version

Summary of OsREG572 (All List)

OrganismOryza sativa  
IDOsREG572  
SequenceCGTGGGGC  
Annotation  
PPDB Motif 
PLACE Motif 
Total Entry Count1503  

Entry Sequences (1503 entries)

LocusGene modelSequenceDescription
Os01g0102600AK064812CACGTGGGGCCCGCAShikimate kinase domain containing protein. 
J013000E05CACGTGGGGCCCGCANONE 
J013027D08CACGTGGGGCCCGCANONE 
J013045K12CACGTGGGGCCCGCANONE 
J023119M03CACGTGGGGCCCGCANONE 
J065081F02CACGTGGGGCCCGCANONE 
J065180C08CACGTGGGGCCCGCANONE 
J065211M06CACGTGGGGCCCGCANONE 
J075073J06CACGTGGGGCCCGCANONE 
J075123A18CACGTGGGGCCCGCANONE 
J075124A07CACGTGGGGCCCGCANONE 
J075187B05CACGTGGGGCCCGCANONE 
Os01g0229400AB029508GCCCCACGTGSmall GTP-binding protein OsRac1. 
J013111C23GCCCCACGTGNONE 
J023077H07GCCCCACGTGNONE 
J100039H15GCCCCACGTGNONE 
Os01g0250900AK065179TGTGGGCCCCACGHAD superfamily (subfamily IG) hydrolase, 5'-Nucleotidase protein. 
J013002D15TGTGGGCCCCACGNONE 
J013037K03TGTGGGCCCCACGNONE 
J013091F03TGTGGGCCCCACGNONE 
J013127B14TGTGGGCCCCACGNONE 
Os01g0253500J100088F12CGGGCCCCACGTConserved hypothetical protein. 
Os01g0262700AK100901CGCGTGGGGCConserved hypothetical protein. 
AK119928CGCGTGGGGCNONE 
J033057O20CGCGTGGGGCNONE 
J065093J01CGCGTGGGGCNONE 
J075164F23CGCGTGGGGCNONE 
J100025E08CGCGTGGGGCNONE 
J100029L03CGCGTGGGGCNONE 
J100079F02CGCGTGGGGCNONE 
Os01g0265800003-115-A07GCCCCACGNONE 
006-119-B11GCCCCACGNONE 
AK109487GCCCCACGNONE 
J065013P12GCCCCACGNONE 
J065158M13GCCCCACGNONE 
J100035D16GCCCCACGNONE 
J100053F24GCCCCACGNONE 
Os01g0270100006-096-H09GTGGTGGGCCCCACGCCCCACCGTCCGANONE 
009-009-C10GTGGTGGGCCCCACGCCCCACCGTCCGANONE 
009-054-E06GTGGTGGGCCCCACGCCCCACCGTCCGANONE 
014-085-F09GTGGTGGGCCCCACGCCCCACCGTCCGANONE 
AK073275GTGGTGGGCCCCACGCCCCACCGTCCGANONE 
AK104155GTGGTGGGCCCCACGCCCCACCGTCCGANONE 
AK119511GTGGTGGGCCCCACGCCCCACCGTCCGASimilar to Cysteine protease inhibitor. 
J033025K21GTGGTGGGCCCCACGCCCCACCGTCCGANONE 
J075065H10GTGGTGGGCCCCACGCCCCACCGTCCGANONE 
J075143G10GTGGTGGGCCCCACGCCCCACCGTCCGANONE 
J100059J02GTGGTGGGCCCCACGCCCCACCGTCCGANONE 
Os01g0349000AK108540GTGGGACCCACGTGGGCCCCACGTGTCAGTGConserved hypothetical protein. 
J065059M15GTGGGACCCACGTGGGCCCCACGTGTCAGTGNONE 
Os01g0513400AK069619CTGACAGGTGGGCCCCACGProtein of unknown function DUF789 family protein. 
Os01g0558600006-120-G12GGGTGGGCCCCACGNONE 
J013100N20GGGTGGGCCCCACGNONE 
J033043P09GGGTGGGCCCCACGNONE 
J033125M18GGGTGGGCCCCACGNONE 
J053043N11GGGTGGGCCCCACGNONE 
J065008E07GGGTGGGCCCCACGNONE 
J065080O16GGGTGGGCCCCACGNONE 
J075002G24GGGTGGGCCCCACGNONE 
J075123C09GGGTGGGCCCCACGNONE 
S66160GGGTGGGCCCCACGRas-related protein RIC1. 
Os01g0581300AK066182TTCGTGGGGCCCSimilar to Lycopene epsilon-cyclase (Fragment). 
AK072015TTCGTGGGGCCCNONE 
Os01g0596700AK107371AACGGGCCCCACGFBD domain containing protein. 
Os01g0635400AK102655CGTGGGGCCCCASimilar to mRNA-associated protein mrnp 41 (Rae1 protein homolog). 
AK111923CGTGGGGCCCCANONE 
Os01g0644200014-007-H12GCCCCACGTNONE 
AK063634GCCCCACGTConserved hypothetical protein. 
AY549310GCCCCACGTNONE 
J075068F10GCCCCACGTNONE 
J075082A11GCCCCACGTNONE 
Os01g0645000AK108658GCGGGCCCCACGSimilar to TIS11 protein (dTIS11). 
Os01g0654500013-057-E05CAAGTGGGCCCCACGNONE 
AF155333CAAGTGGGCCCCACGNONE 
AK061752CAAGTGGGCCCCACGSimilar to NADP-isocitrate dehydrogenase. 
D21069CAAGTGGGCCCCACGNONE 
Os01g0667100Os01g0667100GCCCCACGTConserved hypothetical protein. 
Os01g0670500AK109750GTGGGACCCACTTGGGCCCCACGTGTCConserved hypothetical protein. 
Os01g0705800AK106968GCCCCACGCGConserved hypothetical protein. 
Os01g0714800AK108555GCCCCACGWRKY transcription factor 26. 
AY870609GCCCCACGNONE 
Os01g0728100005-004-B01CGTGGGGCNONE 
Os01g0736600009-105-F04CGTGGGGCNONE 
014-035-D08CGTGGGGCNONE 
AK099546CGTGGGGCZinc finger, RING-type domain containing protein. 
AK105189CGTGGGGCNONE 
J065155B14CGTGGGGCNONE 
J075007F01CGTGGGGCNONE 
Os01g0744400AK067648CGTGGGGCConserved hypothetical protein. 
Os01g0789100AK069910GCCCCACGCDP-alcohol phosphatidyltransferase family protein. 
J080093C23GCCCCACGNONE 
Os01g0801500AK060529CGTGGGGCCCBeta-1,3-glucanase precursor. 
AK099192CGTGGGGCCCNONE 
J023110B18CGTGGGGCCCNONE 
Os01g0826400AK107199CACGGCCCCACGWRKY transcription factor 24 (WRKY24). 
AY341849CACGGCCCCACGNONE 
AY676925CACGGCCCCACGNONE 
AY870608CACGGCCCCACGNONE 
Os01g0851300AK101770GCCCCACGReticulon family protein. 
J033064I03GCCCCACGNONE 
J100058A05GCCCCACGNONE 
Os01g0976500AK100555CGTGGGGCt-snare domain containing protein. 
J023103M06CGTGGGGCNONE 
J023110K22CGTGGGGCNONE 
J090055C08CGTGGGGCNONE 
J090062C10CGTGGGGCNONE 
Os02g0169300006-023-D12ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
006-062-B01ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
015-049-F11ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
015-057-G02ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
015-092-F04ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
015-095-H02ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
015-097-B07ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
AK070041ATCTGGGCCCCACGCCTCCCGGCCCCACASimilar to Phosphoglycerate kinase, cytosolic (EC 2.7.2.3). 
J013042K07ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J013134H23ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J013134J23ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J023036N24ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J023049C06ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J023077E10ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J023077F10ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J023105N12ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J033036O12ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J033064P11ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J033079F01ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J033123M22ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J033143E10ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J075013D12ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
Os02g0198200J075078L15CGTGGGGCCCGCANONE 
J075078L15GCCCCACGTGTCATCCACCCCCACGNONE 
J075097G10CGTGGGGCCCGCANONE 
J075097G10GCCCCACGTGTCATCCACCCCCACGNONE 
J075099N12CGTGGGGCCCGCANONE 
J075099N12GCCCCACGTGTCATCCACCCCCACGNONE 
J075142K24CGTGGGGCCCGCANONE 
J075142K24GCCCCACGTGTCATCCACCCCCACGNONE 
J075199K14CGTGGGGCCCGCANONE 
J075199K14GCCCCACGTGTCATCCACCCCCACGNONE 
Os02g0229400AK120560GCCCCACGSimilar to Hexose transporter. 
J013022N19GCCCCACGNONE 
J013050H22GCCCCACGNONE 
J013089H21GCCCCACGNONE 
J013098P19GCCCCACGNONE 
J013099J21GCCCCACGNONE 
J013132C18GCCCCACGNONE 
J013134F10GCCCCACGNONE 
J013157O13GCCCCACGNONE 
J013160B05GCCCCACGNONE 
J023001L23GCCCCACGNONE 
J023031N15GCCCCACGNONE 
J023037P12GCCCCACGNONE 
J023041B10GCCCCACGNONE 
J023050C12GCCCCACGNONE 
J023127G21GCCCCACGNONE 
J023130K12GCCCCACGNONE 
J023143M15GCCCCACGNONE 
J033045O05GCCCCACGNONE 
J033079N22GCCCCACGNONE 
J033120C21GCCCCACGNONE 
J033122G11GCCCCACGNONE 
J043036L23GCCCCACGNONE 
J065035G15GCCCCACGNONE 
J065053E14GCCCCACGNONE 
J065067J18GCCCCACGNONE 
J065127E10GCCCCACGNONE 
J065156O12GCCCCACGNONE 
J065191D18GCCCCACGNONE 
J065207K16GCCCCACGNONE 
J090022K01GCCCCACGNONE 
J090034K09GCCCCACGNONE 
J090041G15GCCCCACGNONE 
J100046E05GCCCCACGNONE 
Os02g0288200AK073147CCCGGCCCCACGCGTNONE 
AK102886CCCGGCCCCACGCGTConserved hypothetical protein. 
Os02g0326700AK064977GGCCGGGCCCCACGRhomboid-like protein family protein. 
Os02g0556700AK073875CACTGACACGTGGGCCCCACGCCTCT-complex 11 family protein. 
Os02g0562300AK073250ACCGGGCCCCACGTCalmodulin binding protein-like family protein. 
Os02g0658500012-083-D01CTCGGCCCCACGNONE 
016-061-E08CTCGGCCCCACGNONE 
AK099591CTCGGCCCCACGConserved hypothetical protein. 
AK107591CTCGGCCCCACGNONE 
J013043M11CTCGGCCCCACGNONE 
J100025J18CTCGGCCCCACGNONE 
J100059C10CTCGGCCCCACGNONE 
Os02g0669100012-068-E10GCCCCACGCGNONE 
016-075-F09GCCCCACGCGNONE 
AB011367GCCCCACGCGNONE 
AK070197GCCCCACGCGNONE 
AY587109GCCCCACGCGDehydrin family protein. 
