version

Summary of OsREG575 (All List)

OrganismOryza sativa  
IDOsREG575  
SequenceCTCGGCCC  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count1798  

Entry Sequences (1798 entries)

LocusGene modelSequenceDescription
Os01g0104600AK058683CTCGGCCCNONE 
AK100613CTCGGCCCSimilar to Light-mediated development protein DET1 (Deetiolated1 homolog) (tDET1) (High pigmentation protein 2) (Protein dark green). 
J075195M06CTCGGCCCNONE 
J090042G02CTCGGCCCNONE 
Os01g0155600006-048-F03ATCTCGGCCCATANONE 
AK060171ATCTCGGCCCATANONE 
AK071635ATCTCGGCCCATASimilar to Splicing factor RSZ33. 
J023080A03ATCTCGGCCCATANONE 
J023100L15ATCTCGGCCCATANONE 
J033075I17ATCTCGGCCCATANONE 
J033085O09ATCTCGGCCCATANONE 
J033105E15ATCTCGGCCCATANONE 
J033132N10ATCTCGGCCCATANONE 
J033132P12ATCTCGGCCCATANONE 
J033149H12ATCTCGGCCCATANONE 
J043026M03ATCTCGGCCCATANONE 
J080305J10ATCTCGGCCCATANONE 
J080308K03ATCTCGGCCCATANONE 
J090023M04ATCTCGGCCCATANONE 
J090078F24ATCTCGGCCCATANONE 
J100066P05ATCTCGGCCCATANONE 
Os01g0156300AK107993CTCGGCCCSimilar to Cappuccino protein. 
Os01g0166800AK073783ATCTCGGCCCGGCConserved hypothetical protein. 
AK099378ATCTCGGCCCGGCNONE 
J033026H10ATCTCGGCCCGGCNONE 
J033067O18ATCTCGGCCCGGCNONE 
J033108A17ATCTCGGCCCGGCNONE 
J065015J11ATCTCGGCCCGGCNONE 
J065204P09ATCTCGGCCCGGCNONE 
Os01g0191800AK061360TCTCGGCCCAGTANONE 
Os01g0221300011-021-E12TCTCGGCCCAACANONE 
AK073330TCTCGGCCCAACAConserved hypothetical protein. 
J013130J18TCTCGGCCCAACANONE 
J033024A12TCTCGGCCCAACANONE 
J065063H09TCTCGGCCCAACANONE 
J065093G05TCTCGGCCCAACANONE 
J090007K12TCTCGGCCCAACANONE 
Os01g0231700012-002-F11ATATGGGCCGGGCCGAGNONE 
013-082-F05ATATGGGCCGGGCCGAGNONE 
AK107453ATATGGGCCGGGCCGAGSimilar to 60S acidic ribosomal protein P2-B (CaRP2B). 
J065005L22ATATGGGCCGGGCCGAGNONE 
J065023E21ATATGGGCCGGGCCGAGNONE 
J065036H21ATATGGGCCGGGCCGAGNONE 
J065037M24ATATGGGCCGGGCCGAGNONE 
J065049L04ATATGGGCCGGGCCGAGNONE 
J065072F17ATATGGGCCGGGCCGAGNONE 
J065085H10ATATGGGCCGGGCCGAGNONE 
J065109N19ATATGGGCCGGGCCGAGNONE 
J065117M19ATATGGGCCGGGCCGAGNONE 
J065144C15ATATGGGCCGGGCCGAGNONE 
J065159G24ATATGGGCCGGGCCGAGNONE 
J065164N14ATATGGGCCGGGCCGAGNONE 
J075025K16ATATGGGCCGGGCCGAGNONE 
J075057L05ATATGGGCCGGGCCGAGNONE 
J075070I16ATATGGGCCGGGCCGAGNONE 
J075089D10ATATGGGCCGGGCCGAGNONE 
J075138F10ATATGGGCCGGGCCGAGNONE 
J090018C11ATATGGGCCGGGCCGAGNONE 
J100018L19ATATGGGCCGGGCCGAGNONE 
J100024B14ATATGGGCCGGGCCGAGNONE 
J100048L02ATATGGGCCGGGCCGAGNONE 
J100055A22ATATGGGCCGGGCCGAGNONE 
J100069K01ATATGGGCCGGGCCGAGNONE 
Os01g0272600015-046-G06CTCGGCCCCACACNONE 
AK067786CTCGGCCCCACACConserved hypothetical protein. 
Os01g0286000AK109824AACGGGCCGTAAGTGGGCCGAGSnf7 family protein. 
Os01g0306100AK111041TTATGGGCCGAGAPlant specific eukaryotic initiation factor 4B family protein. 
Os01g0309800AK110758GGGCCGAGASimilar to Hydrogenase expression/formation protein hypB. 
J065065I19GGGCCGAGANONE 
J065167H24GGGCCGAGANONE 
J065173I11GGGCCGAGANONE 
J075055J21GGGCCGAGANONE 
Os01g0327600AK120216CTCGGCCCGNONE 
AK121799CTCGGCCCGConserved hypothetical protein. 
J065081I07CTCGGCCCGNONE 
J065082D04CTCGGCCCGNONE 
J065082G10CTCGGCCCGNONE 
J065085G24CTCGGCCCGNONE 
J065105J24CTCGGCCCGNONE 
J065128D18CTCGGCCCGNONE 
J065155D13CTCGGCCCGNONE 
J065200C11CTCGGCCCGNONE 
Os01g0530366J075001P06CTCGGCCCAAAANONE 
J075006K21CTCGGCCCAAAARNA polymerase Rbp10 domain containing protein. 
J075030G13CTCGGCCCAAAANONE 
Os01g0558600006-120-G12ATCTCGGCCCGGCCCGGCCCAACTNONE 
J013100N20ATCTCGGCCCGGCCCGGCCCAACTNONE 
J033043P09ATCTCGGCCCGGCCCGGCCCAACTNONE 
J033125M18ATCTCGGCCCGGCCCGGCCCAACTNONE 
J053043N11ATCTCGGCCCGGCCCGGCCCAACTNONE 
J065008E07ATCTCGGCCCGGCCCGGCCCAACTNONE 
J065080O16ATCTCGGCCCGGCCCGGCCCAACTNONE 
J075002G24ATCTCGGCCCGGCCCGGCCCAACTNONE 
J075123C09ATCTCGGCCCGGCCCGGCCCAACTNONE 
S66160ATCTCGGCCCGGCCCGGCCCAACTRas-related protein RIC1. 
Os01g0582400AK069484AATGGGCCGTAATCTCGGCCCGTTSimilar to Multidomain cyclophilin type peptidyl-prolyl cis-trans isomerase. 
J023019D12AATGGGCCGTAATCTCGGCCCGTTNONE 
J023036F15AATGGGCCGTAATCTCGGCCCGTTNONE 
J023095O16AATGGGCCGTAATCTCGGCCCGTTNONE 
J033102M15AATGGGCCGTAATCTCGGCCCGTTNONE 
J043013I06AATGGGCCGTAATCTCGGCCCGTTNONE 
J065083M21AATGGGCCGTAATCTCGGCCCGTTNONE 
J065176A17AATGGGCCGTAATCTCGGCCCGTTNONE 
Os01g0588700AK066951CTCGGCCCGGTProtein of unknown function DUF572 family protein. 
AK071911CTCGGCCCGGTNONE 
J013059D18CTCGGCCCGGTNONE 
J013090C12CTCGGCCCGGTNONE 
J090043F17CTCGGCCCGGTNONE 
Os01g0604100AK099765AAATGGGCCGAGCCCAACTUspA domain containing protein. 
J013094O21AAATGGGCCGAGCCCAACTNONE 
Os01g0647000006-044-B06CTCGGCCCCCGCGNONE 
AK061541CTCGGCCCCCGCGNONE 
J075138L22CTCGGCCCCCGCGNONE 
J080315F03CTCGGCCCCCGCGNONE 
Os01g0650000009-079-D11CTCGGCCCCAGNONE 
AK062640CTCGGCCCCAGLipolytic enzyme, G-D-S-L family protein. 
AK072891CTCGGCCCCAGNONE 
J075163B04CTCGGCCCCAGNONE 
J075182F14CTCGGCCCCAGNONE 
Os01g0672700AK121375TCTCGGCCCGDNA polymerase, beta-like region domain containing protein. 
J023127C22TCTCGGCCCGNONE 
J033092B05TCTCGGCCCGNONE 
J033129P21TCTCGGCCCGNONE 
J065079H18TCTCGGCCCGNONE 
Os01g0678600009-114-H06CTCGGCCCAGCNONE 
AK063019CTCGGCCCAGCNONE 
AK071536CTCGGCCCAGCNONE 
AK120629CTCGGCCCAGCRibosomal protein S20 family protein. 
J013045E23CTCGGCCCAGCNONE 
J013153D21CTCGGCCCAGCNONE 
J013157A14CTCGGCCCAGCNONE 
J023048M04CTCGGCCCAGCNONE 
J065006P11CTCGGCCCAGCNONE 
J065042O14CTCGGCCCAGCNONE 
J065080D15CTCGGCCCAGCNONE 
J065096M02CTCGGCCCAGCNONE 
J065109M14CTCGGCCCAGCNONE 
J065204H02CTCGGCCCAGCNONE 
J065207L21CTCGGCCCAGCNONE 
J075028D22CTCGGCCCAGCNONE 
J075040O12CTCGGCCCAGCNONE 
J075051O03CTCGGCCCAGCNONE 
J075071M13CTCGGCCCAGCNONE 
J075151H15CTCGGCCCAGCNONE 
J075153D16CTCGGCCCAGCNONE 
J075153I21CTCGGCCCAGCNONE 
J080311L16CTCGGCCCAGCNONE 
J100053A20CTCGGCCCAGCNONE 
J100071P19CTCGGCCCAGCNONE 
Os01g0720700J033124M22GGGCCGAGNONE 
J065006G21GGGCCGAGNONE 
J065025M24GGGCCGAGNONE 
J065041J02GGGCCGAGNONE 
J065044B14GGGCCGAGNONE 
J065061J06GGGCCGAGNONE 
J065116L21GGGCCGAGNONE 
J075030F18GGGCCGAGNONE 
J075034K17GGGCCGAGNONE 
J075063I02GGGCCGAGNONE 
J075110D21GGGCCGAGSimilar to Serine acetyltransferase. 
