGGCCCACGTNONE 
J075007F16AAGGCCCACGTNONE 
J075017I11AAGGCCCACGTNONE 
J075018O05AAGGCCCACGTNONE 
J075019G24AAGGCCCACGTNONE 
J075032D04AAGGCCCACGTNONE 
J075032N13AAGGCCCACGTNONE 
J075033C09AAGGCCCACGTNONE 
J075033D11AAGGCCCACGTNONE 
J075039A20AAGGCCCACGTNONE 
J075058P12AAGGCCCACGTNONE 
J075062E10AAGGCCCACGTNONE 
J075062P16AAGGCCCACGTNONE 
J075063C17AAGGCCCACGTNONE 
J075066E07AAGGCCCACGTNONE 
J075066I20AAGGCCCACGTNONE 
J075075K21AAGGCCCACGTNONE 
J075078F03AAGGCCCACGTNONE 
J075082F10AAGGCCCACGTNONE 
J075086G16AAGGCCCACGTNONE 
J075087E07AAGGCCCACGTNONE 
J075087K06AAGGCCCACGTNONE 
J075087L04AAGGCCCACGTNONE 
J075088B16AAGGCCCACGTNONE 
J075088D02AAGGCCCACGTNONE 
J075094H21AAGGCCCACGTNONE 
J075094I24AAGGCCCACGTNONE 
J075094K10AAGGCCCACGTNONE 
J075095C18AAGGCCCACGTNONE 
J075097B05AAGGCCCACGTNONE 
J075099C13AAGGCCCACGTNONE 
J075099H22AAGGCCCACGTNONE 
J075099L16AAGGCCCACGTNONE 
J075104K08AAGGCCCACGTNONE 
J075118O06AAGGCCCACGTNONE 
J075119E15AAGGCCCACGTNONE 
J075124N06AAGGCCCACGTNONE 
J075126G02AAGGCCCACGTNONE 
J075127L24AAGGCCCACGTNONE 
J075131E23AAGGCCCACGTNONE 
J075140H06AAGGCCCACGTNONE 
J075146I20AAGGCCCACGTNONE 
J075146N24AAGGCCCACGTNONE 
J075147I19AAGGCCCACGTNONE 
J075155K07AAGGCCCACGTNONE 
J075156C05AAGGCCCACGTNONE 
J075161G07AAGGCCCACGTNONE 
J075164G01AAGGCCCACGTNONE 
J075170J18AAGGCCCACGTNONE 
J075172G17AAGGCCCACGTNONE 
J075176G10AAGGCCCACGTNONE 
J075178C05AAGGCCCACGTNONE 
J075179G01AAGGCCCACGTNONE 
J075181E24AAGGCCCACGTNONE 
J080029D19AAGGCCCACGTNONE 
J080034L11AAGGCCCACGTNONE 
J080039G07AAGGCCCACGTNONE 
J080062M23AAGGCCCACGTNONE 
J080302A01AAGGCCCACGTNONE 
J100042I15AAGGCCCACGTNONE 
J100043G22AAGGCCCACGTNONE 
J100056L12AAGGCCCACGTNONE 
J100061A12AAGGCCCACGTNONE 
J100073O20AAGGCCCACGTNONE 
J100082I08AAGGCCCACGTNONE 
Os06g0113600016-067-E03ACGTGGGCCAGNONE 
AK062095ACGTGGGCCAGNONE 
AK101235ACGTGGGCCAGCyclin-like F-box domain containing protein. 
AK122025ACGTGGGCCAGNONE 
J013022O19ACGTGGGCCAGNONE 
J023045P05ACGTGGGCCAGNONE 
J033031K01ACGTGGGCCAGNONE 
J033034I09ACGTGGGCCAGNONE 
J033041O04ACGTGGGCCAGNONE 
J033071K03ACGTGGGCCAGNONE 
J033075K16ACGTGGGCCAGNONE 
J033097M01ACGTGGGCCAGNONE 
J033099M22ACGTGGGCCAGNONE 
J033108N15ACGTGGGCCAGNONE 
J033121D18ACGTGGGCCAGNONE 
J033125O06ACGTGGGCCAGNONE 
J033139M16ACGTGGGCCAGNONE 
J033145P18ACGTGGGCCAGNONE 
J033149D05ACGTGGGCCAGNONE 
Os06g0122200AK109712CCCGTGGGCCGAACGGCCCATGTConserved hypothetical protein. 