AY786415GCCCCACGCGNONE 
J023042N13GCCCCACGCGNONE 
J023128F01GCCCCACGCGNONE 
J065002K05GCCCCACGCGNONE 
J090057I09GCCCCACGCGNONE 
J090067J23GCCCCACGCGNONE 
J090071B04GCCCCACGCGNONE 
J100018L23GCCCCACGCGNONE 
J100036A11GCCCCACGCGNONE 
J100063L18GCCCCACGCGNONE 
J100071G02GCCCCACGCGNONE 
J100084P19GCCCCACGCGNONE 
Os02g0682200AK069103GCCCCACGSimilar to MADS box protein. 
J023006N09GCCCCACGNONE 
J023055B08GCCCCACGNONE 
J023103J04GCCCCACGNONE 
J023122I21GCCCCACGNONE 
J023146H12GCCCCACGNONE 
J090033B14GCCCCACGNONE 
J090088D07GCCCCACGNONE 
U78782GCCCCACGNONE 
Os02g0686700AK111294CGTGGGGCCCACCTProtein of unknown function DUF581 family protein. 
Os02g0698100009-089-H10TGTGGGCCCCACGNONE 
AK060614TGTGGGCCCCACGGalactose oxidase, central domain containing protein. 
J090039P20TGTGGGCCCCACGNONE 
Os02g0709900AB110204GCCCCACGTGPrefoldin domain containing protein. 
AK109259GCCCCACGTGNONE 
J013093N22GCCCCACGTGNONE 
J033116F21GCCCCACGTGNONE 
Os02g0721800AK100043GCGGGCCCCACGTGTCCSimilar to Phosphatidylinositol transfer-like protein IV. 
Os02g0743500AK100319GGCCCCACGTGTCSimilar to EDR1. 
AK102767GGCCCCACGTGTCNONE 
Os02g0814300AK111376GCCCCACGTGCytochrome c, monohaem domain containing protein. 
J065063I24GCCCCACGTGNONE 
Os02g0817900AK068163GGCCCCACGTCytochrome P450 family protein. 
Os02g0828200003-107-H05GCCCCACGNONE 
AK107588GCCCCACGConserved hypothetical protein. 
J075023B21GCCCCACGNONE 
J075065K11GCCCCACGNONE 
J075116L02GCCCCACGNONE 
J075123G23GCCCCACGNONE 
J075183E14GCCCCACGNONE 
Os02g0829100AB037145GCGGGCCCCACGTGTCNONE 
AJ278822GCGGGCCCCACGTGTCReplication protein A 30kDa. 
AK103235GCGGGCCCCACGTGTCNONE 
Os03g0131200AB020502GCCCCACGTNONE 
AK062174GCCCCACGTNONE 
AK066378GCCCCACGTSimilar to Catalase isozyme 2 (EC 1.11.1.6). 
AY339372GCCCCACGTNONE 
J013060B21GCCCCACGTNONE 
J013149P20GCCCCACGTNONE 
J023060E16GCCCCACGTNONE 
J043004A19GCCCCACGTNONE 
J053029N09GCCCCACGTNONE 
J053072I10GCCCCACGTNONE 
J065016G02GCCCCACGTNONE 
J065022E22GCCCCACGTNONE 
J065024K17GCCCCACGTNONE 
J065035E10GCCCCACGTNONE 
J065036D13GCCCCACGTNONE 
J065041E06GCCCCACGTNONE 
J065064H14GCCCCACGTNONE 
J065067I06GCCCCACGTNONE 
J065080C01GCCCCACGTNONE 
J065086K23GCCCCACGTNONE 
J065087L12GCCCCACGTNONE 
J065090I05GCCCCACGTNONE 
J065117E23GCCCCACGTNONE 
J065120A10GCCCCACGTNONE 
J065120L22GCCCCACGTNONE 
J065123F02GCCCCACGTNONE 
J065128G02GCCCCACGTNONE 
J065142B04GCCCCACGTNONE 
J065143K12GCCCCACGTNONE 
J065148B18GCCCCACGTNONE 
J065153C16GCCCCACGTNONE 
J065163J11GCCCCACGTNONE 
J065168L24GCCCCACGTNONE 
J065181J11GCCCCACGTNONE 
J065190F19GCCCCACGTNONE 
J065209E24GCCCCACGTNONE 
J065210G04GCCCCACGTNONE 
J065217H17GCCCCACGTNONE 
J065219I20GCCCCACGTNONE 
J075001M13GCCCCACGTNONE 
J075007B08GCCCCACGTNONE 
J075009I01GCCCCACGTNONE 
J075014C11GCCCCACGTNONE 
J075014L02GCCCCACGTNONE 
J075016E07GCCCCACGTNONE 
J075017J02GCCCCACGTNONE 
J075018F07GCCCCACGTNONE 
J075018N07GCCCCACGTNONE 
J075019B06GCCCCACGTNONE 
J075024F21GCCCCACGTNONE 
J075026B18GCCCCACGTNONE 
J075026M12GCCCCACGTNONE 
J075032B13GCCCCACGTNONE 
J075033O09GCCCCACGTNONE 
J075041A09GCCCCACGTNONE 
J075045L13GCCCCACGTNONE 
J075048N11GCCCCACGTNONE 
J075052A14GCCCCACGTNONE 
J075061B17GCCCCACGTNONE 
J075061I05GCCCCACGTNONE 
J075066I11GCCCCACGTNONE 
J075066P09GCCCCACGTNONE 
J075068F03GCCCCACGTNONE 
J075068P22GCCCCACGTNONE 
J075080I15GCCCCACGTNONE 
J075081I07GCCCCACGTNONE 
J075082K01GCCCCACGTNONE 
J075083A18GCCCCACGTNONE 
J075086O11GCCCCACGTNONE 
J075087E02GCCCCACGTNONE 
J075087M19GCCCCACGTNONE 
J075088G23GCCCCACGTNONE 
J075092K18GCCCCACGTNONE 
J075095H15GCCCCACGTNONE 
J075095K12GCCCCACGTNONE 
J075096L06GCCCCACGTNONE 
J075100H23GCCCCACGTNONE 
J075100K01GCCCCACGTNONE 
J075102K21GCCCCACGTNONE 
J075104F24GCCCCACGTNONE 
J075106C17GCCCCACGTNONE 
J075106E06GCCCCACGTNONE 
J075106M19GCCCCACGTNONE 
J075106O12GCCCCACGTNONE 
J075108I09GCCCCACGTNONE 
J075111M06GCCCCACGTNONE 
J075112E12GCCCCACGTNONE 
J075114C04GCCCCACGTNONE 
J075120A06GCCCCACGTNONE 
J075120D14GCCCCACGTNONE 
J075122P15GCCCCACGTNONE 
J075123A11GCCCCACGTNONE 
J075123L12GCCCCACGTNONE 
J075127G14GCCCCACGTNONE 
J075127H09GCCCCACGTNONE 
J075128M04GCCCCACGTNONE 
J075129J04GCCCCACGTNONE 
J075130J01GCCCCACGTNONE 
J075137N02GCCCCACGTNONE 
J075137O14GCCCCACGTNONE 
J075138H22GCCCCACGTNONE 
J075139P16GCCCCACGTNONE 
J075141G08GCCCCACGTNONE 
J075142C17GCCCCACGTNONE 
J075143B09GCCCCACGTNONE 
J075156I11GCCCCACGTNONE 
J075158M03GCCCCACGTNONE 
J075166I21GCCCCACGTNONE 
J075167C08GCCCCACGTNONE 
J075170C12GCCCCACGTNONE 
J075170F08GCCCCACGTNONE 
J075170G04GCCCCACGTNONE 
J075172N16GCCCCACGTNONE 
J075172P13GCCCCACGTNONE 
J075173G24GCCCCACGTNONE 
J075175D01GCCCCACGTNONE 
J075175K01GCCCCACGTNONE 
J075181O04GCCCCACGTNONE 
J075186A04GCCCCACGTNONE 
J075190B08GCCCCACGTNONE 
J075190M24GCCCCACGTNONE 
J075193D18GCCCCACGTNONE 
J075193H03GCCCCACGTNONE 
J075195N18GCCCCACGTNONE 
J080001N20GCCCCACGTNONE 
J080006K17GCCCCACGTNONE 
J080012I16GCCCCACGTNONE 
J080013K20GCCCCACGTNONE 
J080018N01GCCCCACGTNONE 
J080041G15GCCCCACGTNONE 
J080048L15GCCCCACGTNONE 
J080049A21GCCCCACGTNONE 
J080075G12GCCCCACGTNONE 
J080076O09GCCCCACGTNONE 
J080078P10GCCCCACGTNONE 
J080084D10GCCCCACGTNONE 
J090005N07GCCCCACGTNONE 
Os03g0154300J065112A07AGGTGGGCCCCACGAAConserved hypothetical protein. 
J065192P15AGGTGGGCCCCACGAANONE 
Os03g0192500AK068957ACACGTGGGGCProtein phosphatase 2C-like domain containing protein. 
AY603974ACACGTGGGGCNONE 
Os03g0213600AK100407ACGTGGGGCCCConserved hypothetical protein. 
Os03g0287900009-074-B07GCGGGCCCCACGTNONE 
014-027-E07GCGGGCCCCACGTNONE 
AK063663GCGGGCCCCACGTSimilar to Protein disulfide isomerase. 
J065009N21GCGGGCCCCACGTNONE 
Os03g0301000AK066115TCATGGGCCCCACGCATGGGCCCACCCConserved hypothetical protein. 
Os03g0302900011-005-H01CGACACGTGGGACCCACCCGCGCGTGGGGCCCACGCGTNONE 
AK069222CGACACGTGGGACCCACCCGCGCGTGGGGCCCACGCGTConserved hypothetical protein. 
J023014L15CGACACGTGGGACCCACCCGCGCGTGGGGCCCACGCGTNONE 
J033023G12CGACACGTGGGACCCACCCGCGCGTGGGGCCCACGCGTNONE 
J090008H16CGACACGTGGGACCCACCCGCGCGTGGGGCCCACGCGTNONE 
Os03g0340500012-007-F10GGCCCCACGTGTCAGTGNONE 
AK099406GGCCCCACGTGTCAGTGNONE 
AK102158GGCCCCACGTGTCAGTGSimilar to Sucrose synthase (EC 2.4.1.13). 