J075188L15GGGCCGAGNONE 
J075197B17GGGCCGAGNONE 
Os01g0764600AK060621CGGATCGGGCCGAGFosfomycin resistance kinase FomA family protein. 
AK060621GTTTGGGCCGAGAFosfomycin resistance kinase FomA family protein. 
J013111L18CGGATCGGGCCGAGNONE 
J013111L18GTTTGGGCCGAGANONE 
J013134N08CGGATCGGGCCGAGNONE 
J013134N08GTTTGGGCCGAGANONE 
Os01g0766200AK069471GGGCCGAGZinc finger, RING-type domain containing protein. 
AK070278GGGCCGAGNONE 
J013074F08GGGCCGAGNONE 
J023023M16GGGCCGAGNONE 
J023049F08GGGCCGAGNONE 
J065061D21GGGCCGAGNONE 
J100083B13GGGCCGAGNONE 
Os01g0842200003-126-E01TCTCGGCCCAGGNONE 
AK102593TCTCGGCCCAGGNONE 
AK119896TCTCGGCCCAGGSimilar to Scarecrow-like 9 (Fragment). 
J013151G12TCTCGGCCCAGGNONE 
J033098G15TCTCGGCCCAGGNONE 
J090041L03TCTCGGCCCAGGNONE 
J090069J20TCTCGGCCCAGGNONE 
Os01g0850400AJ575220GGGCCGAGAGGCCCACGCGNONE 
AK108582GGGCCGAGAGGCCCACGCGSimilar to MYBY1 protein (Fragment). 
Os01g0853800006-033-H02CTCGGCCCGNONE 
006-037-A10CTCGGCCCGNONE 
006-038-F10CTCGGCCCGNONE 
006-054-E01CTCGGCCCGNONE 
006-067-E10CTCGGCCCGNONE 
012-015-G05CTCGGCCCGNONE 
AK069147CTCGGCCCGC2 calcium/lipid-binding region, CaLB domain containing protein. 
AK105929CTCGGCCCGNONE 
AK106144CTCGGCCCGNONE 
AK106186CTCGGCCCGNONE 
J023007P09CTCGGCCCGNONE 
J023007P10CTCGGCCCGNONE 
J065084L10CTCGGCCCGNONE 
J065179B10CTCGGCCCGNONE 
J065186D16CTCGGCCCGNONE 
J075040I08CTCGGCCCGNONE 
J075043K21CTCGGCCCGNONE 
J075051J08CTCGGCCCGNONE 
J075061D24CTCGGCCCGNONE 
J075095H04CTCGGCCCGNONE 
J075145J12CTCGGCCCGNONE 
J075148O18CTCGGCCCGNONE 
J075187J05CTCGGCCCGNONE 
J090042A20CTCGGCCCGNONE 
J100025K01CTCGGCCCGNONE 
Os01g0870100AK103428CTCGGCCCGCACGCCTCNONE 
Os01g0872700AK066633CTCGGCCCAAAANONE 
AK100381CTCGGCCCAAAAPutative 5-3 exonuclease domain containing protein. 
J013028K13CTCGGCCCAAAANONE 
J013038C19CTCGGCCCAAAANONE 
J023024P16CTCGGCCCAAAANONE 
J023074N21CTCGGCCCAAAANONE 
J023085E21CTCGGCCCAAAANONE 
J033034K14CTCGGCCCAAAANONE 
J033044N04CTCGGCCCAAAANONE 
J033052O10CTCGGCCCAAAANONE 
J033087J09CTCGGCCCAAAANONE 
J033129L17CTCGGCCCAAAANONE 
J033143O07CTCGGCCCAAAANONE 
J065014M22CTCGGCCCAAAANONE 
J065025H10CTCGGCCCAAAANONE 
J065051H21CTCGGCCCAAAANONE 
J065123E05CTCGGCCCAAAANONE 
J065181P03CTCGGCCCAAAANONE 
J100064B21CTCGGCCCAAAANONE 
Os01g0877500AK101067CTCGGCCCGProtein of unknown function UPF0054 family protein. 
Os01g0878800AK070438GGGCCGAGNONE 
AK104297GGGCCGAGNONE 
AK105779GGGCCGAGNONE 
Os01g0908400009-140-E01TCTCGGCCCGNONE 
AK062957TCTCGGCCCGConserved hypothetical protein. 
AK099301TCTCGGCCCGNONE 
J065123M13TCTCGGCCCGNONE 
J075020O14TCTCGGCCCGNONE 
J075136L21TCTCGGCCCGNONE 
Os01g0950900AK101121AGTGGGCCGAGProtein of unknown function DUF221 domain containing protein. 
J023036H24AGTGGGCCGAGNONE 
J023084G23AGTGGGCCGAGNONE 
J033025J04AGTGGGCCGAGNONE 
J033139J18AGTGGGCCGAGNONE 
J090006A09AGTGGGCCGAGNONE 
J090036D02AGTGGGCCGAGNONE 
Os01g0971600AK070366GTTTGGGCCGAGSimilar to Sn-glycerol-3-phosphate dehydrogenase (Fragment). 
Os01g0973400AK060011AGATGGGCCGGGCCGGGCCGAGCCGNONE 
AK068879AGATGGGCCGGGCCGGGCCGAGCCGConserved hypothetical protein 48 family protein. 
AK099210AGATGGGCCGGGCCGGGCCGAGCCGNONE 
AK104863AGATGGGCCGGGCCGGGCCGAGCCGNONE 
J013170C09AGATGGGCCGGGCCGGGCCGAGCCGNONE 
J033106K13AGATGGGCCGGGCCGGGCCGAGCCGNONE 
J075018P18AGATGGGCCGGGCCGGGCCGAGCCGNONE 
J075039C18AGATGGGCCGGGCCGGGCCGAGCCGNONE 
J075104L18AGATGGGCCGGGCCGGGCCGAGCCGNONE 
Os01g0978400009-028-D08CTCGGCCCNONE 
AK062411CTCGGCCCNAD-dependent epimerase/dehydratase family protein. 
Os02g0115900AF006825ATCTCGGCCCGTTNONE 
AK065743ATCTCGGCCCGTTEndosperm lumenal binding protein. 
AK119653ATCTCGGCCCGTTNONE 
Os02g0130300011-005-D07AAATGGGCCGAGNONE 
011-041-B06AAATGGGCCGAGNONE 
015-099-D11AAATGGGCCGAGNONE 
016-049-D06AAATGGGCCGAGNONE 
AK102708AAATGGGCCGAGZinc finger, RING-type domain containing protein. 
Os02g0136800011-089-E11CTCGGCCCATTNONE 
AK070727CTCGGCCCATTNONE 
AK103485CTCGGCCCATTProtein of unknown function DUF1677, Oryza sativa family protein. 
J023058D10CTCGGCCCATTNONE 
J033140H14CTCGGCCCATTNONE 
J033142H14CTCGGCCCATTNONE 
J065151O09CTCGGCCCATTNONE 
J090076K09CTCGGCCCATTNONE 
J090085K04CTCGGCCCATTNONE 
Os02g0149700AK103492CGGGCCGAGExo70 exocyst complex subunit family protein. 
Os02g0176300AK066588TGTTGGGCTTGGGCCTCGGCCCAGGConserved hypothetical protein. 
J013072N24TGTTGGGCTTGGGCCTCGGCCCAGGNONE 
Os02g0188500AK102004AGCCCATACAACTGGGCCTCGGCCCATCANONE 
AK106917AGCCCATACAACTGGGCCTCGGCCCATCAUbiquitin domain containing protein. 
J090039N13AGCCCATACAACTGGGCCTCGGCCCATCANONE 
Os02g0193500009-092-G09CTCGGCCCGGCCCNONE 
009-092-G09TCTCGGCCCATCANONE 
AK101237CTCGGCCCGGCCCHypothetical protein. 
AK101237TCTCGGCCCATCAHypothetical protein. 
J033031K13CTCGGCCCGGCCCNONE 
J033031K13TCTCGGCCCATCANONE 
J033034P12CTCGGCCCGGCCCNONE 
J033034P12TCTCGGCCCATCANONE 
J080304L19CTCGGCCCGGCCCNONE 
J080304L19TCTCGGCCCATCANONE 
J100059N21CTCGGCCCGGCCCNONE 
J100059N21TCTCGGCCCATCANONE 
Os02g0198000AK067695TGTGGGCCGAGProtein of unknown function DUF1677, Oryza sativa family protein. 
Os02g0252100AF139211GGGCCGAGANONE 
AK062577GGGCCGAGASimilar to SC35-like splicing factor SCL30, 30 kD. 
AK099051GGGCCGAGANONE 
J013156E01GGGCCGAGANONE 
J065001D02GGGCCGAGANONE 
J065042A05GGGCCGAGANONE 
J065116H01GGGCCGAGANONE 
J065167P13GGGCCGAGANONE 
J065168N07GGGCCGAGANONE 
J075093G21GGGCCGAGANONE 
J075109H15GGGCCGAGANONE 
J075194P17GGGCCGAGANONE 
Os02g0510300AK067961CTCGGCCCACAConserved hypothetical protein. 
AK104001CTCGGCCCACANONE 
J013123J20CTCGGCCCACANONE 
J065169H15CTCGGCCCACANONE 
Os02g0556100006-100-D03GGGCCGAGNONE 
AK059938GGGCCGAGNONE 
AK103125GGGCCGAGNAD-dependent epimerase/dehydratase family protein. 
J033107B22GGGCCGAGNONE 
J033119M03GGGCCGAGNONE 
J033120L06GGGCCGAGNONE 
J043007B02GGGCCGAGNONE 
J043012G03GGGCCGAGNONE 
J043024A02GGGCCGAGNONE 
J043027J18GGGCCGAGNONE 
J100019E06GGGCCGAGNONE 
J100069C22GGGCCGAGNONE 
Os02g0626100005-017-F11CTCGGCCCGCANONE 
AK058306CTCGGCCCGCANONE 
Os02g0638000AK103830ACATGGGCCGAGATCGGCCCAACTNONE 
AK106548ACATGGGCCGAGATCGGCCCAACTConserved hypothetical protein. 