Os06g0129000Os06g0129000GACACGTGGGCCCTConserved hypothetical protein. 
Os06g0134900AK103205TCGTGGGCCTTConserved hypothetical protein. 
J033122E01TCGTGGGCCTTNONE 
Os06g0135000J075008J15AAGGCCCACGANONE 
J075166F23AAGGCCCACGANONE 
J075185F03AAGGCCCACGANONE 
Os06g0144000AK068998TGTGGGCCCACGTGBRCT domain containing protein. 
J023001F16TGTGGGCCCACGTGNONE 
Os06g0199300J065045H01ACGTGGGCCTCNONE 
J075177C22ACGTGGGCCTCNONE 
J080068H06ACGTGGGCCTCNONE 
J090048F01ACGTGGGCCTCNONE 
J100066F17ACGTGGGCCTCNONE 
Os06g0210500AK066979GGACGGCTGGGCCGTGGGCCCCCGTGGGCTGCCGTGGGCCTTSimilar to Mitochondrial phosphate transporter. 
Os06g0248200Os06g0248200TCGTGGGCCAANONE 
Os06g0291600AK100261GACACGTGGGCCACSimilar to Protein kinase G11A (EC 2.7.1.-) (Fragment). 
J023063D14GACACGTGGGCCACNONE 
J090041B12GACACGTGGGCCACNONE 
Os06g0298500AK108252TAGGCCCACGGConserved hypothetical protein. 
J065144C04TAGGCCCACGGNONE 
J075054P09TAGGCCCACGGNONE 
J075165A13TAGGCCCACGGNONE 
J075172E10TAGGCCCACGGNONE 
Os06g0334600AK064993CCCGGCCCACGCGHypothetical protein. 
J013001D16CCCGGCCCACGCGNONE 
J043009I09CCCGGCCCACGCGNONE 
Os06g0337100006-100-G05CTGGCCCACGGGTCAGTGGNONE 
AK061222CTGGCCCACGGGTCAGTGGConserved hypothetical protein. 
Os06g0495500AK109873GCGTGGGCCATMulti antimicrobial extrusion protein MatE family protein. 
Os06g0542200AK058589TCGTGGGCCCTNADP oxidoreductase, coenzyme F420-dependent family protein. 
Os06g0552300011-011-G12GCCACGTGGGCCCCACCNONE 
AK101229GCCACGTGGGCCCCACCBZR1, transcriptional repressor family protein. 
J023061O03GCCACGTGGGCCCCACCNONE 
J033031H19GCCACGTGGGCCCCACCNONE 
J075103K14GCCACGTGGGCCCCACCNONE 
J075108I16GCCACGTGGGCCCCACCNONE 
J075194I23GCCACGTGGGCCCCACCNONE 
J090008K01GCCACGTGGGCCCCACCNONE 
J100062P15GCCACGTGGGCCCCACCNONE 
Os06g0562700AK109753GACGGCCCACGTConserved hypothetical protein. 
Os06g0567000009-166-G12ATCCAACGGCCCACGGGNONE 
AK121337ATCCAACGGCCCACGGGProtein of unknown function UPF0197 family protein. 
J013122F01ATCCAACGGCCCACGGGNONE 
J023080N12ATCCAACGGCCCACGGGNONE 
J023120F03ATCCAACGGCCCACGGGNONE 
J065013B18ATCCAACGGCCCACGGGNONE 
J065039P21ATCCAACGGCCCACGGGNONE 
J065089E06ATCCAACGGCCCACGGGNONE 
J065095N19ATCCAACGGCCCACGGGNONE 
J065119H03ATCCAACGGCCCACGGGNONE 
J065121D18ATCCAACGGCCCACGGGNONE 
J065149G04ATCCAACGGCCCACGGGNONE 
J075012J04ATCCAACGGCCCACGGGNONE 
J075021G13ATCCAACGGCCCACGGGNONE 
J075106I23ATCCAACGGCCCACGGGNONE 
J075107F19ATCCAACGGCCCACGGGNONE 
J075152J22ATCCAACGGCCCACGGGNONE 
J075186J20ATCCAACGGCCCACGGGNONE 
J075188F16ATCCAACGGCCCACGGGNONE 
J080001G06ATCCAACGGCCCACGGGNONE 
J080002O09ATCCAACGGCCCACGGGNONE 
J080006E10ATCCAACGGCCCACGGGNONE 