J013030N13GGCCCCACGTGTCAGTGNONE 
J013063E02GGCCCCACGTGTCAGTGNONE 
J013063I02GGCCCCACGTGTCAGTGNONE 
J013157O07GGCCCCACGTGTCAGTGNONE 
J023131N05GGCCCCACGTGTCAGTGNONE 
J033033P05GGCCCCACGTGTCAGTGNONE 
J033040N16GGCCCCACGTGTCAGTGNONE 
J033044M19GGCCCCACGTGTCAGTGNONE 
J033086F24GGCCCCACGTGTCAGTGNONE 
J033097H01GGCCCCACGTGTCAGTGNONE 
J033106C22GGCCCCACGTGTCAGTGNONE 
J033128M13GGCCCCACGTGTCAGTGNONE 
J033133I15GGCCCCACGTGTCAGTGNONE 
J043027A21GGCCCCACGTGTCAGTGNONE 
J090028A09GGCCCCACGTGTCAGTGNONE 
J090053D06GGCCCCACGTGTCAGTGNONE 
J090083O17GGCCCCACGTGTCAGTGNONE 
J090099H10GGCCCCACGTGTCAGTGNONE 
J100036M05GGCCCCACGTGTCAGTGNONE 
Os03g0342900006-032-D01CTGGCCCACCTCGCCCCACGNONE 
006-033-E10CTGGCCCACCTCGCCCCACGNONE 
006-051-G06CTGGCCCACCTCGCCCCACGNONE 
006-053-E05CTGGCCCACCTCGCCCCACGNONE 
006-056-B05CTGGCCCACCTCGCCCCACGNONE 
006-058-F04CTGGCCCACCTCGCCCCACGNONE 
006-059-E05CTGGCCCACCTCGCCCCACGNONE 
006-060-F10CTGGCCCACCTCGCCCCACGNONE 
006-104-D12CTGGCCCACCTCGCCCCACGNONE 
009-129-C12CTGGCCCACCTCGCCCCACGNONE 
AK060136CTGGCCCACCTCGCCCCACGNONE 
AK060980CTGGCCCACCTCGCCCCACGNONE 
AK064815CTGGCCCACCTCGCCCCACGDormancyauxin associated family protein. 
AK104244CTGGCCCACCTCGCCCCACGNONE 
AK104391CTGGCCCACCTCGCCCCACGNONE 
AK104590CTGGCCCACCTCGCCCCACGNONE 
AK104744CTGGCCCACCTCGCCCCACGNONE 
AK106100CTGGCCCACCTCGCCCCACGNONE 
J013000E10CTGGCCCACCTCGCCCCACGNONE 
J075027O22CTGGCCCACCTCGCCCCACGNONE 
J075052J03CTGGCCCACCTCGCCCCACGNONE 
J075066E15CTGGCCCACCTCGCCCCACGNONE 
J075095C17CTGGCCCACCTCGCCCCACGNONE 
J075118N05CTGGCCCACCTCGCCCCACGNONE 
J075187K22CTGGCCCACCTCGCCCCACGNONE 
J090026L04CTGGCCCACCTCGCCCCACGNONE 
J090059G16CTGGCCCACCTCGCCCCACGNONE 
J100055P20CTGGCCCACCTCGCCCCACGNONE 
J100062A10CTGGCCCACCTCGCCCCACGNONE 
J100068G20CTGGCCCACCTCGCCCCACGNONE 
Os03g0373300AK107897TCGTGGGCCCCACGTCTCProtein of unknown function DUF1110 family protein. 
Os03g0669200J013037D23GCGGGCCCCACGTNONE 
J023026K09GCGGGCCCCACGTNONE 
J075008E21GCGGGCCCCACGTNONE 
J075061B21GCGGGCCCCACGTNONE 
J075151B13GCGGGCCCCACGTNONE 
J075195L02GCGGGCCCCACGTNONE 
J090061B07GCGGGCCCCACGTNONE 
Os03g0698900013-074-A08TGGGGCCCCACGNONE 
AK073303TGGGGCCCCACGAlkaline phytoceramidase family protein. 
AK103953TGGGGCCCCACGNONE 
J033024P22TGGGGCCCCACGNONE 
J065194N16TGGGGCCCCACGNONE 
J065195O11TGGGGCCCCACGNONE 
J075020F03TGGGGCCCCACGNONE 
J075032P18TGGGGCCCCACGNONE 
J075037H13TGGGGCCCCACGNONE 
J075147I01TGGGGCCCCACGNONE 
J075187B13TGGGGCCCCACGNONE 
J100043G08TGGGGCCCCACGNONE 
J100060L06TGGGGCCCCACGNONE 
J100063O21TGGGGCCCCACGNONE 
J100066O13TGGGGCCCCACGNONE 
J100072K20TGGGGCCCCACGNONE 
J100083G21TGGGGCCCCACGNONE 
J100085D07TGGGGCCCCACGNONE 
Os03g0736300AK104929GGGACCCGTGGGGCNONE 
Os03g0758800AJ252135GCCGTTGGGTGGGCCCCACGTNONE 
AJ312906GCCGTTGGGTGGGCCCCACGTNONE 
AK060387GCCGTTGGGTGGGCCCCACGTSimilar to Eukaryotic translation initiation factor 5A-2 (eIF-5A-2) (eIF-4D). 
AK121592GCCGTTGGGTGGGCCCCACGTNONE 
J023109G09GCCGTTGGGTGGGCCCCACGTNONE 
J033038B14GCCGTTGGGTGGGCCCCACGTNONE 
J043013C09GCCGTTGGGTGGGCCCCACGTNONE 
J053096E21GCCGTTGGGTGGGCCCCACGTNONE 
J065026B08GCCGTTGGGTGGGCCCCACGTNONE 
J065062B16GCCGTTGGGTGGGCCCCACGTNONE 
J065066E03GCCGTTGGGTGGGCCCCACGTNONE 
J065091J12GCCGTTGGGTGGGCCCCACGTNONE 
J065164A06GCCGTTGGGTGGGCCCCACGTNONE 
J075014I20GCCGTTGGGTGGGCCCCACGTNONE 
J075117N07GCCGTTGGGTGGGCCCCACGTNONE 
J075142M03GCCGTTGGGTGGGCCCCACGTNONE 
J075175D04GCCGTTGGGTGGGCCCCACGTNONE 
J075188M01GCCGTTGGGTGGGCCCCACGTNONE 
J075199I20GCCGTTGGGTGGGCCCCACGTNONE 
J090010J12GCCGTTGGGTGGGCCCCACGTNONE 
J090025O16GCCGTTGGGTGGGCCCCACGTNONE 
J090041H05GCCGTTGGGTGGGCCCCACGTNONE 
J090078P07GCCGTTGGGTGGGCCCCACGTNONE 
J100031K10GCCGTTGGGTGGGCCCCACGTNONE 
J100055F23GCCGTTGGGTGGGCCCCACGTNONE 
J100064G05GCCGTTGGGTGGGCCCCACGTNONE 
J100080C24GCCGTTGGGTGGGCCCCACGTNONE 
J100080O07GCCGTTGGGTGGGCCCCACGTNONE 
J100090F01GCCGTTGGGTGGGCCCCACGTNONE 
Os03g0780600AK120180CCCGTGGGCCCCACGTNONE 
D13224CCCGTGGGCCCCACGTTubulin beta-1 chain (Beta-1 tubulin). 
J013033M18CCCGTGGGCCCCACGTNONE 
J033022G05CCCGTGGGCCCCACGTNONE 
J033028A16CCCGTGGGCCCCACGTNONE 
J033050M08CCCGTGGGCCCCACGTNONE 
J090053F04CCCGTGGGCCCCACGTNONE 
J090064E19CCCGTGGGCCCCACGTNONE 
J090083J24CCCGTGGGCCCCACGTNONE 
J100024I23CCCGTGGGCCCCACGTNONE 
Os03g0786600AK109838ACGTGGGGCProtein of unknown function DUF860, plant family protein. 
Os03g0807900006-056-G10GACACGTGGGGCCCGGCNONE 
AK060962GACACGTGGGGCCCGGCChaperonin-like RbcX family protein. 
AK070287GACACGTGGGGCCCGGCNONE 
J023049O16GACACGTGGGGCCCGGCNONE 
J100025I21GACACGTGGGGCCCGGCNONE 
J100035K21GACACGTGGGGCCCGGCNONE 
Os03g0844100AK067164TAATGGGCCCCACGTCTCSimilar to Pti1 kinase-like protein. 
Os03g0850100AK101126ACGTGGGGCCCACCTGNLI interacting factor domain containing protein. 
Os04g0271700AK059031GCCCCACGUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
AK070110GCCCCACGNONE 
AK099145GCCCCACGNONE 
J065045A03GCCCCACGNONE 
Os04g0319800J065187N03GCCCCACGCGTSimilar to Cytokinin-O-glucosyltransferase 2 (EC 2.4.1.-) (Zeatin O- glucosyltransferase 2). 
Os04g0382300AK071912AGTGGGCCCCACGNONE 
AK101795AGTGGGCCCCACGSimilar to SNF1-related protein kinase regulatory gamma subunit 1 (AKIN gamma1) (AKING1). 
Os04g0387600009-148-E01CCCGTGGGGCCCACGCNONE 
009-155-A11CCCGTGGGGCCCACGCNONE 
009-175-F04CCCGTGGGGCCCACGCNONE 
AK063862CCCGTGGGGCCCACGCConserved hypothetical protein. 
J065035F12CCCGTGGGGCCCACGCNONE 
J065162C13CCCGTGGGGCCCACGCNONE 
J065169L19CCCGTGGGGCCCACGCNONE 
Os04g0405300AK110700ACGTGGGGCSimilar to Stem secoisolariciresinol dehydrogenase (Fragment). 
Os04g0439900AK062578GCCCCACGNONE 
AK065119GCCCCACGSimilar to Translocon Tic40 precursor. 
AK098870GCCCCACGNONE 
Os04g0466600J065051L19GCCCCACGNONE 
J090042O12GCCCCACGNONE 
Os04g0500700AK072528CCTCGCCCCACGCGGCCCCCACCCGSimilar to Hydroxyanthranilate hydroxycinnamoyltransferase 3. 
AK104637CCTCGCCCCACGCGGCCCCCACCCGNONE 
AK119237CCTCGCCCCACGCGGCCCCCACCCGNONE 
Os04g0540600AF464932GAGACGTGGGGCNONE 
AK071169GAGACGTGGGGCAldehyde dehydrogenase NAD(P)-dependent family protein. 
J023022A08GAGACGTGGGGCNONE 
J023127F17GAGACGTGGGGCNONE 
J033127K14GAGACGTGGGGCNONE 
J075060H15GAGACGTGGGGCNONE 
J080063F04GAGACGTGGGGCNONE 
J090030C21GAGACGTGGGGCNONE 
J090049I06GAGACGTGGGGCNONE 
Os04g0568900AY224421CGTGGGGCNONE 
Os04g0579200AK100603GCCCCACGCACGCGZinc finger, RING-type domain containing protein. 
AK100603GCCCCACGGGZinc finger, RING-type domain containing protein. 
Os04g0602800AK100925CGCGTGGGGCSimilar to Yarrowia lipolytica chromosome D of strain CLIB99 of Yarrowia lipolytica. 
Os04g0645100AK072140ACGTGGGGCCCTetratricopeptide-like helical domain containing protein. 
Os04g0679800AK060662CCGTGGGCCCCACGSimilar to RNA-binding protein-like protein. 
AK099987CCGTGGGCCCCACGNONE 
J013130B11CCGTGGGCCCCACGNONE 
J065049C17CCGTGGGCCCCACGNONE 
J075191N12CCGTGGGCCCCACGNONE 
J075191P12CCGTGGGCCCCACGNONE 
J100031C07CCGTGGGCCCCACGNONE 
Os05g0116000AK058320GCCCCACGNONE 
AK121775GCCCCACG11-S plant seed storage protein family protein. 