Os02g0643500AK068423TCTCGGCCCACAAPentapeptide repeat containing protein. 
Os02g0658500012-083-D01CTCGGCCCCACGNONE 
016-061-E08CTCGGCCCCACGNONE 
AK099591CTCGGCCCCACGConserved hypothetical protein. 
AK107591CTCGGCCCCACGNONE 
J013043M11CTCGGCCCCACGNONE 
J100025J18CTCGGCCCCACGNONE 
J100059C10CTCGGCCCCACGNONE 
Os02g0712550J065112A12CTCGGCCCHypothetical protein. 
J065134N11CTCGGCCCNONE 
Os02g0717600J090003H19CGGCTCGGCCCNONE 
J100090A12CGGCTCGGCCCConserved hypothetical protein. 
Os02g0741500AK068867CCATGGGCCTTGGGCCGAGRibbon-helix-helix domain containing protein. 
Os02g0741900009-042-A12CGGGCCGAGNONE 
AK068461CGGGCCGAGConserved hypothetical protein. 
J065203C15CGGGCCGAGNONE 
Os02g0767100011-054-E05AGATGGGCCGAGNONE 
AK063351AGATGGGCCGAGNONE 
AK103640AGATGGGCCGAGConserved hypothetical protein. 
J090022G11AGATGGGCCGAGNONE 
J090072L18AGATGGGCCGAGNONE 
Os02g0776800AB042415ACGTGGGCCGAGNONE 
AK072308ACGTGGGCCGAGReplication protein A 70kDa. 
AK101212ACGTGGGCCGAGNONE 
J033031B02ACGTGGGCCGAGNONE 
J090004E18ACGTGGGCCGAGNONE 
J090084C24ACGTGGGCCGAGNONE 
Os02g0788500006-024-A02AGATGGGCCGAGNONE 
006-031-G02AGATGGGCCGAGNONE 
006-081-F11AGATGGGCCGAGNONE 
006-082-H05AGATGGGCCGAGNONE 
AK061452AGATGGGCCGAGConserved hypothetical protein. 
AK104117AGATGGGCCGAGNONE 
AK104526AGATGGGCCGAGNONE 
J075024D11AGATGGGCCGAGNONE 
J075056B12AGATGGGCCGAGNONE 
J075108H12AGATGGGCCGAGNONE 
J075156P10AGATGGGCCGAGNONE 
J075197A19AGATGGGCCGAGNONE 
Os02g0791300J100026B09TCTCGGCCCAGANONE 
J100039D05TCTCGGCCCAGAHelix-loop-helix DNA-binding domain containing protein. 
Os02g0804300006-046-D12TCTCGGCCCATTTCACGTGTCNONE 
AK060165TCTCGGCCCATTTCACGTGTCNONE 
AK067584TCTCGGCCCATTTCACGTGTCSAM (and some other nucleotide) binding motif domain containing protein. 
J013112C12TCTCGGCCCATTTCACGTGTCNONE 
J023098C22TCTCGGCCCATTTCACGTGTCNONE 
J033123P06TCTCGGCCCATTTCACGTGTCNONE 
J065060N24TCTCGGCCCATTTCACGTGTCNONE 
J065069H22TCTCGGCCCATTTCACGTGTCNONE 
J065155N20TCTCGGCCCATTTCACGTGTCNONE 
J065170K07TCTCGGCCCATTTCACGTGTCNONE 
J090033D12TCTCGGCCCATTTCACGTGTCNONE 
Os02g0819700AK067374CTCGGCCCAGTTZinc finger, Zim17-type family protein. 
AK099160CTCGGCCCAGTTNONE 
J100086K17CTCGGCCCAGTTNONE 
Os02g0826200AK070787CTCGGCCCGdTDP-4-dehydrorhamnose reductase family protein. 
J075022D14CTCGGCCCGNONE 
Os02g0834700AK061331CTCGGCCCAAATNONE 
AK067965CTCGGCCCAAATSimilar to Cell division inhibitor. 
Os03g0108000014-001-C09AACGGGCCGAGNONE 
AK102520AACGGGCCGAGSimilar to Dual specificity phosphatase Cdc25 (EC 3.1.3.48) (Arath;CDC25). 
J023083K07AACGGGCCGAGNONE 
J023110F13AACGGGCCGAGNONE 
J033095O09AACGGGCCGAGNONE 
J065219M15AACGGGCCGAGNONE 
J075009G03AACGGGCCGAGNONE 
J080301C17AACGGGCCGAGNONE 
J080301I02AACGGGCCGAGNONE 
J080301O05AACGGGCCGAGNONE 
J080305C08AACGGGCCGAGNONE 
J080305D11AACGGGCCGAGNONE 
J080311B05AACGGGCCGAGNONE 
J080316A17AACGGGCCGAGNONE 
J080317K12AACGGGCCGAGNONE 
J100087M06AACGGGCCGAGNONE 
Os03g0157300011-050-C09CTCGGCCCNONE 
AK063160CTCGGCCCNONE 
AK103362CTCGGCCCProtein of unknown function Cys-rich family protein. 
J013059E20CTCGGCCCNONE 
J013157F18CTCGGCCCNONE 
J033055M12CTCGGCCCNONE 
J033058M02CTCGGCCCNONE 
J033066C15CTCGGCCCNONE 
J033095K18CTCGGCCCNONE 
J033099M11CTCGGCCCNONE 
J033126N07CTCGGCCCNONE 
J033149O14CTCGGCCCNONE 
J090015B11CTCGGCCCNONE 
J090017C22CTCGGCCCNONE 
J090018L20CTCGGCCCNONE 
J090031I01CTCGGCCCNONE 
Os03g0157700015-011-D01CGCGCGACGCGGGCCGAGNONE 
AK102075CGCGCGACGCGGGCCGAGProtein of unknown function DUF639 family protein. 
AK106245CGCGCGACGCGGGCCGAGNONE 
J075144I02CGCGCGACGCGGGCCGAGNONE 
Os03g0162200009-031-E05GTTTGGGCCGAGNONE 
013-049-D04GTTTGGGCCGAGNONE 
013-082-E03GTTTGGGCCGAGNONE 
014-039-G04GTTTGGGCCGAGNONE 
014-098-G11GTTTGGGCCGAGNONE 
AK061605GTTTGGGCCGAGNONE 
AK121533GTTTGGGCCGAGSimilar to Histone H2A. 
J033024D06GTTTGGGCCGAGNONE 
J033030P21GTTTGGGCCGAGNONE 
J065063C20GTTTGGGCCGAGNONE 
J065064A18GTTTGGGCCGAGNONE 
J065147G02GTTTGGGCCGAGNONE 
J065204K06GTTTGGGCCGAGNONE 
J090004C22GTTTGGGCCGAGNONE 
J090014K02GTTTGGGCCGAGNONE 
J090074E10GTTTGGGCCGAGNONE 
J090086L09GTTTGGGCCGAGNONE 
Os03g0177100AK068092GGGCCGAGCCGConserved hypothetical protein. 
J100036F01GGGCCGAGCCGNONE 
J100040N06GGGCCGAGCCGNONE 
J100043E08GGGCCGAGCCGNONE 
Os03g0249400009-059-H08AGTTGGGCCGAGANONE 
AK062522AGTTGGGCCGAGASimilar to 40S ribosomal protein S20 (S22) (Fragment). 
J053031I05AGTTGGGCCGAGANONE 
J053052E06AGTTGGGCCGAGANONE 
J053061K22AGTTGGGCCGAGANONE 
J065108I02AGTTGGGCCGAGANONE 
Os03g0251500AK101151CTCGGCCCCACANONE 
AK119298CTCGGCCCCACASimilar to T-cell immune regulator 1 transcript variant 3 (Fragment). 
Os03g0277500014-019-A09CTCGGCCCGNONE 
AK063650CTCGGCCCGGlyoxalase/bleomycin resistance protein/dioxygenase domain containing protein. 
J065043F18CTCGGCCCGNONE 
J065092A08CTCGGCCCGNONE 
J065122E17CTCGGCCCGNONE 
J065182K12CTCGGCCCGNONE 
J065197H15CTCGGCCCGNONE 
J075115A05CTCGGCCCGNONE 
Os03g0283100006-097-E01ATTTGGGCCGAGNONE 
AK061849ATTTGGGCCGAGNONE 
AK065887ATTTGGGCCGAGSimilar to In2-1 protein. 
J013044J05ATTTGGGCCGAGNONE 
J013130I02ATTTGGGCCGAGNONE 
J013162M18ATTTGGGCCGAGNONE 
J023014O17ATTTGGGCCGAGNONE 
J023139N17ATTTGGGCCGAGNONE 
Os03g0299600009-037-H11TCTCGGCCCAGACTGACAGNONE 
011-072-E02TCTCGGCCCAGACTGACAGNONE 
AK068151TCTCGGCCCAGACTGACAGWound-induced WI12 family protein. 
J013132L05TCTCGGCCCAGACTGACAGNONE 
J023012P15TCTCGGCCCAGACTGACAGNONE 
J023022H03TCTCGGCCCAGACTGACAGNONE 
J023026N15TCTCGGCCCAGACTGACAGNONE 
J023056A21TCTCGGCCCAGACTGACAGNONE 
J023093P10TCTCGGCCCAGACTGACAGNONE 
J075143J10TCTCGGCCCAGACTGACAGNONE 
J075166I19TCTCGGCCCAGACTGACAGNONE 
J090010G13TCTCGGCCCAGACTGACAGNONE 
J090033D23TCTCGGCCCAGACTGACAGNONE 
J090090L22TCTCGGCCCAGACTGACAGNONE 
Os03g0302700006-099-F12ATCTCGGCCCGNONE 
AK112010ATCTCGGCCCGZinc finger, RING-type domain containing protein. 