J080006F24ATCCAACGGCCCACGGGNONE 
J080012L07ATCCAACGGCCCACGGGNONE 
J080016A10ATCCAACGGCCCACGGGNONE 
J080017D11ATCCAACGGCCCACGGGNONE 
J080017I04ATCCAACGGCCCACGGGNONE 
J080017I10ATCCAACGGCCCACGGGNONE 
J080020P06ATCCAACGGCCCACGGGNONE 
J080024A20ATCCAACGGCCCACGGGNONE 
J080027B10ATCCAACGGCCCACGGGNONE 
J080027E03ATCCAACGGCCCACGGGNONE 
J080027I01ATCCAACGGCCCACGGGNONE 
J080027K20ATCCAACGGCCCACGGGNONE 
J080041L12ATCCAACGGCCCACGGGNONE 
J080043D21ATCCAACGGCCCACGGGNONE 
J080044K11ATCCAACGGCCCACGGGNONE 
J080048I08ATCCAACGGCCCACGGGNONE 
J080049M12ATCCAACGGCCCACGGGNONE 
J080050C14ATCCAACGGCCCACGGGNONE 
J080050N21ATCCAACGGCCCACGGGNONE 
J080053F04ATCCAACGGCCCACGGGNONE 
J080054O16ATCCAACGGCCCACGGGNONE 
J080058O21ATCCAACGGCCCACGGGNONE 
J080059M11ATCCAACGGCCCACGGGNONE 
J080061A11ATCCAACGGCCCACGGGNONE 
J080063B15ATCCAACGGCCCACGGGNONE 
J080063F22ATCCAACGGCCCACGGGNONE 
J080066M18ATCCAACGGCCCACGGGNONE 
J080068D12ATCCAACGGCCCACGGGNONE 
J080070D22ATCCAACGGCCCACGGGNONE 
J080071B06ATCCAACGGCCCACGGGNONE 
J080072B17ATCCAACGGCCCACGGGNONE 
J080081O04ATCCAACGGCCCACGGGNONE 
J080089H05ATCCAACGGCCCACGGGNONE 
J080093K13ATCCAACGGCCCACGGGNONE 
J080095I05ATCCAACGGCCCACGGGNONE 
J080097F19ATCCAACGGCCCACGGGNONE 
J080304C03ATCCAACGGCCCACGGGNONE 
J080304H11ATCCAACGGCCCACGGGNONE 
J080308M21ATCCAACGGCCCACGGGNONE 
J080313O15ATCCAACGGCCCACGGGNONE 
J090020N23ATCCAACGGCCCACGGGNONE 
J100023C12ATCCAACGGCCCACGGGNONE 
Os06g0585200016-065-C02AACGGCCCGTGGGCCGCANONE 
016-065-C02CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCNONE 
AK068592AACGGCCCGTGGGCCGCANONE 
AK068592CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCNONE 
AK073844AACGGCCCGTGGGCCGCANONE 
AK073844CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCNONE 
AK106549AACGGCCCGTGGGCCGCAConserved hypothetical protein. 
AK106549CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCConserved hypothetical protein. 
J013154A14AACGGCCCGTGGGCCGCANONE 
J013154A14CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCNONE 
J100049K24AACGGCCCGTGGGCCGCANONE 
J100049K24CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCNONE 
J100059C18AACGGCCCGTGGGCCGCANONE 
J100059C18CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCNONE 
J100082N13AACGGCCCGTGGGCCGCANONE 
J100082N13CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCNONE 
Os06g0589500AK073322CACTGACACGTGGGCCCACGGConserved hypothetical protein. 
AK073322CCCGTGGGCCCCConserved hypothetical protein. 
J033030G15CACTGACACGTGGGCCCACGGNONE 
J033030G15CCCGTGGGCCCCNONE 
J033148N18CACTGACACGTGGGCCCACGGNONE 
J033148N18CCCGTGGGCCCCNONE 
Os06g0606800AK066355ACGTGGGCCACTargeting for Xklp2 family protein. 