J023003L12GCCCCACGNONE 
J023025C18GCCCCACGNONE 
J023074E20GCCCCACGNONE 
J023128H09GCCCCACGNONE 
J033092N18GCCCCACGNONE 
J065009J09GCCCCACGNONE 
J090073L21GCCCCACGNONE 
Os05g0119300004-011-B09GCTGGGCCCCACGCGNONE 
006-063-A03GCTGGGCCCCACGCGNONE 
006-077-E12GCTGGGCCCCACGCGNONE 
006-079-E12GCTGGGCCCCACGCGNONE 
006-100-B11GCTGGGCCCCACGCGNONE 
009-109-A12GCTGGGCCCCACGCGNONE 
009-123-C07GCTGGGCCCCACGCGNONE 
009-163-D09GCTGGGCCCCACGCGNONE 
009-170-D11GCTGGGCCCCACGCGNONE 
009-173-C01GCTGGGCCCCACGCGNONE 
009-192-E01GCTGGGCCCCACGCGNONE 
011-048-G01GCTGGGCCCCACGCGNONE 
AK060883GCTGGGCCCCACGCGNONE 
AK068289GCTGGGCCCCACGCGNONE 
AK071554GCTGGGCCCCACGCGNONE 
AK099495GCTGGGCCCCACGCGXYPPX repeat containing protein. 
AY348312GCTGGGCCCCACGCGNONE 
J013037L16GCTGGGCCCCACGCGNONE 
J013088P04GCTGGGCCCCACGCGNONE 
J013099D14GCTGGGCCCCACGCGNONE 
J013146E19GCTGGGCCCCACGCGNONE 
J013147E18GCTGGGCCCCACGCGNONE 
J023104E19GCTGGGCCCCACGCGNONE 
J023128O20GCTGGGCCCCACGCGNONE 
J023132D16GCTGGGCCCCACGCGNONE 
J023143E13GCTGGGCCCCACGCGNONE 
J033028F15GCTGGGCCCCACGCGNONE 
J033133D24GCTGGGCCCCACGCGNONE 
J053091M07GCTGGGCCCCACGCGNONE 
J075029L15GCTGGGCCCCACGCGNONE 
J075097M12GCTGGGCCCCACGCGNONE 
J075103J11GCTGGGCCCCACGCGNONE 
J075138J10GCTGGGCCCCACGCGNONE 
J075172K18GCTGGGCCCCACGCGNONE 
J080001C15GCTGGGCCCCACGCGNONE 
J080002M13GCTGGGCCCCACGCGNONE 
J080009K01GCTGGGCCCCACGCGNONE 
J080010N01GCTGGGCCCCACGCGNONE 
J080011D23GCTGGGCCCCACGCGNONE 
J080013C13GCTGGGCCCCACGCGNONE 
J080013M16GCTGGGCCCCACGCGNONE 
J080018J02GCTGGGCCCCACGCGNONE 
J080020F03GCTGGGCCCCACGCGNONE 
J080020G05GCTGGGCCCCACGCGNONE 
J080021D05GCTGGGCCCCACGCGNONE 
J080030A19GCTGGGCCCCACGCGNONE 
J080031A16GCTGGGCCCCACGCGNONE 
J080033J23GCTGGGCCCCACGCGNONE 
J080035H07GCTGGGCCCCACGCGNONE 
J080039M24GCTGGGCCCCACGCGNONE 
J080042B16GCTGGGCCCCACGCGNONE 
J080043B03GCTGGGCCCCACGCGNONE 
J080045G01GCTGGGCCCCACGCGNONE 
J080045K17GCTGGGCCCCACGCGNONE 
J080047A09GCTGGGCCCCACGCGNONE 
J080047I22GCTGGGCCCCACGCGNONE 
J080048M14GCTGGGCCCCACGCGNONE 
J080049J02GCTGGGCCCCACGCGNONE 
J080052C15GCTGGGCCCCACGCGNONE 
J080052E11GCTGGGCCCCACGCGNONE 
J080052M22GCTGGGCCCCACGCGNONE 
J080056O21GCTGGGCCCCACGCGNONE 
J080059J04GCTGGGCCCCACGCGNONE 
J080059O17GCTGGGCCCCACGCGNONE 
J080064N04GCTGGGCCCCACGCGNONE 
J080066A03GCTGGGCCCCACGCGNONE 
J080066I22GCTGGGCCCCACGCGNONE 
J080069C13GCTGGGCCCCACGCGNONE 
J080069J03GCTGGGCCCCACGCGNONE 
J080069N04GCTGGGCCCCACGCGNONE 
J080071A01GCTGGGCCCCACGCGNONE 
J080071C03GCTGGGCCCCACGCGNONE 
J080071J02GCTGGGCCCCACGCGNONE 
J080080D17GCTGGGCCCCACGCGNONE 
J080084O06GCTGGGCCCCACGCGNONE 
J080085O20GCTGGGCCCCACGCGNONE 
J080086H15GCTGGGCCCCACGCGNONE 
J080094K06GCTGGGCCCCACGCGNONE 
J080095C05GCTGGGCCCCACGCGNONE 
J080095G04GCTGGGCCCCACGCGNONE 
J080096F03GCTGGGCCCCACGCGNONE 
J080096F20GCTGGGCCCCACGCGNONE 
J090004H05GCTGGGCCCCACGCGNONE 
J090012P10GCTGGGCCCCACGCGNONE 
J090021B09GCTGGGCCCCACGCGNONE 
J090034M08GCTGGGCCCCACGCGNONE 
J090046G21GCTGGGCCCCACGCGNONE 
J090055K24GCTGGGCCCCACGCGNONE 
J090055L05GCTGGGCCCCACGCGNONE 
J090057H17GCTGGGCCCCACGCGNONE 
J090082K21GCTGGGCCCCACGCGNONE 
J100022A07GCTGGGCCCCACGCGNONE 
J100022M02GCTGGGCCCCACGCGNONE 
J100069K11GCTGGGCCCCACGCGNONE 
J100086C24GCTGGGCCCCACGCGNONE 
Os05g0164100AF456329CGTGTGGGCCCCACGNONE 
AK065086CGTGTGGGCCCCACGNONE 
AK072243CGTGTGGGCCCCACGSimilar to Fructose-6-phosphate 2-kinase/fructose-2,6-bisphosphatase (EC 2.7.1.105) (EC 3.1.3.46) (Fragment). 
J013001L18CGTGTGGGCCCCACGNONE 
J013132O12CGTGTGGGCCCCACGNONE 
J023003N09CGTGTGGGCCCCACGNONE 
Os05g0242600016-092-A07CCCGTGGGGCCCGCNONE 
AK107430CCCGTGGGGCCCGCPrefoldin domain containing protein. 
J065218C11CCCGTGGGGCCCGCNONE 
Os05g0295100AK100239GCCCCACGGGProtein of unknown function DUF1253 family protein. 
AK108559GCCCCACGGGNONE 
Os05g0319700AK107192GGCCCCACGCGSimilar to Protein kinase-like protein (Fragment). 
Os05g0357200014-046-H09GCCCCACGTGGGCCCCACGCCTCNONE 
014-046-H09TCGTGGGCCCCACGGCCNONE 
AK064069GCCCCACGTGGGCCCCACGCCTCNONE 
AK064069TCGTGGGCCCCACGGCCNONE 
AK072064GCCCCACGTGGGCCCCACGCCTCMitochondrial substrate carrier family protein. 
AK072064TCGTGGGCCCCACGGCCMitochondrial substrate carrier family protein. 
J065038M01GCCCCACGTGGGCCCCACGCCTCNONE 
J065038M01TCGTGGGCCCCACGGCCNONE 
J065121C16GCCCCACGTGGGCCCCACGCCTCNONE 
J065121C16TCGTGGGCCCCACGGCCNONE 
J075173E09GCCCCACGTGGGCCCCACGCCTCNONE 
J075173E09TCGTGGGCCCCACGGCCNONE 
J080307A20GCCCCACGTGGGCCCCACGCCTCNONE 
J080307A20TCGTGGGCCCCACGGCCNONE 
J090046B19GCCCCACGTGGGCCCCACGCCTCNONE 
J090046B19TCGTGGGCCCCACGGCCNONE 
J100033N12GCCCCACGTGGGCCCCACGCCTCNONE 
J100033N12TCGTGGGCCCCACGGCCNONE 
J100036G01GCCCCACGTGGGCCCCACGCCTCNONE 
J100036G01TCGTGGGCCCCACGGCCNONE 
J100057B19GCCCCACGTGGGCCCCACGCCTCNONE 
J100057B19TCGTGGGCCCCACGGCCNONE 
Os05g0373300Os05g0373300GACACGTGGGGCCSimilar to BONZAI1. 
Os05g0392801J090025K15GTGGGACCCACGTGGGCCCCACGTConserved hypothetical protein. 
J090053E06GTGGGACCCACGTGGGCCCCACGTNONE 
Os05g0397300009-051-E02TTCGTGGGGCCCACGANONE 
009-060-E03TTCGTGGGGCCCACGANONE 
009-075-B01TTCGTGGGGCCCACGANONE 
009-082-B11TTCGTGGGGCCCACGANONE 
009-136-D05TTCGTGGGGCCCACGANONE 
AK062621TTCGTGGGGCCCACGANONE 
AK066003TTCGTGGGGCCCACGANONE 
AK070832TTCGTGGGGCCCACGAConserved hypothetical protein. 
J023066C05TTCGTGGGGCCCACGANONE 
Os05g0404000012-088-B05ACGTGGGGCNONE 
AK102821ACGTGGGGCMitochodrial transcription termination factor-related family protein. 
J033108O14ACGTGGGGCNONE 
J090052L24ACGTGGGGCNONE 
Os05g0408200AK100057GCGGGCCCCACGCGCGACGCSBP domain containing protein. 
J065182F20GCGGGCCCCACGCGCGACGCNONE 
Os05g0411300014-098-D05ACGTGGGCCCCACGTGTCNONE 
015-093-F04ACGTGGGCCCCACGTGTCNONE 
AK071931ACGTGGGCCCCACGTGTCConserved hypothetical protein. 
AK073142ACGTGGGCCCCACGTGTCNONE 
Os05g0413200006-067-C03GCCCCACGNONE 
006-080-C03GCCCCACGNONE 
006-095-G10GCCCCACGNONE 
006-115-G11GCCCCACGNONE 
013-040-E05GCCCCACGNONE 
AB104732GCCCCACGNONE 
AK122099GCCCCACGBeta-tubulin. 
J033087H20GCCCCACGNONE 
J033117C18GCCCCACGNONE 
J033125G10GCCCCACGNONE 
Os05g0473300AK102559TGTGGGCCCCACGCCTCNONE 
AK103822TGTGGGCCCCACGCCTCNONE 
AK109855TGTGGGCCCCACGCCTCSimilar to Ethylene response factor 1. 
