version

Summary of OsREG574 (All List)

OrganismOryza sativa  
IDOsREG574  
SequenceCTCCCCCA  
Annotation  
PPDB Motif 
PLACE Motif 
Total Entry Count1603  

Entry Sequences (1603 entries)

LocusGene modelSequenceDescription
Os01g0155400AK063770TGGGGGAGConserved hypothetical protein. 
J080011N12TGGGGGAGNONE 
J080014I07TGGGGGAGNONE 
J080027D08TGGGGGAGNONE 
J080029H01TGGGGGAGNONE 
J080037K11TGGGGGAGNONE 
J080060I05TGGGGGAGNONE 
J080062B06TGGGGGAGNONE 
J080063G23TGGGGGAGNONE 
J080076B09TGGGGGAGNONE 
J080076O07TGGGGGAGNONE 
J080097D04TGGGGGAGNONE 
Os01g0157900AK072658CTCCCCCAProtein of unknown function Cys-rich family protein. 
Os01g0167100009-183-G08TGGGGGAGNONE 
AK063153TGGGGGAGNONE 
J065154C02TGGGGGAGNONE 
Os01g0174700AK062282CTCCCCCANONE 
AK101660CTCCCCCASimilar to Akt (Fragment). 
Os01g0191800AK061360CTCCCCCANONE 
Os01g0200700003-117-A10GTGTGGGGGAGNONE 
009-011-D05GTGTGGGGGAGNONE 
009-016-D05GTGTGGGGGAGNONE 
009-043-F05GTGTGGGGGAGNONE 
009-088-B02GTGTGGGGGAGNONE 
009-105-E05GTGTGGGGGAGNONE 
009-118-D05GTGTGGGGGAGNONE 
009-118-D11GTGTGGGGGAGNONE 
009-121-E05GTGTGGGGGAGNONE 
009-121-G02GTGTGGGGGAGNONE 
009-124-B08GTGTGGGGGAGNONE 
009-126-E04GTGTGGGGGAGNONE 
009-127-F01GTGTGGGGGAGNONE 
009-129-H11GTGTGGGGGAGNONE 
009-150-C11GTGTGGGGGAGNONE 
009-151-G09GTGTGGGGGAGNONE 
009-156-H01GTGTGGGGGAGNONE 
009-163-D12GTGTGGGGGAGNONE 
009-166-E01GTGTGGGGGAGNONE 
009-185-D03GTGTGGGGGAGNONE 
009-190-E08GTGTGGGGGAGNONE 
009-191-H01GTGTGGGGGAGNONE 
009-192-A09GTGTGGGGGAGNONE 
009-194-G03GTGTGGGGGAGNONE 
009-196-G07GTGTGGGGGAGNONE 
013-005-G02GTGTGGGGGAGNONE 
016-091-B04GTGTGGGGGAGNONE 
AF001396GTGTGGGGGAGNONE 
AF147786GTGTGGGGGAGNONE 
AK058313GTGTGGGGGAGSimilar to Metallothionein-like protein type 3 (MT-3) (MWMT3). 
AK120350GTGTGGGGGAGNONE 
J013038E17GTGTGGGGGAGNONE 
J013040L18GTGTGGGGGAGNONE 
J013051P11GTGTGGGGGAGNONE 
J013065G09GTGTGGGGGAGNONE 
J013129O19GTGTGGGGGAGNONE 
J033046N24GTGTGGGGGAGNONE 
J043010D24GTGTGGGGGAGNONE 
J065045L19GTGTGGGGGAGNONE 
J065055A05GTGTGGGGGAGNONE 
J065055A06GTGTGGGGGAGNONE 
J065068J11GTGTGGGGGAGNONE 
J065073P09GTGTGGGGGAGNONE 
J065077G01GTGTGGGGGAGNONE 
J065093O19GTGTGGGGGAGNONE 
J065094I04GTGTGGGGGAGNONE 
J065109M22GTGTGGGGGAGNONE 
J065114M11GTGTGGGGGAGNONE 
J065116H03GTGTGGGGGAGNONE 
J065128A19GTGTGGGGGAGNONE 
J065130C24GTGTGGGGGAGNONE 
J065142E10GTGTGGGGGAGNONE 
J065148K01GTGTGGGGGAGNONE 
J065159C20GTGTGGGGGAGNONE 
J065167L04GTGTGGGGGAGNONE 
J065183G24GTGTGGGGGAGNONE 
J075007A16GTGTGGGGGAGNONE 
J075007B16GTGTGGGGGAGNONE 
J075013N19GTGTGGGGGAGNONE 
J075015H14GTGTGGGGGAGNONE 
J075022I03GTGTGGGGGAGNONE 
J075030K16GTGTGGGGGAGNONE 
J075032L15GTGTGGGGGAGNONE 
J075038I11GTGTGGGGGAGNONE 
J075043D06GTGTGGGGGAGNONE 
J075043J09GTGTGGGGGAGNONE 
J075048M09GTGTGGGGGAGNONE 
J075049D16GTGTGGGGGAGNONE 
J075050F09GTGTGGGGGAGNONE 
J075052G16GTGTGGGGGAGNONE 
J075060E12GTGTGGGGGAGNONE 
J075064P13GTGTGGGGGAGNONE 
J075082N08GTGTGGGGGAGNONE 
J075082N18GTGTGGGGGAGNONE 
J075085D09GTGTGGGGGAGNONE 
J075085F18GTGTGGGGGAGNONE 
J075090L09GTGTGGGGGAGNONE 
J075097I03GTGTGGGGGAGNONE 
J075098N03GTGTGGGGGAGNONE 
J075100L09GTGTGGGGGAGNONE 
J075115B10GTGTGGGGGAGNONE 
J075127N20GTGTGGGGGAGNONE 
J075131J17GTGTGGGGGAGNONE 
J075137K04GTGTGGGGGAGNONE 
J075143E17GTGTGGGGGAGNONE 
J075146O06GTGTGGGGGAGNONE 
J075151D18GTGTGGGGGAGNONE 
J075154H23GTGTGGGGGAGNONE 
J075156B14GTGTGGGGGAGNONE 
J075156H24GTGTGGGGGAGNONE 
J075161A06GTGTGGGGGAGNONE 
J075162N01GTGTGGGGGAGNONE 
J075166K17GTGTGGGGGAGNONE 
J075172C05GTGTGGGGGAGNONE 
J075176I03GTGTGGGGGAGNONE 
J075180J22GTGTGGGGGAGNONE 
J075181F09GTGTGGGGGAGNONE 
J075183D18GTGTGGGGGAGNONE 
J075188I23GTGTGGGGGAGNONE 
J075188L16GTGTGGGGGAGNONE 
J075194G19GTGTGGGGGAGNONE 
J080001A16GTGTGGGGGAGNONE 
J080001A18GTGTGGGGGAGNONE 
J080002G19GTGTGGGGGAGNONE 
J080002M08GTGTGGGGGAGNONE 
J080003I02GTGTGGGGGAGNONE 
J080003K02GTGTGGGGGAGNONE 
J080005I12GTGTGGGGGAGNONE 
J080007H03GTGTGGGGGAGNONE 
J080008B16GTGTGGGGGAGNONE 
J080008N06GTGTGGGGGAGNONE 
J080010B17GTGTGGGGGAGNONE 
J080010F06GTGTGGGGGAGNONE 
J080010J04GTGTGGGGGAGNONE 
J080012G03GTGTGGGGGAGNONE 
J080016E16GTGTGGGGGAGNONE 
J080018H07GTGTGGGGGAGNONE 
J080018H11GTGTGGGGGAGNONE 
J080018M11GTGTGGGGGAGNONE 
J080020L10GTGTGGGGGAGNONE 
J080021F13GTGTGGGGGAGNONE 
J080021J04GTGTGGGGGAGNONE 
J080021J08GTGTGGGGGAGNONE 
J080022H19GTGTGGGGGAGNONE 
J080023C04GTGTGGGGGAGNONE 
J080023E15GTGTGGGGGAGNONE 
J080030L17GTGTGGGGGAGNONE 
J080032A12GTGTGGGGGAGNONE 
J080033A01GTGTGGGGGAGNONE 
J080033A05GTGTGGGGGAGNONE 
J080034D11GTGTGGGGGAGNONE 
J080035A09GTGTGGGGGAGNONE 
J080035O06GTGTGGGGGAGNONE 
J080040G01GTGTGGGGGAGNONE 
J080041C01GTGTGGGGGAGNONE 
J080045F24GTGTGGGGGAGNONE 
J080045J19GTGTGGGGGAGNONE 
J080045P12GTGTGGGGGAGNONE 
J080046B01GTGTGGGGGAGNONE 
J080046F01GTGTGGGGGAGNONE 
J080046F11GTGTGGGGGAGNONE 
J080047D04GTGTGGGGGAGNONE 
J080047J20GTGTGGGGGAGNONE 
J080047M23GTGTGGGGGAGNONE 
J080048D03GTGTGGGGGAGNONE 
J080050H21GTGTGGGGGAGNONE 
J080051B10GTGTGGGGGAGNONE 
J080053I23GTGTGGGGGAGNONE 
J080061A01GTGTGGGGGAGNONE 
J080064C12GTGTGGGGGAGNONE 
J080065D08GTGTGGGGGAGNONE 
J080066K10GTGTGGGGGAGNONE 
J080067C07GTGTGGGGGAGNONE 
J080068A05GTGTGGGGGAGNONE 
J080068H19GTGTGGGGGAGNONE 
J080068I09GTGTGGGGGAGNONE 
J080071H22GTGTGGGGGAGNONE 
J080072H09GTGTGGGGGAGNONE 
J080074K10GTGTGGGGGAGNONE 
J080075C10GTGTGGGGGAGNONE 
J080075H03GTGTGGGGGAGNONE 
J080079B17GTGTGGGGGAGNONE 
J080079C09GTGTGGGGGAGNONE 
J080079H01GTGTGGGGGAGNONE 
J080080A04GTGTGGGGGAGNONE 
J080080G12GTGTGGGGGAGNONE 
J080082K17GTGTGGGGGAGNONE 
J080085G21GTGTGGGGGAGNONE 
J080085J03GTGTGGGGGAGNONE 
J080086A13GTGTGGGGGAGNONE 
J080087A17GTGTGGGGGAGNONE 
J080088B04GTGTGGGGGAGNONE 
J080091F11GTGTGGGGGAGNONE 
J080092N10GTGTGGGGGAGNONE 
J080092P03GTGTGGGGGAGNONE 
J080094K23GTGTGGGGGAGNONE 
J080095C08GTGTGGGGGAGNONE 
J080096P06GTGTGGGGGAGNONE 
J080301I12GTGTGGGGGAGNONE 
J080301N10GTGTGGGGGAGNONE 
J080302L04GTGTGGGGGAGNONE 
J080303L16GTGTGGGGGAGNONE 
J080304C12GTGTGGGGGAGNONE 
J080304J22GTGTGGGGGAGNONE 
J080304K14GTGTGGGGGAGNONE 
J080305N24GTGTGGGGGAGNONE 
J080307F05GTGTGGGGGAGNONE 
J080308J07GTGTGGGGGAGNONE 
J080308O10GTGTGGGGGAGNONE 
J080312I15GTGTGGGGGAGNONE 
J080312O05GTGTGGGGGAGNONE 
J080313N01GTGTGGGGGAGNONE 
J080313N10GTGTGGGGGAGNONE 
J080315B12GTGTGGGGGAGNONE 
J080317D12GTGTGGGGGAGNONE 
J080318M08GTGTGGGGGAGNONE 
J090012C09GTGTGGGGGAGNONE 
J090023G22GTGTGGGGGAGNONE 
J100035A22GTGTGGGGGAGNONE 
J100037K23GTGTGGGGGAGNONE 
J100079J19GTGTGGGGGAGNONE 
Os01g0229200AK061937TGGGGGAGNONE 
Os01g0239700AK067723CTCCCCCASimilar to Leucine-rich receptor-like protein kinase. 
