version

Summary of OsREG573 (All List)

OrganismOryza sativa  
IDOsREG573  
SequenceCGTGTGGC  
Annotation  
PPDB Motif 
PLACE Motif 
Total Entry Count1595  

Entry Sequences (1595 entries)

LocusGene modelSequenceDescription
Os01g0156300AK107993CCGTGGGCCACACGTCTCSimilar to Cappuccino protein. 
Os01g0158000AK058679AGTTGGGCCACACGNONE 
AK103127AGTTGGGCCACACGImportin alpha-2 subunit. 
D78504AGTTGGGCCACACGNONE 
Os01g0281100AK109672GCCACACGConserved hypothetical protein. 
AK109672GTGACGTGTGGCGTGConserved hypothetical protein. 
J065013K07GCCACACGNONE 
J065013K07GTGACGTGTGGCGTGNONE 
J065040E15GCCACACGNONE 
J065040E15GTGACGTGTGGCGTGNONE 
J065127F12GCCACACGNONE 
J065127F12GTGACGTGTGGCGTGNONE 
J075155K23GCCACACGNONE 
J075155K23GTGACGTGTGGCGTGNONE 
Os01g0300900AK119559GCCACACGNONE 
Os01g0510600006-075-H02GCCACACGNONE 
AK072814GCCACACGTetratricopeptide-like helical domain containing protein. 
AK104796GCCACACGNONE 
J013028A13GCCACACGNONE 
J013109A12GCCACACGNONE 
J023141A19GCCACACGNONE 
Os01g0539400004-019-C07GCCACACGNONE 
AK059524GCCACACGConserved hypothetical protein. 
AK106137GCCACACGNONE 
J065099M02GCCACACGNONE 
J075170M12GCCACACGNONE 
Os01g0558700Os01g0558700CCCACGCGGCCACACGCACGCGConserved hypothetical protein. 
Os01g0598600AK104992CGTGTGGCNONE 
Os01g0639900004-009-H08CGTGTGGCNONE 
006-050-F07CGTGTGGCNONE 
006-120-D04CGTGTGGCNONE 
AF182806CGTGTGGCNONE 
AK060890CGTGTGGCSimilar to Carbonic anhydrase, chloroplast precursor (EC 4.2.1.1) (Carbonate dehydratase). 
AK099825CGTGTGGCNONE 
J075022I06CGTGTGGCNONE 
U08404CGTGTGGCNONE 
Os01g0643900AK108288GCCACACGOleosin family protein. 
AK108288GCCACACGOleosin family protein. 
Os01g0689900AK064656CGTGTGGCCCACTNONE 
AK102164CGTGTGGCCCACTProtein kinase-like domain containing protein. 
J033043D15CGTGTGGCCCACTNONE 
J033060J20CGTGTGGCCCACTNONE 
J033086H03CGTGTGGCCCACTNONE 
J033117B10CGTGTGGCCCACTNONE 
J053023O03CGTGTGGCCCACTNONE 
J053055P21CGTGTGGCCCACTNONE 
J053078A20CGTGTGGCCCACTNONE 
J053082K03CGTGTGGCCCACTNONE 
J053086A16CGTGTGGCCCACTNONE 
J080027C22CGTGTGGCCCACTNONE 
J080062G19CGTGTGGCCCACTNONE 
J080065M03CGTGTGGCCCACTNONE 
J100068P17CGTGTGGCCCACTNONE 
Os01g0690800AK066430CGTGTGGCCCACTProtein kinase-like domain containing protein. 
AK073248CGTGTGGCCCACTNONE 
J065001D22CGTGTGGCCCACTNONE 
J065116J04CGTGTGGCCCACTNONE 
J100044K03CGTGTGGCCCACTNONE 
Os01g0733200AK066316GCCACACGTGGCSimilar to Heat shock transcription factor 29 (Fragment). 
AY344493GCCACACGTGGCNONE 
J013066G03GCCACACGTGGCNONE 
J090034J08GCCACACGTGGCNONE 
Os01g0741900014-012-B05GCCACACGNONE 
AK068600GCCACACGSimilar to Auxin-responsive protein IAA26 (Indoleacetic acid-induced protein 26) (Phytochrome-associated protein 1). 
J013035G23GCCACACGNONE 
J013154A18GCCACACGNONE 
J033092G10GCCACACGNONE 
J043020A20GCCACACGNONE 
J100041K22GCCACACGNONE 
J100066E16GCCACACGNONE 
J100081J06GCCACACGNONE 
Os01g0744400AK067648GCCACACGConserved hypothetical protein. 
Os01g0810100AK071916GTTGGGCCACACGRibonuclease III domain containing protein. 
AK099056GTTGGGCCACACGNONE 
AK104320GTTGGGCCACACGNONE 
Os01g0830000012-056-G03CACGCCTCTCGGCCGCCACACGNONE 
015-092-H05CACGCCTCTCGGCCGCCACACGNONE 
AK121100CACGCCTCTCGGCCGCCACACGSimilar to Plastid sufB (Fragment). 
J023069G03CACGCCTCTCGGCCGCCACACGNONE 
J090047G13CACGCCTCTCGGCCGCCACACGNONE 
J090059K22CACGCCTCTCGGCCGCCACACGNONE 
Os01g0830100AK069755CGTGTGGCGGCCGAGAGGCGTGPyridine nucleotide-disulphide oxidoreductase, NAD-binding region domain containing protein. 
Os01g0847900006-030-E09GCCACACGNONE 
AK059798GCCACACGPrenylated rab acceptor PRA1 family protein. 
AK073643GCCACACGNONE 
J065091G23GCCACACGNONE 
Os01g0854800AK109676GCCACACGSimilar to Cytochrome P450 86A1 (EC 1.14.-.-) (CYPLXXXVI) (P450-dependent fatty acid omega-hydroxylase). 
J100041A10GCCACACGNONE 
Os01g0863166J065007F23GCCACACGNONE 
J065124H21GCCACACGConserved hypothetical protein. 
Os01g0894600006-082-B08CGTGTGGCNONE 
AK099522CGTGTGGCNONE 
J013030F08CGTGTGGCNONE 
Os01g0896400AK107067CGTGTGGCCCACCCGConserved hypothetical protein. 
Os01g0905800006-028-A06GCCACACGNONE 
006-050-H08GCCACACGNONE 
006-057-G07GCCACACGNONE 
006-062-D02GCCACACGNONE 
006-116-G09GCCACACGNONE 
009-117-H10GCCACACGNONE 
011-025-F02GCCACACGNONE 
011-045-E10GCCACACGNONE 
011-068-E01GCCACACGNONE 
013-040-A01GCCACACGNONE 
013-079-E10GCCACACGNONE 
013-079-G11GCCACACGNONE 
015-095-D06GCCACACGNONE 
AK062270GCCACACGNONE 
AK073770GCCACACGAldolase C-1. 
AK104719GCCACACGNONE 
D21279GCCACACGNONE 
D50301GCCACACGNONE 
J013029D24GCCACACGNONE 
J013039N01GCCACACGNONE 
J023039J01GCCACACGNONE 
J023064E16GCCACACGNONE 
J023085J23GCCACACGNONE 
J023100H14GCCACACGNONE 
J023127J19GCCACACGNONE 
J023135J04GCCACACGNONE 
J023140C02GCCACACGNONE 
J023150B18GCCACACGNONE 
J033027L09GCCACACGNONE 
J033033N07GCCACACGNONE 
J033042E03GCCACACGNONE 
J033046K04GCCACACGNONE 
J033068A16GCCACACGNONE 
J033075I01GCCACACGNONE 
J033076C19GCCACACGNONE 
J033079O08GCCACACGNONE 
J033080E19GCCACACGNONE 
J033082F12GCCACACGNONE 
J033089B13GCCACACGNONE 
J033090E13GCCACACGNONE 
J033091K16GCCACACGNONE 
J033093E06GCCACACGNONE 
J033094K02GCCACACGNONE 
J033097O10GCCACACGNONE 
J033098D04GCCACACGNONE 
J033099J02GCCACACGNONE 
J033109F07GCCACACGNONE 
J033120F06GCCACACGNONE 
J033126F10GCCACACGNONE 
J033128I19GCCACACGNONE 
J033132B13GCCACACGNONE 
J033132C16GCCACACGNONE 
J043022A15GCCACACGNONE 
J065001J20GCCACACGNONE 
J065009J23GCCACACGNONE 
J065021P12GCCACACGNONE 
J065047O05GCCACACGNONE 
J065059G07GCCACACGNONE 
J065072B20GCCACACGNONE 
J065073N03GCCACACGNONE 
J065108H21GCCACACGNONE 
J065111B01GCCACACGNONE 
J065113K02GCCACACGNONE 
J065167F23GCCACACGNONE 
J065168A06GCCACACGNONE 
J065172D04GCCACACGNONE 
J065191F04GCCACACGNONE 
J065191K22GCCACACGNONE 
J065193D04GCCACACGNONE 
J065200O11GCCACACGNONE 
J075063B18GCCACACGNONE 
J075127I16GCCACACGNONE 
J075189P14GCCACACGNONE 
J080001P12GCCACACGNONE 
J080004I20GCCACACGNONE 
J080005I23GCCACACGNONE 
J080007H13GCCACACGNONE 
J080010O21GCCACACGNONE 
J080011A07GCCACACGNONE 
J080012N11GCCACACGNONE 
J080012P03GCCACACGNONE 
J080023O17GCCACACGNONE 
J080033D12GCCACACGNONE 
J080035G15GCCACACGNONE 
J080036M15GCCACACGNONE 
J080040N08GCCACACGNONE 
J080044D18GCCACACGNONE 
J080045E16GCCACACGNONE 
J080045H12GCCACACGNONE 
J080047D17GCCACACGNONE 
J080054B19GCCACACGNONE 
J080056P07GCCACACGNONE 
J080063H06GCCACACGNONE 
J080065A11GCCACACGNONE 
J080066B03GCCACACGNONE 
J080066H02GCCACACGNONE 
J080067K05GCCACACGNONE 
J080086B05GCCACACGNONE 
J080096K02GCCACACGNONE 
J080315F07GCCACACGNONE 
J080315M01GCCACACGNONE 
J090001L02GCCACACGNONE 
J090001L03GCCACACGNONE 
J090004I19GCCACACGNONE 
J090024E02GCCACACGNONE 
J090034N18GCCACACGNONE 
J090036K17GCCACACGNONE 
J090051C05GCCACACGNONE 
J090094B01GCCACACGNONE 
J100030C02GCCACACGNONE 
J100033D19GCCACACGNONE 
J100036K05GCCACACGNONE 
J100042F23GCCACACGNONE 
J100045C03GCCACACGNONE 
J100045L18GCCACACGNONE 
J100047A19GCCACACGNONE 
J100052A07GCCACACGNONE 
J100066N04GCCACACGNONE 
J100066N18GCCACACGNONE 
J100074B08GCCACACGNONE 
J100074G10GCCACACGNONE 
J100074H15GCCACACGNONE 
J100074N03GCCACACGNONE 
J100077H11GCCACACGNONE 
J100078G24GCCACACGNONE 
J100089K09GCCACACGNONE 
Os01g0918300009-036-G04GCCACACGNONE 
009-128-H04GCCACACGNONE 
009-189-D06GCCACACGNONE 
AB016030GCCACACGNONE 
AK058869GCCACACGUbiquitin-like protein SMT3. 