Os05g0512400011-014-B07CACGTGGGGCNONE 
AK120770CACGTGGGGCConserved hypothetical protein. 
Os05g0514300AK061747GGCCCCACGTGTCSimilar to Tubby-like protein 3. 
AK098851GGCCCCACGTGTCNONE 
Os05g0529300AK102648AGTGGGCCCCACGSimilar to ER lumen protein retaining receptor (HDEL receptor). 
Os05g0529400009-126-H06CGTGGGGCCCACTNONE 
AK063846CGTGGGGCCCACTConserved hypothetical protein. 
AK122038CGTGGGGCCCACTNONE 
J033113C01CGTGGGGCCCACTNONE 
Os05g0542900AK102925GGCCCCACGTVirulence factor, pectin lyase fold family protein. 
Os05g0588500AK069614GGCCCCACGTMtN3 and saliva related transmembrane protein family protein. 
J023022G11GGCCCCACGTNONE 
J023023E05GGCCCCACGTNONE 
Os06g0115200J100029D05CCACTGACATGTGGGCCCCACGNONE 
J100048P05CCACTGACATGTGGGCCCCACGQuinonprotein alcohol dehydrogenase-like domain containing protein. 
Os06g0136600AK069316GGCCCCACGSimilar to Enolase 1 (EC 4.2.1.11) (2-phosphoglycerate dehydratase 1) (2-phospho- D-glycerate hydro-lyase 1). 
J075010L23GGCCCCACGNONE 
Os06g0199300J065045H01GGCCCCACGTGTCCNONE 
J075177C22GGCCCCACGTGTCCNONE 
J080068H06GGCCCCACGTGTCCNONE 
J090048F01GGCCCCACGTGTCCNONE 
J100066F17GGCCCCACGTGTCCNONE 
Os06g0233000009-177-C07GGCCCCACGAANONE 
AK063118GGCCCCACGAAConserved hypothetical protein. 
Os06g0246600AK107692CCAGGCCCCACGCGTSimilar to Glutamate receptor 3.3 precursor (Ligand-gated ion channel 3.3). 
Os06g0286351AK121119GGCCCCACGCGTArmadillo-like helical domain containing protein. 
Os06g0326400AK065052GCCCCACGCGNONE 
AK121116GCCCCACGCGPyrophosphate-dependent phosphofructokinase PfpB family protein. 
J013107E23GCCCCACGCGNONE 
J013129K13GCCCCACGCGNONE 
J023010F22GCCCCACGCGNONE 
J023120K19GCCCCACGCGNONE 
Os06g0337100006-100-G05CGTGGGGCNONE 
AK061222CGTGGGGCConserved hypothetical protein. 
Os06g0557100AK111851CGTGGGGCCCACACProtein kinase-like domain containing protein. 
AK119892CGTGGGGCCCACACNONE 
J023150C23CGTGGGGCCCACACNONE 
J033108M17CGTGGGGCCCACACNONE 
J065062L01CGTGGGGCCCACACNONE 
J065161G20CGTGGGGCCCACACNONE 
J090062G13CGTGGGGCCCACACNONE 
J090087H11CGTGGGGCCCACACNONE 
J100055H23CGTGGGGCCCACACNONE 
J100063G05CGTGGGGCCCACACNONE 
Os06g0678200AK059456CCCCCACGCCGGCCCCACGTGTCNONE 
AK071299CCCCCACGCCGGCCCCACGTGTCSimilar to Geranyl diphosphate synthase. 
Os06g0712800AK121236GGCCCCACGSimilar to Ankyrin-like protein. 
Os06g0715700AK121440GGCCCCACGTProtein of unknown function DUF803 family protein. 
Os07g0154900009-142-E09GGGGCCCACGTGGGCCCCACGTGTCNONE 
AK062969GGGGCCCACGTGGGCCCCACGTGTCConserved hypothetical protein. 
Os07g0166800006-038-C11CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
012-080-F02CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
AK070524CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCRad6 (Ubiquitin carrier protein). 
AK121382CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J023022D19CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J023055G02CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J023073E02CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J023125B08CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J023127H21CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J033052G01CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J033067F13CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J065046L14CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J065178D11CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J065205N17CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J075006K17CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J075051D20CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J075109L04CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J090024K15CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J090025N04CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J090049N09CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J090070N12CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J090078O21CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J090083L07CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J100063K16CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
J100083D14CAGGTGGGTCCCATCCCCCGTGGGCCCCACGTGTCNONE 
Os07g0191700AK066389ACCCGCGCGACGTGGGGCCCACGCSimilar to AT.I.24-9 protein (Fragment). 
AK103768ACCCGCGCGACGTGGGGCCCACGCNONE 
Os07g0240300AK072205AGGTGGGCCCCACGTGConserved hypothetical protein. 
AK098977AGGTGGGCCCCACGTGNONE 
Os07g0240400009-080-C04GCGGGCCCCACGAANONE 
AK062643GCGGGCCCCACGAAConserved hypothetical protein. 
Os07g0241500AK107239CACGTCACCGACACGTGGGGCCCACCCUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
J065065I20CACGTCACCGACACGTGGGGCCCACCCNONE 
J065158P15CACGTCACCGACACGTGGGGCCCACCCNONE 
J065167J16CACGTCACCGACACGTGGGGCCCACCCNONE 
J065183I01CACGTCACCGACACGTGGGGCCCACCCNONE 
J065187L18CACGTCACCGACACGTGGGGCCCACCCNONE 
J065205J10CACGTCACCGACACGTGGGGCCCACCCNONE 
Os07g0408500AK103596CTCGGCCCCACGCGSimilar to Rac GTPase activating protein 3 (Fragment). 
Os07g0438800AK060412ACCGGGCCCCACGNONE 
AK100065ACCGGGCCCCACGSimilar to Phosphate starvation regulator protein (Regulatory protein of P- starvation acclimation response Psr1). 
AK103195ACCGGGCCCCACGNONE 
AY224478ACCGGGCCCCACGNONE 
J013160O05ACCGGGCCCCACGNONE 
J023030C05ACCGGGCCCCACGNONE 
J033025O04ACCGGGCCCCACGNONE 
J033121P15ACCGGGCCCCACGNONE 
J043034I23ACCGGGCCCCACGNONE 
J065022N01ACCGGGCCCCACGNONE 
J065022N02ACCGGGCCCCACGNONE 
J065023M01ACCGGGCCCCACGNONE 
J065101G13ACCGGGCCCCACGNONE 
J075058P13ACCGGGCCCCACGNONE 
J075186K10ACCGGGCCCCACGNONE 
J075199F17ACCGGGCCCCACGNONE 
Os07g0557500AK101830AGAGTGGGCCCCACGTZinc finger, RING-type domain containing protein. 
J013075M04AGAGTGGGCCCCACGTNONE 
J033068I24AGAGTGGGCCCCACGTNONE 
Os07g0603100AK101352CGCGTGGGGCCCACCANuclear transport factor 2 domain containing protein. 
J023077E09CGCGTGGGGCCCACCANONE 
J023081N15CGCGTGGGGCCCACCANONE 
J033022N22CGCGTGGGGCCCACCANONE 
J033024M18CGCGTGGGGCCCACCANONE 
J033034P09CGCGTGGGGCCCACCANONE 
J033046A06CGCGTGGGGCCCACCANONE 
J033051K01CGCGTGGGGCCCACCANONE 
J033081P09CGCGTGGGGCCCACCANONE 
J033091B17CGCGTGGGGCCCACCANONE 
J033092K23CGCGTGGGGCCCACCANONE 
J033132J09CGCGTGGGGCCCACCANONE 
J033144A14CGCGTGGGGCCCACCANONE 
J033145A14CGCGTGGGGCCCACCANONE 
J043021B20CGCGTGGGGCCCACCANONE 
J053024D23CGCGTGGGGCCCACCANONE 
J065212J10CGCGTGGGGCCCACCANONE 
J090055M05CGCGTGGGGCCCACCANONE 
J090065E14CGCGTGGGGCCCACCANONE 
J090092J06CGCGTGGGGCCCACCANONE 
Os07g0608400AK109447GGTGGGCCCCACGCGSimilar to nucleic acid binding protein [Oryza sativa (japonica cultivar-group)]. 
Os07g0621201J065152G13ACGTGGGGCCCACAConserved hypothetical protein. 
Os07g0623600AK063642TGCGGGCCCCACGTGTCConserved hypothetical protein. 
Os07g0626600Os07g0626600TGTGGGCCCCACGSimilar to Embryogenic callus protein-like. 
Os07g0661600006-050-D12TCCGGCCCCACGCGNONE 
009-124-B10TCCGGCCCCACGCGNONE 
AK061123TCCGGCCCCACGCGNONE 
AK066432TCCGGCCCCACGCGSimilar to RNA-binding protein-like protein. 
AK104664TCCGGCCCCACGCGNONE 
J013064M13TCCGGCCCCACGCGNONE 
J013122O12TCCGGCCCCACGCGNONE 
J033044A16TCCGGCCCCACGCGNONE 
J033144D14TCCGGCCCCACGCGNONE 
J090078P13TCCGGCCCCACGCGNONE 
Os08g0126500AK110941GCCCCACGTATGGCCCACTTGProtein of unknown function DUF295 family protein. 
Os08g0127600AK058365CGCGTGGGGCCCAACCCCACCACHeat shock protein DnaJ, N-terminal domain containing protein. 
AK068373CGCGTGGGGCCCAACCCCACCACNONE 
J013149L10CGCGTGGGGCCCAACCCCACCACNONE 
J075027H17CGCGTGGGGCCCAACCCCACCACNONE 
J075060F10CGCGTGGGGCCCAACCCCACCACNONE 
Os08g0127700012-086-F03GTGGTGGGGTTGGGCCCCACGCGNONE 
AK059350GTGGTGGGGTTGGGCCCCACGCGNONE 
AK099242GTGGTGGGGTTGGGCCCCACGCGNONE 
AK121348GTGGTGGGGTTGGGCCCCACGCGConserved hypothetical protein. 
J033027J18GTGGTGGGGTTGGGCCCCACGCGNONE 
J065012F22GTGGTGGGGTTGGGCCCCACGCGNONE 
J065046N17GTGGTGGGGTTGGGCCCCACGCGNONE 
J065197B02GTGGTGGGGTTGGGCCCCACGCGNONE 
J100018P04GTGGTGGGGTTGGGCCCCACGCGNONE 
J100052C14GTGGTGGGGTTGGGCCCCACGCGNONE 
J100083A12GTGGTGGGGTTGGGCCCCACGCGNONE 
Os08g0397900006-033-G02AGAGTGGGCCCCACGCGNONE 
009-131-F03AGAGTGGGCCCCACGCGNONE 
AK060114AGAGTGGGCCCCACGCGNONE 
AK098973AGAGTGGGCCCCACGCGNONE 
AK109817AGAGTGGGCCCCACGCGConserved hypothetical protein. 
J013089E18AGAGTGGGCCCCACGCGNONE 
J100081N17AGAGTGGGCCCCACGCGNONE 
Os08g0502700AK064774GCCACGTCGGACGGGTGTGGGCCCCACGAAAminotransferase, class V family protein. 