AK122130CTCCCCCANONE 
Os01g0303000009-016-A06CTCCCCCANONE 
009-084-B05CTCCCCCANONE 
009-100-E07CTCCCCCANONE 
009-133-B03CTCCCCCANONE 
AK058929CTCCCCCASimilar to CP12 (Fragment). 
AK066266CTCCCCCANONE 
AK102013CTCCCCCANONE 
J065001I21CTCCCCCANONE 
J065025D22CTCCCCCANONE 
J065098M18CTCCCCCANONE 
J065105O22CTCCCCCANONE 
J065121F07CTCCCCCANONE 
J065181F03CTCCCCCANONE 
J075020M03CTCCCCCANONE 
J075028O06CTCCCCCANONE 
J075032F15CTCCCCCANONE 
J075033H07CTCCCCCANONE 
J075062F22CTCCCCCANONE 
J075083P19CTCCCCCANONE 
J075097J16CTCCCCCANONE 
J075099A15CTCCCCCANONE 
J075104P03CTCCCCCANONE 
J075118K12CTCCCCCANONE 
J075125H01CTCCCCCANONE 
J075127K12CTCCCCCANONE 
J075128F24CTCCCCCANONE 
J075151P06CTCCCCCANONE 
J075169K22CTCCCCCANONE 
J075170K24CTCCCCCANONE 
J075182A01CTCCCCCANONE 
J075199H16CTCCCCCANONE 
J080010O12CTCCCCCANONE 
J080013A02CTCCCCCANONE 
J080013F09CTCCCCCANONE 
J080017C19CTCCCCCANONE 
J080017G05CTCCCCCANONE 
J080022L04CTCCCCCANONE 
J080025B17CTCCCCCANONE 
J080029A08CTCCCCCANONE 
J080037C12CTCCCCCANONE 
J080037L14CTCCCCCANONE 
J080037M24CTCCCCCANONE 
J080038M21CTCCCCCANONE 
J080039E06CTCCCCCANONE 
J080039I10CTCCCCCANONE 
J080042H01CTCCCCCANONE 
J080042L18CTCCCCCANONE 
J080042N21CTCCCCCANONE 
J080043E01CTCCCCCANONE 
J080044H05CTCCCCCANONE 
J080047H10CTCCCCCANONE 
J080050H03CTCCCCCANONE 
J080060N21CTCCCCCANONE 
J080061M09CTCCCCCANONE 
J080062D15CTCCCCCANONE 
J080062I18CTCCCCCANONE 
J080063G05CTCCCCCANONE 
J080063H16CTCCCCCANONE 
J080067G16CTCCCCCANONE 
J080067M07CTCCCCCANONE 
J080068M13CTCCCCCANONE 
J080069A19CTCCCCCANONE 
J080069G14CTCCCCCANONE 
J080070F04CTCCCCCANONE 
J080070K15CTCCCCCANONE 
J080072O20CTCCCCCANONE 
J080075L02CTCCCCCANONE 
J080077I10CTCCCCCANONE 
J080077P03CTCCCCCANONE 
J080078F14CTCCCCCANONE 
J080092H15CTCCCCCANONE 
J080097J15CTCCCCCANONE 
J080305C10CTCCCCCANONE 
Os01g0377700AK059266CTCCCCCAUbiquitin domain containing protein. 
AK107503CTCCCCCANONE 
J065165L07CTCCCCCANONE 
J075196J11CTCCCCCANONE 
Os01g0541600Os01g0541600TGGGGGAGConserved hypothetical protein. 
Os01g0542700AK110526TGGGGGAGEukaryotic transcription factor, DNA-binding domain containing protein. 
J100025K23TGGGGGAGNONE 
Os01g0566500AK058473CTCCCCCASimilar to Dioxygenase RAMOSUS1. 
J065122J04CTCCCCCANONE 
Os01g0571000AK121334CTCCCCCANONE 
Os01g0588900AK071695CTCCCCCAConserved hypothetical protein 730 family protein. 
AK111103CTCCCCCANONE 
J013134L19CTCCCCCANONE 
J023074A10CTCCCCCANONE 
J023109F04CTCCCCCANONE 
J023143L07CTCCCCCANONE 
J065022F16CTCCCCCANONE 
J065083N22CTCCCCCANONE 
J100040N10CTCCCCCANONE 
J100043F13CTCCCCCANONE 
J100075D13CTCCCCCANONE 
J100080D22CTCCCCCANONE 
Os01g0607300AK109289CTCCCCCACACGConserved hypothetical protein. 
Os01g0745400AK107872CTCCCCCASec34-like protein family protein. 
Os01g0751600AK108569TGGGGGAGConserved hypothetical protein. 
J075117H02TGGGGGAGNONE 
J075172C03TGGGGGAGNONE 
Os01g0765300AK101759TGGGGGAGRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os01g0772500AK109736CTCCCCCACGAAGlycosyl transferase, family 14 protein. 
Os01g0830100AK069755GATCCGACGGTGGGGGAGPyridine nucleotide-disulphide oxidoreductase, NAD-binding region domain containing protein. 
Os01g0838200Os01g0838200TGGGGGAGConserved hypothetical protein. 
Os01g0938400009-025-F11CTCCCCCANONE 
AK062398CTCCCCCAConserved hypothetical protein. 
Os01g0966200009-079-H11CTCCCCCANONE 
009-124-G10CTCCCCCANONE 
AK058564CTCCCCCAProtein of unknown function YGGT family protein. 
AK098935CTCCCCCANONE 
Os01g0966400AK103064TGGGGGAGLeucine-rich repeat, SDS22 containing protein. 
J023043O12TGGGGGAGNONE 
J053084D04TGGGGGAGNONE 
J090021L08TGGGGGAGNONE 
Os02g0115900AF006825CTCCCCCANONE 
AK065743CTCCCCCAEndosperm lumenal binding protein. 
AK119653CTCCCCCANONE 
Os02g0121100012-035-F06CAAGGCCCACTCCCCCACGNONE 
013-031-H05CAAGGCCCACTCCCCCACGNONE 
013-058-E11CAAGGCCCACTCCCCCACGNONE 
014-010-D01CAAGGCCCACTCCCCCACGNONE 
AK070711CAAGGCCCACTCCCCCACGConserved hypothetical protein. 
AK119758CAAGGCCCACTCCCCCACGNONE 
J013033G12CAAGGCCCACTCCCCCACGNONE 
J023007M16CAAGGCCCACTCCCCCACGNONE 
J023020K20CAAGGCCCACTCCCCCACGNONE 
J023061H10CAAGGCCCACTCCCCCACGNONE 
J033027H20CAAGGCCCACTCCCCCACGNONE 
J033051E18CAAGGCCCACTCCCCCACGNONE 
J090005F12CAAGGCCCACTCCCCCACGNONE 
J090017A20CAAGGCCCACTCCCCCACGNONE 
J090018G11CAAGGCCCACTCCCCCACGNONE 
J090062C18CAAGGCCCACTCCCCCACGNONE 
J100027N10CAAGGCCCACTCCCCCACGNONE 
J100032L14CAAGGCCCACTCCCCCACGNONE 
J100045C14CAAGGCCCACTCCCCCACGNONE 
J100061M09CAAGGCCCACTCCCCCACGNONE 
J100062K11CAAGGCCCACTCCCCCACGNONE 
J100064H11CAAGGCCCACTCCCCCACGNONE 
J100074H16CAAGGCCCACTCCCCCACGNONE 
J100082N01CAAGGCCCACTCCCCCACGNONE 
Os02g0193900AK069578CGCGTGGGGGAGConserved hypothetical protein. 
AK104014CGCGTGGGGGAGNONE 
J080308C08CGCGTGGGGGAGNONE 
J090043C09CGCGTGGGGGAGNONE 
Os02g0195500AK062207CTCCCCCACGGCCACGGCCNONE 
Os02g0302900AK110752CTCCCCCACCCGReticulon family protein. 
Os02g0499300AK106994CTCCCCCAConserved hypothetical protein. 
Os02g0517531AK121247TGGGGGAGRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
Os02g0525100009-009-F04TGGGGGAGNONE 
AK062326TGGGGGAGConserved hypothetical protein. 
J065053O13TGGGGGAGNONE 
Os02g0527300AK101934CTCCCCCASimilar to Heat shock transcription factor 31 (Fragment). 
J013047O11CTCCCCCANONE 
J033073P11CTCCCCCANONE 
Os02g0565000AK120665CTCCCCCAHomeodomain-like containing protein. 
J100070C12CTCCCCCANONE 
J100074L08CTCCCCCANONE 
Os02g0572200AK109591CTCCCCCASimilar to RING-H2 finger protein ATL3I (YGHL1-C3HC4 RING fusion protein). 