AK069668GCCACACGNONE 
J023026B05GCCACACGNONE 
J053042E12GCCACACGNONE 
J053045P19GCCACACGNONE 
J053078C24GCCACACGNONE 
J065038J05GCCACACGNONE 
J065170B12GCCACACGNONE 
J065174C07GCCACACGNONE 
J075002G06GCCACACGNONE 
J075024O07GCCACACGNONE 
J075068H04GCCACACGNONE 
J075071H14GCCACACGNONE 
J075095G03GCCACACGNONE 
J075117O08GCCACACGNONE 
J075118J23GCCACACGNONE 
J075124P18GCCACACGNONE 
J100057D06GCCACACGNONE 
J100063L03GCCACACGNONE 
X99608GCCACACGNONE 
Os01g0937100AK105806CGTGTGGCSimilar to Xylanase inhibitor precursor (Xylanase inhibitor TAXI-I). 
J033069E12CGTGTGGCNONE 
Os02g0101500012-006-E03GCCACACGNONE 
013-006-A02GCCACACGNONE 
013-011-F03GCCACACGNONE 
AK067642GCCACACGNONE 
AK072105GCCACACGSimilar to NADH-dependent hydroxypyruvate reductase (EC 1.1.1.29) (Fragment). 
J013027G04GCCACACGNONE 
J013034P10GCCACACGNONE 
J013039D15GCCACACGNONE 
J013048P14GCCACACGNONE 
J013050O03GCCACACGNONE 
J013056H19GCCACACGNONE 
J013071D11GCCACACGNONE 
J013097D17GCCACACGNONE 
J013104F13GCCACACGNONE 
J013108J23GCCACACGNONE 
J013119J12GCCACACGNONE 
J013122N16GCCACACGNONE 
J013146M24GCCACACGNONE 
J013149E16GCCACACGNONE 
J013157E04GCCACACGNONE 
J023012P06GCCACACGNONE 
J023050C21GCCACACGNONE 
J023107F18GCCACACGNONE 
J023110B19GCCACACGNONE 
J023111H01GCCACACGNONE 
J023148P04GCCACACGNONE 
J043009E13GCCACACGNONE 
J043009H22GCCACACGNONE 
J065007D17GCCACACGNONE 
J065038K16GCCACACGNONE 
J065042A01GCCACACGNONE 
J065075C20GCCACACGNONE 
J065091I04GCCACACGNONE 
J065131A03GCCACACGNONE 
J075152O18GCCACACGNONE 
J075152P17GCCACACGNONE 
J080001F06GCCACACGNONE 
J080002H09GCCACACGNONE 
J080004L23GCCACACGNONE 
J080005H18GCCACACGNONE 
J080010D22GCCACACGNONE 
J080010G17GCCACACGNONE 
J080013E07GCCACACGNONE 
J080013P18GCCACACGNONE 
J080015D22GCCACACGNONE 
J080025H24GCCACACGNONE 
J080026O03GCCACACGNONE 
J080036J01GCCACACGNONE 
J080036L03GCCACACGNONE 
J080037O13GCCACACGNONE 
J080041D10GCCACACGNONE 
J080045J04GCCACACGNONE 
J080046J06GCCACACGNONE 
J080048G16GCCACACGNONE 
J080048I21GCCACACGNONE 
J080056F16GCCACACGNONE 
J080056L16GCCACACGNONE 
J080057C02GCCACACGNONE 
J080058D03GCCACACGNONE 
J080061B19GCCACACGNONE 
J080061E16GCCACACGNONE 
J080061L22GCCACACGNONE 
J080062P08GCCACACGNONE 
J080067C01GCCACACGNONE 
J080067G13GCCACACGNONE 
J080068F20GCCACACGNONE 
J080072H15GCCACACGNONE 
J080072P12GCCACACGNONE 
J080079O21GCCACACGNONE 
J080081J15GCCACACGNONE 
J080081K02GCCACACGNONE 
J080085O11GCCACACGNONE 
J080086N15GCCACACGNONE 
J080087E22GCCACACGNONE 
J080087O15GCCACACGNONE 
J080091D07GCCACACGNONE 
J080091J02GCCACACGNONE 
J080091L21GCCACACGNONE 
J080093B13GCCACACGNONE 
J100069F01GCCACACGNONE 
J100086B08GCCACACGNONE 
Os02g0119700AK108777GCCACACGProtein prenyltransferase domain containing protein. 
Os02g0130300011-005-D07GCCACACGNONE 
011-041-B06GCCACACGNONE 
015-099-D11GCCACACGNONE 
016-049-D06GCCACACGNONE 
AK102708GCCACACGZinc finger, RING-type domain containing protein. 
Os02g0139900014-011-B08CGTGTGGCNONE 
AK063638CGTGTGGCConserved hypothetical protein. 
Os02g0148600AK059287GACACGTGTGGCConserved hypothetical protein. 
Os02g0175100AB053473CGTGTGGCSimilar to Transcriptional activator protein. 
AK069575CGTGTGGCNONE 
J023025A18CGTGTGGCNONE 
J065001E07CGTGTGGCNONE 
J065171A13CGTGTGGCNONE 
J065208N04CGTGTGGCNONE 
J075098H14CGTGTGGCNONE 
J090026G03CGTGTGGCNONE 
J100031K15CGTGTGGCNONE 
J100032K19CGTGTGGCNONE 
J100041D18CGTGTGGCNONE 
J100061K06CGTGTGGCNONE 
Os02g0187800AK071794CGTGTGGCCinnamyl alcohol dehydrogenase (EC 1.1.1.195). 
AK105011CGTGTGGCNONE 
Os02g0208100011-077-C09GCCACACGGCCCSimilar to Chloroplast ADP,ATP carrier protein 2, chloroplast precursor (ADP/ATP translocase 2) (Adenine nucleotide translocase 2). 
Os02g0302900AK110752CGTGTGGCReticulon family protein. 
Os02g0502500011-068-G11GCCACACGNONE 
AK100111GCCACACGNONE 
AK100315GCCACACGProtein kinase-like domain containing protein. 
J013074C19GCCACACGNONE 
J013153K16GCCACACGNONE 
J023078O21GCCACACGNONE 
J033127M18GCCACACGNONE 
J043038D17GCCACACGNONE 
J065090L08GCCACACGNONE 
J065110P16GCCACACGNONE 
J065163C03GCCACACGNONE 
J065213D23GCCACACGNONE 
J090010M14GCCACACGNONE 
J090016E02GCCACACGNONE 
J090044J20GCCACACGNONE 
J090091M16GCCACACGNONE 
J090099I23GCCACACGNONE 
Os02g0517700AK102148CGTGTGGCConserved hypothetical protein. 
AK107859CGTGTGGCNONE 
Os02g0610700014-008-A03GCCCACGGCCACACGNONE 
AK059205GCCCACGGCCACACGConserved hypothetical protein. 
AK100281GCCCACGGCCACACGNONE 
J023074H03GCCCACGGCCACACGNONE 
J065002J16GCCCACGGCCACACGNONE 
J065032I20GCCCACGGCCACACGNONE 
J065076A07GCCCACGGCCACACGNONE 
J065142O21GCCCACGGCCACACGNONE 
J065203A03GCCCACGGCCACACGNONE 
J075017F24GCCCACGGCCACACGNONE 
J075017G24GCCCACGGCCACACGNONE 
Os02g0686800AK071055GCCACACGProtein of unknown function DUF581 family protein. 
J090050E05GCCACACGNONE 
Os02g0705000006-069-G11GCCACACGCCCACACNONE 
006-096-C01GCCACACGCCCACACNONE 
006-099-A07GCCACACGCCCACACNONE 
AK068080GCCACACGCCCACACNmrA-like family protein. 
AK104529GCCACACGCCCACACNONE 
AK106021GCCACACGCCCACACNONE 
J013132K15GCCACACGCCCACACNONE 
Os02g0731500J065098J18GCCACACGGCCCACGGAWPM-19-like family protein. 
J065123G07GCCACACGGCCCACGGNONE 
Os02g0740500J053032K17GCCACACGNONE 
J053037O20GCCACACGNONE 
J065002N12GCCACACGNONE 
J065063M14GCCACACGNONE 
J065066O08GCCACACGNONE 
J065101A01GCCACACGNONE 
J065101L24GCCACACGConserved hypothetical protein. 