AK065126GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
AK099206GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J013001P06GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J013033N17GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J013070L14GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J013104J15GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J013159L20GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J033068M20GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J065039M22GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J065057C23GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J065069O15GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J065080A01GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J065081F08GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J065117F05GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J065178C01GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J065178C02GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J065212F12GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J075015K06GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J075062J08GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J075063O17GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J075072G05GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J075098H11GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J075098J11GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J075098P09GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J075133G18GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J075137G02GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J075169K02GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080007M21GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080009M17GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080011J02GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080012I10GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080021K10GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080023P13GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080024C08GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080025P11GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080027B13GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080032P16GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080033G07GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080041F17GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080041N19GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080042C20GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080046J24GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080047L14GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080049O11GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080051E15GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080052F01GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080054A08GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080054K14GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080057G21GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080059L15GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080063H12GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080070M24GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080071D24GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080077O19GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080078E08GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080078N12GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080081I08GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080082A17GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080087A09GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080087F22GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080088I08GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080090F19GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080091H16GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080091N06GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080092H08GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080097H19GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080302C09GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080302G05GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080302K14GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080303L01GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080304D07GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080305G03GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080306B12GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080307G07GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080315A14GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J080318H14GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J100029P15GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J100042C22GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J100063F24GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J100087P16GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
J100088A12GCCACGTCGGACGGGTGTGGGCCCCACGAANONE 
Os08g0543400AK058361GCCCCACGNONE 
AK058361GCCCCACGNONE 
J023080G08GCCCCACGNONE 
J023080G08GCCCCACGNONE 
J023092M19GCCCCACGNONE 
J023092M19GCCCCACGNONE 
J023109A08GCCCCACGNONE 
J023109A08GCCCCACGNONE 
Os08g0547200AK101130AGTGACACTGACAGGTGGGCCCCACGRabGAP/TBC domain containing protein. 
AK119577AGTGACACTGACAGGTGGGCCCCACGNONE 
Os09g0251800006-100-E12GCCCCACGNONE 
AK061218GCCCCACGC2 calcium/lipid-binding region, CaLB domain containing protein. 
AK104010GCCCCACGNONE 
J065048A02GCCCCACGNONE 
J065073P10GCCCCACGNONE 
J065075B09GCCCCACGNONE 
J065112B05GCCCCACGNONE 
J090014H10GCCCCACGNONE 
Os09g0341500AK073913GCCCCACGConserved hypothetical protein. 
J033076F19GCCCCACGNONE 
J100085E04GCCCCACGNONE 
Os09g0346500004-015-F05GCCCCACGCGCGAGNONE 
005-018-A05GCCCCACGCGCGAGNONE 
006-021-B03GCCCCACGCGCGAGNONE 
006-021-D10GCCCCACGCGCGAGNONE 
006-021-E07GCCCCACGCGCGAGNONE 
006-021-F03GCCCCACGCGCGAGNONE 
006-022-A06GCCCCACGCGCGAGNONE 
006-022-B07GCCCCACGCGCGAGNONE 
006-022-C02GCCCCACGCGCGAGNONE 
006-023-E02GCCCCACGCGCGAGNONE 
006-023-G08GCCCCACGCGCGAGNONE 
006-023-H05GCCCCACGCGCGAGNONE 
006-024-B09GCCCCACGCGCGAGNONE 
006-024-E02GCCCCACGCGCGAGNONE 
006-025-F01GCCCCACGCGCGAGNONE 
006-025-G12GCCCCACGCGCGAGNONE 
006-026-D02GCCCCACGCGCGAGNONE 
006-026-D05GCCCCACGCGCGAGNONE 
006-028-C05GCCCCACGCGCGAGNONE 
006-028-E07GCCCCACGCGCGAGNONE 
006-028-F05GCCCCACGCGCGAGNONE 
006-028-F07GCCCCACGCGCGAGNONE 
006-028-F08GCCCCACGCGCGAGNONE 
006-028-G09GCCCCACGCGCGAGNONE 
006-029-B04GCCCCACGCGCGAGNONE 
006-029-C10GCCCCACGCGCGAGNONE 
006-030-H03GCCCCACGCGCGAGNONE 
006-031-F04GCCCCACGCGCGAGNONE 
006-031-G11GCCCCACGCGCGAGNONE 
006-032-D07GCCCCACGCGCGAGNONE 
006-032-G02GCCCCACGCGCGAGNONE 
006-032-H02GCCCCACGCGCGAGNONE 
006-032-H10GCCCCACGCGCGAGNONE 
006-033-A05GCCCCACGCGCGAGNONE 
006-033-C04GCCCCACGCGCGAGNONE 
006-033-D02GCCCCACGCGCGAGNONE 
006-034-C05GCCCCACGCGCGAGNONE 
006-034-D01GCCCCACGCGCGAGNONE 
006-034-H10GCCCCACGCGCGAGNONE 
006-035-A10GCCCCACGCGCGAGNONE 
006-035-B10GCCCCACGCGCGAGNONE 
006-035-D05GCCCCACGCGCGAGNONE 
006-036-B07GCCCCACGCGCGAGNONE 
006-036-F04GCCCCACGCGCGAGNONE 
006-036-H02GCCCCACGCGCGAGNONE 
006-036-H05GCCCCACGCGCGAGNONE 
006-036-H06GCCCCACGCGCGAGNONE 
006-037-C10GCCCCACGCGCGAGNONE 
006-037-F03GCCCCACGCGCGAGNONE 
006-038-B05GCCCCACGCGCGAGNONE 
006-038-E03GCCCCACGCGCGAGNONE 
006-038-E06GCCCCACGCGCGAGNONE 
006-039-B07GCCCCACGCGCGAGNONE 
006-039-D03GCCCCACGCGCGAGNONE 
006-039-F05GCCCCACGCGCGAGNONE 
006-041-A10GCCCCACGCGCGAGNONE 
006-041-B07GCCCCACGCGCGAGNONE 
006-042-B05GCCCCACGCGCGAGNONE 
006-042-C04GCCCCACGCGCGAGNONE 
006-042-D12GCCCCACGCGCGAGNONE 
006-043-C11GCCCCACGCGCGAGNONE 
006-043-E04GCCCCACGCGCGAGNONE 
006-044-E09GCCCCACGCGCGAGNONE 
006-045-B01GCCCCACGCGCGAGNONE 
006-045-G02GCCCCACGCGCGAGNONE 
006-046-A01GCCCCACGCGCGAGNONE 
006-046-C07GCCCCACGCGCGAGNONE 
006-046-G02GCCCCACGCGCGAGNONE 
006-047-B02GCCCCACGCGCGAGNONE 
006-047-C01GCCCCACGCGCGAGNONE 
006-047-D05GCCCCACGCGCGAGNONE 
006-047-F09GCCCCACGCGCGAGNONE 
006-049-E05GCCCCACGCGCGAGNONE 
006-049-E09GCCCCACGCGCGAGNONE 
006-050-A01GCCCCACGCGCGAGNONE 
006-050-A12GCCCCACGCGCGAGNONE 
006-050-C05GCCCCACGCGCGAGNONE 
006-050-C06GCCCCACGCGCGAGNONE 
006-050-G06GCCCCACGCGCGAGNONE 
006-050-G10GCCCCACGCGCGAGNONE 
006-050-H02GCCCCACGCGCGAGNONE 
006-051-A02GCCCCACGCGCGAGNONE 
006-051-B09GCCCCACGCGCGAGNONE 
006-051-C02GCCCCACGCGCGAGNONE 
006-051-H01GCCCCACGCGCGAGNONE 
006-052-B12GCCCCACGCGCGAGNONE 
006-052-D08GCCCCACGCGCGAGNONE 