Os02g0595700006-057-E01CTCCCCCANONE 
006-082-F10CTCCCCCANONE 
006-087-C10CTCCCCCANONE 
006-091-H03CTCCCCCANONE 
006-094-A11CTCCCCCANONE 
AF145053CTCCCCCANONE 
AK064937CTCCCCCANONE 
AK066858CTCCCCCANONE 
AK104785CTCCCCCANONE 
AK119587CTCCCCCAChloroplast translational elongation factor Tu. 
J013000P03CTCCCCCANONE 
Os02g0653000AK062922CTCCCCCAConserved hypothetical protein. 
Os02g0667000AK058849CTCCCCCAComplex 1 LYR protein family protein. 
Os02g0731600AK058271CTCCCCCAConserved hypothetical protein. 
Os02g0751300J033055P08CTCCCCCAProtein of unknown function DUF581 family protein. 
Os02g0762400AK103084TGGGGGAGCyclin-dependent kinase inhibitor family protein. 
Os02g0767900009-154-G01TGGATGGGGGAGNONE 
009-172-H09TGGATGGGGGAGNONE 
AK099885TGGATGGGGGAGGlutaredoxin 2 family protein. 
Os02g0788800AK066747CTCCCCCAAmino acid/polyamine transporter II family protein. 
Os02g0792600J090091O08CTCCCCCACCACNONE 
Os02g0797600004-004-A08CTCCCCCANONE 
006-050-H07CTCCCCCANONE 
006-092-B02CTCCCCCANONE 
006-100-B08CTCCCCCANONE 
013-037-D09CTCCCCCANONE 
013-068-H02CTCCCCCANONE 
AK060857CTCCCCCANONE 
AK098882CTCCCCCANONE 
AK104474CTCCCCCANONE 
AK120644CTCCCCCAConserved hypothetical protein. 
J013001F21CTCCCCCANONE 
J013074D07CTCCCCCANONE 
J013096H23CTCCCCCANONE 
J013098H07CTCCCCCANONE 
J013132L13CTCCCCCANONE 
J013134K05CTCCCCCANONE 
J013155B15CTCCCCCANONE 
J023002L17CTCCCCCANONE 
J023013B08CTCCCCCANONE 
J023087I01CTCCCCCANONE 
J033071O04CTCCCCCANONE 
J065161N23CTCCCCCANONE 
J075055G11CTCCCCCANONE 
J075106J02CTCCCCCANONE 
J080009D06CTCCCCCANONE 
J080009N22CTCCCCCANONE 
J080016L03CTCCCCCANONE 
J080023E17CTCCCCCANONE 
J080027A12CTCCCCCANONE 
J080036M24CTCCCCCANONE 
J080038N07CTCCCCCANONE 
J080041A04CTCCCCCANONE 
J080042K11CTCCCCCANONE 
J080050A04CTCCCCCANONE 
J080053G16CTCCCCCANONE 
J080063D03CTCCCCCANONE 
J080063F07CTCCCCCANONE 
J080067H13CTCCCCCANONE 
J080068F12CTCCCCCANONE 
J080072G17CTCCCCCANONE 
J080072I06CTCCCCCANONE 
J080072J24CTCCCCCANONE 
J080076G09CTCCCCCANONE 
J080085H10CTCCCCCANONE 
J080092I17CTCCCCCANONE 
J080092N20CTCCCCCANONE 
J080093G10CTCCCCCANONE 
J090074C23CTCCCCCANONE 
J090083O18CTCCCCCANONE 
J100046M05CTCCCCCANONE 
J100050N16CTCCCCCANONE 
J100054D07CTCCCCCANONE 
J100054O11CTCCCCCANONE 
J100055F04CTCCCCCANONE 
J100055H22CTCCCCCANONE 
J100063A05CTCCCCCANONE 
J100063I24CTCCCCCANONE 
J100067I12CTCCCCCANONE 
J100074A22CTCCCCCANONE 
J100078B22CTCCCCCANONE 
J100079B03CTCCCCCANONE 
Os02g0799600009-031-H12CTCCCCCANONE 
009-134-F05CTCCCCCANONE 
014-071-B12CTCCCCCANONE 
AK063712CTCCCCCAConserved hypothetical protein. 
J075019J12CTCCCCCANONE 
Os02g0805200AK071591CTCCCCCAProliferating cell nuclear antigen (PCNA) (Cyclin). 
J023105C08CTCCCCCANONE 
J033030H07CTCCCCCANONE 
J033050M24CTCCCCCANONE 
J033069B10CTCCCCCANONE 
J033121A16CTCCCCCANONE 
J053023M14CTCCCCCANONE 
J053033A15CTCCCCCANONE 
J053054H14CTCCCCCANONE 
J053055H24CTCCCCCANONE 
J053082B18CTCCCCCANONE 
J065001N03CTCCCCCANONE 
J065011O16CTCCCCCANONE 
J065026K24CTCCCCCANONE 
J065056C09CTCCCCCANONE 
J065067H11CTCCCCCANONE 
J065097E19CTCCCCCANONE 
J065118O11CTCCCCCANONE 
J065124N09CTCCCCCANONE 
J065143A02CTCCCCCANONE 
J065213P06CTCCCCCANONE 
J065215E24CTCCCCCANONE 
J075051B11CTCCCCCANONE 
J075065K05CTCCCCCANONE 
J080306E10CTCCCCCANONE 
J090042I16CTCCCCCANONE 
J090066J24CTCCCCCANONE 
J090092K17CTCCCCCANONE 
J100029A17CTCCCCCANONE 
J100052N08CTCCCCCANONE 
J100071I23CTCCCCCANONE 
Os02g0808800011-057-A10CTCCCCCANONE 
015-074-B06CTCCCCCANONE 
AK064401CTCCCCCASimilar to Cinnamoyl-CoA reductase (EC 1.2.1.44). 
Os03g0109400AK102378GTGGTGGGGGAGHomeobox domain containing protein. 
AK110678GTGGTGGGGGAGNONE 
AY425991GTGGTGGGGGAGNONE 
Os03g0112800AK100572CTCCCCCAProtein of unknown function DUF726 family protein. 
Os03g0120200AK058771CTCCCCCANONE 
AK102865CTCCCCCANONE 
AK121787CTCCCCCARemorin, C-terminal region domain containing protein. 
Os03g0120400AK070517CTCCCCCAHeavy metal transport/detoxification protein domain containing protein. 
J023056A13CTCCCCCANONE 
J023068D19CTCCCCCANONE 
Os03g0121200013-060-B01CTCCCCCANONE 
AK060028CTCCCCCANONE 
AK073847CTCCCCCANONE 
AK103660CTCCCCCASimilar to Peroxidase 1. 
AK120013CTCCCCCANONE 
J023048M02CTCCCCCANONE 
J023052M11CTCCCCCANONE 
J023118A08CTCCCCCANONE 
J023135O08CTCCCCCANONE 
J033058P11CTCCCCCANONE 
J033135H09CTCCCCCANONE 
J033140I05CTCCCCCANONE 
J090015H12CTCCCCCANONE 
J090037M21CTCCCCCANONE 
Os03g0145900J013045K15TGGGGGAGNONE 
J013051O08TGGGGGAGNONE 
J065054C08TGGGGGAGNONE 
J075053J16TGGGGGAGNONE 
Os03g0147700AK063281TGGGGGAGMT-A70 family protein. 
Os03g0158800AK108516CTCCCCCASimilar to P69C protein. 
J065013G11CTCCCCCANONE 
Os03g0163100AK065571CTCCCCCACACProtein of unknown function DUF1012 family protein. 
Os03g0181100AK067971CTCCCCCANONE 
AK120087CTCCCCCAZIM domain containing protein. 
J013123K19CTCCCCCANONE 
J100077H14CTCCCCCANONE 
Os03g0181500003-108-B12CTCCCCCANONE 
006-025-D12CTCCCCCANONE 
006-034-D11CTCCCCCANONE 
006-045-B04CTCCCCCANONE 
006-087-C12CTCCCCCANONE 
006-116-A09CTCCCCCANONE 
006-119-H05CTCCCCCANONE 
013-014-E04CTCCCCCANONE 
014-039-H09CTCCCCCANONE 
015-067-B05CTCCCCCANONE 
AK060840CTCCCCCANONE 
AK061335CTCCCCCASimilar to Fiddlehead protein. 
AK099232CTCCCCCANONE 
AK119228CTCCCCCANONE 
J013030L02CTCCCCCANONE 
J013151K04CTCCCCCANONE 
J013170F20CTCCCCCANONE 
J065063H18CTCCCCCANONE 
J065219J11CTCCCCCANONE 
J075090B17CTCCCCCANONE 
J075125F15CTCCCCCANONE 
J075140K11CTCCCCCANONE 
J090073H24CTCCCCCANONE 
Os03g0192700012-005-H03CTCCCCCANONE 
012-006-B05CTCCCCCANONE 
012-006-E07CTCCCCCANONE 
012-051-D10CTCCCCCANONE 
014-089-H06CTCCCCCANONE 
015-034-C05CTCCCCCANONE 
015-042-C06CTCCCCCANONE 
015-059-E09CTCCCCCANONE 
015-096-A08CTCCCCCANONE 
016-030-D06CTCCCCCANONE 
016-053-H07CTCCCCCANONE 
016-064-D02CTCCCCCANONE 
AB012107CTCCCCCANONE 
AK058750CTCCCCCASimilar to Myo-inositol-1-phosphate synthase. 
AK103501CTCCCCCANONE 
J023102F09CTCCCCCANONE 
J023103H09CTCCCCCANONE 
J023107F22CTCCCCCANONE 
J033031E17CTCCCCCANONE 
J033090C03CTCCCCCANONE 
J033090C17CTCCCCCANONE 
J033091K19CTCCCCCANONE 
J033131B11CTCCCCCANONE 
J033133D04CTCCCCCANONE 
J053050C09CTCCCCCANONE 
J053078O12CTCCCCCANONE 
J075037B10CTCCCCCANONE 
J090021M23CTCCCCCANONE 
Os03g0194900006-038-B11CTCCCCCANONE 
006-048-H09CTCCCCCANONE 
009-141-E07CTCCCCCANONE 
013-006-A05CTCCCCCANONE 
013-073-G09CTCCCCCANONE 
013-093-E05CTCCCCCANONE 
AK061389CTCCCCCANONE 
AK070149CTCCCCCADOMON related domain containing protein. 