J065105E15GCCACACGNONE 
J065115C03GCCACACGNONE 
J065139L09GCCACACGNONE 
J065154E17GCCACACGNONE 
J065156I21GCCACACGNONE 
J065159A04GCCACACGNONE 
J065160E18GCCACACGNONE 
J065160F22GCCACACGNONE 
J065169B10GCCACACGNONE 
J065180C13GCCACACGNONE 
J065215H02GCCACACGNONE 
J075006C10GCCACACGNONE 
J075092M13GCCACACGNONE 
J080302F14GCCACACGNONE 
Os02g0797600004-004-A08CGTGTGGCNONE 
006-050-H07CGTGTGGCNONE 
006-092-B02CGTGTGGCNONE 
006-100-B08CGTGTGGCNONE 
013-037-D09CGTGTGGCNONE 
013-068-H02CGTGTGGCNONE 
AK060857CGTGTGGCNONE 
AK098882CGTGTGGCNONE 
AK104474CGTGTGGCNONE 
AK120644CGTGTGGCConserved hypothetical protein. 
J013001F21CGTGTGGCNONE 
J013074D07CGTGTGGCNONE 
J013096H23CGTGTGGCNONE 
J013098H07CGTGTGGCNONE 
J013132L13CGTGTGGCNONE 
J013134K05CGTGTGGCNONE 
J013155B15CGTGTGGCNONE 
J023002L17CGTGTGGCNONE 
J023013B08CGTGTGGCNONE 
J023087I01CGTGTGGCNONE 
J033071O04CGTGTGGCNONE 
J065161N23CGTGTGGCNONE 
J075055G11CGTGTGGCNONE 
J075106J02CGTGTGGCNONE 
J080009D06CGTGTGGCNONE 
J080009N22CGTGTGGCNONE 
J080016L03CGTGTGGCNONE 
J080023E17CGTGTGGCNONE 
J080027A12CGTGTGGCNONE 
J080036M24CGTGTGGCNONE 
J080038N07CGTGTGGCNONE 
J080041A04CGTGTGGCNONE 
J080042K11CGTGTGGCNONE 
J080050A04CGTGTGGCNONE 
J080053G16CGTGTGGCNONE 
J080063D03CGTGTGGCNONE 
J080063F07CGTGTGGCNONE 
J080067H13CGTGTGGCNONE 
J080068F12CGTGTGGCNONE 
J080072G17CGTGTGGCNONE 
J080072I06CGTGTGGCNONE 
J080072J24CGTGTGGCNONE 
J080076G09CGTGTGGCNONE 
J080085H10CGTGTGGCNONE 
J080092I17CGTGTGGCNONE 
J080092N20CGTGTGGCNONE 
J080093G10CGTGTGGCNONE 
J090074C23CGTGTGGCNONE 
J090083O18CGTGTGGCNONE 
J100046M05CGTGTGGCNONE 
J100050N16CGTGTGGCNONE 
J100054D07CGTGTGGCNONE 
J100054O11CGTGTGGCNONE 
J100055F04CGTGTGGCNONE 
J100055H22CGTGTGGCNONE 
J100063A05CGTGTGGCNONE 
J100063I24CGTGTGGCNONE 
J100067I12CGTGTGGCNONE 
J100074A22CGTGTGGCNONE 
J100078B22CGTGTGGCNONE 
J100079B03CGTGTGGCNONE 
Os02g0818900AK107997GCCACACGHeavy metal transport/detoxification protein domain containing protein. 
J065112M01GCCACACGNONE 
J065152N01GCCACACGNONE 
J100052D19GCCACACGNONE 
J100085M12GCCACACGNONE 
J100087A05GCCACACGNONE 
J100088H04GCCACACGNONE 
Os03g0159700012-100-B09GTGACGTGTGGCCCATACNONE 
AK063559GTGACGTGTGGCCCATACProtein prenyltransferase domain containing protein. 
J065197I24GTGACGTGTGGCCCATACNONE 
J090089G20GTGACGTGTGGCCCATACNONE 
Os03g0161200AK066932GCCACACGSimilar to Sulfate transporter 3.1 (AST12) (AtST1). 
Os03g0172200AK069130TCCGGCCCAGCCACACGArmadillo-like helical domain containing protein. 
Os03g0194900006-038-B11GCCACACGNONE 
006-048-H09GCCACACGNONE 
009-141-E07GCCACACGNONE 
013-006-A05GCCACACGNONE 
013-073-G09GCCACACGNONE 
013-093-E05GCCACACGNONE 
AK061389GCCACACGNONE 
AK070149GCCACACGDOMON related domain containing protein. 
AK104041GCCACACGNONE 
AK104413GCCACACGNONE 
J013134O16GCCACACGNONE 
J023042P18GCCACACGNONE 
J023077M08GCCACACGNONE 
J033068I01GCCACACGNONE 
J053023E18GCCACACGNONE 
J053026N22GCCACACGNONE 
J053043H12GCCACACGNONE 
J053064P12GCCACACGNONE 
J053068B02GCCACACGNONE 
J053069A07GCCACACGNONE 
J053070F13GCCACACGNONE 
J053094H07GCCACACGNONE 
J065061I03GCCACACGNONE 
J065115D02GCCACACGNONE 
J065163K24GCCACACGNONE 
J065195M16GCCACACGNONE 
J065219A21GCCACACGNONE 
J075046I11GCCACACGNONE 
J075097H16GCCACACGNONE 
J075128N20GCCACACGNONE 
J075139O20GCCACACGNONE 
J075168H20GCCACACGNONE 
J075170E15GCCACACGNONE 
J075191C04GCCACACGNONE 
J075192P06GCCACACGNONE 
J100027K07GCCACACGNONE 
J100027P03GCCACACGNONE 
J100033P16GCCACACGNONE 
J100050M24GCCACACGNONE 
J100072D05GCCACACGNONE 
Os03g0200700AK061432GCCACACGNONE 
Os03g0231700015-021-C12CGTGTGGCNONE 
AK068401CGTGTGGCNONE 
AK073426CGTGTGGCSimilar to Squalene monooxygenase 2 (EC 1.14.99.7). 
Os03g0241600AK120688CGTGTGGCNONE 
Os03g0255000AK101625GAGGCGTGTGGCFAR1 domain containing protein. 
J033052M07GAGGCGTGTGGCNONE 
Os03g0255900009-164-C12CGTGTGGCNONE 
AK063057CGTGTGGCConserved hypothetical protein. 
Os03g0295500009-083-F02CGTGTGGCNONE 
J053029J05CGTGTGGCNONE 
J053054B07CGTGTGGCCHCH domain containing protein. 
J065024G23CGTGTGGCNONE 
J065036F08CGTGTGGCNONE 
J065066M11CGTGTGGCNONE 
J065143G19CGTGTGGCNONE 
Os03g0379300006-039-F11CGTGTGGCNONE 
AK061515CGTGTGGCBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
AK068704CGTGTGGCNONE 
J013159M16CGTGTGGCNONE 
J090067F01CGTGTGGCNONE 
J090083F21CGTGTGGCNONE 
J100040M08CGTGTGGCNONE 
J100048C03CGTGTGGCNONE 
J100056M07CGTGTGGCNONE 
J100062N22CGTGTGGCNONE 
J100086L07CGTGTGGCNONE 
Os03g0418600AK122114CGTGTGGCConserved hypothetical protein. 
J033128A11CGTGTGGCNONE 
Os03g0598900J053098D07CGTGTGGCNONE 
J065063O13CGTGTGGCDSBA oxidoreductase family protein. 
Os03g0608000AK111073GCCACACGCCCACACGHypothetical protein. 
Os03g0639600AK111569CGTGTGGCSimilar to Zinc-finger protein Lsd1. 
J013071E13CGTGTGGCNONE 
J053039O11CGTGTGGCNONE 
J053048C05CGTGTGGCNONE 
J065171F11CGTGTGGCNONE 
J065188I07CGTGTGGCNONE 
J075172K20CGTGTGGCNONE 
J075199C18CGTGTGGCNONE 
Os03g0659900AK067560CGTGTGGCSimilar to S3 self-incompatibility locus-linked pollen 3.15 protein. 
J090029C14CGTGTGGCNONE 
Os03g0701700011-034-E06GGTGTGTGGGCCGTGTGGCNONE 
AF013979GGTGTGTGGGCCGTGTGGCNONE 
AK065161GGTGTGTGGGCCGTGTGGCSimilar to Ethylene receptor. 
AK067813GGTGTGTGGGCCGTGTGGCNONE 
J013002C04GGTGTGTGGGCCGTGTGGCNONE 
J013035M07GGTGTGTGGGCCGTGTGGCNONE 
J013049B10GGTGTGTGGGCCGTGTGGCNONE 
J013065F11GGTGTGTGGGCCGTGTGGCNONE 
J013072K18GGTGTGTGGGCCGTGTGGCNONE 
J013073P08GGTGTGTGGGCCGTGTGGCNONE 
J013098F08GGTGTGTGGGCCGTGTGGCNONE 
J013154M13GGTGTGTGGGCCGTGTGGCNONE 
J023001H02GGTGTGTGGGCCGTGTGGCNONE 
J023003D16GGTGTGTGGGCCGTGTGGCNONE 
J023014P17GGTGTGTGGGCCGTGTGGCNONE 
J023036A22GGTGTGTGGGCCGTGTGGCNONE 
J023038N01GGTGTGTGGGCCGTGTGGCNONE 
J023042E11GGTGTGTGGGCCGTGTGGCNONE 
J023058O05GGTGTGTGGGCCGTGTGGCNONE 
J023084D05GGTGTGTGGGCCGTGTGGCNONE 
J023088O17GGTGTGTGGGCCGTGTGGCNONE 
J023138O11GGTGTGTGGGCCGTGTGGCNONE 
J023147A10GGTGTGTGGGCCGTGTGGCNONE 
J033029G18GGTGTGTGGGCCGTGTGGCNONE 
J033031N13GGTGTGTGGGCCGTGTGGCNONE 
J033090D09GGTGTGTGGGCCGTGTGGCNONE 
J033091I06GGTGTGTGGGCCGTGTGGCNONE 
J033096B20GGTGTGTGGGCCGTGTGGCNONE 
J033101A19GGTGTGTGGGCCGTGTGGCNONE 
J033135D03GGTGTGTGGGCCGTGTGGCNONE 
J043001L13GGTGTGTGGGCCGTGTGGCNONE 
J043020A13GGTGTGTGGGCCGTGTGGCNONE 
J053071K24GGTGTGTGGGCCGTGTGGCNONE 
J053092L14GGTGTGTGGGCCGTGTGGCNONE 
J053099F19GGTGTGTGGGCCGTGTGGCNONE 
J065009P22GGTGTGTGGGCCGTGTGGCNONE 
J065046A22GGTGTGTGGGCCGTGTGGCNONE 
J065099K22GGTGTGTGGGCCGTGTGGCNONE 
J065112O22GGTGTGTGGGCCGTGTGGCNONE 
J065119K11GGTGTGTGGGCCGTGTGGCNONE 
J065212B11GGTGTGTGGGCCGTGTGGCNONE 
J090022A11GGTGTGTGGGCCGTGTGGCNONE 
J090054F15GGTGTGTGGGCCGTGTGGCNONE 
J090076B20GGTGTGTGGGCCGTGTGGCNONE 
J090099M22GGTGTGTGGGCCGTGTGGCNONE 
J100032L01GGTGTGTGGGCCGTGTGGCNONE 
J100065H13GGTGTGTGGGCCGTGTGGCNONE 
Os03g0726900AK072553CGTGTGGCConserved hypothetical protein. 