AK121656ATCTCGGCCCGNONE 
J075090A19ATCTCGGCCCGNONE 
J075148M06ATCTCGGCCCGNONE 
Os03g0321800006-065-G02GGCCGTGGGCCGAGANONE 
AK061075GGCCGTGGGCCGAGANONE 
AK111447GGCCGTGGGCCGAGASimilar to WRKY transcription factor 55. 
J065122E07GGCCGTGGGCCGAGANONE 
J065187N05GGCCGTGGGCCGAGANONE 
J065214K09GGCCGTGGGCCGAGANONE 
J090050M01GGCCGTGGGCCGAGANONE 
Os03g0333000AK109811TGATGGGCCGAGConserved hypothetical protein. 
J065152D04TGATGGGCCGAGNONE 
J090011B05TGATGGGCCGAGNONE 
Os03g0333100AK101050CTCGGCCCATCAProtein of unknown function DUF663 domain containing protein. 
Os03g0336000AK100067CTCGGCCCATCTProtein prenyltransferase domain containing protein. 
J065161K02CTCGGCCCATCTNONE 
J065162C21CTCGGCCCATCTNONE 
Os03g0337600AF119232CTCGGCCCAGTNONE 
AK070859CTCGGCCCAGTSimilar to Uroporphyrinogen decarboxylase (EC 4.1.1.37) (URO-D) (UPD) (Fragment). 
J013110I18CTCGGCCCAGTNONE 
J013147M17CTCGGCCCAGTNONE 
J065083M01CTCGGCCCAGTNONE 
J065199H24CTCGGCCCAGTNONE 
Os03g0340700011-070-H05CGGGCCGAGTTGGGCCTANONE 
AK100470CGGGCCGAGTTGGGCCTATetratricopeptide-like helical domain containing protein. 
J013158I08CGGGCCGAGTTGGGCCTANONE 
J023009H24CGGGCCGAGTTGGGCCTANONE 
J023031L20CGGGCCGAGTTGGGCCTANONE 
J023093E24CGGGCCGAGTTGGGCCTANONE 
J023105J11CGGGCCGAGTTGGGCCTANONE 
J100059O05CGGGCCGAGTTGGGCCTANONE 
J100075G03CGGGCCGAGTTGGGCCTANONE 
J100086J06CGGGCCGAGTTGGGCCTANONE 
Os03g0343500009-042-G06CTCGGCCCATTANONE 
009-063-D01CTCGGCCCATTANONE 
009-156-H09CTCGGCCCATTANONE 
AB117995CTCGGCCCATTANONE 
AK058737CTCGGCCCATTANONE 
AK059599CTCGGCCCATTASimilar to 60S ribosomal protein L22-2. 
AK121502CTCGGCCCATTANONE 
J023082D10CTCGGCCCATTANONE 
J033022G11CTCGGCCCATTANONE 
J075048M16CTCGGCCCATTANONE 
J075049O20CTCGGCCCATTANONE 
J075082I02CTCGGCCCATTANONE 
J075105G01CTCGGCCCATTANONE 
J075131K05CTCGGCCCATTANONE 
J080002H01CTCGGCCCATTANONE 
J080003H01CTCGGCCCATTANONE 
J080005G08CTCGGCCCATTANONE 
J080011M13CTCGGCCCATTANONE 
J080020M02CTCGGCCCATTANONE 
J080026N24CTCGGCCCATTANONE 
J080028L09CTCGGCCCATTANONE 
J080032O14CTCGGCCCATTANONE 
J080033J12CTCGGCCCATTANONE 
J080035D05CTCGGCCCATTANONE 
J080039H01CTCGGCCCATTANONE 
J080044B07CTCGGCCCATTANONE 
J080044E23CTCGGCCCATTANONE 
J080049N11CTCGGCCCATTANONE 
J080050A21CTCGGCCCATTANONE 
J080055L24CTCGGCCCATTANONE 
J080059N20CTCGGCCCATTANONE 
J080061F04CTCGGCCCATTANONE 
J080078I16CTCGGCCCATTANONE 
J080079G24CTCGGCCCATTANONE 
J080080K13CTCGGCCCATTANONE 
J080083G20CTCGGCCCATTANONE 
J080087B08CTCGGCCCATTANONE 
J080091L19CTCGGCCCATTANONE 
J080094D06CTCGGCCCATTANONE 
J090038L06CTCGGCCCATTANONE 
J090075H06CTCGGCCCATTANONE 
J090081D12CTCGGCCCATTANONE 
Os03g0448600AK111867CTCGGCCCATGWD40-like domain containing protein. 
Os03g0566800AK103270AGTGGGCCGAGSimilar to Eukaryotic initiation factor 4A-3 (eIF4A-3) (eIF-4A-3). 
J023063L18AGTGGGCCGAGNONE 
J023136P06AGTGGGCCGAGNONE 
J033081A22AGTGGGCCGAGNONE 
J033109N12AGTGGGCCGAGNONE 
J033124H10AGTGGGCCGAGNONE 
J033141B09AGTGGGCCGAGNONE 
J090026G23AGTGGGCCGAGNONE 
J090077J20AGTGGGCCGAGNONE 
Os03g0647500015-025-E10CTCGGCCCACAANONE 
AK064308CTCGGCCCACAAConserved hypothetical protein. 
AK103649CTCGGCCCACAANONE 
J033135D01CTCGGCCCACAANONE 
Os03g0703300016-074-H01CTCGGCCCGGANONE 
AK073831CTCGGCCCGGACalponin-like actin-binding domain containing protein. 
Os03g0737600014-094-E01TACTGGGCCGAGCCGNONE 
AB038234TACTGGGCCGAGCCGNONE 
AK101854TACTGGGCCGAGCCGCyclin H-1. 
AK105468TACTGGGCCGAGCCGNONE 
J033069N12TACTGGGCCGAGCCGNONE 
J043017A22TACTGGGCCGAGCCGNONE 
J065154A20TACTGGGCCGAGCCGNONE 
Os03g0744800AK059983TCTCGGCCCAGCCCAAATemp24/gp25L/p24 family protein. 
J065067D01TCTCGGCCCAGCCCAAATNONE 
J065122L19TCTCGGCCCAGCCCAAATNONE 
J090041I03TCTCGGCCCAGCCCAAATNONE 
J100039H03TCTCGGCCCAGCCCAAATNONE 
Os03g0749900006-112-A05CTCGGCCCACCTAGGCCCATTTNONE 
AK061252CTCGGCCCACCTAGGCCCATTTConserved hypothetical protein. 
J023020I01CTCGGCCCACCTAGGCCCATTTNONE 
J033060N21CTCGGCCCACCTAGGCCCATTTNONE 
Os03g0758800AJ252135CGGGCCGAGCCGAATGGGCCGGCNONE 
AJ312906CGGGCCGAGCCGAATGGGCCGGCNONE 
AK060387CGGGCCGAGCCGAATGGGCCGGCSimilar to Eukaryotic translation initiation factor 5A-2 (eIF-5A-2) (eIF-4D). 
AK121592CGGGCCGAGCCGAATGGGCCGGCNONE 
J023109G09CGGGCCGAGCCGAATGGGCCGGCNONE 
J033038B14CGGGCCGAGCCGAATGGGCCGGCNONE 
J043013C09CGGGCCGAGCCGAATGGGCCGGCNONE 
J053096E21CGGGCCGAGCCGAATGGGCCGGCNONE 
J065026B08CGGGCCGAGCCGAATGGGCCGGCNONE 
J065062B16CGGGCCGAGCCGAATGGGCCGGCNONE 
J065066E03CGGGCCGAGCCGAATGGGCCGGCNONE 
J065091J12CGGGCCGAGCCGAATGGGCCGGCNONE 
J065164A06CGGGCCGAGCCGAATGGGCCGGCNONE 
J075014I20CGGGCCGAGCCGAATGGGCCGGCNONE 
J075117N07CGGGCCGAGCCGAATGGGCCGGCNONE 
J075142M03CGGGCCGAGCCGAATGGGCCGGCNONE 
J075175D04CGGGCCGAGCCGAATGGGCCGGCNONE 
J075188M01CGGGCCGAGCCGAATGGGCCGGCNONE 
J075199I20CGGGCCGAGCCGAATGGGCCGGCNONE 
J090010J12CGGGCCGAGCCGAATGGGCCGGCNONE 
J090025O16CGGGCCGAGCCGAATGGGCCGGCNONE 
J090041H05CGGGCCGAGCCGAATGGGCCGGCNONE 
J090078P07CGGGCCGAGCCGAATGGGCCGGCNONE 
J100031K10CGGGCCGAGCCGAATGGGCCGGCNONE 
J100055F23CGGGCCGAGCCGAATGGGCCGGCNONE 
J100064G05CGGGCCGAGCCGAATGGGCCGGCNONE 
J100080C24CGGGCCGAGCCGAATGGGCCGGCNONE 
J100080O07CGGGCCGAGCCGAATGGGCCGGCNONE 
J100090F01CGGGCCGAGCCGAATGGGCCGGCNONE 
Os03g0784400AK103474CAAGCCCAATGGGCCGAGAProtein of unknown function DUF1692 domain containing protein. 
J023135I15CAAGCCCAATGGGCCGAGANONE 
J033130D12CAAGCCCAATGGGCCGAGANONE 
J043035E20CAAGCCCAATGGGCCGAGANONE 
J065206K15CAAGCCCAATGGGCCGAGANONE 
J075053J20CAAGCCCAATGGGCCGAGANONE 
J075129B11CAAGCCCAATGGGCCGAGANONE 
J090003E22CAAGCCCAATGGGCCGAGANONE 
J100023E23CAAGCCCAATGGGCCGAGANONE 
Os03g0784900006-053-H11CGATGGGCCGAGANONE 
009-165-F11CGATGGGCCGAGANONE 
AK060949CGATGGGCCGAGAConserved hypothetical protein. 