AK106565ACGTGGGCCACNONE 
J013067N05ACGTGGGCCACNONE 
J023127B01ACGTGGGCCACNONE 
J033023J04ACGTGGGCCACNONE 
J033025J18ACGTGGGCCACNONE 
J033032A15ACGTGGGCCACNONE 
J033079F03ACGTGGGCCACNONE 
J033115D22ACGTGGGCCACNONE 
J033119N01ACGTGGGCCACNONE 
J033138G24ACGTGGGCCACNONE 
J033149E08ACGTGGGCCACNONE 
J033150A09ACGTGGGCCACNONE 
J043024B06ACGTGGGCCACNONE 
J065028O13ACGTGGGCCACNONE 
J065070C05ACGTGGGCCACNONE 
J065175H22ACGTGGGCCACNONE 
J090008L08ACGTGGGCCACNONE 
J090009M07ACGTGGGCCACNONE 
J090039L01ACGTGGGCCACNONE 
J090049A02ACGTGGGCCACNONE 
J090050A11ACGTGGGCCACNONE 
J090051G16ACGTGGGCCACNONE 
J090062P20ACGTGGGCCACNONE 
J090073P12ACGTGGGCCACNONE 
J090076B19ACGTGGGCCACNONE 
J090084I23ACGTGGGCCACNONE 
J090088N05ACGTGGGCCACNONE 
J100037J10ACGTGGGCCACNONE 
J100043B06ACGTGGGCCACNONE 
J100058C13ACGTGGGCCACNONE 
J100089N01ACGTGGGCCACNONE 
Os06g0618000AK110866CACTGACACGTGGGCCCACCCGGTGTGGGGCCCACGCGTConserved hypothetical protein. 
Os06g0622700AK107021CGCGTGGGCCCCACCACEukaryotic transcription factor, DNA-binding domain containing protein. 
J065053P05CGCGTGGGCCCCACCACNONE 
J065100L18CGCGTGGGCCCCACCACNONE 
J065129N15CGCGTGGGCCCCACCACNONE 
J065152M08CGCGTGGGCCCCACCACNONE 
J065198M12CGCGTGGGCCCCACCACNONE 
J090077J22CGCGTGGGCCCCACCACNONE 
J100024G23CGCGTGGGCCCCACCACNONE 
J100027L01CGCGTGGGCCCCACCACNONE 
J100047C06CGCGTGGGCCCCACCACNONE 
J100055D01CGCGTGGGCCCCACCACNONE 
J100067M05CGCGTGGGCCCCACCACNONE 
J100077M16CGCGTGGGCCCCACCACNONE 
J100078M22CGCGTGGGCCCCACCACNONE 
Os06g0642900AK073896GCCCACCCGGCCCACGCUbiquitin system component Cue domain containing protein. 
J033042P11GCCCACCCGGCCCACGCNONE 
J033072G12GCCCACCCGGCCCACGCNONE 
J090050C02GCCCACCCGGCCCACGCNONE 
Os06g0648500AK106895CGGGTGGGGCCCACGGConserved hypothetical protein. 
Os06g0682300009-098-E01GTGGCCCACGGNONE 
009-134-F09GTGGCCCACGGNONE 
009-137-E02GTGGCCCACGGNONE 
009-198-E05GTGGCCCACGGNONE 
AK062934GTGGCCCACGGHypothetical protein. 
J075053E04GTGGCCCACGGNONE 
Os06g0704300AK107008TCGTGGGCCGAAZinc finger, CCCH-type domain containing protein. 
J065038I12TCGTGGGCCGAANONE 
J065079E03TCGTGGGCCGAANONE 
J075035B15TCGTGGGCCGAANONE 
J090072D21TCGTGGGCCGAANONE 
Os07g0100500J033026C11GGGGCCCACGTGGCNONE 
Os07g0101500AK059667GCCGGCCCACGANONE 
AK071749GCCGGCCCACGASimilar to Sterol 4-alpha-methyl-oxidase (Fragment). 
J023112L07GCCGGCCCACGANONE 
J065050F03GCCGGCCCACGANONE 
J090015C05GCCGGCCCACGANONE 
J090045C11GCCGGCCCACGANONE 
Os07g0105300AK107419GCCGGCCCACGGGConserved hypothetical protein. 
AK109521GCCGGCCCACGGGNONE 
Os07g0112600AK109561CACGTGGGCCTCConserved hypothetical protein. 
Os07g0124100014-015-G11GTTGGGCCCACGTGTNONE 
AJ276693GTTGGGCCCACGTGTPhytosulfokines 4 precursor [Contains: Phytosulfokine-alpha (PSK- alpha) (Phytosulfokine-a); Phytosulfokine-beta (PSK-beta) (Phytosulfokine-b)]. 
AK063647GTTGGGCCCACGTGTNONE 
Os07g0136300AK064609GTCGCGCGTGGGCCGAGAConserved hypothetical protein. 