AK100280CGTGTGGCNONE 
Os03g0729000AK108046GCCACACGConserved hypothetical protein. 
Os03g0741500AK110867GCCACACGSimilar to Cytochrome P450 71A1 (EC 1.14.-.-) (CYPLXXIA1) (ARP-2). 
Os04g0306400AK103443CGTGTGGCRibose 5-phosphate isomerase family protein. 
J075058M23CGTGTGGCNONE 
J090003E11CGTGTGGCNONE 
Os04g0372700009-110-D07GCGTGGGCCCACGCCACACGACGCGTCCNONE 
AK062814GCGTGGGCCCACGCCACACGACGCGTCCSimilar to Quinone-oxidoreductase QR1 (Fragment). 
J065021E21GCGTGGGCCCACGCCACACGACGCGTCCNONE 
J065099E23GCGTGGGCCCACGCCACACGACGCGTCCNONE 
J065120F10GCGTGGGCCCACGCCACACGACGCGTCCNONE 
J065165P14GCGTGGGCCCACGCCACACGACGCGTCCNONE 
J065208L18GCGTGGGCCCACGCCACACGACGCGTCCNONE 
Os04g0447400AK070858CGTGTGGCSimilar to Glutamate decarboxylase 2 (EC 4.1.1.15) (GAD 2). 
J023002M09CGTGTGGCNONE 
J023003G16CGTGTGGCNONE 
J023006F16CGTGTGGCNONE 
J023008D10CGTGTGGCNONE 
J023010A01CGTGTGGCNONE 
J023012M16CGTGTGGCNONE 
J023023H17CGTGTGGCNONE 
J023029B12CGTGTGGCNONE 
J023030F09CGTGTGGCNONE 
J023034K03CGTGTGGCNONE 
J023045A16CGTGTGGCNONE 
J023048I04CGTGTGGCNONE 
J023056C09CGTGTGGCNONE 
J023056F05CGTGTGGCNONE 
J023058B21CGTGTGGCNONE 
J023058N06CGTGTGGCNONE 
J023059F03CGTGTGGCNONE 
J023059M19CGTGTGGCNONE 
J023060P05CGTGTGGCNONE 
J023062D07CGTGTGGCNONE 
J023063F16CGTGTGGCNONE 
J023068K15CGTGTGGCNONE 
J023069L04CGTGTGGCNONE 
J023075I24CGTGTGGCNONE 
J023086H01CGTGTGGCNONE 
J023086I24CGTGTGGCNONE 
J023091M08CGTGTGGCNONE 
J023095A07CGTGTGGCNONE 
J023110K06CGTGTGGCNONE 
J023113D07CGTGTGGCNONE 
J023126J05CGTGTGGCNONE 
J023140F04CGTGTGGCNONE 
J023141N19CGTGTGGCNONE 
Os04g0447500AK064090GCCACACGSimilar to NADPH-dependent codeinone reductase (EC 1.1.1.247). 
Os04g0466600J065051L19CGTGTGGCNONE 
J090042O12CGTGTGGCNONE 
Os04g0500700AK072528GCCACACGSimilar to Hydroxyanthranilate hydroxycinnamoyltransferase 3. 
AK104637GCCACACGNONE 
AK119237GCCACACGNONE 
Os04g0504700AK068596GCCACACGConserved hypothetical protein. 
Os04g0525000AK067753GCCACACGTCTCConserved hypothetical protein. 
J013118G14GCCACACGTCTCNONE 
J065026J15GCCACACGTCTCNONE 
J065184H21GCCACACGTCTCNONE 
J065186H22GCCACACGTCTCNONE 
J065193D20GCCACACGTCTCNONE 
J075060D12GCCACACGTCTCNONE 
J075179L24GCCACACGTCTCNONE 
Os04g0527900AK108116GCCACACGTGTCCSimilar to Tonoplast membrane integral protein ZmTIP3-2. 
J075013N09GCCACACGTGTCCNONE 
J075023I21GCCACACGTGTCCNONE 
Os04g0556300009-065-A04CGCGTGGGCCACACGNONE 
009-124-C05CGCGTGGGCCACACGNONE 
AK062772CGCGTGGGCCACACGGlutathione peroxidase. 
AY100689CGCGTGGGCCACACGNONE 
J065008N06CGCGTGGGCCACACGNONE 
J065012C13CGCGTGGGCCACACGNONE 
J065017J06CGCGTGGGCCACACGNONE 
J065033M15CGCGTGGGCCACACGNONE 
J065086O21CGCGTGGGCCACACGNONE 
J065102K04CGCGTGGGCCACACGNONE 
J065141D21CGCGTGGGCCACACGNONE 
J065159K20CGCGTGGGCCACACGNONE 
J065164C12CGCGTGGGCCACACGNONE 
J065170F10CGCGTGGGCCACACGNONE 
J065181F20CGCGTGGGCCACACGNONE 
J065205N07CGCGTGGGCCACACGNONE 
J065209N21CGCGTGGGCCACACGNONE 
J075001M12CGCGTGGGCCACACGNONE 
J075007D22CGCGTGGGCCACACGNONE 
J075026H04CGCGTGGGCCACACGNONE 
J075042O08CGCGTGGGCCACACGNONE 
J075044G20CGCGTGGGCCACACGNONE 
J075057D10CGCGTGGGCCACACGNONE 
J075096L23CGCGTGGGCCACACGNONE 
J075104K12CGCGTGGGCCACACGNONE 
J075119H14CGCGTGGGCCACACGNONE 
J075136C14CGCGTGGGCCACACGNONE 
J075172D01CGCGTGGGCCACACGNONE 
J075184M01CGCGTGGGCCACACGNONE 
J075186E06CGCGTGGGCCACACGNONE 
J075192M08CGCGTGGGCCACACGNONE 
J080006D18CGCGTGGGCCACACGNONE 
J080044G16CGCGTGGGCCACACGNONE 
J080087G15CGCGTGGGCCACACGNONE 
J100021I05CGCGTGGGCCACACGNONE 
J100039D10CGCGTGGGCCACACGNONE 
J100073B05CGCGTGGGCCACACGNONE 
J100074M12CGCGTGGGCCACACGNONE 
Os04g0645600AK100006CCCACCACCCACACGCCACACGCCCAAAAProtein of unknown function DUF6, transmembrane domain containing protein. 
J013135P10CCCACCACCCACACGCCACACGCCCAAAANONE 
Os04g0668400AK107558GCCACACGConserved hypothetical protein. 
Os05g0110800009-072-H03GCCACACGNONE 
AK067749GCCACACGConserved hypothetical protein. 
AK104935GCCACACGNONE 
J075010F03GCCACACGNONE 
J075019J08GCCACACGNONE 
J075047J02GCCACACGNONE 
J075066A14GCCACACGNONE 
J075073E12GCCACACGNONE 
J075082C17GCCACACGNONE 
J075096A22GCCACACGNONE 
J075115A12GCCACACGNONE 
J075116N01GCCACACGNONE 
J075160A12GCCACACGNONE 
Os05g0130300AK121958GCCACACGConserved hypothetical protein. 
J033107M24GCCACACGNONE 
Os05g0164100AF456329GCCACACGNONE 
AK065086GCCACACGNONE 
AK072243GCCACACGSimilar to Fructose-6-phosphate 2-kinase/fructose-2,6-bisphosphatase (EC 2.7.1.105) (EC 3.1.3.46) (Fragment). 
J013001L18GCCACACGNONE 
J013132O12GCCACACGNONE 
J023003N09GCCACACGNONE 
Os05g0312500AK069307GCCACACGReticulon family protein. 
J023075D16GCCACACGNONE 
J023097K08GCCACACGNONE 
Os05g0381400014-036-H12GCCACACGNONE 
014-085-H12GCCACACGNONE 
AK102039GCCACACGSimilar to ABA induced plasma membrane protein PM 19. 
J075011E17GCCACACGNONE 
J075057P04GCCACACGNONE 
J075066K19GCCACACGNONE 
J075068L13GCCACACGNONE 
J075074J21GCCACACGNONE 
J075076N10GCCACACGNONE 
J075078L14GCCACACGNONE 
J075099O16GCCACACGNONE 
J075120C05GCCACACGNONE 
J075140I24GCCACACGNONE 
J075148F21GCCACACGNONE 
J075151F01GCCACACGNONE 
J075151I10GCCACACGNONE 
J075156M15GCCACACGNONE 
J075191F07GCCACACGNONE 
J075192K20GCCACACGNONE 
J075195M22GCCACACGNONE 
Os05g0404500AK103780CGTGTGGCHypothetical protein. 
Os05g0455500AK101985CGTGTGGCNONE 
AK102633CGTGTGGCDelta 1-pyrroline-5-carboxylate synthetase (P5CS) [Includes: Glutamate 5-kinase (EC 2.7.2.11) (Gamma-glutamyl kinase) (GK); Gamma-glutamyl phosphate reductase (GPR) (EC 1.2.1.41) (Glutamate-5-semialdehyde dehydrogenase) (Glutamyl-gamma-semialdehyde dehydrogenase)]. 