006-052-E08GCCCCACGCGCGAGNONE 
006-052-F05GCCCCACGCGCGAGNONE 
006-052-F11GCCCCACGCGCGAGNONE 
006-052-G08GCCCCACGCGCGAGNONE 
006-052-G11GCCCCACGCGCGAGNONE 
006-052-H07GCCCCACGCGCGAGNONE 
006-053-A08GCCCCACGCGCGAGNONE 
006-053-B06GCCCCACGCGCGAGNONE 
006-054-H08GCCCCACGCGCGAGNONE 
006-055-B08GCCCCACGCGCGAGNONE 
006-055-E03GCCCCACGCGCGAGNONE 
006-055-H08GCCCCACGCGCGAGNONE 
006-056-A10GCCCCACGCGCGAGNONE 
006-056-C10GCCCCACGCGCGAGNONE 
006-056-E04GCCCCACGCGCGAGNONE 
006-057-A10GCCCCACGCGCGAGNONE 
006-058-A02GCCCCACGCGCGAGNONE 
006-058-D11GCCCCACGCGCGAGNONE 
006-058-F01GCCCCACGCGCGAGNONE 
006-058-H03GCCCCACGCGCGAGNONE 
006-058-H10GCCCCACGCGCGAGNONE 
006-059-B04GCCCCACGCGCGAGNONE 
006-059-F04GCCCCACGCGCGAGNONE 
006-060-A06GCCCCACGCGCGAGNONE 
006-060-B07GCCCCACGCGCGAGNONE 
006-060-D03GCCCCACGCGCGAGNONE 
006-062-B09GCCCCACGCGCGAGNONE 
006-062-C02GCCCCACGCGCGAGNONE 
006-062-D01GCCCCACGCGCGAGNONE 
006-062-E01GCCCCACGCGCGAGNONE 
006-062-F03GCCCCACGCGCGAGNONE 
006-062-H02GCCCCACGCGCGAGNONE 
006-063-C03GCCCCACGCGCGAGNONE 
006-063-G02GCCCCACGCGCGAGNONE 
006-063-H10GCCCCACGCGCGAGNONE 
006-064-H01GCCCCACGCGCGAGNONE 
006-067-F08GCCCCACGCGCGAGNONE 
006-068-G11GCCCCACGCGCGAGNONE 
006-071-B06GCCCCACGCGCGAGNONE 
006-071-G08GCCCCACGCGCGAGNONE 
006-071-H10GCCCCACGCGCGAGNONE 
006-072-H11GCCCCACGCGCGAGNONE 
006-073-C12GCCCCACGCGCGAGNONE 
006-073-E07GCCCCACGCGCGAGNONE 
006-073-H09GCCCCACGCGCGAGNONE 
006-074-C03GCCCCACGCGCGAGNONE 
006-074-F03GCCCCACGCGCGAGNONE 
006-074-G02GCCCCACGCGCGAGNONE 
006-074-H12GCCCCACGCGCGAGNONE 
006-075-C06GCCCCACGCGCGAGNONE 
006-075-G07GCCCCACGCGCGAGNONE 
006-075-G08GCCCCACGCGCGAGNONE 
006-075-G09GCCCCACGCGCGAGNONE 
006-075-H09GCCCCACGCGCGAGNONE 
006-076-C02GCCCCACGCGCGAGNONE 
006-076-E12GCCCCACGCGCGAGNONE 
006-076-G04GCCCCACGCGCGAGNONE 
006-076-G06GCCCCACGCGCGAGNONE 
006-076-G11GCCCCACGCGCGAGNONE 
006-077-D09GCCCCACGCGCGAGNONE 
006-077-E08GCCCCACGCGCGAGNONE 
006-079-B10GCCCCACGCGCGAGNONE 
006-079-F11GCCCCACGCGCGAGNONE 
006-079-H04GCCCCACGCGCGAGNONE 
006-079-H11GCCCCACGCGCGAGNONE 
006-080-D06GCCCCACGCGCGAGNONE 
006-080-E10GCCCCACGCGCGAGNONE 
006-080-F09GCCCCACGCGCGAGNONE 
006-080-G04GCCCCACGCGCGAGNONE 
006-081-C05GCCCCACGCGCGAGNONE 
006-081-D08GCCCCACGCGCGAGNONE 
006-081-E09GCCCCACGCGCGAGNONE 
006-081-F07GCCCCACGCGCGAGNONE 
006-081-H11GCCCCACGCGCGAGNONE 
006-082-E05GCCCCACGCGCGAGNONE 
006-083-E12GCCCCACGCGCGAGNONE 
006-083-F12GCCCCACGCGCGAGNONE 
006-084-A10GCCCCACGCGCGAGNONE 
006-084-B07GCCCCACGCGCGAGNONE 
006-084-E05GCCCCACGCGCGAGNONE 
006-084-F07GCCCCACGCGCGAGNONE 
006-085-C01GCCCCACGCGCGAGNONE 
006-085-D08GCCCCACGCGCGAGNONE 
006-085-G07GCCCCACGCGCGAGNONE 
006-085-G11GCCCCACGCGCGAGNONE 
006-086-A01GCCCCACGCGCGAGNONE 
006-086-B09GCCCCACGCGCGAGNONE 
006-086-E05GCCCCACGCGCGAGNONE 
006-086-F11GCCCCACGCGCGAGNONE 
006-086-F12GCCCCACGCGCGAGNONE 
006-086-G03GCCCCACGCGCGAGNONE 
006-087-C01GCCCCACGCGCGAGNONE 
006-087-D09GCCCCACGCGCGAGNONE 
006-087-E02GCCCCACGCGCGAGNONE 
006-087-F07GCCCCACGCGCGAGNONE 
006-088-A05GCCCCACGCGCGAGNONE 
006-088-F02GCCCCACGCGCGAGNONE 
006-089-F08GCCCCACGCGCGAGNONE 
006-090-G11GCCCCACGCGCGAGNONE 
006-091-H10GCCCCACGCGCGAGNONE 
006-092-B09GCCCCACGCGCGAGNONE 
006-092-E09GCCCCACGCGCGAGNONE 
006-093-B01GCCCCACGCGCGAGNONE 
006-093-C09GCCCCACGCGCGAGNONE 
006-093-G08GCCCCACGCGCGAGNONE 
006-094-G06GCCCCACGCGCGAGNONE 
006-095-A11GCCCCACGCGCGAGNONE 
006-095-D06GCCCCACGCGCGAGNONE 
006-095-F06GCCCCACGCGCGAGNONE 
006-096-E05GCCCCACGCGCGAGNONE 
006-096-H05GCCCCACGCGCGAGNONE 
006-097-A04GCCCCACGCGCGAGNONE 
006-097-H01GCCCCACGCGCGAGNONE 
006-098-B10GCCCCACGCGCGAGNONE 
006-098-F01GCCCCACGCGCGAGNONE 
006-098-G08GCCCCACGCGCGAGNONE 
006-098-H08GCCCCACGCGCGAGNONE 
006-099-E01GCCCCACGCGCGAGNONE 
006-100-C11GCCCCACGCGCGAGNONE 
006-100-F03GCCCCACGCGCGAGNONE 
006-101-B03GCCCCACGCGCGAGNONE 
006-101-B06GCCCCACGCGCGAGNONE 
006-101-B09GCCCCACGCGCGAGNONE 
006-101-G02GCCCCACGCGCGAGNONE 
006-101-H03GCCCCACGCGCGAGNONE 
006-102-A03GCCCCACGCGCGAGNONE 
006-102-E11GCCCCACGCGCGAGNONE 
006-102-H01GCCCCACGCGCGAGNONE 
006-102-H03GCCCCACGCGCGAGNONE 
006-103-C04GCCCCACGCGCGAGNONE 
006-103-H06GCCCCACGCGCGAGNONE 
006-104-A03GCCCCACGCGCGAGNONE 
006-104-F11GCCCCACGCGCGAGNONE 
006-105-H05GCCCCACGCGCGAGNONE 
006-105-H07GCCCCACGCGCGAGNONE 
006-106-B12GCCCCACGCGCGAGNONE 
006-106-D04GCCCCACGCGCGAGNONE 
006-107-A08GCCCCACGCGCGAGNONE 
006-107-C03GCCCCACGCGCGAGNONE 
006-107-G02GCCCCACGCGCGAGNONE 
006-108-B06GCCCCACGCGCGAGNONE 
006-109-B02GCCCCACGCGCGAGNONE 
006-109-D08GCCCCACGCGCGAGNONE 
006-109-F11GCCCCACGCGCGAGNONE 
006-109-G08GCCCCACGCGCGAGNONE 
006-110-G12GCCCCACGCGCGAGNONE 
006-110-H07GCCCCACGCGCGAGNONE 
006-111-A01GCCCCACGCGCGAGNONE 
006-111-A11GCCCCACGCGCGAGNONE 
006-111-D01GCCCCACGCGCGAGNONE 
006-111-H10GCCCCACGCGCGAGNONE 
006-111-H11GCCCCACGCGCGAGNONE 
006-112-A03GCCCCACGCGCGAGNONE 
006-112-B02GCCCCACGCGCGAGNONE 
006-112-B10GCCCCACGCGCGAGNONE 
006-112-E12GCCCCACGCGCGAGNONE 
006-112-F06GCCCCACGCGCGAGNONE 
006-112-H10GCCCCACGCGCGAGNONE 
006-113-A10GCCCCACGCGCGAGNONE 
006-113-C07GCCCCACGCGCGAGNONE 
006-114-A04GCCCCACGCGCGAGNONE 
006-114-B10GCCCCACGCGCGAGNONE 
006-114-C04GCCCCACGCGCGAGNONE 
006-114-D03GCCCCACGCGCGAGNONE 
006-114-D07GCCCCACGCGCGAGNONE 
006-114-G11GCCCCACGCGCGAGNONE 
006-115-C01GCCCCACGCGCGAGNONE 
006-116-A12GCCCCACGCGCGAGNONE 
006-116-F09GCCCCACGCGCGAGNONE 
006-116-H01GCCCCACGCGCGAGNONE 
006-117-B04GCCCCACGCGCGAGNONE 
006-117-B08GCCCCACGCGCGAGNONE 
006-117-E07GCCCCACGCGCGAGNONE 
006-117-E11GCCCCACGCGCGAGNONE 
006-117-H04GCCCCACGCGCGAGNONE 
006-117-H11GCCCCACGCGCGAGNONE 
006-118-A12GCCCCACGCGCGAGNONE 
006-118-C01GCCCCACGCGCGAGNONE 
006-119-A12GCCCCACGCGCGAGNONE 
006-119-C11GCCCCACGCGCGAGNONE 
006-119-F06GCCCCACGCGCGAGNONE 
009-038-E07GCCCCACGCGCGAGNONE 
009-053-G07GCCCCACGCGCGAGNONE 
009-088-D05GCCCCACGCGCGAGNONE 
009-109-G12GCCCCACGCGCGAGNONE 
009-124-H09GCCCCACGCGCGAGNONE 
009-134-F04GCCCCACGCGCGAGNONE 
009-149-G07GCCCCACGCGCGAGNONE 
009-181-D07GCCCCACGCGCGAGNONE 
009-191-D03GCCCCACGCGCGAGNONE 
AK058305GCCCCACGCGCGAGNONE 
AK060851GCCCCACGCGCGAGSimilar to Chlorophyll a-b binding protein, chloroplast precursor (LHCII type I CAB) (LHCP). 
AK104281GCCCCACGCGCGAGNONE 
AK104288GCCCCACGCGCGAGNONE 
AK104350GCCCCACGCGCGAGNONE 
D00641GCCCCACGCGCGAGNONE 
J013091G20GCCCCACGCGCGAGNONE 
J013129G18GCCCCACGCGCGAGNONE 
J013158J17GCCCCACGCGCGAGNONE 
J023013M23GCCCCACGCGCGAGNONE 
J023062B14GCCCCACGCGCGAGNONE 
J023105C20GCCCCACGCGCGAGNONE 
J023113G18GCCCCACGCGCGAGNONE 
J065060F20GCCCCACGCGCGAGNONE 
J065132G17GCCCCACGCGCGAGNONE 
J065163A19GCCCCACGCGCGAGNONE 
J075001K18GCCCCACGCGCGAGNONE 
J075047E10GCCCCACGCGCGAGNONE 
J075050E09GCCCCACGCGCGAGNONE 
J075058J15GCCCCACGCGCGAGNONE 
J075086B22GCCCCACGCGCGAGNONE 
J075086E16GCCCCACGCGCGAGNONE 
J075092C16GCCCCACGCGCGAGNONE 
J075130A10GCCCCACGCGCGAGNONE 
J075140F10GCCCCACGCGCGAGNONE 
J075161K06GCCCCACGCGCGAGNONE 
J075176J22GCCCCACGCGCGAGNONE 
J075177I20GCCCCACGCGCGAGNONE 
J075179H01GCCCCACGCGCGAGNONE 
J080003C15GCCCCACGCGCGAGNONE 
J080005N03GCCCCACGCGCGAGNONE 
J080011I16GCCCCACGCGCGAGNONE 
J080014C08GCCCCACGCGCGAGNONE 
J080017L17GCCCCACGCGCGAGNONE 
J080018K10GCCCCACGCGCGAGNONE 
J080022J03GCCCCACGCGCGAGNONE 
J080024I10GCCCCACGCGCGAGNONE 
J080026F17GCCCCACGCGCGAGNONE 
J080029G15GCCCCACGCGCGAGNONE 
J080032H11GCCCCACGCGCGAGNONE 
J080034C09GCCCCACGCGCGAGNONE 
J080035B22GCCCCACGCGCGAGNONE 
J080037H20GCCCCACGCGCGAGNONE 
J080039J16GCCCCACGCGCGAGNONE 
J080042J20GCCCCACGCGCGAGNONE 
J080044F03GCCCCACGCGCGAGNONE 
J080044F23GCCCCACGCGCGAGNONE 
J080045H08GCCCCACGCGCGAGNONE 
J080048H13GCCCCACGCGCGAGNONE 
J080062K23GCCCCACGCGCGAGNONE 
J080063G19GCCCCACGCGCGAGNONE 
J080068M05GCCCCACGCGCGAGNONE 
J080069L18GCCCCACGCGCGAGNONE 
J080071P09GCCCCACGCGCGAGNONE 
J080074E21GCCCCACGCGCGAGNONE 
J080075A14GCCCCACGCGCGAGNONE 
J080075C06GCCCCACGCGCGAGNONE 
J080085D10GCCCCACGCGCGAGNONE 
J080085E07GCCCCACGCGCGAGNONE 
J080086E17GCCCCACGCGCGAGNONE 
J080089F09GCCCCACGCGCGAGNONE 
J080089O19GCCCCACGCGCGAGNONE 
J080096A04GCCCCACGCGCGAGNONE 
J080301D10GCCCCACGCGCGAGNONE 
J080301E15GCCCCACGCGCGAGNONE 
J080306C23GCCCCACGCGCGAGNONE 
J080307L24GCCCCACGCGCGAGNONE 
J080308G21GCCCCACGCGCGAGNONE 
J080315H03GCCCCACGCGCGAGNONE 
J090014I10GCCCCACGCGCGAGNONE 
J090018H12GCCCCACGCGCGAGNONE 
J090031J20GCCCCACGCGCGAGNONE 
J090055A05GCCCCACGCGCGAGNONE 
J090062H23GCCCCACGCGCGAGNONE 
J090071K20GCCCCACGCGCGAGNONE 
J090099G11GCCCCACGCGCGAGNONE 
J100045E10GCCCCACGCGCGAGNONE 
J100046E18GCCCCACGCGCGAGNONE 
J100052B19GCCCCACGCGCGAGNONE 
J100053A01GCCCCACGCGCGAGNONE 
J100079P18GCCCCACGCGCGAGNONE 
Os09g0369500013-023-F11TGCGGGCCCCACGCCTGGGCCCCNONE 
AK105322TGCGGGCCCCACGCCTGGGCCCCNONE 
AK105479TGCGGGCCCCACGCCTGGGCCCCConserved hypothetical protein. 