Os07g0139400AB096864CGCGTGGGCCCCACTCCNONE 
AK065558CGCGTGGGCCCCACTCCUDP-glucose 4-epimerase family protein. 
AK099140CGCGTGGGCCCCACTCCNONE 
AK099183CGCGTGGGCCCCACTCCNONE 
J013033B01CGCGTGGGCCCCACTCCNONE 
J013157B14CGCGTGGGCCCCACTCCNONE 
J023052E04CGCGTGGGCCCCACTCCNONE 
J023086K05CGCGTGGGCCCCACTCCNONE 
J023099C15CGCGTGGGCCCCACTCCNONE 
J033025C08CGCGTGGGCCCCACTCCNONE 
J033072I24CGCGTGGGCCCCACTCCNONE 
J043020I04CGCGTGGGCCCCACTCCNONE 
J090039I21CGCGTGGGCCCCACTCCNONE 
J090078P20CGCGTGGGCCCCACTCCNONE 
J090084C18CGCGTGGGCCCCACTCCNONE 
J100024F07CGCGTGGGCCCCACTCCNONE 
J100054D22CGCGTGGGCCCCACTCCNONE 
J100062O08CGCGTGGGCCCCACTCCNONE 
Os07g0141400003-129-D08GATCCGACGTGGGCCAANONE 
006-021-E02GATCCGACGTGGGCCAANONE 
006-025-C06GATCCGACGTGGGCCAANONE 
006-027-H11GATCCGACGTGGGCCAANONE 
006-036-C05GATCCGACGTGGGCCAANONE 
006-046-D07GATCCGACGTGGGCCAANONE 
006-047-A02GATCCGACGTGGGCCAANONE 
006-050-F02GATCCGACGTGGGCCAANONE 
006-053-D07GATCCGACGTGGGCCAANONE 
006-054-E06GATCCGACGTGGGCCAANONE 
006-055-E01GATCCGACGTGGGCCAANONE 
006-055-F01GATCCGACGTGGGCCAANONE 
006-056-H12GATCCGACGTGGGCCAANONE 
006-057-D07GATCCGACGTGGGCCAANONE 
006-074-G10GATCCGACGTGGGCCAANONE 
006-077-C02GATCCGACGTGGGCCAANONE 
006-081-E01GATCCGACGTGGGCCAANONE 
006-089-B08GATCCGACGTGGGCCAANONE 
006-089-C10GATCCGACGTGGGCCAANONE 
006-092-E07GATCCGACGTGGGCCAANONE 
006-096-C11GATCCGACGTGGGCCAANONE 
006-096-H06GATCCGACGTGGGCCAANONE 
006-097-E07GATCCGACGTGGGCCAANONE 
006-098-D03GATCCGACGTGGGCCAANONE 
006-102-C05GATCCGACGTGGGCCAANONE 
006-107-E09GATCCGACGTGGGCCAANONE 
006-110-C09GATCCGACGTGGGCCAANONE 
006-113-C01GATCCGACGTGGGCCAANONE 
006-114-D09GATCCGACGTGGGCCAANONE 
006-115-H06GATCCGACGTGGGCCAANONE 
009-016-G06GATCCGACGTGGGCCAANONE 
009-031-C05GATCCGACGTGGGCCAANONE 
009-060-B05GATCCGACGTGGGCCAANONE 
009-123-H12GATCCGACGTGGGCCAANONE 
009-154-B09GATCCGACGTGGGCCAANONE 
009-172-F07GATCCGACGTGGGCCAANONE 
009-193-A04GATCCGACGTGGGCCAANONE 
AF022732GATCCGACGTGGGCCAANONE 
AF052203GATCCGACGTGGGCCAANONE 
AK065248GATCCGACGTGGGCCAASimilar to 23 kDa polypeptide of photosystem II. 
AK104722GATCCGACGTGGGCCAANONE 
D49713GATCCGACGTGGGCCAANONE 
J013002J02GATCCGACGTGGGCCAANONE 
J065051O13GATCCGACGTGGGCCAANONE 
J065066J18GATCCGACGTGGGCCAANONE 
J065077G23GATCCGACGTGGGCCAANONE 
J065162C22GATCCGACGTGGGCCAANONE 
J065162G22GATCCGACGTGGGCCAANONE 
J075091B13GATCCGACGTGGGCCAANONE 
J075099J22GATCCGACGTGGGCCAANONE 
J100056O22GATCCGACGTGGGCCAANONE 
J100059E01GATCCGACGTGGGCCAANONE 
J100079F20GATCCGACGTGGGCCAANONE 
Os07g0152800AK065458TACTGGGCCCACGTGTConserved hypothetical protein. 