AK104041CTCCCCCANONE 
AK104413CTCCCCCANONE 
J013134O16CTCCCCCANONE 
J023042P18CTCCCCCANONE 
J023077M08CTCCCCCANONE 
J033068I01CTCCCCCANONE 
J053023E18CTCCCCCANONE 
J053026N22CTCCCCCANONE 
J053043H12CTCCCCCANONE 
J053064P12CTCCCCCANONE 
J053068B02CTCCCCCANONE 
J053069A07CTCCCCCANONE 
J053070F13CTCCCCCANONE 
J053094H07CTCCCCCANONE 
J065061I03CTCCCCCANONE 
J065115D02CTCCCCCANONE 
J065163K24CTCCCCCANONE 
J065195M16CTCCCCCANONE 
J065219A21CTCCCCCANONE 
J075046I11CTCCCCCANONE 
J075097H16CTCCCCCANONE 
J075128N20CTCCCCCANONE 
J075139O20CTCCCCCANONE 
J075168H20CTCCCCCANONE 
J075170E15CTCCCCCANONE 
J075191C04CTCCCCCANONE 
J075192P06CTCCCCCANONE 
J100027K07CTCCCCCANONE 
J100027P03CTCCCCCANONE 
J100033P16CTCCCCCANONE 
J100050M24CTCCCCCANONE 
J100072D05CTCCCCCANONE 
Os03g0242300AK065146CTCCCCCAConserved hypothetical protein. 
J013002A22CTCCCCCANONE 
J023088H11CTCCCCCANONE 
J065083M12CTCCCCCANONE 
J065169P06CTCCCCCANONE 
J100037B08CTCCCCCANONE 
Os03g0246800AK070145CTCCCCCANONE 
AK102770CTCCCCCANONE 
Os03g0255000AK101625CTCCCCCAFAR1 domain containing protein. 
AK101625CTCCCCCAFAR1 domain containing protein. 
J033052M07CTCCCCCANONE 
J033052M07CTCCCCCANONE 
Os03g0257500AK058775CTCCCCCAProtein of unknown function DUF292, eukaryotic domain containing protein. 
Os03g0271500AK068546CGTGGGGGAGNONE 
AK109239CGTGGGGGAGConserved hypothetical protein. 
J013157P04CGTGGGGGAGNONE 
J075041K23CGTGGGGGAGNONE 
Os03g0288900AK100329CTCCCCCAConserved hypothetical protein. 
J023080H15CTCCCCCANONE 
J033136I21CTCCCCCANONE 
J065036A16CTCCCCCANONE 
J065186A16CTCCCCCANONE 
J065187B08CTCCCCCANONE 
J065202E24CTCCCCCANONE 
Os03g0293500015-054-D06CTCCCCCANONE 
AK101594CTCCCCCASimilar to Pyruvate decarboxylase isozyme 3 (EC 4.1.1.1) (PDC) (Fragment). 
AK119500CTCCCCCANONE 
J033051F01CTCCCCCANONE 
J090058D14CTCCCCCANONE 
J100037N18CTCCCCCANONE 
J100042J23CTCCCCCANONE 
J100053E20CTCCCCCANONE 
J100060G07CTCCCCCANONE 
U27350CTCCCCCANONE 
Os03g0301200AK119578CTCCCCCANONE 
J013027D03CTCCCCCANONE 
J075035F14CTCCCCCANONE 
J090075I19CTCCCCCANONE 
J090081E22CTCCCCCANONE 
J100035I20CTCCCCCANONE 
J100051E18CTCCCCCANONE 
J100053H11CTCCCCCANONE 
J100081P07CTCCCCCANONE 
Os03g0303100015-002-B09CTCCCCCANONE 
015-005-B02CTCCCCCANONE 
015-017-E10CTCCCCCANONE 
AK071041CTCCCCCAProtein of unknown function DUF1645 family protein. 
J065140F05CTCCCCCANONE 
Os03g0315400AK120551CTCCCCCASimilar to Typical P-type R2R3 Myb protein (Fragment). 
J013130B13CTCCCCCANONE 
J065053B05CTCCCCCANONE 
J065169H20CTCCCCCANONE 
J065169M22CTCCCCCANONE 
J100061H19CTCCCCCANONE 
Os03g0365900AK069388TGGGGGAGLipolytic enzyme, G-D-S-L family protein. 
J023011L04TGGGGGAGNONE 
Os03g0442900011-029-B08TGGGGGAGNONE 
AK099556TGGGGGAGConserved hypothetical protein. 
J013033P18TGGGGGAGNONE 
J065056H05TGGGGGAGNONE 
J065186C16TGGGGGAGNONE 
Os03g0577000012-055-F04TGGGGGAGNONE 
AK061051TGGGGGAGSimilar to Ribosomal protein S3 (Fragment). 
AK099146TGGGGGAGNONE 
J065060A01TGGGGGAGNONE 
J075079B17TGGGGGAGNONE 
J075134K12TGGGGGAGNONE 
J090048F23TGGGGGAGNONE 
J090072I19TGGGGGAGNONE 
J100087C19TGGGGGAGNONE 
J100090C21TGGGGGAGNONE 
Os03g0577200006-030-H11CTCCCCCANONE 
AK061735CTCCCCCASimilar to Mps one binder kinase activator-like 1A (Mob1 homolog 1A) (Mob1A) (Mob1B) (Protein Mob4A). 
AK098953CTCCCCCANONE 
AK099558CTCCCCCANONE 
AK104547CTCCCCCANONE 
J013034B14CTCCCCCANONE 
J013066J17CTCCCCCANONE 
J090033N14CTCCCCCANONE 
Os03g0701000J075172J23CTCCCCCANONE 
Os03g0726100004-005-B05CTCCCCCANONE 
006-023-C08CTCCCCCANONE 
006-029-H02CTCCCCCANONE 
006-032-B03CTCCCCCANONE 
006-035-C10CTCCCCCANONE 
006-040-H05CTCCCCCANONE 
006-043-C02CTCCCCCANONE 
006-046-B11CTCCCCCANONE 
006-046-E05CTCCCCCANONE 
006-046-H04CTCCCCCANONE 
006-048-A09CTCCCCCANONE 
006-050-A02CTCCCCCANONE 
006-063-A02CTCCCCCANONE 
006-064-A09CTCCCCCANONE 
006-070-G11CTCCCCCANONE 
006-072-G04CTCCCCCANONE 
006-077-G12CTCCCCCANONE 
006-080-F04CTCCCCCANONE 
006-080-H01CTCCCCCANONE 
006-084-D10CTCCCCCANONE 
006-084-G06CTCCCCCANONE 
006-085-H10CTCCCCCANONE 
006-086-C05CTCCCCCANONE 
006-087-D10CTCCCCCANONE 
006-096-C09CTCCCCCANONE 
006-100-F10CTCCCCCANONE 
006-108-D12CTCCCCCANONE 
006-115-G10CTCCCCCANONE 
006-119-C09CTCCCCCANONE 
006-120-E05CTCCCCCANONE 
011-042-H01CTCCCCCANONE 
011-075-B11CTCCCCCANONE 
013-003-D03CTCCCCCANONE 
013-028-B11CTCCCCCANONE 
013-031-A01CTCCCCCANONE 
013-035-F03CTCCCCCANONE 
013-051-D02CTCCCCCANONE 
013-055-D06CTCCCCCANONE 
013-059-H03CTCCCCCANONE 
013-076-A09CTCCCCCANONE 
013-076-B01CTCCCCCANONE 
013-090-F09CTCCCCCANONE 
013-100-A05CTCCCCCANONE 
013-100-F05CTCCCCCANONE 
013-100-G12CTCCCCCANONE 
014-006-G08CTCCCCCANONE 
015-003-B07CTCCCCCANONE 
016-093-C06CTCCCCCANONE 
AF030548CTCCCCCANONE 
AK102194CTCCCCCASimilar to Tubulin alpha-1 chain (Alpha-1 tubulin). 
AK119247CTCCCCCANONE 
AK119362CTCCCCCANONE 
AK119638CTCCCCCANONE 
J013066P16CTCCCCCANONE 
J023022H18CTCCCCCANONE 
J023087O13CTCCCCCANONE 
J023121I16CTCCCCCANONE 
J023123M09CTCCCCCANONE 
J033022M05CTCCCCCANONE 
J033087C05CTCCCCCANONE 
J065022K07CTCCCCCANONE 
J065024E22CTCCCCCANONE 
J065041G05CTCCCCCANONE 
J065045M11CTCCCCCANONE 
J065082K10CTCCCCCANONE 
J065121K18CTCCCCCANONE 
J065137O07CTCCCCCANONE 
J065144B12CTCCCCCANONE 
J065152E04CTCCCCCANONE 
J065159D24CTCCCCCANONE 
J065217E02CTCCCCCANONE 
J075014N22CTCCCCCANONE 
J075064O17CTCCCCCANONE 
J080316L10CTCCCCCANONE 
J080318L20CTCCCCCANONE 
J090034D01CTCCCCCANONE 
J090034P05CTCCCCCANONE 
J090041H08CTCCCCCANONE 
J090042F20CTCCCCCANONE 
J090042I15CTCCCCCANONE 
J090050O17CTCCCCCANONE 
J090054L13CTCCCCCANONE 
J090062A12CTCCCCCANONE 
J090068I22CTCCCCCANONE 
J090070J23CTCCCCCANONE 
J090070M18CTCCCCCANONE 
J090084L07CTCCCCCANONE 
J090087H13CTCCCCCANONE 
J090095H10CTCCCCCANONE 
J090099M17CTCCCCCANONE 
J100022O10CTCCCCCANONE 
J100048A05CTCCCCCANONE 
J100057O06CTCCCCCANONE 
X91806CTCCCCCANONE 
Os03g0734300AK105387CTCCCCCASimilar to Proteinase inhibitor type II CEVI57 precursor. 
J065010F13CTCCCCCANONE 
J065012C15CTCCCCCANONE 
J065014G24CTCCCCCANONE 
J065040L17CTCCCCCANONE 
J065044N03CTCCCCCANONE 
J065135I08CTCCCCCANONE 
J065153O04CTCCCCCANONE 
J065166I05CTCCCCCANONE 
J065173J12CTCCCCCANONE 
J065202D16CTCCCCCANONE 
J075056E10CTCCCCCANONE 
J075112P03CTCCCCCANONE 
J075166L16CTCCCCCANONE 
J100021J16CTCCCCCANONE 
Os03g0737600014-094-E01CTCCCCCACGGGNONE 
AB038234CTCCCCCACGGGNONE 
AK101854CTCCCCCACGGGCyclin H-1. 