AY574031CGTGTGGCNONE 
D49714CGTGTGGCNONE 
J013002F07CGTGTGGCNONE 
J033085C02CGTGTGGCNONE 
Os05g0456000AK058420GCGTGGGCGTGTGGCCCAAAAMitochondrial glycoprotein family protein. 
AK102036GCGTGGGCGTGTGGCCCAAAANONE 
J065066F02GCGTGGGCGTGTGGCCCAAAANONE 
Os05g0506000AF031609CGTGTGGCCCATCGNONE 
AK062012CGTGTGGCCCATCGNONE 
AK098900CGTGTGGCCCATCGNONE 
AK122090CGTGTGGCCCATCGSimilar to MS5-like protein (Fragment). 
J013002B13CGTGTGGCCCATCGNONE 
J023149G13CGTGTGGCCCATCGNONE 
J033123O20CGTGTGGCCCATCGNONE 
J080315O17CGTGTGGCCCATCGNONE 
Os05g0509500AB115419GCGTGGGCGTGTGGCNONE 
AK068958GCGTGGGCGTGTGGCSimilar to Signal recognition particle 54 kDa protein 2 (SRP54). 
Os05g0555300009-032-C03CGTGTGGCGCGCGAGNONE 
009-125-E08CGTGTGGCGCGCGAGNONE 
009-149-C12CGTGTGGCGCGCGAGNONE 
009-172-C01CGTGTGGCGCGCGAGNONE 
AK062890CGTGTGGCGCGCGAGFerredoxin domain containing protein. 
AK062997CGTGTGGCGCGCGAGNONE 
Os06g0141600006-035-C07CAACGGCCACACGNONE 
AK059772CAACGGCCACACGEarly nodulin 93 ENOD93 protein family protein. 
J075028K13CAACGGCCACACGNONE 
J075070B17CAACGGCCACACGNONE 
J075075G08CAACGGCCACACGNONE 
J075081B21CAACGGCCACACGNONE 
J075116B04CAACGGCCACACGNONE 
J075133E10CAACGGCCACACGNONE 
J075144I23CAACGGCCACACGNONE 
J075147G16CAACGGCCACACGNONE 
J075151E04CAACGGCCACACGNONE 
J075162E07CAACGGCCACACGNONE 
J075163P14CAACGGCCACACGNONE 
J075182C07CAACGGCCACACGNONE 
J075196O22CAACGGCCACACGNONE 
J100086C12CAACGGCCACACGNONE 
Os06g0142200AB018376CAACGGCCACACGEarly nodulin. 
AK105832CAACGGCCACACGNONE 
AK122162CAACGGCCACACGNONE 
J033057P14CAACGGCCACACGNONE 
J033147G13CAACGGCCACACGNONE 
J043012H17CAACGGCCACACGNONE 
J065065E18CAACGGCCACACGNONE 
J065099L01CAACGGCCACACGNONE 
J065119D03CAACGGCCACACGNONE 
J065134O21CAACGGCCACACGNONE 
J065160G17CAACGGCCACACGNONE 
J065201C04CAACGGCCACACGNONE 
J090056D21CAACGGCCACACGNONE 
Os06g0226600006-083-D04GCCACACGNONE 
AK061806GCCACACGNONE 
AK102752GCCACACGTB2/DP1 and HVA22 related protein family protein. 
J013089J11GCCACACGNONE 
J033106M05GCCACACGNONE 
J100044M21GCCACACGNONE 
J100056E06GCCACACGNONE 
J100059F06GCCACACGNONE 
Os06g0264300AK061556GCCACACGNONE 
AK073271GCCACACGSimilar to RAD23, isoform I. 
Os06g0282000J100029K16GCCACACGNONE 
J100090N09GCCACACGUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
Os06g0332400AK058294CGTGTGGCGTGNONE 
AK101738CGTGTGGCGTGVHS domain containing protein. 
J013119B12CGTGTGGCGTGNONE 
J013132G17CGTGTGGCGTGNONE 
J023034E06CGTGTGGCGTGNONE 
J023039I05CGTGTGGCGTGNONE 
J033024E14CGTGTGGCGTGNONE 
J033039N04CGTGTGGCGTGNONE 
J033048P16CGTGTGGCGTGNONE 
J033069F24CGTGTGGCGTGNONE 
J033071D15CGTGTGGCGTGNONE 
J033106D01CGTGTGGCGTGNONE 
J033106D09CGTGTGGCGTGNONE 
J033106F09CGTGTGGCGTGNONE 
J033107K03CGTGTGGCGTGNONE 
J033129G10CGTGTGGCGTGNONE 
J065016B15CGTGTGGCGTGNONE 
J065022H07CGTGTGGCGTGNONE 
J065048E07CGTGTGGCGTGNONE 
J065068B11CGTGTGGCGTGNONE 
J065157C13CGTGTGGCGTGNONE 
J100042J02CGTGTGGCGTGNONE 
Os06g0343900AK070940CCACGGCCACACGCCTCAGCCCAACTConserved hypothetical protein. 
Os06g0559000AK109653GCCACACGConserved hypothetical protein. 
Os06g0583900AK072583CGTGTGGCSimilar to Pectate lyase homolog (EC 4.2.2.2) (Fragment). 
Os06g0608300AK102908GCCACACGSimilar to Small nuclear ribonucleoprotein component. 
Os06g0690700AK100055GCCACACGSimilar to Potential cadmium/zinc-transporting ATPase HMA1 (EC 3.6.3.3) (EC 3.6.3.5). 
Os07g0107900011-004-F03GCCACACGNONE 
011-089-F01GCCACACGNONE 
AK073520GCCACACGNONE 
AK073651GCCACACGConserved hypothetical protein. 
J013118M08GCCACACGNONE 
J033042E18GCCACACGNONE 
J033066E10GCCACACGNONE 
J080303I24GCCACACGNONE 
J080316O19GCCACACGNONE 
J090019H13GCCACACGNONE 
Os07g0133500015-010-H05GCCACACGNONE 
AB110179GCCACACGNONE 
AK106244GCCACACGProtein of unknown function DUF1005 family protein. 
J090075I21GCCACACGNONE 
Os07g0142000AK059877CGTGTGGCReticulon family protein. 
AK099414CGTGTGGCNONE 
Os07g0242000AK107347CGTGTGGCConserved hypothetical protein. 
Os07g0472300AK070792GCCACACGConserved hypothetical protein. 
J023007O06GCCACACGNONE 
J023041I11GCCACACGNONE 
J023065F23GCCACACGNONE 
Os07g0552800AF435651CGTGTGGCNONE 
AK066835CGTGTGGCNONE 
J023009K24CGTGTGGCNONE 
J023050L14CGTGTGGCNONE 
J023092I02CGTGTGGCNONE 
J023100P04CGTGTGGCNONE 
J023112O13CGTGTGGCNONE 
J023121J20CGTGTGGCNONE 
Os07g0556200006-026-F07GTGTGGGGGCGTGGGCGTGTGGCNONE 
006-042-H11GTGTGGGGGCGTGGGCGTGTGGCNONE 
006-048-D01GTGTGGGGGCGTGGGCGTGTGGCNONE 
006-051-E02GTGTGGGGGCGTGGGCGTGTGGCNONE 
006-061-E07GTGTGGGGGCGTGGGCGTGTGGCNONE 
006-075-H06GTGTGGGGGCGTGGGCGTGTGGCNONE 
006-110-E10GTGTGGGGGCGTGGGCGTGTGGCNONE 
006-112-C09GTGTGGGGGCGTGGGCGTGTGGCNONE 
006-116-E10GTGTGGGGGCGTGGGCGTGTGGCNONE 
AF093631GTGTGGGGGCGTGGGCGTGTGGCNONE 
AK071634GTGTGGGGGCGTGGGCGTGTGGCRieske iron-sulfur protein family protein. 
J013022H19GTGTGGGGGCGTGGGCGTGTGGCNONE 
J013057E06GTGTGGGGGCGTGGGCGTGTGGCNONE 
J013151C13GTGTGGGGGCGTGGGCGTGTGGCNONE 
J023080E08GTGTGGGGGCGTGGGCGTGTGGCNONE 
J023100K03GTGTGGGGGCGTGGGCGTGTGGCNONE 
J023105H15GTGTGGGGGCGTGGGCGTGTGGCNONE 
J023114I15GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065002C09GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065037K17GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065038K18GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065039D16GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065040D18GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065042O04GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065046J20GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065046L02GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065046L03GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065053H02GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065063A22GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065066C08GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065077J23GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065081N04GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065085O08GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065087H09GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065093M05GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065094C01GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065102I04GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065103C05GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065104O06GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065108H03GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065121I10GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065123E14GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065128E14GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065129G16GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065131I07GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065135F13GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065137K23GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065143A11GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065143I04GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065154N18GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065170L23GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065179D21GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065180C18GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065190F03GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065205C02GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065208A12GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065209B05GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065211C03GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065212L24GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065216I06GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065217O06GTGTGGGGGCGTGGGCGTGTGGCNONE 
J065218A02GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075007M16GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075013H23GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075013O14GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075015K10GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075022G20GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075023H23GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075037I08GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075038C06GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075042B14GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075063D13GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075064O11GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075067D07GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075071G15GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075072F15GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075073D09GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075083M23GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075084J12GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075088I06GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075089C10GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075093K09GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075095P15GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075098P08GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075103A15GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075108G23GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075116G03GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075118O21GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075127H14GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075129H07GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075138J20GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075142F12GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075143F18GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075143L11GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075145N09GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075146N05GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075147P21GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075154C18GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075154N24GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075155D22GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075159C14GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075161E14GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075168K20GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075170E13GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075170M24GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075175E08GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075176C15GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075176H16GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075177M01GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075178F18GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075179C03GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075179E16GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075183D09GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075188O16GTGTGGGGGCGTGGGCGTGTGGCNONE 
J075193J05GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080001M22GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080013N04GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080031E11GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080034E09GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080034L17GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080037F06GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080038M04GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080040F10GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080042P19GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080045B11GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080048E07GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080048I09GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080050J17GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080051G02GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080062E19GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080063E12GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080079A22GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080079C15GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080080D08GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080096L22GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080302E06GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080302G12GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080303B02GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080303M06GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080304I06GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080306N10GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080308D09GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080308J23GTGTGGGGGCGTGGGCGTGTGGCNONE 
J080317I16GTGTGGGGGCGTGGGCGTGTGGCNONE 
J100038H16GTGTGGGGGCGTGGGCGTGTGGCNONE 
J100043C14GTGTGGGGGCGTGGGCGTGTGGCNONE 
J100045N09GTGTGGGGGCGTGGGCGTGTGGCNONE 
J100073D03GTGTGGGGGCGTGGGCGTGTGGCNONE 
Os07g0595700003-103-G05CGATGGGCCACACGNONE 
AK108488CGATGGGCCACACGConserved hypothetical protein. 