J013022G05TACTGGGCCCACGTGTNONE 
J013023D18TACTGGGCCCACGTGTNONE 
J013048J16TACTGGGCCCACGTGTNONE 
J013055I03TACTGGGCCCACGTGTNONE 
J013057F12TACTGGGCCCACGTGTNONE 
J023109A22TACTGGGCCCACGTGTNONE 
J023148E09TACTGGGCCCACGTGTNONE 
J033069G17TACTGGGCCCACGTGTNONE 
J033092I18TACTGGGCCCACGTGTNONE 
J033093C02TACTGGGCCCACGTGTNONE 
J033141M17TACTGGGCCCACGTGTNONE 
J043016M18TACTGGGCCCACGTGTNONE 
J090016D12TACTGGGCCCACGTGTNONE 
J090071B10TACTGGGCCCACGTGTNONE 
J090098K07TACTGGGCCCACGTGTNONE 
J100035K14TACTGGGCCCACGTGTNONE 
Os07g0154900009-142-E09GGGGCCCACGTGGGCCCCACGTGTCNONE 
AK062969GGGGCCCACGTGGGCCCCACGTGTCConserved hypothetical protein. 
Os07g0162600015-024-F04TCGTGGGCCCGGANONE 
AK105789TCGTGGGCCCGGANONE 
AK106274TCGTGGGCCCGGAEsterase/lipase/thioesterase domain containing protein. 
J100026E18TCGTGGGCCCGGANONE 
J100037B07TCGTGGGCCCGGANONE 
J100090H11TCGTGGGCCCGGANONE 
Os07g0166800006-038-C11CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
012-080-F02CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
AK070524CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCRad6 (Ubiquitin carrier protein). 
AK121382CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J023022D19CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J023055G02CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J023073E02CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J023125B08CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J023127H21CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J033052G01CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J033067F13CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J065046L14CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J065178D11CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J065205N17CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J075006K17CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J075051D20CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J075109L04CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J090024K15CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J090025N04CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J090049N09CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J090070N12CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J090078O21CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J090083L07CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J100063K16CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J100083D14CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
Os07g0173200AK061624ACCGGGCCCACGTFrigida-like family protein. 
AK065275ACCGGGCCCACGTNONE 
AK098856ACCGGGCCCACGTNONE 
AK098899ACCGGGCCCACGTNONE 
Os07g0179000AK100008TTCGGCCCATTAAAGCCCATATAGGCCCACGANONE 
AK119398TTCGGCCCATTAAAGCCCATATAGGCCCACGAProtein prenyltransferase domain containing protein. 
AK119505TTCGGCCCATTAAAGCCCATATAGGCCCACGANONE 
Os07g0184900AK102066TCGGCCCGTGGGCCGTGTTGGGCCGAGGCCCACGTGGGAGTGGGAAGGCCCACGCACCGCSimilar to Ku70-like protein. 
Os07g0185700012-040-A11AGGGCCCACGGGCCCATCGNONE 
AK070572AGGGCCCACGGGCCCATCGConserved hypothetical protein. 
J065116D10AGGGCCCACGGGCCCATCGNONE 
J065122F20AGGGCCCACGGGCCCATCGNONE 
Os07g0187300AK103069AAGGCCCACGAARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
AK103069CCCGTGGGCCGGARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J013042I12AAGGCCCACGAANONE 
J013042I12CCCGTGGGCCGGANONE 
J033117P16AAGGCCCACGAANONE 
J033117P16CCCGTGGGCCGGANONE 
Os07g0191700AK066389ACCCGCGCGACGTGGGGCCCACGCSimilar to AT.I.24-9 protein (Fragment). 
AK103768ACCCGCGCGACGTGGGGCCCACGCNONE 
Os07g0213400003-104-B01CCGTGGGCCAGNONE 
AK062273CCGTGGGCCAGConserved hypothetical protein. 