AK099097CGATGGGCCGAGANONE 
J023019M19CGATGGGCCGAGANONE 
J065024O11CGATGGGCCGAGANONE 
J065106D20CGATGGGCCGAGANONE 
J065201L15CGATGGGCCGAGANONE 
J075031B04CGATGGGCCGAGANONE 
J075033C19CGATGGGCCGAGANONE 
J075035F11CGATGGGCCGAGANONE 
J075074K14CGATGGGCCGAGANONE 
J075083A22CGATGGGCCGAGANONE 
J075120O10CGATGGGCCGAGANONE 
J075153L20CGATGGGCCGAGANONE 
J075159G02CGATGGGCCGAGANONE 
J080001J18CGATGGGCCGAGANONE 
J080015I03CGATGGGCCGAGANONE 
J080027E23CGATGGGCCGAGANONE 
J080046D24CGATGGGCCGAGANONE 
J080053B17CGATGGGCCGAGANONE 
J080070P07CGATGGGCCGAGANONE 
J080076D18CGATGGGCCGAGANONE 
J080078E13CGATGGGCCGAGANONE 
J080090H03CGATGGGCCGAGANONE 
J100024F19CGATGGGCCGAGANONE 
J100052D15CGATGGGCCGAGANONE 
J100079B14CGATGGGCCGAGANONE 
Os03g0793700AK121667CCCATCCATCTCGGCCCCupin 1 domain containing protein. 
AY098743CCCATCCATCTCGGCCCNONE 
Os03g0795900012-092-G05CTCGGCCCAATNONE 
015-043-D09CTCGGCCCAATNONE 
016-078-G11CTCGGCCCAATNONE 
AK068660CTCGGCCCAATSimilar to Heat shock transcription factor 31 (Fragment). 
J013162K14CTCGGCCCAATNONE 
J023001L04CTCGGCCCAATNONE 
J053032K11CTCGGCCCAATNONE 
J065059E10CTCGGCCCAATNONE 
J065095H19CTCGGCCCAATNONE 
J065181M06CTCGGCCCAATNONE 
J100047D11CTCGGCCCAATNONE 
J100068G04CTCGGCCCAATNONE 
Os03g0802300AK120564AGTGGGCCTTGGGCCGAGAConserved hypothetical protein. 
AK120687AGTGGGCCTTGGGCCGAGANONE 
Os03g0803800012-043-D10TCTCGGCCCAATANONE 
AK063484TCTCGGCCCAATAConserved hypothetical protein. 
Os03g0824500AK058990TCATGGGCCGAGCCGConserved hypothetical protein. 
J065057L18TCATGGGCCGAGCCGNONE 
J065083L02TCATGGGCCGAGCCGNONE 
J065086L24TCATGGGCCGAGCCGNONE 
J065121L10TCATGGGCCGAGCCGNONE 
J065168N03TCATGGGCCGAGCCGNONE 
J100035J22TCATGGGCCGAGCCGNONE 
J100050G18TCATGGGCCGAGCCGNONE 
J100055F15TCATGGGCCGAGCCGNONE 
Os03g0831100AK103115CTCGGCCCAGTArmadillo-like helical domain containing protein. 
J033119F15CTCGGCCCAGTNONE 
J065011M19CTCGGCCCAGTNONE 
J075019I08CTCGGCCCAGTNONE 
J075047A01CTCGGCCCAGTNONE 
J075096P21CTCGGCCCAGTNONE 
J075121I05CTCGGCCCAGTNONE 
J075121I07CTCGGCCCAGTNONE 
J090063F13CTCGGCCCAGTNONE 
J090068F16CTCGGCCCAGTNONE 
J090094E14CTCGGCCCAGTNONE 
Os03g0836200009-165-F07CTCGGCCCACAAGCGGCCCAACTNONE 
015-092-G01CTCGGCCCACAAGCGGCCCAACTNONE 
AK058443CTCGGCCCACAAGCGGCCCAACTNONE 
AK067084CTCGGCCCACAAGCGGCCCAACTSimilar to RNA-binding protein RZ-1. 
AK101225CTCGGCCCACAAGCGGCCCAACTNONE 
J013092A03CTCGGCCCACAAGCGGCCCAACTNONE 
J013095N17CTCGGCCCACAAGCGGCCCAACTNONE 
J013147J18CTCGGCCCACAAGCGGCCCAACTNONE 
J023019O10CTCGGCCCACAAGCGGCCCAACTNONE 
J023065N18CTCGGCCCACAAGCGGCCCAACTNONE 
J033113E18CTCGGCCCACAAGCGGCCCAACTNONE 
J033133E03CTCGGCCCACAAGCGGCCCAACTNONE 
J065059J15CTCGGCCCACAAGCGGCCCAACTNONE 
J065075O11CTCGGCCCACAAGCGGCCCAACTNONE 
J065119I07CTCGGCCCACAAGCGGCCCAACTNONE 
J065171J03CTCGGCCCACAAGCGGCCCAACTNONE 
J090016D21CTCGGCCCACAAGCGGCCCAACTNONE 
J090081O03CTCGGCCCACAAGCGGCCCAACTNONE 
J100040G18CTCGGCCCACAAGCGGCCCAACTNONE 
J100040L10CTCGGCCCACAAGCGGCCCAACTNONE 
J100055H13CTCGGCCCACAAGCGGCCCAACTNONE 
J100059I22CTCGGCCCACAAGCGGCCCAACTNONE 
J100078A08CTCGGCCCACAAGCGGCCCAACTNONE 
Os03g0852900011-012-A12GGGCCGAGNONE 
AK100660GGGCCGAGSimilar to Cleavage and polyadenylation specificity factor, 73 kDa subunit (CPSF 73 kDa subunit). 
J013073D18GGGCCGAGNONE 
J013152K17GGGCCGAGNONE 
J023111N01GGGCCGAGNONE 
J065214G07GGGCCGAGNONE 
J090080E10GGGCCGAGNONE 
Os04g0378200AK103076TGATGGGCCGAGSterile alpha motif SAM domain containing protein. 
J033118E02TGATGGGCCGAGNONE 
J065065F15TGATGGGCCGAGNONE 
J090080I24TGATGGGCCGAGNONE 
Os04g0396800009-077-F11GGGCCGAGNONE 
AK062632GGGCCGAGNONE 
Os04g0413600009-142-B05CTCGGCCCAATANONE 
AK121192CTCGGCCCAATASimilar to 40S ribosomal protein S14 (Clone MCH2). 
J023086F11CTCGGCCCAATANONE 
J065085D06CTCGGCCCAATANONE 
J075062H12CTCGGCCCAATANONE 
J075072I22CTCGGCCCAATANONE 
J075074H21CTCGGCCCAATANONE 
J075087L16CTCGGCCCAATANONE 
J075088D11CTCGGCCCAATANONE 
J075115N15CTCGGCCCAATANONE 
J100064G10CTCGGCCCAATANONE 
J100080E09CTCGGCCCAATANONE 
Os04g0436100AK072631TCTCGGCCCGPhenylacetic acid degradation-related protein domain containing protein. 
J023132I18TCTCGGCCCGNONE 
J065112K15TCTCGGCCCGNONE 
J065138F04TCTCGGCCCGNONE 
J075078D03TCTCGGCCCGNONE 
J090090K17TCTCGGCCCGNONE 
Os04g0484900AK122179GGGCCGAGATSimilar to Kluyveromyces lactis strain NRRL Y-1140 chromosome E of strain NRRL Y- 1140 of Kluyveromyces lactis. 
J023093A12GGGCCGAGATNONE 
J033024H07GGGCCGAGATNONE 
J033149C03GGGCCGAGATNONE 
Os04g0502300009-116-F02TCAGGCCCATCTCGGCCCACTCTNONE 
009-130-H06TCAGGCCCATCTCGGCCCACTCTNONE 
AK120520TCAGGCCCATCTCGGCCCACTCTSimilar to 40S ribosomal protein S11. 
J013124K01TCAGGCCCATCTCGGCCCACTCTNONE 
J023102F03TCAGGCCCATCTCGGCCCACTCTNONE 
J033094F17TCAGGCCCATCTCGGCCCACTCTNONE 
J053054C22TCAGGCCCATCTCGGCCCACTCTNONE 
J065024N13TCAGGCCCATCTCGGCCCACTCTNONE 
J065083J18TCAGGCCCATCTCGGCCCACTCTNONE 
J065132O14TCAGGCCCATCTCGGCCCACTCTNONE 
J065156M09TCAGGCCCATCTCGGCCCACTCTNONE 
J065176N15TCAGGCCCATCTCGGCCCACTCTNONE 
J065208H08TCAGGCCCATCTCGGCCCACTCTNONE 
J075054B03TCAGGCCCATCTCGGCCCACTCTNONE 
J090053E20TCAGGCCCATCTCGGCCCACTCTNONE 
J100075B09TCAGGCCCATCTCGGCCCACTCTNONE 
J100089H12TCAGGCCCATCTCGGCCCACTCTNONE 
Os04g0508000AK071432ATTGGGCCGAGATProtein of unknown function DUF231, plant domain containing protein. 
Os04g0508100009-180-A02AACTGGGCCGAGTCATGGGCCGCANONE 
009-180-A02ATCTCGGCCCAATNONE 
AK121759AACTGGGCCGAGTCATGGGCCGCAConserved hypothetical protein. 
AK121759ATCTCGGCCCAATConserved hypothetical protein. 
J023007G10AACTGGGCCGAGTCATGGGCCGCANONE 
J023007G10ATCTCGGCCCAATNONE 
J033089A17AACTGGGCCGAGTCATGGGCCGCANONE 
J033089A17ATCTCGGCCCAATNONE 
J065193E13AACTGGGCCGAGTCATGGGCCGCANONE 
J065193E13ATCTCGGCCCAATNONE 
J075025M02AACTGGGCCGAGTCATGGGCCGCANONE 
J075025M02ATCTCGGCCCAATNONE 
J075027J10AACTGGGCCGAGTCATGGGCCGCANONE 
J075027J10ATCTCGGCCCAATNONE 
J075030N03AACTGGGCCGAGTCATGGGCCGCANONE 
J075030N03ATCTCGGCCCAATNONE 
J075045I20AACTGGGCCGAGTCATGGGCCGCANONE 
J075045I20ATCTCGGCCCAATNONE 
J075065E04AACTGGGCCGAGTCATGGGCCGCANONE 
J075065E04ATCTCGGCCCAATNONE 
J075134M16AACTGGGCCGAGTCATGGGCCGCANONE 
J075134M16ATCTCGGCCCAATNONE 
J075140B10AACTGGGCCGAGTCATGGGCCGCANONE 
J075140B10ATCTCGGCCCAATNONE 
Os04g0520900AK068793TCTCGGCCCAAATProtein prenyltransferase domain containing protein. 