J065136O05CGATGGGCCACACGNONE 
Os07g0595800011-069-G09CGTGTGGCCCATCGNONE 
AK066349CGTGTGGCCCATCGPrefoldin related, ubiquitously expressed transcript family protein. 
J013062C05CGTGTGGCCCATCGNONE 
Os07g0642600AK121167GCCACACGRNA polymerase II transcription factor SIII subunit A family protein. 
J023080K05GCCACACGNONE 
J065022A04GCCACACGNONE 
J065041H24GCCACACGNONE 
J065042J11GCCACACGNONE 
J065044I23GCCACACGNONE 
J065045I17GCCACACGNONE 
J065047L18GCCACACGNONE 
J065121E21GCCACACGNONE 
J065134B21GCCACACGNONE 
J065180K16GCCACACGNONE 
J065197G19GCCACACGNONE 
J090083H01GCCACACGNONE 
J100085L12GCCACACGNONE 
Os07g0648000AK111216GCCACACGArmadillo-like helical domain containing protein. 
Os07g0676900AK072862CGTGTGGCSimilar to Peroxidase (EC 1.11.1.7). 
J023143D07CGTGTGGCNONE 
J100048I19CGTGTGGCNONE 
J100057J04CGTGTGGCNONE 
Os07g0693100AB111050GCCACACGNONE 
AK100433GCCACACGSimilar to Pyruvate decarboxylase isozyme 3 (EC 4.1.1.1) (PDC). 
J023054O07GCCACACGNONE 
J023088C24GCCACACGNONE 
J023088I11GCCACACGNONE 
Os08g0135900AK072535GCCACACGSimilar to Tryptophan synthase beta chain 1 (EC 4.2.1.20) (Orange pericarp 1) (Fragment). 
Os08g0260600AK108529TCCACGCCCACACGCCACACGCD9/CD37/CD63 antigen family protein. 
Os08g0270900AK108117GCCACACGConserved hypothetical protein. 
Os08g0420800AK109317CGTGTGGCConserved hypothetical protein. 
Os08g0425700AK059408CGTGTGGCSimilar to Annexin-like protein. 
AK104119CGTGTGGCNONE 
J065063J06CGTGTGGCNONE 
Os08g0441500006-053-D04GCCACACGCGGTGCGNONE 
006-120-F03GCCACACGCGGTGCGNONE 
AK072872GCCACACGCGGTGCGSimilar to Cinnamoyl-CoA reductase. 
AK102061GCCACACGCGGTGCGNONE 
AK105802GCCACACGCGGTGCGNONE 
AK105870GCCACACGCGGTGCGNONE 
J023108K19GCCACACGCGGTGCGNONE 
J023143B20GCCACACGCGGTGCGNONE 
J033119I24GCCACACGCGGTGCGNONE 
J043029L11GCCACACGCGGTGCGNONE 
J065045L03GCCACACGCGGTGCGNONE 
J065077B13GCCACACGCGGTGCGNONE 
J065213C08GCCACACGCGGTGCGNONE 
J075004B13GCCACACGCGGTGCGNONE 
J075009D18GCCACACGCGGTGCGNONE 
J075028F01GCCACACGCGGTGCGNONE 
J075028F02GCCACACGCGGTGCGNONE 
J075061I19GCCACACGCGGTGCGNONE 
J075129B20GCCACACGCGGTGCGNONE 
J075129I17GCCACACGCGGTGCGNONE 
J075157E11GCCACACGCGGTGCGNONE 
J080005B20GCCACACGCGGTGCGNONE 
J080010G02GCCACACGCGGTGCGNONE 
J080012F23GCCACACGCGGTGCGNONE 
J080013H17GCCACACGCGGTGCGNONE 
J080013O09GCCACACGCGGTGCGNONE 
J080016J07GCCACACGCGGTGCGNONE 
J080016J11GCCACACGCGGTGCGNONE 
J080017C17GCCACACGCGGTGCGNONE 
J080024D05GCCACACGCGGTGCGNONE 
J080024D23GCCACACGCGGTGCGNONE 
J080024N24GCCACACGCGGTGCGNONE 
J080025J02GCCACACGCGGTGCGNONE 
J080025M18GCCACACGCGGTGCGNONE 
J080026G22GCCACACGCGGTGCGNONE 
J080038O03GCCACACGCGGTGCGNONE 
J080039A12GCCACACGCGGTGCGNONE 
J080040A10GCCACACGCGGTGCGNONE 
J080040B19GCCACACGCGGTGCGNONE 
J080044L12GCCACACGCGGTGCGNONE 
J080045L03GCCACACGCGGTGCGNONE 
J080046E07GCCACACGCGGTGCGNONE 
J080048I23GCCACACGCGGTGCGNONE 
J080050D21GCCACACGCGGTGCGNONE 
J080051F06GCCACACGCGGTGCGNONE 
J080051O07GCCACACGCGGTGCGNONE 
J080053H15GCCACACGCGGTGCGNONE 
J080054G19GCCACACGCGGTGCGNONE 
J080055G12GCCACACGCGGTGCGNONE 
J080055M14GCCACACGCGGTGCGNONE 
J080057A07GCCACACGCGGTGCGNONE 
J080060F15GCCACACGCGGTGCGNONE 
J080060I09GCCACACGCGGTGCGNONE 
J080060L20GCCACACGCGGTGCGNONE 
J080061G05GCCACACGCGGTGCGNONE 
J080066C16GCCACACGCGGTGCGNONE 
J080067E20GCCACACGCGGTGCGNONE 
J080068F18GCCACACGCGGTGCGNONE 
J080069D21GCCACACGCGGTGCGNONE 
J080079D15GCCACACGCGGTGCGNONE 
J080079M07GCCACACGCGGTGCGNONE 
J080080D24GCCACACGCGGTGCGNONE 
J080080P21GCCACACGCGGTGCGNONE 
J080084G21GCCACACGCGGTGCGNONE 
J080084L07GCCACACGCGGTGCGNONE 
J080089L22GCCACACGCGGTGCGNONE 
J080090P15GCCACACGCGGTGCGNONE 
J080091G06GCCACACGCGGTGCGNONE 
J080092H02GCCACACGCGGTGCGNONE 
J080092O09GCCACACGCGGTGCGNONE 
J080093D01GCCACACGCGGTGCGNONE 
J090082D09GCCACACGCGGTGCGNONE 
J100040B01GCCACACGCGGTGCGNONE 
J100067F14GCCACACGCGGTGCGNONE 
Os08g0517300AK069175GCCACACGZinc finger, C2H2-type domain containing protein. 
Os09g0319800AK066759CGTGTGGCTerpenoid cylases/protein prenyltransferase alpha-alpha toroid domain containing protein. 
Os09g0370300AK108199GCCACACGTGTCCGCGACGCSimilar to Iron sulfur subunit of succinate dehydrogenase (Truncated) and ribosomal protein S14 precursor. 
Os09g0424600AK073882GCCACACGHAD superfamily (subfamily IG) hydrolase, 5'-Nucleotidase protein. 
Os09g0434600AK069042CGTGTGGCConserved hypothetical protein. 
AK071264CGTGTGGCNONE 
J023079H14CGTGTGGCNONE 
J023082P06CGTGTGGCNONE 
J023083M07CGTGTGGCNONE 
J023089M10CGTGTGGCNONE 
J023145P18CGTGTGGCNONE 
Os09g0456800006-028-A04GCCACACGNONE 
AK061433GCCACACGSimilar to Heat stress transcription factor Spl7 (Heat shock transcription factor) (Heat shock factor RHSF10). 
AK101182GCCACACGNONE 
J033029F08GCCACACGNONE 
J065006I18GCCACACGNONE 
J065078A03GCCACACGNONE 
J065079C11GCCACACGNONE 
J065088F02GCCACACGNONE 
J065105N17GCCACACGNONE 
J100044B07GCCACACGNONE 
J100047C02GCCACACGNONE 
Os09g0505300AK061352GCCACACGSimilar to Br FatA1. 
Os09g0521400AK063755CGTGTGGCGCCCACGANONE 
AK101064CGTGTGGCGCCCACGASimilar to HMG-CoA synthase. 
J013109J08CGTGTGGCGCCCACGANONE 
J023133K23CGTGTGGCGCCCACGANONE 
J033044M22CGTGTGGCGCCCACGANONE 
J033068D15CGTGTGGCGCCCACGANONE 
J043027C06CGTGTGGCGCCCACGANONE 
J065094O16CGTGTGGCGCCCACGANONE 
Os09g0525900006-115-E04GCCACACGNONE 
AK059988GCCACACGRhomboid-like protein family protein. 
AK071290GCCACACGNONE 
J013153K05GCCACACGNONE 
J023087M04GCCACACGNONE 
J065165B13GCCACACGNONE 
J075013G15GCCACACGNONE 
J075028A09GCCACACGNONE 
J075031I06GCCACACGNONE 
J075051C21GCCACACGNONE 
J075114H22GCCACACGNONE 
J075129A19GCCACACGNONE 
J075129M12GCCACACGNONE 
J075166N24GCCACACGNONE 
J075167M23GCCACACGNONE 
J075168D10GCCACACGNONE 
Os09g0547200016-021-H03GTCCGTCCGTGTGGCNONE 
AK073078GTCCGTCCGTGTGGCProtein of unknown function DUF292, eukaryotic domain containing protein. 