J065122P17CCGTGGGCCAGNONE 
J065160A01CCGTGGGCCAGNONE 
J090065M11CCGTGGGCCAGNONE 
Os07g0223100006-044-G07GAGGCCCACGGNONE 
006-071-E10GAGGCCCACGGNONE 
006-077-A04GAGGCCCACGGNONE 
009-162-H05GAGGCCCACGGNONE 
J023050M10GAGGCCCACGGNONE 
J023055F05GAGGCCCACGGNONE 
J023060I11GAGGCCCACGGNONE 
J023101M01GAGGCCCACGGNONE 
J065059J21GAGGCCCACGGNONE 
J065087I18GAGGCCCACGGNONE 
J065113L17GAGGCCCACGGNONE 
J065123E19GAGGCCCACGGNONE 
J065137O04GAGGCCCACGGNONE 
J065217M03GAGGCCCACGGNONE 
J090012O14GAGGCCCACGGNONE 
J090014C13GAGGCCCACGGNONE 
J090060C24GAGGCCCACGGNONE 
J100037H14GAGGCCCACGGNONE 
J100060E10GAGGCCCACGGNONE 
J100067L04GAGGCCCACGGNONE 
J100075G09GAGGCCCACGGNONE 
J100077C15GAGGCCCACGGNONE 
Os07g0274700J065002G18CCCGTGGGCCCCCACCCGCGCNONE 
J065092L19CCCGTGGGCCCCCACCCGCGCNONE 
J065099K11CCCGTGGGCCCCCACCCGCGCNONE 
J065103L08CCCGTGGGCCCCCACCCGCGCNONE 
J065185I19CCCGTGGGCCCCCACCCGCGCNONE 
J075004L22CCCGTGGGCCCCCACCCGCGCNONE 
J075007G03CCCGTGGGCCCCCACCCGCGCNONE 
J075020E09CCCGTGGGCCCCCACCCGCGCNONE 
J075046B02CCCGTGGGCCCCCACCCGCGCNONE 
J075070D08CCCGTGGGCCCCCACCCGCGCNONE 
J075118L24CCCGTGGGCCCCCACCCGCGCNONE 
J075140C15CCCGTGGGCCCCCACCCGCGCNONE 
J075157A21CCCGTGGGCCCCCACCCGCGCNONE 
J075165J01CCCGTGGGCCCCCACCCGCGCNONE 
J075172J18CCCGTGGGCCCCCACCCGCGCNONE 
J075177P10CCCGTGGGCCCCCACCCGCGCNONE 
J100042D15CCCGTGGGCCCCCACCCGCGCNONE 
J100053M21CCCGTGGGCCCCCACCCGCGCNONE 
J100067M12CCCGTGGGCCCCCACCCGCGCNONE 
Os07g0300900AK061941GCGTGGGCCTCSimilar to Lysine-sensitive aspartate kinase. 
AK102162GCGTGGGCCTCNONE 
Os07g0301200AB110202CACGTGGGCCGGCNONE 
AK073463CACGTGGGCCGGCSimilar to RNA helicase (Fragment). 
Os07g0419800J080309B06GAGGCGTGGGCCACNONE 
Os07g0435100AB037153ACGTGGGCCTCNONE 
AK061383ACGTGGGCCTCSimilar to 26S proteasome subunit RPN12. 
AK061408ACGTGGGCCTCNONE 
AK101316ACGTGGGCCTCNONE 
J023133D07ACGTGGGCCTCNONE 
J023136B17ACGTGGGCCTCNONE 
J033065M08ACGTGGGCCTCNONE 
J033070F05ACGTGGGCCTCNONE 
J033070L20ACGTGGGCCTCNONE 
J033108J15ACGTGGGCCTCNONE 
J053080M19ACGTGGGCCTCNONE 
J053091B15ACGTGGGCCTCNONE 
J065067J03ACGTGGGCCTCNONE 
J065102C02ACGTGGGCCTCNONE 
J065135H09ACGTGGGCCTCNONE 
J080302K03ACGTGGGCCTCNONE 
J090059J11ACGTGGGCCTCNONE 
J090074G14ACGTGGGCCTCNONE 
J100025F20ACGTGGGCCTCNONE 
J100028L08ACGTGGGCCTCNONE 
J100049L14ACGTGGGCCTCNONE 
J100054O07ACGTGGGCCTCNONE 
Os07g0469100009-036-F03TTGTGGGCTCGTGGGCCACNONE 
009-126-D06TTGTGGGCTCGTGGGCCACNONE 
009-190-A01TTGTGGGCTCGTGGGCCACNONE 
AK061626TTGTGGGCTCGTGGGCCACNONE 
AK120365TTGTGGGCTCGTGGGCCACSimilar to Thylakoid membrane phosphoprotein 14 kDa, chloroplast precursor. 