AK105468CTCCCCCACGGGNONE 
J033069N12CTCCCCCACGGGNONE 
J043017A22CTCCCCCACGGGNONE 
J065154A20CTCCCCCACGGGNONE 
Os03g0773800006-117-H02CTCCCCCANONE 
AK064972CTCCCCCANONE 
AK067105CTCCCCCASimilar to Malate dehydrogenase, glyoxysomal precursor (EC 1.1.1.37) (mbNAD-MDH). 
AK104821CTCCCCCANONE 
J013001B17CTCCCCCANONE 
J013089E13CTCCCCCANONE 
J013091B15CTCCCCCANONE 
J013108B21CTCCCCCANONE 
J013153I05CTCCCCCANONE 
J023110L02CTCCCCCANONE 
J065023O13CTCCCCCANONE 
J065041G09CTCCCCCANONE 
J075092N22CTCCCCCANONE 
J075123H07CTCCCCCANONE 
J075161F04CTCCCCCANONE 
J080077G22CTCCCCCANONE 
Os03g0801900015-081-G06GACAGGTGGGCTCTCCCCCANONE 
AK106415GACAGGTGGGCTCTCCCCCAProtein of unknown function DUF569 family protein. 
J090099L17GACAGGTGGGCTCTCCCCCANONE 
J100024B03GACAGGTGGGCTCTCCCCCANONE 
J100088I08GACAGGTGGGCTCTCCCCCANONE 
Os03g0820100011-030-A10CTCCCCCANONE 
011-031-C01CTCCCCCANONE 
AK111534CTCCCCCASimilar to Auxin-resistance protein AXR1. 
J013033L14CTCCCCCANONE 
J013034D14CTCCCCCANONE 
J013065N20CTCCCCCANONE 
J013127A04CTCCCCCANONE 
J013146A11CTCCCCCANONE 
J023025D19CTCCCCCANONE 
J023083K15CTCCCCCANONE 
J033037N01CTCCCCCANONE 
J033041H02CTCCCCCANONE 
J043009M22CTCCCCCANONE 
J090039L03CTCCCCCANONE 
J090050L08CTCCCCCANONE 
J090053J21CTCCCCCANONE 
J090088G07CTCCCCCANONE 
Os03g0833300012-091-F09CTCCCCCANONE 
015-038-A05CTCCCCCANONE 
AK065741CTCCCCCANONE 
AK069847CTCCCCCASimilar to Squamosa-promoter binding-like protein 8. 
AK072164CTCCCCCANONE 
AK121030CTCCCCCANONE 
J013040K13CTCCCCCANONE 
J013122I04CTCCCCCANONE 
J013130O11CTCCCCCANONE 
J023003A13CTCCCCCANONE 
J023003A14CTCCCCCANONE 
J023034C10CTCCCCCANONE 
J033058F07CTCCCCCANONE 
J033065P18CTCCCCCANONE 
J033124B15CTCCCCCANONE 
J043001C15CTCCCCCANONE 
J043031N15CTCCCCCANONE 
J065090G07CTCCCCCANONE 
J090043M05CTCCCCCANONE 
J090053E11CTCCCCCANONE 
J090066P15CTCCCCCANONE 
J090067E22CTCCCCCANONE 
Os03g0841800AK070062CTCCCCCASimilar to Shaggy-related protein kinase kappa (EC 2.7.1.-) (ASK-kappa) (AtK-1). 
Os03g0854800J090007D13CTCCCCCANONE 
J090085N22CTCCCCCANONE 
Os04g0163800012-080-A06CTCCCCCANONE 
AK063533CTCCCCCAProtein of unknown function DUF594 family protein. 
Os04g0189400AK071283TGGGGGAGGamma Purothionin family protein. 
Os04g0270100AK063713CTCCCCCANONE 
AK107968CTCCCCCANONE 
Os04g0385600Os04g0385600GTGTGGGGGAGZinc finger, MYND-type domain containing protein. 
Os04g0418800011-026-A07CTCCCCCANONE 
013-016-A06CTCCCCCANONE 
013-046-C12CTCCCCCANONE 
013-060-H02CTCCCCCANONE 
013-091-D07CTCCCCCANONE 
AK064039CTCCCCCASimilar to Hydroxyproline-rich glycoprotein. 
AK102919CTCCCCCANONE 
J033114B14CTCCCCCANONE 
Os04g0437000J065046G11TGGGGGAGNONE 
J065141A18TGGGGGAGNo apical meristem (NAM) protein domain containing protein. 
J100029L01TGGGGGAGNONE 
J100032L13TGGGGGAGNONE 
J100082O14TGGGGGAGNONE 
Os04g0498600006-068-G08CTCCCCCANONE 
006-095-H08CTCCCCCANONE 
006-108-E12CTCCCCCANONE 
009-194-E05CTCCCCCANONE 
AK062001CTCCCCCANONE 
Os04g0516900AK108714TGGGGGAGConserved hypothetical protein. 
Os04g0530300009-053-E04TGGGGGAGNONE 
009-074-E03TGGGGGAGNONE 
AK066705TGGGGGAGConserved hypothetical protein. 
Os04g0551300AK061936TGGGGGAGNONE 
Os04g0558700AK110633CTCCCCCACGTConserved hypothetical protein. 
Os04g0564600009-038-A02CTCCCCCANONE 
AK105145CTCCCCCANONE 
AK120614CTCCCCCASimilar to HMG1 protein. 
J013102D16CTCCCCCANONE 
J013151P06CTCCCCCANONE 
J033082C11CTCCCCCANONE 
J065073N13CTCCCCCANONE 
J065142E11CTCCCCCANONE 
J065187I19CTCCCCCANONE 
J065204K02CTCCCCCANONE 
J090089P22CTCCCCCANONE 
J100060B16CTCCCCCANONE 
Os04g0594500015-024-B07CTCCCCCANONE 
AK106269CTCCCCCAProtein of unknown function DUF674 family protein. 
Os04g0629200J100086C21CTCCCCCACupredoxin domain containing protein. 
Os04g0647800AK065350CTCCCCCASimilar to Glycerol kinase 2 (EC 2.7.1.30). 
AK069876CTCCCCCANONE 
AK104069CTCCCCCANONE 
Os04g0656800AK058886CTCCCCCASimilar to Peroxidase precursor (EC 1.11.1.7). 
Os05g0155500AK120498TGGGGGAGNONE 
J013121O08TGGGGGAGNONE 
Os05g0176700009-076-A09CTCCCCCANONE 
009-147-H06CTCCCCCANONE 
009-161-C02CTCCCCCANONE 
AK071729CTCCCCCAConserved hypothetical protein. 
J023110H11CTCCCCCANONE 
J075092I23CTCCCCCANONE 
J100038P12CTCCCCCANONE 
J100039J21CTCCCCCANONE 
J100039M13CTCCCCCANONE 
J100084A22CTCCCCCANONE 
Os05g0187000AB026564CTCCCCCANONE 
AK103126CTCCCCCABeta 2 subunit of 20S proteasome (20S proteasome beta subunit). 
J023025O17CTCCCCCANONE 
J033022B11CTCCCCCANONE 
J033023J11CTCCCCCANONE 
J043024J15CTCCCCCANONE 
J075012M05CTCCCCCANONE 
J075014K21CTCCCCCANONE 
J075022G22CTCCCCCANONE 
J075075H15CTCCCCCANONE 
J075086E08CTCCCCCANONE 
J075090O05CTCCCCCANONE 
J075105A09CTCCCCCANONE 
J075127C04CTCCCCCANONE 
J075162K04CTCCCCCANONE 
J075187K10CTCCCCCANONE 
J075190G16CTCCCCCANONE 
J075194E10CTCCCCCANONE 
J090001G14CTCCCCCANONE 
J090003I23CTCCCCCANONE 
J090019B04CTCCCCCANONE 
J090046P04CTCCCCCANONE 
J100025M01CTCCCCCANONE 
J100049G13CTCCCCCANONE 
J100059G08CTCCCCCANONE 
J100078M14CTCCCCCANONE 
Os05g0202300AK109150CTCCCCCAConserved hypothetical protein. 
Os05g0207400AK070191TGGGGGAGRINGv domain containing protein. 
AK104023TGGGGGAGNONE 
Os05g0295800AK070232TGGGGGAGSimilar to Glyoxalase I (EC 4.4.1.5). 
J023043J03TGGGGGAGNONE 
Os05g0316800AK110613TGGGGGAGSimilar to Ethylene-responsive transcription factor 9 (Ethylene-responsive element binding factor 9) (EREBP-9) (AtERF9). 
J065161I18TGGGGGAGNONE 
Os05g0361700AJ575218GTGTGGGGGAGNONE 
J075074A07GTGTGGGGGAGNONE 
Os05g0388500AK065313CTCCCCCASimilar to 50S ribosomal protein L1. 
AK098990CTCCCCCANONE 
AK104689CTCCCCCANONE 
J013094L23CTCCCCCANONE 
J065118O04CTCCCCCANONE 
Os05g0392700AK058728CTCCCCCANONE 
AK073425CTCCCCCANONE 
AK104407CTCCCCCAMitochondrial substrate carrier family protein. 
Os05g0407500AK074026TGGGGGAGEsterase/lipase/thioesterase domain containing protein. 
Os05g0414200015-033-G02TGGGGGAGNONE 
AK106297TGGGGGAGDisease resistance protein family protein. 
Os05g0432700009-005-F08TGGGGGAGNONE 
009-147-C10TGGGGGAGNONE 
AK058810TGGGGGAGProteinase inhibitor I9, subtilisin propeptide domain containing protein. 
J033076D10TGGGGGAGNONE 
J065015O11TGGGGGAGNONE 
J065017B19TGGGGGAGNONE 
J065201B12TGGGGGAGNONE 
J075059E07TGGGGGAGNONE 
J075089B17TGGGGGAGNONE 
J075193C17TGGGGGAGNONE 
J080316M09TGGGGGAGNONE 
Os05g0453700009-171-G06CTCCCCCACGNONE 
015-019-F02CTCCCCCACGNONE 
AB110169CTCCCCCACGNONE 
AK063881CTCCCCCACGSimilar to ENOD18 protein (Fragment). 
AK073600CTCCCCCACGNONE 
J033048I03CTCCCCCACGNONE 
J065026A09CTCCCCCACGNONE 
J065028M08CTCCCCCACGNONE 
J075140N01CTCCCCCACGNONE 
Os05g0466600009-088-F09CTCCCCCATCCAACGGCNONE 
009-105-C11CTCCCCCATCCAACGGCNONE 
009-156-C06CTCCCCCATCCAACGGCNONE 
AK119240CTCCCCCATCCAACGGChistone H4 [Oryza sativa (japonica cultivar-group)]. 