AK105606TCTCGGCCCAAATNONE 
Os04g0530400AK067634CTCGGCCCAGTt-snare domain containing protein. 
Os04g0611300009-006-G08AGATGGGCCGAGATNONE 
009-011-C01AGATGGGCCGAGATNONE 
009-036-B09AGATGGGCCGAGATNONE 
009-116-G09AGATGGGCCGAGATNONE 
009-126-E09AGATGGGCCGAGATNONE 
009-132-F09AGATGGGCCGAGATNONE 
009-151-G07AGATGGGCCGAGATNONE 
009-155-C07AGATGGGCCGAGATNONE 
009-163-G01AGATGGGCCGAGATNONE 
009-169-G08AGATGGGCCGAGATNONE 
009-191-B02AGATGGGCCGAGATNONE 
009-196-A08AGATGGGCCGAGATNONE 
009-198-E07AGATGGGCCGAGATNONE 
014-015-F04AGATGGGCCGAGATNONE 
015-087-H04AGATGGGCCGAGATNONE 
AK062605AGATGGGCCGAGATNONE 
AK063022AGATGGGCCGAGATConserved hypothetical protein. 
AK066749AGATGGGCCGAGATNONE 
AK104924AGATGGGCCGAGATNONE 
J065002M20AGATGGGCCGAGATNONE 
J065045L23AGATGGGCCGAGATNONE 
J065101E05AGATGGGCCGAGATNONE 
J065140J23AGATGGGCCGAGATNONE 
J065179G11AGATGGGCCGAGATNONE 
J065191B18AGATGGGCCGAGATNONE 
J065192E03AGATGGGCCGAGATNONE 
J065199H21AGATGGGCCGAGATNONE 
J075067F01AGATGGGCCGAGATNONE 
J075089L01AGATGGGCCGAGATNONE 
J075147K22AGATGGGCCGAGATNONE 
J080069G23AGATGGGCCGAGATNONE 
J100053D10AGATGGGCCGAGATNONE 
J100078C10AGATGGGCCGAGATNONE 
Os04g0612800016-010-G05TGGATGGGCCGAGCACGGCCCAAANONE 
AK071230TGGATGGGCCGAGCACGGCCCAAAProtein prenyltransferase domain containing protein. 
Os04g0627000AK101563TCCGGGCCGAGANONE 
Os04g0659400AK070174CTCGGCCCGGAENT domain containing protein. 
Os04g0667600009-131-H09CTCGGCCCNONE 
009-200-A04CTCGGCCCNONE 
AK068657CTCGGCCCHeavy metal transport/detoxification protein domain containing protein. 
J065013M12CTCGGCCCNONE 
J065024H17CTCGGCCCNONE 
J065025P10CTCGGCCCNONE 
J065028I11CTCGGCCCNONE 
J065044K11CTCGGCCCNONE 
J065045B14CTCGGCCCNONE 
J065052B02CTCGGCCCNONE 
J065061F20CTCGGCCCNONE 
J065061K16CTCGGCCCNONE 
J065063E12CTCGGCCCNONE 
J065065E16CTCGGCCCNONE 
J065082M02CTCGGCCCNONE 
J065084O10CTCGGCCCNONE 
J065096H18CTCGGCCCNONE 
J065122F02CTCGGCCCNONE 
J065131F09CTCGGCCCNONE 
J065139P06CTCGGCCCNONE 
J065148L17CTCGGCCCNONE 
J065164D23CTCGGCCCNONE 
J065167M17CTCGGCCCNONE 
J065174B15CTCGGCCCNONE 
J065176G01CTCGGCCCNONE 
J065186K17CTCGGCCCNONE 
J065186N05CTCGGCCCNONE 
J065213N24CTCGGCCCNONE 
J075001P17CTCGGCCCNONE 
J075004A15CTCGGCCCNONE 
J075007B03CTCGGCCCNONE 
J075026D23CTCGGCCCNONE 
J075032D17CTCGGCCCNONE 
J075058C22CTCGGCCCNONE 
J075080L14CTCGGCCCNONE 
J075094K18CTCGGCCCNONE 
J075097K15CTCGGCCCNONE 
J075098E02CTCGGCCCNONE 
J075104D11CTCGGCCCNONE 
J075120L16CTCGGCCCNONE 
J075126A18CTCGGCCCNONE 
J075129M08CTCGGCCCNONE 
J075143N14CTCGGCCCNONE 
J075146D07CTCGGCCCNONE 
J075149L10CTCGGCCCNONE 
J075171F22CTCGGCCCNONE 
J090058C05CTCGGCCCNONE 
J100018N19CTCGGCCCNONE 
J100024K09CTCGGCCCNONE 
J100036F15CTCGGCCCNONE 
J100042A15CTCGGCCCNONE 
J100042P14CTCGGCCCNONE 
J100051N18CTCGGCCCNONE 
J100055K14CTCGGCCCNONE 
J100056F05CTCGGCCCNONE 
J100058L10CTCGGCCCNONE 
J100083J17CTCGGCCCNONE 
J100086N07CTCGGCCCNONE 
Os04g0674100J080097J12TAATGGGCCGAGThioredoxin-like fold domain containing protein. 
Os04g0674200AK101965CTCGGCCCATTANONE 
AK103795CTCGGCCCATTACoenzyme Q biosynthesis Coq4 family protein. 
J033076F14CTCGGCCCATTANONE 
J065020P20CTCGGCCCATTANONE 
J065057I21CTCGGCCCATTANONE 
J065059P11CTCGGCCCATTANONE 
J065083A22CTCGGCCCATTANONE 
J065093K10CTCGGCCCATTANONE 
J065097D03CTCGGCCCATTANONE 
J065103P05CTCGGCCCATTANONE 
J065113K09CTCGGCCCATTANONE 
J065118F23CTCGGCCCATTANONE 
J065119M06CTCGGCCCATTANONE 
J065146K17CTCGGCCCATTANONE 
J065161N12CTCGGCCCATTANONE 
J065169L02CTCGGCCCATTANONE 
J065189H12CTCGGCCCATTANONE 
J065192E24CTCGGCCCATTANONE 
J065193K17CTCGGCCCATTANONE 
J065197O21CTCGGCCCATTANONE 
J065214D09CTCGGCCCATTANONE 
J065217B11CTCGGCCCATTANONE 
J075132K07CTCGGCCCATTANONE 
J100059D14CTCGGCCCATTANONE 
Os04g0674350J065104O14TCTCGGCCCATGGNONE 
J065118J19TCTCGGCCCATGGNONE 
J065167I12TCTCGGCCCATGGHypothetical protein. 
Os04g0683800011-050-B05CTCGGCCCGGCCCNONE 
AK073897CTCGGCCCGGCCCSimilar to Phosphoribosyltransferase (Fragment). 
AK102910CTCGGCCCGGCCCNONE 
J033075A06CTCGGCCCGGCCCNONE 
J033079F23CTCGGCCCGGCCCNONE 
J033093D20CTCGGCCCGGCCCNONE 
J033099B18CTCGGCCCGGCCCNONE 
J033129G13CTCGGCCCGGCCCNONE 
J065075F21CTCGGCCCGGCCCNONE 
J065093M19CTCGGCCCGGCCCNONE 
J075023K10CTCGGCCCGGCCCNONE 
J075046J08CTCGGCCCGGCCCNONE 
J090003I20CTCGGCCCGGCCCNONE 
J090017L12CTCGGCCCGGCCCNONE 
J090024B04CTCGGCCCGGCCCNONE 
J090033A20CTCGGCCCGGCCCNONE 
J090083F02CTCGGCCCGGCCCNONE 
Os05g0129900AK060436ATCTCGGCCCATGAAAAGCCCTetratricopeptide-like helical domain containing protein. 
AK102515ATCTCGGCCCATGAAAAGCCCNONE 
Os05g0182700003-102-E07TTGTGGGCCGAGATNONE 
011-019-D04TTGTGGGCCGAGATNONE 
013-068-D09TTGTGGGCCGAGATNONE 
014-032-G03TTGTGGGCCGAGATNONE 
AK065911TTGTGGGCCGAGATProtein of unknown function DUF1664 family protein. 
AK104343TTGTGGGCCGAGATNONE 
J013045E01TTGTGGGCCGAGATNONE 
J013156L15TTGTGGGCCGAGATNONE 
J023029P17TTGTGGGCCGAGATNONE 
J023134I24TTGTGGGCCGAGATNONE 
J033099A10TTGTGGGCCGAGATNONE 
J033115L16TTGTGGGCCGAGATNONE 
J090007M24TTGTGGGCCGAGATNONE 
J090019F02TTGTGGGCCGAGATNONE 
Os05g0304200009-059-H05CTCGGCCCATAANONE 
AK099372CTCGGCCCATAANONE 
AK112073CTCGGCCCATAAPAP fibrillin family protein. 
Os05g0344400Os05g0344400CTCGGCCCProtein of unknown function DUF588 family protein. 
Os05g0358000006-083-G07CTCGGCCCCACCAACNONE 
AK061141CTCGGCCCCACCAACNONE 
AK070900CTCGGCCCCACCAACNONE 
AK101263CTCGGCCCCACCAACDrought induced 19 family protein. 
J023098C13CTCGGCCCCACCAACNONE 
J033032J06CTCGGCCCCACCAACNONE 
J065014A09CTCGGCCCCACCAACNONE 
J065121L01CTCGGCCCCACCAACNONE 
J065130K19CTCGGCCCCACCAACNONE 
J065208B21CTCGGCCCCACCAACNONE 
J075080G14CTCGGCCCCACCAACNONE 
J075135L01CTCGGCCCCACCAACNONE 
J075180J15CTCGGCCCCACCAACNONE 
Os05g0361900006-033-D04CTCGGCCCGGTNONE 
AK060107CTCGGCCCGGTMitochondrial substrate carrier family protein. 