Os09g0371200J100027I16CAGGTGGGCCCCACGTMajor facilitator superfamily MFS_1 protein. 
Os09g0372900006-044-C02GCCCCACGGCCNONE 
AK059785GCCCCACGGCCCyclin-like F-box domain containing protein. 
AK067586GCCCCACGGCCNONE 
AK100129GCCCCACGGCCNONE 
J023009I10GCCCCACGGCCNONE 
J065195A19GCCCCACGGCCNONE 
J065202M02GCCCCACGGCCNONE 
J065215H14GCCCCACGGCCNONE 
Os09g0400700009-060-D04GCCCCACGTNONE 
009-104-G09GCCCCACGTNONE 
009-106-D08GCCCCACGTNONE 
014-041-F03GCCCCACGTNONE 
AK062784GCCCCACGTConserved hypothetical protein. 
Os09g0424600AK073882ACAGGTGGGCCCCACGTGGCHAD superfamily (subfamily IG) hydrolase, 5'-Nucleotidase protein. 
Os09g0445600AK107839GCCCCACGCGTConserved hypothetical protein. 
Os09g0457900AK067195CACGTCACCTCGGCCCCACGSimilar to AP2 domain containing protein RAP2.6 (Fragment). 
J013098P10CACGTCACCTCGGCCCCACGNONE 
Os09g0476100AK099938CTCGCGCGTGGGGCCCACCCGRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os09g0516600AK070780AGGTGGGCCCCACGGCCCGNONE 
AK103563AGGTGGGCCCCACGGCCCGNONE 
AY054407AGGTGGGCCCCACGGCCCGGlyoxalase II. 
J013058P06AGGTGGGCCCCACGGCCCGNONE 
J013093G04AGGTGGGCCCCACGGCCCGNONE 
J023007G05AGGTGGGCCCCACGGCCCGNONE 
J023091A08AGGTGGGCCCCACGGCCCGNONE 
J023136K23AGGTGGGCCCCACGGCCCGNONE 
J023138D20AGGTGGGCCCCACGGCCCGNONE 
J033022N20AGGTGGGCCCCACGGCCCGNONE 
J033065N15AGGTGGGCCCCACGGCCCGNONE 
J033109L23AGGTGGGCCCCACGGCCCGNONE 
J053073C08AGGTGGGCCCCACGGCCCGNONE 
J075094J24AGGTGGGCCCCACGGCCCGNONE 
J075106P21AGGTGGGCCCCACGGCCCGNONE 
Os09g0551600005-020-H08TGTGGGCCCCACGTGNONE 
006-043-E02TGTGGGCCCCACGTGNONE 
013-043-F03TGTGGGCCCCACGTGNONE 
AK066658TGTGGGCCCCACGTGSimilar to HMGd1 protein (Nucleasome/chromatin assembly factor D protein NFD101). 
J013071N11TGTGGGCCCCACGTGNONE 
J065177J20TGTGGGCCCCACGTGNONE 
J075041D06TGTGGGCCCCACGTGNONE 
J075199H24TGTGGGCCCCACGTGNONE 
J080001G07TGTGGGCCCCACGTGNONE 
J080024A12TGTGGGCCCCACGTGNONE 
J080025B15TGTGGGCCCCACGTGNONE 
J090017G07TGTGGGCCCCACGTGNONE 
J090050G23TGTGGGCCCCACGTGNONE 
J090083G11TGTGGGCCCCACGTGNONE 
Os09g0559900AK111842CACGGCCCCACGCGProtein kinase-like domain containing protein. 
Os11g0137200J013093A11GGTGGGCCCCACGNONE 
J013093B11GGTGGGCCCCACGNONE 
J023131E04GGTGGGCCCCACGNONE 
J033128M14GGTGGGCCCCACGNONE 
J065169D05GGTGGGCCCCACGNONE 
Os11g0139100009-099-H06TGTGGGCCCCACGTNONE 
AK121443TGTGGGCCCCACGTSimilar to 50S ribosomal protein L24. 
J023140O18TGTGGGCCCCACGTNONE 
J023143M23TGTGGGCCCCACGTNONE 
J033079G04TGTGGGCCCCACGTNONE 
J043004D20TGTGGGCCCCACGTNONE 
J065097F05TGTGGGCCCCACGTNONE 
Os11g0159000AK065738CAGGTGGGCCCCACGTGConserved hypothetical protein. 
Os11g0166800AK070928CGCGTGGGGCRNA polymerase II transcription factor SIII subunit A family protein. 
Os11g0216100AK059179CAGGTGGGCCCCACGSimilar to Chaperone protein dnaJ. 
Os11g0244800AK103215GTGGGCCCCACGTGTCSimilar to Alfin-1. 
J065009E13GTGGGCCCCACGTGTCNONE 
J065027D16GTGGGCCCCACGTGTCNONE 
J065085B06GTGGGCCCCACGTGTCNONE 
J065180O17GTGGGCCCCACGTGTCNONE 
J090010C16GTGGGCCCCACGTGTCNONE 
J090039K20GTGGGCCCCACGTGTCNONE 
Os11g0247300AK105080GCCCCACGGGNONE 
Os11g0255300011-023-E04GCCCCACGNONE 
AK071495GCCCCACGCysteine endopeptidase (Cysteine proteinase (EC 3.4.22.-)-rice). 
J023084I24GCCCCACGNONE 
J023099K03GCCCCACGNONE 
J023122F02GCCCCACGNONE 
J090050G24GCCCCACGNONE 
J090078A11GCCCCACGNONE 
J100029N13GCCCCACGNONE 
J100065M08GCCCCACGNONE 
J100077B15GCCCCACGNONE 
X80876GCCCCACGNONE 
Os11g0479300AK099761GCCCCACGTRabGAP/TBC domain containing protein. 
Os11g0586300AK072257GCCCCACGConserved hypothetical protein. 
Os11g0595200009-005-A06AGCCCACAATGTGGGCCCCACGNONE 
AK071115AGCCCACAATGTGGGCCCCACGNONE 
AK106159AGCCCACAATGTGGGCCCCACGPAP fibrillin family protein. 
AY387683AGCCCACAATGTGGGCCCCACGNONE 
AY387684AGCCCACAATGTGGGCCCCACGNONE 
J065166K17AGCCCACAATGTGGGCCCCACGNONE 
Os11g0604600006-022-C01ACCGGGCCCCACGCGTNONE 
AK061397ACCGGGCCCCACGCGTNONE 
AK102376ACCGGGCCCCACGCGTRINGv domain containing protein. 
J033091P05ACCGGGCCCCACGCGTNONE 
J065062C12ACCGGGCCCCACGCGTNONE 
J065062H09ACCGGGCCCCACGCGTNONE 
J065064A02ACCGGGCCCCACGCGTNONE 
J065101I16ACCGGGCCCCACGCGTNONE 
J065123F23ACCGGGCCCCACGCGTNONE 
J065155N12ACCGGGCCCCACGCGTNONE 
J065164F22ACCGGGCCCCACGCGTNONE 
J065181G08ACCGGGCCCCACGCGTNONE 
J075055H05ACCGGGCCCCACGCGTNONE 
J075058A22ACCGGGCCCCACGCGTNONE 
J075082H23ACCGGGCCCCACGCGTNONE 
J075111A14ACCGGGCCCCACGCGTNONE 
J075176I06ACCGGGCCCCACGCGTNONE 
Os12g0510500AK066140CGTGGGGCDisease resistance protein family protein. 
AK098997CGTGGGGCNONE 
J013051F22CGTGGGGCNONE 
Os12g0565800AK072828GGGCCCCACGAAZinc finger, TTF-type domain containing protein. 
Os12g0581700AK111563CGTGGGGCCCACAConserved hypothetical protein. 
J023011D12CGTGGGGCCCACANONE 
J065176G05CGTGGGGCCCACANONE 
J065192E06CGTGGGGCCCACANONE 
J100075L05CGTGGGGCCCACANONE 
Os12g0599900AK101252ACGTGGGGCCCACTetratricopeptide region domain containing protein. 
J033032F05ACGTGGGGCCCACNONE 
Os12g0620400015-008-B10CACGTGGGGCCCGCNONE 
AK059006CACGTGGGGCCCGCNONE 
AK059973CACGTGGGGCCCGCNONE 
AK063843CACGTGGGGCCCGCMethyl-CpG binding domain containing protein. 
AK072503CACGTGGGGCCCGCNONE 
AK072934CACGTGGGGCCCGCNONE 
J023126H05CACGTGGGGCCCGCNONE 
J023131G11CACGTGGGGCCCGCNONE 
J023146E17CACGTGGGGCCCGCNONE 
J033064P08CACGTGGGGCCCGCNONE 
J033095L07CACGTGGGGCCCGCNONE 
J065101N06CACGTGGGGCCCGCNONE 
J065186F11CACGTGGGGCCCGCNONE 
J065215J15CACGTGGGGCCCGCNONE 
J080049H05CACGTGGGGCCCGCNONE 
J080059L05CACGTGGGGCCCGCNONE 
J080061M17CACGTGGGGCCCGCNONE 
J080063D16CACGTGGGGCCCGCNONE 
J090012D01CACGTGGGGCCCGCNONE 
J090023D20CACGTGGGGCCCGCNONE 
J090040A09CACGTGGGGCCCGCNONE 
J090044K08CACGTGGGGCCCGCNONE 
J100019H03CACGTGGGGCCCGCNONE 
J100054N04CACGTGGGGCCCGCNONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.