Os05g0495900AK069244CTCCCCCACTCTSimilar to Beta-1,3-glucanase precursor (Fragment). 
J013157P10CTCCCCCACTCTNONE 
J023031M04CTCCCCCACTCTNONE 
J065063H10CTCCCCCACTCTNONE 
Os05g0506000AF031609CCCACTCCCCCANONE 
AK062012CCCACTCCCCCANONE 
AK098900CCCACTCCCCCANONE 
AK122090CCCACTCCCCCASimilar to MS5-like protein (Fragment). 
J013002B13CCCACTCCCCCANONE 
J023149G13CCCACTCCCCCANONE 
J033123O20CCCACTCCCCCANONE 
J080315O17CCCACTCCCCCANONE 
Os05g0524200AK071990CTCCCCCADual specificity protein phosphatase domain containing protein. 
Os05g0571100006-092-E08CTCCCCCANONE 
006-092-E08TGGGGGAGNONE 
006-120-A03CTCCCCCANONE 
006-120-A03TGGGGGAGNONE 
015-030-F01CTCCCCCANONE 
015-030-F01TGGGGGAGNONE 
AK068658CTCCCCCAProtein of unknown function DUF860, plant family protein. 
AK068658TGGGGGAGProtein of unknown function DUF860, plant family protein. 
AK104438CTCCCCCANONE 
AK104438TGGGGGAGNONE 
Os05g0577900016-028-C02TGGGGGAGNONE 
AK064201TGGGGGAGConserved hypothetical protein. 
Os05g0578000AK065040CTCCCCCASimilar to PEX14 protein. 
J013001H17CTCCCCCANONE 
J013036A06CTCCCCCANONE 
J033122K08CTCCCCCANONE 
Os06g0111800AK102134CTCCCCCANONE 
AK105393CTCCCCCASimilar to CSLD2 (Fragment). 
Os06g0134800014-049-H04CGCCACGTCTCTCCCCCACGCGTNONE 
AK063692CGCCACGTCTCTCCCCCACGCGTGlycine cleavage T protein (aminomethyl transferase) family protein. 
Os06g0142200AF140229CTCCCCCANONE 
J043037K21CTCCCCCANONE 
J065056F01CTCCCCCANONE 
J065076A17CTCCCCCANONE 
J065208M24CTCCCCCANONE 
J075125B21CTCCCCCANONE 
Os06g0192800AK070038CTCCCCCACGTSimilar to RING-H2 finger protein ATL1R (RING-H2 finger protein ATL8). 
J065057C13CTCCCCCACGTNONE 
J100067A03CTCCCCCACGTNONE 
Os06g0211200011-063-B02CTCCCCCANONE 
AK103188CTCCCCCASimilar to Abscisic acid responsive elements-binding factor (ABA-responsive element binding protein 1) (AREB1). 
AK105312CTCCCCCANONE 
J065214N03CTCCCCCANONE 
J090046C13CTCCCCCANONE 
J090049L03CTCCCCCANONE 
J100074P03CTCCCCCANONE 
Os06g0247800AK102187CTCCCCCASimilar to Dynamin-like protein (Fragment). 
AY224491CTCCCCCANONE 
Os06g0257450014-007-C08CTCCCCCARibonucleotide reductase family protein. 
J023123B13CTCCCCCANONE 
J033074K03CTCCCCCANONE 
J033112N11CTCCCCCANONE 
Os06g0258000AK107483CTCCCCCACACSimilar to Typical P-type R2R3 Myb protein (Fragment). 
Os06g0357800AK070985CTCCCCCAConserved hypothetical protein. 
Os06g0472400009-175-E11CTCCCCCANONE 
AK063108CTCCCCCANONE 
AK067008CTCCCCCASimilar to Transcriptional regulator. 
Os06g0499900J065053E01TGGGGGAGNONE 
J065078C19TGGGGGAGNONE 
J065122P11TGGGGGAGNONE 
J065209B15TGGGGGAGNONE 
J065218E19TGGGGGAGNONE 
Os06g0560700011-041-C04CTCCCCCANONE 
AK063332CTCCCCCALipolytic enzyme, G-D-S-L family protein. 
Os06g0602400AK106474TGGGGGAGSimilar to DEAD-box protein 3, X-chromosomal (DEAD-box RNA helicase DEAD3) (mDEAD3) (Embryonic RNA helicase) (D1PAS1 related sequence 2). 
Os06g0602600AK121619CTCCCCCAAlba, DNA/RNA-binding protein family protein. 
J033044O03CTCCCCCANONE 
J043036G04CTCCCCCANONE 
J075107E08CTCCCCCANONE 
J090060N14CTCCCCCANONE 
J090094K04CTCCCCCANONE 
Os06g0717600AK061850TGGGGGAGNONE 
AK067113TGGGGGAGZinc finger, RING-type domain containing protein. 
Os07g0106700009-004-C02GTCAGTGGGGGAGNONE 
009-037-F10GTCAGTGGGGGAGNONE 
AK060004GTCAGTGGGGGAGNONE 
AK100221GTCAGTGGGGGAGNONE 
J065041B01GTCAGTGGGGGAGNONE 
J065183O15GTCAGTGGGGGAGNONE 
J075030L24GTCAGTGGGGGAGNONE 
J075097O21GTCAGTGGGGGAGNONE 
J075109P03GTCAGTGGGGGAGNONE 
J075114J05GTCAGTGGGGGAGNONE 
J075185N04GTCAGTGGGGGAGNONE 
Os07g0134000AK103862CTCCCCCANONE 
Os07g0179000AK100008CTCCCCCANONE 
AK119398CTCCCCCAProtein prenyltransferase domain containing protein. 
AK119505CTCCCCCANONE 
Os07g0181500AK072431CTCCCCCAProtein of unknown function DUF506, plant family protein. 
Os07g0191000AK071379CTCCCCCAInositol monophosphatase family protein. 
AK103440CTCCCCCANONE 
Os07g0294800AK065831CTCCCCCAConserved hypothetical protein. 
J013037A06CTCCCCCANONE 
J065191M21CTCCCCCANONE 
Os07g0408500AK103596CTCCCCCASimilar to Rac GTPase activating protein 3 (Fragment). 
Os07g0424400AK073561CTCCCCCASimilar to Cellulose synthase-7. 
AK120236CTCCCCCANONE 
AK121193CTCCCCCANONE 
Os07g0456700AK100891CTCCCCCASimilar to (1,4)-beta-xylan endohydrolase (EC 3.2.1.8). 
Os07g0459200AK066819CTCCCCCACGTGTCNONE 
AK102099CTCCCCCACGTGTCSimilar to Possible kinase. 
Os07g0495000015-070-F12GTGGTGGGGGAGNONE 
AK060721GTGGTGGGGGAGNONE 
AK073883GTGGTGGGGGAGCupin, RmlC-type domain containing protein. 
AK119204GTGGTGGGGGAGNONE 
J033071H20GTGGTGGGGGAGNONE 
J090079B04GTGGTGGGGGAGNONE 
Os07g0501100AK110924CTCCCCCACGSimilar to Chalcone synthase 2 (EC 2.3.1.74) (Naringenin-chalcone synthase 2). 
Os07g0546700009-110-H10CTCCCCCANONE 
AK058262CTCCCCCANONE 
J065154I05CTCCCCCANONE 
J065175P09CTCCCCCANONE 
J065187F11CTCCCCCANONE 
J075114K16CTCCCCCANONE 
J090031L21CTCCCCCANONE 
U86017CTCCCCCASimilar to 60S ribosomal protein L38. 
Os07g0559100Os07g0559100TGGGGGAGConserved hypothetical protein. 
Os07g0562800AY374513TGGGGGAGTGGGMyosin heavy chain class VIII A1 protein. 
J013050C16TGGGGGAGTGGGNONE 
J013071C23TGGGGGAGTGGGNONE 
J013126F22TGGGGGAGTGGGNONE 
J013155K02TGGGGGAGTGGGNONE 
J013170J03TGGGGGAGTGGGNONE 
J033031C06TGGGGGAGTGGGNONE 
J033067N11TGGGGGAGTGGGNONE 
J033098C14TGGGGGAGTGGGNONE 
J033110O21TGGGGGAGTGGGNONE 
J090034G13TGGGGGAGTGGGNONE 
J090039H15TGGGGGAGTGGGNONE 
J090076F24TGGGGGAGTGGGNONE 
J090077N06TGGGGGAGTGGGNONE 
J090097E03TGGGGGAGTGGGNONE 
Os07g0564500AK121213TGGGGGAGPyridine nucleotide-disulphide oxidoreductase, NAD-binding region domain containing protein. 
Os07g0607800009-036-C11TGGGGGAGNONE 
Os07g0619400009-095-D09TGGGGGAGNONE 
AK062716TGGGGGAGCalcium-binding EF-hand domain containing protein. 
Os07g0638300AK101401TGGGGGAGNONE 
AK102982TGGGGGAGSimilar to 1-Cys peroxiredoxin. 
AY336994TGGGGGAGNONE 
D63917TGGGGGAGNONE 
J033044N01TGGGGGAGNONE 
J033055M23TGGGGGAGNONE 
J033057E19TGGGGGAGNONE 
J033114I23TGGGGGAGNONE 
J033115O22TGGGGGAGNONE 
J033120C03TGGGGGAGNONE 
J033121H24TGGGGGAGNONE 
J043034H13TGGGGGAGNONE 
J065029D17TGGGGGAGNONE 
J065058P20TGGGGGAGNONE 
J065062L08TGGGGGAGNONE 
J065082B12TGGGGGAGNONE 
J065131K01TGGGGGAGNONE 
J065181F09TGGGGGAGNONE 
J065200F11TGGGGGAGNONE 
J075003I12TGGGGGAGNONE 
J075006B18TGGGGGAGNONE 
J075013E13TGGGGGAGNONE 
J075013I03TGGGGGAGNONE 
J075017J08TGGGGGAGNONE 
J075019J19TGGGGGAGNONE 
J075030G22TGGGGGAGNONE 
J075037E04TGGGGGAGNONE 
J075048L18TGGGGGAGNONE 
J075056A08TGGGGGAGNONE 
J075059G05TGGGGGAGNONE 
J075062J04TGGGGGAGNONE 
J075070F14TGGGGGAGNONE 
J075072N23TGGGGGAGNONE 
J075085J23TGGGGGAGNONE 
J075091L01TGGGGGAGNONE 
J075094B10TGGGGGAGNONE 
J075098M05TGGGGGAGNONE 
J075106B18TGGGGGAGNONE 
J075116K24TGGGGGAGNONE 
J075136C06TGGGGGAGNONE 
J075137I15TGGGGGAGNONE 
J075140K14TGGGGGAGNONE 
J075147H07TGGGGGAGNONE 
J075167I19TGGGGGAGNONE 
J075182O03TGGGGGAGNONE 
J075188G23TGGGGGAGNONE 
J075194C06TGGGGGAGNONE 
Os07g0675250013-097-G10CTCCCCCANONE 
AK063620CTCCCCCAConserved hypothetical protein. 