AK104984GTCCGTCCGTGTGGCNONE 
J065005L05GTCCGTCCGTGTGGCNONE 
J065039C06GTCCGTCCGTGTGGCNONE 
J065116H17GTCCGTCCGTGTGGCNONE 
J100046A17GTCCGTCCGTGTGGCNONE 
Os09g0553200003-101-F12GCCACACGNONE 
003-125-E09GCCACACGNONE 
011-031-H12GCCACACGNONE 
012-033-A01GCCACACGNONE 
015-046-H04GCCACACGNONE 
015-056-F04GCCACACGNONE 
016-029-H06GCCACACGNONE 
016-080-D05GCCACACGNONE 
AB062606GCCACACGNONE 
AK065780GCCACACGSimilar to UTP--glucose-1-phosphate uridylyltransferase (EC 2.7.7.9) (UDP-glucose pyrophosphorylase) (UDPGP) (UGPase). 
AK103930GCCACACGNONE 
AK104344GCCACACGNONE 
AK119197GCCACACGNONE 
AK119232GCCACACGNONE 
J013039M01GCCACACGNONE 
J013043M01GCCACACGNONE 
J013064F03GCCACACGNONE 
J013066K19GCCACACGNONE 
J013092G12GCCACACGNONE 
J013123P09GCCACACGNONE 
J013155F01GCCACACGNONE 
J013158J12GCCACACGNONE 
J013159H14GCCACACGNONE 
J013169C10GCCACACGNONE 
J013170L23GCCACACGNONE 
J023010J18GCCACACGNONE 
J023019E23GCCACACGNONE 
J023045B14GCCACACGNONE 
J023082K24GCCACACGNONE 
J023086G04GCCACACGNONE 
J023090N09GCCACACGNONE 
J023113C08GCCACACGNONE 
J023125H18GCCACACGNONE 
J033034M08GCCACACGNONE 
J033035K03GCCACACGNONE 
J033039D15GCCACACGNONE 
J033045P18GCCACACGNONE 
J033058P08GCCACACGNONE 
J033061D16GCCACACGNONE 
J033070F14GCCACACGNONE 
J033086F23GCCACACGNONE 
J033095C05GCCACACGNONE 
J033114H22GCCACACGNONE 
J033133M20GCCACACGNONE 
J043026G01GCCACACGNONE 
J043037F17GCCACACGNONE 
J065120K17GCCACACGNONE 
J065123O07GCCACACGNONE 
J080305H06GCCACACGNONE 
J090001F11GCCACACGNONE 
J090020C17GCCACACGNONE 
J090043A19GCCACACGNONE 
J090051J17GCCACACGNONE 
J090068K06GCCACACGNONE 
J090075P19GCCACACGNONE 
J100036G10GCCACACGNONE 
J100084F02GCCACACGNONE 
Os11g0106700006-055-F11CCACGTGTGGCCCATCCNONE 
006-099-D08CCACGTGTGGCCCATCCNONE 
009-155-A12CCACGTGTGGCCCATCCNONE 
AF519570CCACGTGTGGCCCATCCNONE 
AK059354CCACGTGTGGCCCATCCSimilar to Ferritin 1, chloroplast precursor (EC 1.16.3.1) (ZmFer1). 
Os11g0544600AK064128CGTGTGGCConserved hypothetical protein. 
J075118L07CGTGTGGCNONE 
Os11g0549665006-027-H01GCCACACGGCCCAAGTAGGCCCAGGNONE 
006-083-C01GCCACACGGCCCAAGTAGGCCCAGGNONE 
AK072644GCCACACGGCCCAAGTAGGCCCAGGNONE 
AK101587GCCACACGGCCCAAGTAGGCCCAGGConserved hypothetical protein. 
AK106162GCCACACGGCCCAAGTAGGCCCAGGNONE 
J013051C18GCCACACGGCCCAAGTAGGCCCAGGNONE 
J013067E02GCCACACGGCCCAAGTAGGCCCAGGNONE 
J013169N16GCCACACGGCCCAAGTAGGCCCAGGNONE 
J023049M16GCCACACGGCCCAAGTAGGCCCAGGNONE 
J023050I19GCCACACGGCCCAAGTAGGCCCAGGNONE 
J023063H21GCCACACGGCCCAAGTAGGCCCAGGNONE 
J023063K01GCCACACGGCCCAAGTAGGCCCAGGNONE 
J023108O17GCCACACGGCCCAAGTAGGCCCAGGNONE 
J023115H08GCCACACGGCCCAAGTAGGCCCAGGNONE 
J023117O16GCCACACGGCCCAAGTAGGCCCAGGNONE 
J023129J01GCCACACGGCCCAAGTAGGCCCAGGNONE 
J023133I23GCCACACGGCCCAAGTAGGCCCAGGNONE 
J023143P10GCCACACGGCCCAAGTAGGCCCAGGNONE 
J033045J08GCCACACGGCCCAAGTAGGCCCAGGNONE 
J033050I15GCCACACGGCCCAAGTAGGCCCAGGNONE 
J033051A04GCCACACGGCCCAAGTAGGCCCAGGNONE 
J033060C24GCCACACGGCCCAAGTAGGCCCAGGNONE 
J033069L21GCCACACGGCCCAAGTAGGCCCAGGNONE 
J033103H04GCCACACGGCCCAAGTAGGCCCAGGNONE 
J033112L21GCCACACGGCCCAAGTAGGCCCAGGNONE 
J033118O16GCCACACGGCCCAAGTAGGCCCAGGNONE 
J033126B10GCCACACGGCCCAAGTAGGCCCAGGNONE 
J033133P10GCCACACGGCCCAAGTAGGCCCAGGNONE 
J033144H19GCCACACGGCCCAAGTAGGCCCAGGNONE 
J033145H19GCCACACGGCCCAAGTAGGCCCAGGNONE 
J043029L04GCCACACGGCCCAAGTAGGCCCAGGNONE 
J075066N17GCCACACGGCCCAAGTAGGCCCAGGNONE 
J075150D02GCCACACGGCCCAAGTAGGCCCAGGNONE 
J075158D05GCCACACGGCCCAAGTAGGCCCAGGNONE 
J090009I10GCCACACGGCCCAAGTAGGCCCAGGNONE 
J090048D05GCCACACGGCCCAAGTAGGCCCAGGNONE 
J090085E02GCCACACGGCCCAAGTAGGCCCAGGNONE 
J090085H13GCCACACGGCCCAAGTAGGCCCAGGNONE 
J100029L21GCCACACGGCCCAAGTAGGCCCAGGNONE 
J100041M06GCCACACGGCCCAAGTAGGCCCAGGNONE 
J100045B04GCCACACGGCCCAAGTAGGCCCAGGNONE 
J100077C04GCCACACGGCCCAAGTAGGCCCAGGNONE 
Os11g0707000003-106-C01CGTGTGGCNONE 
003-130-G06CGTGTGGCNONE 
005-012-E05CGTGTGGCNONE 
006-021-F04CGTGTGGCNONE 
006-031-E07CGTGTGGCNONE 
006-035-C03CGTGTGGCNONE 
006-038-D10CGTGTGGCNONE 
006-043-A10CGTGTGGCNONE 
006-043-G08CGTGTGGCNONE 
006-046-C03CGTGTGGCNONE 
006-055-G09CGTGTGGCNONE 
006-085-A03CGTGTGGCNONE 
006-118-E05CGTGTGGCNONE 
AB034698CGTGTGGCNONE 
AB034748CGTGTGGCNONE 
AB110180CGTGTGGCNONE 
AK060841CGTGTGGCNONE 
AK060847CGTGTGGCNONE 
AK064986CGTGTGGCNONE 
AK104332CGTGTGGCSimilar to Ribulose-bisphosphate carboxylase activase (EC 6.3.4.-) (Fragments). 