J013068P10TTGTGGGCTCGTGGGCCACNONE 
J053066C23TTGTGGGCTCGTGGGCCACNONE 
J065011K15TTGTGGGCTCGTGGGCCACNONE 
J065053E15TTGTGGGCTCGTGGGCCACNONE 
J065167F21TTGTGGGCTCGTGGGCCACNONE 
J075065G04TTGTGGGCTCGTGGGCCACNONE 
J075146A09TTGTGGGCTCGTGGGCCACNONE 
Os07g0479200005-017-H08GAGGCCCACGCNONE 
AK058326GAGGCCCACGCSimilar to SL15-like (Fragment). 
J013092A08GAGGCCCACGCNONE 
J033139E04GAGGCCCACGCNONE 
J043016M16GAGGCCCACGCNONE 
J053050O18GAGGCCCACGCNONE 
J053098B03GAGGCCCACGCNONE 
J065068G10GAGGCCCACGCNONE 
J065091I17GAGGCCCACGCNONE 
J065109A03GAGGCCCACGCNONE 
J065168B17GAGGCCCACGCNONE 
J065177A05GAGGCCCACGCNONE 
J065180J01GAGGCCCACGCNONE 
J075006F13GAGGCCCACGCNONE 
J075022J03GAGGCCCACGCNONE 
J075024N09GAGGCCCACGCNONE 
J075114B12GAGGCCCACGCNONE 
J080023M06GAGGCCCACGCNONE 
J080081N24GAGGCCCACGCNONE 
J090060N07GAGGCCCACGCNONE 
Os07g0486000AK069343AGGTGGGCCCACGTGSimilar to MSH4. 
Os07g0486500AK063998CGGGCCCACGTGTCGRho GTPase activation protein domain containing protein. 
AK068175CGGGCCCACGTGTCGNONE 
J013130L24CGGGCCCACGTGTCGNONE 
J013156J03CGGGCCCACGTGTCGNONE 
J033031L21CGGGCCCACGTGTCGNONE 
J043001A20CGGGCCCACGTGTCGNONE 
J043007B17CGGGCCCACGTGTCGNONE 
J043017M19CGGGCCCACGTGTCGNONE 
J043024H09CGGGCCCACGTGTCGNONE 
J043030B12CGGGCCCACGTGTCGNONE 
J065177C18CGGGCCCACGTGTCGNONE 
J075004K10CGGGCCCACGTGTCGNONE 
J075004K12CGGGCCCACGTGTCGNONE 
J075088G07CGGGCCCACGTGTCGNONE 
J075107M02CGGGCCCACGTGTCGNONE 
J075126G01CGGGCCCACGTGTCGNONE 
J075185J08CGGGCCCACGTGTCGNONE 
J100034E04CGGGCCCACGTGTCGNONE 
J100038G12CGGGCCCACGTGTCGNONE 
Os07g0498300009-045-C02TCGTGGGCCCCACACNONE 
009-060-A09TCGTGGGCCCCACACNONE 
009-121-C04TCGTGGGCCCCACACNONE 
009-157-G09TCGTGGGCCCCACACNONE 
009-197-B02TCGTGGGCCCCACACNONE 
AK059124TCGTGGGCCCCACACConserved hypothetical protein. 
AK119800TCGTGGGCCCCACACNONE 
J065184M18TCGTGGGCCCCACACNONE 
J075009G21TCGTGGGCCCCACACNONE 
J075013O03TCGTGGGCCCCACACNONE 
J075061C22TCGTGGGCCCCACACNONE 
J075094E12TCGTGGGCCCCACACNONE 
J075148C01TCGTGGGCCCCACACNONE 
Os07g0516200AK061373GGCCCGTTCAGGCCCGGCCCACGCSimilar to Endoribonuclease, L-PSP family. 
Os07g0545400009-136-E03TCCGGGCCCACGANONE 
013-015-G08TCCGGGCCCACGANONE 
AK059228TCCGGGCCCACGANONE 
J065040D09TCCGGGCCCACGANONE 
J065051C19TCCGGGCCCACGANONE 
J065139B05TCCGGGCCCACGANONE 
J065160E20TCCGGGCCCACGANONE 
J065207I17TCCGGGCCCACGANONE 
J080319M24TCCGGGCCCACGANONE 
Os07g0555400AK070977CACGTGGGCCGGAConserved hypothetical protein. 
Os07g0568300AK067784TCGTGGGCCCCACCCGCGCNONE 
AK067895TCGTGGGCCCCACCCGCGCSimilar to ZF protein (Fragment).