J075026H18CTCCCCCANONE 
J075192A02CTCCCCCANONE 
Os08g0120000006-042-E02CTCCCCCANONE 
006-051-F06CTCCCCCANONE 
006-052-G03CTCCCCCANONE 
006-095-B11CTCCCCCANONE 
AB017427CTCCCCCANONE 
AB017428CTCCCCCANONE 
AK059789CTCCCCCANONE 
AK059815CTCCCCCASuccinate dehydrogenase iron-protein subunit (SDHB). 
AK099077CTCCCCCANONE 
AK102607CTCCCCCANONE 
AK104303CTCCCCCANONE 
AK104304CTCCCCCANONE 
AK104421CTCCCCCANONE 
D10414CTCCCCCANONE 
J013170D08CTCCCCCANONE 
J023086D16CTCCCCCANONE 
J033099B04CTCCCCCANONE 
J065042P05CTCCCCCANONE 
J065144E22CTCCCCCANONE 
J065162J20CTCCCCCANONE 
J065196N13CTCCCCCANONE 
J090013B11CTCCCCCANONE 
Os08g0127600AK058365TGGGGGAGHeat shock protein DnaJ, N-terminal domain containing protein. 
AK068373TGGGGGAGNONE 
J013149L10TGGGGGAGNONE 
J075027H17TGGGGGAGNONE 
J075060F10TGGGGGAGNONE 
Os08g0127700012-086-F03CTCCCCCANONE 
AK059350CTCCCCCANONE 
AK099242CTCCCCCANONE 
AK121348CTCCCCCAConserved hypothetical protein. 
J033027J18CTCCCCCANONE 
J065012F22CTCCCCCANONE 
J065046N17CTCCCCCANONE 
J065197B02CTCCCCCANONE 
J100018P04CTCCCCCANONE 
J100052C14CTCCCCCANONE 
J100083A12CTCCCCCANONE 
Os08g0178800009-155-D05GGCCGTGGTGGTGGGGGAGNONE 
AK063025GGCCGTGGTGGTGGGGGAGHypothetical protein. 
Os08g0260400Os08g0260400GGGCCCCACTCCCCCAHelix-loop-helix DNA-binding domain containing protein. 
Os08g0260600AK108529TGGGGGAGCD9/CD37/CD63 antigen family protein. 
Os08g0282000016-023-A09TGGGGGAGNONE 
AK101411TGGGGGAGCD9/CD37/CD63 antigen family protein. 
J033037J09TGGGGGAGNONE 
J090047I07TGGGGGAGNONE 
J100021H13TGGGGGAGNONE 
Os08g0304900AK063295TGGGGGAGSimilar to AtMMH-1 protein (F6D8.28 protein). 
Os08g0384100016-008-D12TGGGGGAGNONE 
AK065829TGGGGGAGDouble-stranded RNA binding domain containing protein. 
J013037D04TGGGGGAGNONE 
J075023A04TGGGGGAGNONE 
J075155J05TGGGGGAGNONE 
Os08g0448000011-022-B08CTCCCCCANONE 
AK120964CTCCCCCASimilar to 4-coumarate--CoA ligase 1 (EC 6.2.1.12) (4CL 1) (4-coumaroyl-CoA synthase 1) (Clone 4CL14) (Fragment). 
J065073D06CTCCCCCANONE 
J075026G13CTCCCCCANONE 
J075161H04CTCCCCCANONE 
J075161N08CTCCCCCANONE 
Os08g0473650J065031A07CTCCCCCAHypothetical protein. 
J065129E01CTCCCCCANONE 
J065134I05CTCCCCCANONE 
J065212K13CTCCCCCANONE 
J065217M14CTCCCCCANONE 
Os08g0502400AK106964CTCCCCCABeta-Ig-H3/fasciclin domain containing protein. 
Os08g0517200AK107078TGGGGGAGNONE 
Os08g0526100011-072-E04CGCGTCTCCCCCANONE 
AK100965CGCGTCTCCCCCANAD-dependent epimerase/dehydratase family protein. 
J023142D13CGCGTCTCCCCCANONE 
J033132L16CGCGTCTCCCCCANONE 
J090006E20CGCGTCTCCCCCANONE 
J100069L13CGCGTCTCCCCCANONE 
Os08g0542700AK100665CTCCCCCAAnkyrin repeat containing protein. 
Os08g0546700AK061056CTCCCCCARhomboid-like protein family protein. 
Os09g0111800004-013-C09CGTGGGGGAGNONE 
006-085-E01CGTGGGGGAGNONE 
016-037-E02CGTGGGGGAGNONE 
AK060898CGTGGGGGAGNONE 
AK069338CGTGGGGGAGRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J013039A09CGTGGGGGAGNONE 
J023012N03CGTGGGGGAGNONE 
J033029N15CGTGGGGGAGNONE 
J033064E17CGTGGGGGAGNONE 
J080305G19CGTGGGGGAGNONE 
J080305N02CGTGGGGGAGNONE 
J080306B09CGTGGGGGAGNONE 
J080310C20CGTGGGGGAGNONE 
J080311A20CGTGGGGGAGNONE 
J080311G17CGTGGGGGAGNONE 
J080316J11CGTGGGGGAGNONE 
J090054J05CGTGGGGGAGNONE 
J090055M10CGTGGGGGAGNONE 
J090059H08CGTGGGGGAGNONE 
Os09g0293900Os09g0293900TGGGGGAGPeptidylprolyl isomerase, FKBP-type domain containing protein. 
Os09g0309500J100027L22CTCCCCCACACConserved hypothetical protein. 
Os09g0313500AK065687TGGGGGAGDisease resistance protein family protein. 
J013039H12TGGGGGAGNONE 
J090060B10TGGGGGAGNONE 
Os09g0324000AK107774CTCCCCCACCACSimilar to Oleosin. 
AK119722CTCCCCCACCACNONE 
J065205O11CTCCCCCACCACNONE 
J075150L22CTCCCCCACCACNONE 
Os09g0360400009-192-H06CTCCCCCANONE 
AK071395CTCCCCCAConserved hypothetical protein. 
J013045J21CTCCCCCANONE 
J023095O09CTCCCCCANONE 
J065207K01CTCCCCCANONE 
Os09g0400700009-060-D04CCCACTCCCCCANONE 
009-104-G09CCCACTCCCCCANONE 
009-106-D08CCCACTCCCCCANONE 
014-041-F03CCCACTCCCCCANONE 
AK062784CCCACTCCCCCAConserved hypothetical protein. 
Os09g0417800AK067834TGGGGGAGWRKY transcription factor 62. 
Os09g0445500AK120514CTCCCCCACTCCZinc finger, C2H2-type domain containing protein. 
J013124A16CTCCCCCACTCCNONE 
Os09g0446800AK061999TGGGGGAGNONE 
J013049P03TGGGGGAGNONE 
J013055J11TGGGGGAGNONE 
J013070P19TGGGGGAGNONE 
J013072C09TGGGGGAGNONE 
J013108I17TGGGGGAGNONE 
J013118L14TGGGGGAGNONE 
J013123A14TGGGGGAGNONE 
J013124L24TGGGGGAGNONE 
J013128P10TGGGGGAGNONE 
J013134H01TGGGGGAGNONE 
J013152O16TGGGGGAGNONE 
J013153N08TGGGGGAGNONE 
J013157H14TGGGGGAGNONE 
J013158P14TGGGGGAGNONE 
J023066A03TGGGGGAGNONE 
J023086N13TGGGGGAGNONE 
J023103G22TGGGGGAGNONE 
J023114B07TGGGGGAGNONE 
J033071D05TGGGGGAGNONE 
J033098F14TGGGGGAGNONE 
J033099H02TGGGGGAGNONE 
J043017M24TGGGGGAGNONE 
J090011H01TGGGGGAGNONE 
J090017C01TGGGGGAGNONE 
J090029F09TGGGGGAGNONE 
J090041K03TGGGGGAGNONE 
Os09g0559900AK111842CTCCCCCAProtein kinase-like domain containing protein. 
Os09g0568800AK059234CTCCCCCASimilar to Ribosomal protein S25 (40S ribosomal 25S subunit). 
J033140B10CTCCCCCANONE 
J033142B10CTCCCCCANONE 
J065011L22CTCCCCCANONE 
J065030J07CTCCCCCANONE 
J065038K20CTCCCCCANONE 
J065040B12CTCCCCCANONE 
J065056B12CTCCCCCANONE 
J065064L14CTCCCCCANONE 
J065116B03CTCCCCCANONE 
J065128E10CTCCCCCANONE 
J065135B14CTCCCCCANONE 
J065143F21CTCCCCCANONE 
J065197F15CTCCCCCANONE 
J075011K03CTCCCCCANONE 
J075015B17CTCCCCCANONE 
J075021I04CTCCCCCANONE 
J075025G18CTCCCCCANONE 
J075030E17CTCCCCCANONE 
J075034A22CTCCCCCANONE 
J075035C18CTCCCCCANONE 
J075081E22CTCCCCCANONE 
J075090F16CTCCCCCANONE 
J075120P07CTCCCCCANONE 
J075151D16CTCCCCCANONE 
J075183B11CTCCCCCANONE 
J075187N12CTCCCCCANONE 
J075195N06CTCCCCCANONE 
J080008P04CTCCCCCANONE 
J080009D04CTCCCCCANONE 
J080017F06CTCCCCCANONE 
J080030A10CTCCCCCANONE 
J080031K06CTCCCCCANONE 
J080044N14CTCCCCCANONE 
J080046B13CTCCCCCANONE 
J080046I07CTCCCCCANONE 
J080047D05CTCCCCCANONE 
J080050F09CTCCCCCANONE 
J080059H13CTCCCCCANONE 
J080071G18CTCCCCCANONE 
J080074K19CTCCCCCANONE 
J080082L07CTCCCCCANONE 
J080086N23CTCCCCCANONE 
J080088H05CTCCCCCANONE 
J080088P03CTCCCCCANONE 
J080090N24CTCCCCCANONE 
J080093G02CTCCCCCANONE 
J080311L14CTCCCCCANONE 
J090021N07CTCCCCCANONE 
J100045I01CTCCCCCANONE 
J100057A16CTCCCCCANONE 
Os11g0176000AK105568TGGGGGAGWD40-like domain containing protein. 