AK104602CTCGGCCCGGTNONE 
AK104747CTCGGCCCGGTNONE 
J033133L03CTCGGCCCGGTNONE 
J080001O06CTCGGCCCGGTNONE 
J080004F05CTCGGCCCGGTNONE 
J080005D12CTCGGCCCGGTNONE 
J080008G19CTCGGCCCGGTNONE 
J080015D10CTCGGCCCGGTNONE 
J080015H22CTCGGCCCGGTNONE 
J080016K15CTCGGCCCGGTNONE 
J080018D12CTCGGCCCGGTNONE 
J080020A01CTCGGCCCGGTNONE 
J080027A09CTCGGCCCGGTNONE 
J080032F05CTCGGCCCGGTNONE 
J080039D09CTCGGCCCGGTNONE 
J080043J19CTCGGCCCGGTNONE 
J080052G22CTCGGCCCGGTNONE 
J080052M15CTCGGCCCGGTNONE 
J080053D22CTCGGCCCGGTNONE 
J080061I18CTCGGCCCGGTNONE 
J080064O14CTCGGCCCGGTNONE 
J080075K01CTCGGCCCGGTNONE 
J080082I02CTCGGCCCGGTNONE 
J080095C14CTCGGCCCGGTNONE 
J100028N14CTCGGCCCGGTNONE 
Os05g0393800AK069074CGGGCCGAGProtein of unknown function DUF221 domain containing protein. 
Os05g0412800AF402803CTCGGCCCCACACSimilar to Glutathione S-transferase GST 41 (EC 2.5.1.18). 
Os05g0417200AK071955CTCGGCCCATGAThioredoxin-like fold domain containing protein. 
Os05g0429700AK069203CCACTGACGGCTCGGCCCCACCNONE 
AK103559CCACTGACGGCTCGGCCCCACCC2 calcium/lipid-binding region, CaLB domain containing protein. 
Os05g0437800015-045-B10ATATGGGCCGAGNONE 
AK106328ATATGGGCCGAGConserved hypothetical protein. 
Os05g0440100015-006-F06CTCGGCCCACTNONE 
015-076-D04CTCGGCCCACTNONE 
AK073094CTCGGCCCACTNONE 
AK102786CTCGGCCCACTHistone deacetylase superfamily protein. 
J033107M16CTCGGCCCACTNONE 
Os05g0469900AK109700AGGTGGGCCGAGConserved hypothetical protein. 
Os05g0506900AK106697AATTGGGCCGAGBrix domain containing protein. 
Os05g0518300003-113-E09CTCGGCCCAATNONE 
006-088-A08CTCGGCCCAATNONE 
011-046-H04CTCGGCCCAATNONE 
013-059-A09CTCGGCCCAATNONE 
014-094-H08CTCGGCCCAATNONE 
015-008-B01CTCGGCCCAATNONE 
015-062-H06CTCGGCCCAATNONE 
016-057-H02CTCGGCCCAATNONE 
AK061147CTCGGCCCAATLipolytic enzyme, G-D-S-L family protein. 
J065171N11CTCGGCCCAATNONE 
J065186B12CTCGGCCCAATNONE 
Os05g0535200AK070696TCTCGGCCCACGGCGTGGACyclin-like F-box domain containing protein. 
J023057L12TCTCGGCCCACGGCGTGGANONE 
Os05g0548100AK060333CTCGGCCCAAGConserved hypothetical protein. 
AK100682CTCGGCCCAAGNONE 
J013151E01CTCGGCCCAAGNONE 
J023113L22CTCGGCCCAAGNONE 
J043027A19CTCGGCCCAAGNONE 
J075093E06CTCGGCCCAAGNONE 
J090060D15CTCGGCCCAAGNONE 
J090082J03CTCGGCCCAAGNONE 
J100050E01CTCGGCCCAAGNONE 
Os05g0557200AK062090CTTGGGCTCGGCCCAACANONE 
AK102111CTTGGGCTCGGCCCAACAArmadillo-like helical domain containing protein. 
J013047E13CTTGGGCTCGGCCCAACANONE 
J013089P04CTTGGGCTCGGCCCAACANONE 
J013130H17CTTGGGCTCGGCCCAACANONE 
J013132C20CTTGGGCTCGGCCCAACANONE 
J023001E06CTTGGGCTCGGCCCAACANONE 
J023108C09CTTGGGCTCGGCCCAACANONE 
J023125C12CTTGGGCTCGGCCCAACANONE 
J033023O10CTTGGGCTCGGCCCAACANONE 
J033033K16CTTGGGCTCGGCCCAACANONE 
J033064C11CTTGGGCTCGGCCCAACANONE 
J033071P07CTTGGGCTCGGCCCAACANONE 
J033072H14CTTGGGCTCGGCCCAACANONE 
J033084F06CTTGGGCTCGGCCCAACANONE 
J033084H11CTTGGGCTCGGCCCAACANONE 
J033097C05CTTGGGCTCGGCCCAACANONE 
J043009E20CTTGGGCTCGGCCCAACANONE 
J053035M10CTTGGGCTCGGCCCAACANONE 
J053043J22CTTGGGCTCGGCCCAACANONE 
J053082K10CTTGGGCTCGGCCCAACANONE 
J053094N13CTTGGGCTCGGCCCAACANONE 
Os05g0566800AK065748CTCGGCCCCCGCGCold acclimation protein COR413-TM1. 
AY181210CTCGGCCCCCGCGNONE 
Os05g0574500006-021-A08ATCTCGGCCCATTAGGCCCATATNONE 
006-049-A11ATCTCGGCCCATTAGGCCCATATNONE 
006-086-F03ATCTCGGCCCATTAGGCCCATATNONE 
009-051-F06ATCTCGGCCCATTAGGCCCATATNONE 
AB015287ATCTCGGCCCATTAGGCCCATATNONE 
AB015972ATCTCGGCCCATTAGGCCCATATNONE 
AK061714ATCTCGGCCCATTAGGCCCATATNONE 
AK098889ATCTCGGCCCATTAGGCCCATATNONE 
AK121699ATCTCGGCCCATTAGGCCCATATSimilar to GTP-binding nuclear protein Ran1B (Fragment). 
J013001L15ATCTCGGCCCATTAGGCCCATATNONE 
J013072D17ATCTCGGCCCATTAGGCCCATATNONE 
J023028M04ATCTCGGCCCATTAGGCCCATATNONE 
J023031F01ATCTCGGCCCATTAGGCCCATATNONE 
J023114L22ATCTCGGCCCATTAGGCCCATATNONE 
J033058L12ATCTCGGCCCATTAGGCCCATATNONE 
J033073D17ATCTCGGCCCATTAGGCCCATATNONE 
J043031D08ATCTCGGCCCATTAGGCCCATATNONE 
J043036G01ATCTCGGCCCATTAGGCCCATATNONE 
J065144O04ATCTCGGCCCATTAGGCCCATATNONE 
J065181O08ATCTCGGCCCATTAGGCCCATATNONE 
J080066B20ATCTCGGCCCATTAGGCCCATATNONE 
Os06g0116400006-082-G06ACATGGGCTCGGCCCAAGCCACGTCNONE 
AK058327ACATGGGCTCGGCCCAAGCCACGTCNONE 
AK105979ACATGGGCTCGGCCCAAGCCACGTCHigh-affinity nickel-transporter family protein. 
J065083I24ACATGGGCTCGGCCCAAGCCACGTCNONE 
J100072O18ACATGGGCTCGGCCCAAGCCACGTCNONE 
Os06g0118000006-039-F07CGGCTCGGCCCNONE 
AK061513CGGCTCGGCCCPeptidase A1, pepsin family protein. 
J065075J23CGGCTCGGCCCNONE 
Os06g0135340J065061D17ATCTCGGCCCNONE 
J065159A10ATCTCGGCCCConserved hypothetical protein. 
Os06g0157800AK121504CTCGGCCCGCASimilar to CG7224 (Fragment). 
J033022L20CTCGGCCCGCANONE 
J075033D09CTCGGCCCGCANONE 
Os06g0226600006-083-D04AGATGGGCCGAGANONE 
AK061806AGATGGGCCGAGANONE 
AK102752AGATGGGCCGAGATB2/DP1 and HVA22 related protein family protein. 
J013089J11AGATGGGCCGAGANONE 
J033106M05AGATGGGCCGAGANONE 
J100044M21AGATGGGCCGAGANONE 
J100056E06AGATGGGCCGAGANONE 
J100059F06AGATGGGCCGAGANONE 
Os06g0247800AK102187CCACCAACTCGGCCCATCCSimilar to Dynamin-like protein (Fragment). 
AY224491CCACCAACTCGGCCCATCCNONE 
Os06g0332600AK121615CTCGGCCCAATAConserved hypothetical protein. 
J033044B19CTCGGCCCAATANONE 
Os06g0574900AK109218TGGGCCGAGConserved hypothetical protein. 
Os06g0622700AK107021TCTCGGCCCAATTEukaryotic transcription factor, DNA-binding domain containing protein. 
J065053P05TCTCGGCCCAATTNONE 
J065100L18TCTCGGCCCAATTNONE 
J065129N15TCTCGGCCCAATTNONE 
J065152M08TCTCGGCCCAATTNONE 
J065198M12TCTCGGCCCAATTNONE 
J090077J22TCTCGGCCCAATTNONE 
J100024G23TCTCGGCCCAATTNONE 
J100027L01TCTCGGCCCAATTNONE 
J100047C06TCTCGGCCCAATTNONE 
J100055D01TCTCGGCCCAATTNONE 
J100067M05TCTCGGCCCAATTNONE 
J100077M16TCTCGGCCCAATTNONE 
J100078M22TCTCGGCCCAATTNONE 
Os06g0648200009-150-E06CTCGGCCCGTTNONE 
009-150-E06TGGATGGGCCGAGNONE 
014-034-H10CTCGGCCCGTTNONE 
014-034-H10TGGATGGGCCGAGNONE 
015-035-E11CTCGGCCCGTTNONE 
015-035-E11TGGATGGGCCGAGNONE 
AK063001CTCGGCCCGTTNONE 
AK063001TGGATGGGCCGAGNONE 
AK063675CTCGGCCCGTTNONE 
AK063675TGGATGGGCCGAGNONE 
AK106303CTCGGCCCGTTConserved hypothetical protein. 