AK119513CGTGTGGCNONE 
J013001C24CGTGTGGCNONE 
J013024I02CGTGTGGCNONE 
J013044O11CGTGTGGCNONE 
J013048O10CGTGTGGCNONE 
J013051A08CGTGTGGCNONE 
J013055H23CGTGTGGCNONE 
J013070N15CGTGTGGCNONE 
J013074C16CGTGTGGCNONE 
J013096P16CGTGTGGCNONE 
J013109A14CGTGTGGCNONE 
J013112C07CGTGTGGCNONE 
J013112N16CGTGTGGCNONE 
J013123B03CGTGTGGCNONE 
J013128G01CGTGTGGCNONE 
J013132L17CGTGTGGCNONE 
J013158I17CGTGTGGCNONE 
J013159L01CGTGTGGCNONE 
J023001H04CGTGTGGCNONE 
J023004L05CGTGTGGCNONE 
J023013G12CGTGTGGCNONE 
J023020K06CGTGTGGCNONE 
J023031J19CGTGTGGCNONE 
J023034A05CGTGTGGCNONE 
J023034E21CGTGTGGCNONE 
J023041M12CGTGTGGCNONE 
J023041P06CGTGTGGCNONE 
J023044C04CGTGTGGCNONE 
J023047H01CGTGTGGCNONE 
J023048D08CGTGTGGCNONE 
J023052H08CGTGTGGCNONE 
J023054D24CGTGTGGCNONE 
J023063G11CGTGTGGCNONE 
J023068O21CGTGTGGCNONE 
J023074C13CGTGTGGCNONE 
J023078O06CGTGTGGCNONE 
J023089K10CGTGTGGCNONE 
J023100O05CGTGTGGCNONE 
J023107N16CGTGTGGCNONE 
J023120L08CGTGTGGCNONE 
J023123N23CGTGTGGCNONE 
J023127M10CGTGTGGCNONE 
J023128C22CGTGTGGCNONE 
J023129C04CGTGTGGCNONE 
J023146H08CGTGTGGCNONE 
J053063N05CGTGTGGCNONE 
J053066F02CGTGTGGCNONE 
J053066N18CGTGTGGCNONE 
J053076G01CGTGTGGCNONE 
J065012O05CGTGTGGCNONE 
J065035L06CGTGTGGCNONE 
J065037M01CGTGTGGCNONE 
J065045N23CGTGTGGCNONE 
J065058F09CGTGTGGCNONE 
J065072E14CGTGTGGCNONE 
J065073I20CGTGTGGCNONE 
J065076B05CGTGTGGCNONE 
J065093B09CGTGTGGCNONE 
J065117A22CGTGTGGCNONE 
J065149J21CGTGTGGCNONE 
J065155M04CGTGTGGCNONE 
J065161J21CGTGTGGCNONE 
J065163H19CGTGTGGCNONE 
J065192A15CGTGTGGCNONE 
J065211L18CGTGTGGCNONE 
J075001K13CGTGTGGCNONE 
J075002J24CGTGTGGCNONE 
J075004N18CGTGTGGCNONE 
J075025H21CGTGTGGCNONE 
J075028F20CGTGTGGCNONE 
J075039F23CGTGTGGCNONE 
J075043M08CGTGTGGCNONE 
J075057D02CGTGTGGCNONE 
J075059I01CGTGTGGCNONE 
J075069P10CGTGTGGCNONE 
J075073D08CGTGTGGCNONE 
J075084I17CGTGTGGCNONE 
J075089I04CGTGTGGCNONE 
J075093O18CGTGTGGCNONE 
J075097N13CGTGTGGCNONE 
J075114B02CGTGTGGCNONE 
J075123E10CGTGTGGCNONE 
J075128C19CGTGTGGCNONE 
J075135F05CGTGTGGCNONE 
J075136A04CGTGTGGCNONE 
J075141B05CGTGTGGCNONE 
J075169H18CGTGTGGCNONE 
J075183L14CGTGTGGCNONE 
J075191N03CGTGTGGCNONE 
J080001C11CGTGTGGCNONE 
J080004F18CGTGTGGCNONE 
J080004H21CGTGTGGCNONE 
J080004O09CGTGTGGCNONE 
J080005J02CGTGTGGCNONE 
J080006I03CGTGTGGCNONE 
J080006J17CGTGTGGCNONE 
J080009I09CGTGTGGCNONE 
J080010I06CGTGTGGCNONE 
J080011A17CGTGTGGCNONE 
J080014N22CGTGTGGCNONE 
J080016E24CGTGTGGCNONE 
J080016P08CGTGTGGCNONE 
J080017G22CGTGTGGCNONE 
J080017P09CGTGTGGCNONE 
J080018D23CGTGTGGCNONE 
J080018E15CGTGTGGCNONE 
J080020K04CGTGTGGCNONE 
J080024P09CGTGTGGCNONE 
J080025G15CGTGTGGCNONE 
J080025N11CGTGTGGCNONE 
J080026H10CGTGTGGCNONE 
J080026N06CGTGTGGCNONE 
J080027C07CGTGTGGCNONE 
J080027M21CGTGTGGCNONE 
J080028I03CGTGTGGCNONE 
J080028K11CGTGTGGCNONE 
J080029B19CGTGTGGCNONE 
J080029G14CGTGTGGCNONE 
J080029G20CGTGTGGCNONE 
J080030A16CGTGTGGCNONE 
J080031C05CGTGTGGCNONE 
J080033M16CGTGTGGCNONE 
J080034C24CGTGTGGCNONE 
J080034F11CGTGTGGCNONE 
J080036B03CGTGTGGCNONE 
J080036C14CGTGTGGCNONE 
J080037C01CGTGTGGCNONE 
J080038M20CGTGTGGCNONE 
J080039K03CGTGTGGCNONE 
J080040M24CGTGTGGCNONE 
J080040P19CGTGTGGCNONE 
J080042L24CGTGTGGCNONE 
J080042O06CGTGTGGCNONE 
J080043A22CGTGTGGCNONE 
J080043N19CGTGTGGCNONE 
J080044A18CGTGTGGCNONE 
J080044P14CGTGTGGCNONE 
J080045K12CGTGTGGCNONE 
J080045N16CGTGTGGCNONE 
J080047A16CGTGTGGCNONE 
J080047B09CGTGTGGCNONE 
J080047E08CGTGTGGCNONE 
J080047G06CGTGTGGCNONE 
J080048H04CGTGTGGCNONE 
J080049B17CGTGTGGCNONE 
J080049D05CGTGTGGCNONE 
J080049G23CGTGTGGCNONE 
J080050D03CGTGTGGCNONE 
J080050J24CGTGTGGCNONE 
J080050O20CGTGTGGCNONE 
J080052E24CGTGTGGCNONE 
J080052K11CGTGTGGCNONE 
J080053B04CGTGTGGCNONE 
J080053D20CGTGTGGCNONE 
J080053E16CGTGTGGCNONE 
J080054H20CGTGTGGCNONE 
J080054H22CGTGTGGCNONE 
J080054N24CGTGTGGCNONE 
J080055H08CGTGTGGCNONE 
J080056H08CGTGTGGCNONE 
J080056H12CGTGTGGCNONE 
J080057N11CGTGTGGCNONE 
J080058D08CGTGTGGCNONE 
J080058D21CGTGTGGCNONE 
J080058E10CGTGTGGCNONE 
J080060J10CGTGTGGCNONE 
J080061O04CGTGTGGCNONE 
J080065M18CGTGTGGCNONE 
J080066D15CGTGTGGCNONE 
J080067E22CGTGTGGCNONE 
J080067N20CGTGTGGCNONE 
J080068F02CGTGTGGCNONE 
J080069G20CGTGTGGCNONE 
J080069O13CGTGTGGCNONE 
J080070I20CGTGTGGCNONE 
J080071H11CGTGTGGCNONE 
J080071H17CGTGTGGCNONE 
J080071O18CGTGTGGCNONE 
J080077G14CGTGTGGCNONE 
J080077H17CGTGTGGCNONE 
J080078B18CGTGTGGCNONE 
J080078D24CGTGTGGCNONE 
J080079H02CGTGTGGCNONE 
J080079J02CGTGTGGCNONE 
J080081O20CGTGTGGCNONE 
J080082E02CGTGTGGCNONE 
J080082N12CGTGTGGCNONE 
J080084E18CGTGTGGCNONE 
J080085P08CGTGTGGCNONE 
J080086B21CGTGTGGCNONE 
J080086L10CGTGTGGCNONE 
J080086L18CGTGTGGCNONE 
J080087D12CGTGTGGCNONE 
J080087E24CGTGTGGCNONE 
J080087G12CGTGTGGCNONE 
J080088J22CGTGTGGCNONE 
J080090C18CGTGTGGCNONE 
J080090L02CGTGTGGCNONE 
J080092N05CGTGTGGCNONE 
J080092P20CGTGTGGCNONE 
J080094D15CGTGTGGCNONE 
J080095A11CGTGTGGCNONE 
J080095K13CGTGTGGCNONE 
J080096L16CGTGTGGCNONE 
J080097F16CGTGTGGCNONE 
J080305J21CGTGTGGCNONE 
J080308I22CGTGTGGCNONE 
J080310E21CGTGTGGCNONE 
J080310G09CGTGTGGCNONE 
J090032M14CGTGTGGCNONE 
J090045I12CGTGTGGCNONE 
J090076M15CGTGTGGCNONE 
J090088C17CGTGTGGCNONE 
J090094B06CGTGTGGCNONE 
U74321CGTGTGGCNONE 
Os12g0106000AF370029CCACGTGTGGCCCATCCSimilar to Ferritin 1, chloroplast precursor (EC 1.16.3.1) (ZmFer1). 
AF519571CCACGTGTGGCCCATCCNONE 
AK102242CCACGTGTGGCCCATCCNONE 
AY324879CCACGTGTGGCCCATCCNONE 
J053063M21CCACGTGTGGCCCATCCNONE 
J090080A16CCACGTGTGGCCCATCCNONE 
Os12g0189300AK068710GCCACACGIsocitrate lyase and phosphorylmutase family protein. 
Os12g0437800AK063833CGTGTGGCSimilar to MPI. 
AK121693CGTGTGGCNONE 
AY878693CGTGTGGCNONE 
J065021K01CGTGTGGCNONE 
J065027K12CGTGTGGCNONE 
J065031I22CGTGTGGCNONE 
J065031L17CGTGTGGCNONE 
J065056K14CGTGTGGCNONE 
J065083J01CGTGTGGCNONE 
J065095J18CGTGTGGCNONE 
J065096N19CGTGTGGCNONE 
J065098F20CGTGTGGCNONE 
J065131F07CGTGTGGCNONE 
J065135H05CGTGTGGCNONE 
J065137E03CGTGTGGCNONE 
J065141F13CGTGTGGCNONE 
J065152E02CGTGTGGCNONE 
J065159J20CGTGTGGCNONE 
J065174J02CGTGTGGCNONE 
J065175I19CGTGTGGCNONE 
J065189P13CGTGTGGCNONE 
J065198J01CGTGTGGCNONE 
J065205F13CGTGTGGCNONE 
J065216A18CGTGTGGCNONE 
J100026N16CGTGTGGCNONE 
J100032E21CGTGTGGCNONE 
J100061K15CGTGTGGCNONE 
J100087B09CGTGTGGCNONE 
Os12g0457500015-025-F11CGTGTGGCNONE 
AK073212CGTGTGGCHypothetical protein. 
Os12g0498400AK058897GCCACACGNONE 
AK070044GCCACACGNONE 
AY496951GCCACACGSeptum formation topological specificity factor MinE family protein. 
J023038J16GCCACACGNONE 
Os12g0561200AK063760GCCACACGPAPA-1-like conserved region domain containing protein. 
Os12g0580300AK102871GCCACACGSimilar to TATA-binding protein TBP2. 
Os12g0586000AK119516GCCACACGSimilar to Disease resistance protein ADR1 (Activated disease resistance protein 1). 
Os12g0601400009-057-A09CGTGTGGCNONE 
AK073361CGTGTGGCSimilar to Auxin-responsive protein (Aux/IAA) (Fragment). 
J065037G12CGTGTGGCNONE 
J065099K06CGTGTGGCNONE 
J065156F11CGTGTGGCNONE 
J100025G04CGTGTGGCNONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.