Os11g0216400Os11g0216400CTCCCCCAProteinase inhibitor, propeptide domain containing protein. 
Os11g0294400009-034-C04TGGGGGAGNONE 
AK062429TGGGGGAGWW/Rsp5/WWP domain containing protein. 
J065019M12TGGGGGAGNONE 
Os11g0448400AB095094TGGGGGAGSimilar to Sigma factor SIG2A. 
J075053H03TGGGGGAGNONE 
J075062F23TGGGGGAGNONE 
J090029D08TGGGGGAGNONE 
Os11g0525800AK059719TGGGGGAGACGTGSimilar to ADL308Cp. 
J065171D14TGGGGGAGACGTGNONE 
J075048H22TGGGGGAGACGTGNONE 
J075121D14TGGGGGAGACGTGNONE 
J075136P16TGGGGGAGACGTGNONE 
Os11g0547000AK100677CTCCCCCASimilar to FKF1. 
Os11g0586300AK072257CTCCCCCACGTConserved hypothetical protein. 
Os11g0660500009-031-D10CTCCCCCANONE 
009-100-G09CTCCCCCANONE 
009-162-G10CTCCCCCANONE 
009-183-H11CTCCCCCANONE 
013-010-B11CTCCCCCANONE 
013-050-A05CTCCCCCANONE 
013-070-E10CTCCCCCANONE 
AK105453CTCCCCCASimilar to Translationally controlled tumor protein (Fragment). 
D12626CTCCCCCANONE 
J013128M15CTCCCCCANONE 
J023004I19CTCCCCCANONE 
J033114F08CTCCCCCANONE 
J033147I20CTCCCCCANONE 
J065031M04CTCCCCCANONE 
J065033J03CTCCCCCANONE 
J065038E01CTCCCCCANONE 
J065048O06CTCCCCCANONE 
J065054E01CTCCCCCANONE 
J065075N08CTCCCCCANONE 
J065080C07CTCCCCCANONE 
J065096A12CTCCCCCANONE 
J065115P22CTCCCCCANONE 
J065122I21CTCCCCCANONE 
J065127A13CTCCCCCANONE 
J065158B06CTCCCCCANONE 
J065162E04CTCCCCCANONE 
J065162E05CTCCCCCANONE 
J065163L06CTCCCCCANONE 
J065177B16CTCCCCCANONE 
J065181M15CTCCCCCANONE 
J065201G15CTCCCCCANONE 
J065202J06CTCCCCCANONE 
J075002B19CTCCCCCANONE 
J075008G19CTCCCCCANONE 
J075010P05CTCCCCCANONE 
J075018H23CTCCCCCANONE 
J075051E18CTCCCCCANONE 
J075053C24CTCCCCCANONE 
J075077B06CTCCCCCANONE 
J075080B11CTCCCCCANONE 
J075083M04CTCCCCCANONE 
J075085H01CTCCCCCANONE 
J075109E11CTCCCCCANONE 
J075111O09CTCCCCCANONE 
J075130D13CTCCCCCANONE 
J075132H13CTCCCCCANONE 
J075147H19CTCCCCCANONE 
J075148J01CTCCCCCANONE 
J075159A18CTCCCCCANONE 
J075166F03CTCCCCCANONE 
J075191F09CTCCCCCANONE 
J075192K09CTCCCCCANONE 
J080006P15CTCCCCCANONE 
J080013J18CTCCCCCANONE 
J080023O06CTCCCCCANONE 
J080024I17CTCCCCCANONE 
J080029P03CTCCCCCANONE 
J080030C14CTCCCCCANONE 
J080038K15CTCCCCCANONE 
J080042I15CTCCCCCANONE 
J080053L07CTCCCCCANONE 
J080061H12CTCCCCCANONE 
J080064H24CTCCCCCANONE 
J080066J20CTCCCCCANONE 
J080074N07CTCCCCCANONE 
J080079F16CTCCCCCANONE 
J080079O07CTCCCCCANONE 
J080092E15CTCCCCCANONE 
J080301F19CTCCCCCANONE 
J080302O21CTCCCCCANONE 
J080306L02CTCCCCCANONE 
J080307F16CTCCCCCANONE 
J080307G01CTCCCCCANONE 
J080307K01CTCCCCCANONE 
J080309O22CTCCCCCANONE 
J080311E17CTCCCCCANONE 
J080311N08CTCCCCCANONE 
J080312O12CTCCCCCANONE 
J080315C08CTCCCCCANONE 
J080316D07CTCCCCCANONE 
J080318C17CTCCCCCANONE 
J090004B08CTCCCCCANONE 
J090009K02CTCCCCCANONE 
J090025O15CTCCCCCANONE 
J090026L03CTCCCCCANONE 
J090036P17CTCCCCCANONE 
J090047A21CTCCCCCANONE 
J090053O03CTCCCCCANONE 
J090059C04CTCCCCCANONE 
J090062O21CTCCCCCANONE 
J090064M11CTCCCCCANONE 
J090070C14CTCCCCCANONE 
J090075I03CTCCCCCANONE 
J090081G22CTCCCCCANONE 
J090083E18CTCCCCCANONE 
J090084A05CTCCCCCANONE 
J100019L11CTCCCCCANONE 
J100022D16CTCCCCCANONE 
J100042F09CTCCCCCANONE 
J100051J12CTCCCCCANONE 
J100065G21CTCCCCCANONE 
J100066D08CTCCCCCANONE 
J100069H04CTCCCCCANONE 
J100078I16CTCCCCCANONE 
J100090D15CTCCCCCANONE 
Os12g0131300J090086B06TGGGGGAGHypothetical protein. 
Os12g0170400012-013-C12CTCCCCCANONE 
012-078-F04CTCCCCCANONE 
016-038-B08CTCCCCCANONE 
AK121826CTCCCCCAZinc finger, C2H2-type domain containing protein. 
J033086P08CTCCCCCANONE 
J033099G14CTCCCCCANONE 
J065019L01CTCCCCCANONE 
J065093E18CTCCCCCANONE 
J065138J04CTCCCCCANONE 
J065139B14CTCCCCCANONE 
J065193K21CTCCCCCANONE 
J075005D01CTCCCCCANONE 
J075057B19CTCCCCCANONE 
J075061A15CTCCCCCANONE 
J075105N16CTCCCCCANONE 
J075146K15CTCCCCCANONE 
J100026B22CTCCCCCANONE 
Os12g0183100AK060732CTCCCCCASimilar to Branched chain alpha-keto acid dehydrogenase E1-alpha subunit (Fragment). 
Os12g0235800AK071066CTCCCCCACCAACSimilar to Argininosuccinate synthase (Fragment). 
Os12g0273700AK071152TGGGGGAGConserved hypothetical protein. 
Os12g0488900AK068902CTCCCCCAArmadillo-like helical domain containing protein. 
Os12g0498800AK067767CTCCCCCAConserved hypothetical protein. 
J065073G03CTCCCCCANONE 
J065102I05CTCCCCCANONE 
Os12g0547100009-053-F04CCCACTCCCCCANONE 
009-080-H03CCCACTCCCCCANONE 
AK105589CCCACTCCCCCAConserved hypothetical protein. 
AK121480CCCACTCCCCCANONE 
J023149J02CCCACTCCCCCANONE 
Os12g0620400015-008-B10CTCCCCCACGNONE 
015-008-B10TGGGGGAGGGCCGGGNONE 
AK059006CTCCCCCACGNONE 
AK059006TGGGGGAGGGCCGGGNONE 
AK059973CTCCCCCACGNONE 
AK059973TGGGGGAGGGCCGGGNONE 
AK063843CTCCCCCACGMethyl-CpG binding domain containing protein. 
AK063843TGGGGGAGGGCCGGGMethyl-CpG binding domain containing protein. 
AK072503CTCCCCCACGNONE 
AK072503TGGGGGAGGGCCGGGNONE 
AK072934CTCCCCCACGNONE 
AK072934TGGGGGAGGGCCGGGNONE 
J023126H05CTCCCCCACGNONE 
J023126H05TGGGGGAGGGCCGGGNONE 
J023131G11CTCCCCCACGNONE 
J023131G11TGGGGGAGGGCCGGGNONE 
J023146E17CTCCCCCACGNONE 
J023146E17TGGGGGAGGGCCGGGNONE 
J033064P08CTCCCCCACGNONE 
J033064P08TGGGGGAGGGCCGGGNONE 
J033095L07CTCCCCCACGNONE 
J033095L07TGGGGGAGGGCCGGGNONE 
J065101N06CTCCCCCACGNONE 
J065101N06TGGGGGAGGGCCGGGNONE 
J065186F11CTCCCCCACGNONE 
J065186F11TGGGGGAGGGCCGGGNONE 
J065215J15CTCCCCCACGNONE 
J065215J15TGGGGGAGGGCCGGGNONE 
J080049H05CTCCCCCACGNONE 
J080049H05TGGGGGAGGGCCGGGNONE 
J080059L05CTCCCCCACGNONE 
J080059L05TGGGGGAGGGCCGGGNONE 
J080061M17CTCCCCCACGNONE 
J080061M17TGGGGGAGGGCCGGGNONE 
J080063D16CTCCCCCACGNONE 
J080063D16TGGGGGAGGGCCGGGNONE 
J090012D01CTCCCCCACGNONE 
J090012D01TGGGGGAGGGCCGGGNONE 
J090023D20CTCCCCCACGNONE 
J090023D20TGGGGGAGGGCCGGGNONE 
J090040A09CTCCCCCACGNONE 
J090040A09TGGGGGAGGGCCGGGNONE 
J090044K08CTCCCCCACGNONE 
J090044K08TGGGGGAGGGCCGGGNONE 
J100019H03CTCCCCCACGNONE 
J100019H03TGGGGGAGGGCCGGGNONE 
J100054N04CTCCCCCACGNONE 
J100054N04TGGGGGAGGGCCGGGNONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.