AK106303TGGATGGGCCGAGConserved hypothetical protein. 
Os06g0649500AK072591CTCGGCCCACAWD40-like domain containing protein. 
Os06g0663600AK100787AGATGGGCCGAGATEndonuclease V family protein. 
Os06g0683800AK110639CGGCTCGGCCCAAATConserved hypothetical protein. 
Os06g0694500AK067484GCCGGCCCATCTCGGCCCATGASimilar to Nitrogen fixation like protein. 
AK103983GCCGGCCCATCTCGGCCCATGANONE 
Os07g0108100Os07g0108100ATCTCGGCCCPeptidase C1A, papain family protein. 
Os07g0110100009-059-D11GCTGGGCCGAGNONE 
AK071499GCTGGGCCGAGConserved hypothetical protein. 
J065064P17GCTGGGCCGAGNONE 
J065111B09GCTGGGCCGAGNONE 
J075099A14GCTGGGCCGAGNONE 
J075139C23GCTGGGCCGAGNONE 
Os07g0136300AK064609GTCGCGCGTGGGCCGAGAConserved hypothetical protein. 
Os07g0150200009-152-C07CTCGGCCCATCANONE 
AK058680CTCGGCCCATCANONE 
AK121635CTCGGCCCATCASimilar to 40S ribosomal protein S12-1. 
J033051C16CTCGGCCCATCANONE 
J033123H15CTCGGCCCATCANONE 
J065093I01CTCGGCCCATCANONE 
J065197C05CTCGGCCCATCANONE 
J075037B11CTCGGCCCATCANONE 
J075114B08CTCGGCCCATCANONE 
J075123N01CTCGGCCCATCANONE 
J075129O04CTCGGCCCATCANONE 
J075160H17CTCGGCCCATCANONE 
J075166H17CTCGGCCCATCANONE 
J080310F11CTCGGCCCATCANONE 
J080315P11CTCGGCCCATCANONE 
J090025A22CTCGGCCCATCANONE 
Os07g0164500J013094M18CTCGGCCCAAATNONE 
J013153L05CTCGGCCCAAATNONE 
J023011J18CTCGGCCCAAATNONE 
J023106H21CTCGGCCCAAATNONE 
J033105F10CTCGGCCCAAATNONE 
J065210M20CTCGGCCCAAATSimilar to Dolichyl pyrophosphate Man9GlcNAc2 alpha-1,3-glucosyltransferase (EC 2.4.1.-) (Dolichyl-P-Glc:Man9GlcNAc2-PP-dolichyl glucosyltransferase). 
J090060F05CTCGGCCCAAATNONE 
J090061C13CTCGGCCCAAATNONE 
J090074K15CTCGGCCCAAATNONE 
Os07g0170900015-094-H05GGGCCGAGGGCCGAGNONE 
AK106442GGGCCGAGGGCCGAGConserved hypothetical protein. 
Os07g0184900AK102066TCGGCCCGTGGGCCGTGTTGGGCCGAGGCCCACGTGGGAGTGGGAAGGCCCACGCACCGCSimilar to Ku70-like protein. 
Os07g0243200AK121036CCCACTCTTCTCGGCCCATCGSimilar to ADP-glucose pyrophosphorylase large subunit 2 (EC 2.7.7.27) (Fragment). 
D21272CCCACTCTTCTCGGCCCATCGNONE 
Os07g0258400AK121534CTCGGCCCGGCCCACCTNONE 
L41217CTCGGCCCGGCCCACCTNONE 
S81897CTCGGCCCGGCCCACCTOsNramp1 (Integral membrane protein). 
Os07g0274700J065002G18TCTCGGCCCACCCGNONE 
J065092L19TCTCGGCCCACCCGNONE 
J065099K11TCTCGGCCCACCCGNONE 
J065103L08TCTCGGCCCACCCGNONE 
J065185I19TCTCGGCCCACCCGNONE 
J075004L22TCTCGGCCCACCCGNONE 
J075007G03TCTCGGCCCACCCGNONE 
J075020E09TCTCGGCCCACCCGNONE 
J075046B02TCTCGGCCCACCCGNONE 
J075070D08TCTCGGCCCACCCGNONE 
J075118L24TCTCGGCCCACCCGNONE 
J075140C15TCTCGGCCCACCCGNONE 
J075157A21TCTCGGCCCACCCGNONE 
J075165J01TCTCGGCCCACCCGNONE 
J075172J18TCTCGGCCCACCCGNONE 
J075177P10TCTCGGCCCACCCGNONE 
J100042D15TCTCGGCCCACCCGNONE 
J100053M21TCTCGGCCCACCCGNONE 
J100067M12TCTCGGCCCACCCGNONE 
Os07g0408500AK103596CTCGGCCCCACGCGSimilar to Rac GTPase activating protein 3 (Fragment). 
Os07g0546100AK058282GGGCCGAGNONE 
Os07g0564000AK069806AGTTGGGCCGAGAConserved hypothetical protein. 
Os07g0564400Os07g0564400CTCGGCCCAGANucleic acid-binding, OB-fold domain containing protein. 
Os07g0569800AK108637GGTGGGCCGAGConcanavalin A-like lectin/glucanase domain containing protein. 
Os07g0573400006-035-G11CCCGGGCCGAGNONE 
AK061739CCCGGGCCGAGNONE 
AK065116CCCGGGCCGAGNONE 
AK102732CCCGGGCCGAGProtein of unknown function DUF239, plant domain containing protein. 
AK119637CCCGGGCCGAGNONE 
AK121705CCCGGGCCGAGNONE 
Os07g0585800006-106-A05ACTGGGCCGAGANONE 
AK066419ACTGGGCCGAGANONE 
AK105064ACTGGGCCGAGASimilar to NADH-ubiquinone oxidoreductase 18 kDa subunit (EC 1.6.5.3) (EC 1.6.99.3) (Complex I-18KD) (CI-18KD) (Fragment). 
J065065N01ACTGGGCCGAGANONE 
J065085B08ACTGGGCCGAGANONE 
J065099I23ACTGGGCCGAGANONE 
J065169A01ACTGGGCCGAGANONE 
J065187N13ACTGGGCCGAGANONE 
J065191L18ACTGGGCCGAGANONE 
J065194D04ACTGGGCCGAGANONE 
J065211M09ACTGGGCCGAGANONE 
J065212I02ACTGGGCCGAGANONE 
J090003C10ACTGGGCCGAGANONE 
J090025O11ACTGGGCCGAGANONE 
J090092F10ACTGGGCCGAGANONE 
J100055A04ACTGGGCCGAGANONE 
J100064A01ACTGGGCCGAGANONE 
J100080L02ACTGGGCCGAGANONE 
Os07g0606500AK068811ATCTCGGCCCATTTNONE 
AK121873ATCTCGGCCCATTTNONE 
J013159C05ATCTCGGCCCATTTNONE 
J075158B14ATCTCGGCCCATTTNONE 
Os07g0607200AK065746CTCGGCCCAACAProtein of unknown function DUF751 family protein. 
J065037B15CTCGGCCCAACANONE 
J065042E20CTCGGCCCAACANONE 
J065161I08CTCGGCCCAACANONE 
Os07g0616900AK071047CTCGGCCCAAAAProtein of unknown function DUF500 family protein. 
J013106G03CTCGGCCCAAAANONE 
J013124C20CTCGGCCCAAAANONE 
J033096D16CTCGGCCCAAAANONE 
J043005E08CTCGGCCCAAAANONE 
J065197K12CTCGGCCCAAAANONE 
J065211I03CTCGGCCCAAAANONE 
Os07g0633200AK061338GGGCCGAGASimilar to SC35-like splicing factor SCL30a, 30a kD. 
AK073451GGGCCGAGANONE 
J033096E22GGGCCGAGANONE 
J033125D06GGGCCGAGANONE 
J075048C23GGGCCGAGANONE 
J075050G02GGGCCGAGANONE 
J075104J04GGGCCGAGANONE 
J075144N04GGGCCGAGANONE 
Os07g0637300AF323611CTCGGCCCCACANONE 
AK069157CTCGGCCCCACANONE 
J023007C01CTCGGCCCCACANONE 
Os07g0644300AK066726CTCGGCCCAATTSimilar to XPA-binding protein 2 (Adapter protein ATH-55). 
AK101483CTCGGCCCAATTNONE 
Os08g0113800J033069I12TCTCGGCCCAAACNONE 
J053050I07TCTCGGCCCAAACNONE 
J065006J11TCTCGGCCCAAACNONE 
J065013D02TCTCGGCCCAAACNONE 
J065055L24TCTCGGCCCAAACNONE 
J065071I11TCTCGGCCCAAACConserved hypothetical protein. 
J065093G12TCTCGGCCCAAACNONE 
J065101N03TCTCGGCCCAAACNONE 
Os08g0116800AK063695CTCGGCCCAGGExoribonuclease domain containing protein. 
AK063695TCTCGGCCCAGGExoribonuclease domain containing protein. 
Os08g0122400AK071781TCTCGGCCCConserved hypothetical protein. 
J023110A01TCTCGGCCCNONE 
Os08g0127500AK071322CTCGGCCCAcid phosphatase/vanadium-dependent haloperoxidase related family protein. 
J023087N16CTCGGCCCNONE 
J065146A20CTCGGCCCNONE 
J075043F12CTCGGCCCNONE 
J090015B21CTCGGCCCNONE 
Os08g0129200014-040-E08AGTGGGCCGAGATNONE 
AK070034AGTGGGCCGAGATNONE 
AK101577AGTGGGCCGAGATSimilar to Cold shock protein-1. 
J065137A09AGTGGGCCGAGATNONE 
J100062K14AGTGGGCCGAGATNONE 
Os08g0150800AK101530AAATGGGCTCGGCCCACASimilar to Tyrosyl-tRNA synthetase (Tyrosyl-tRNA ligase; TyrRS). class-I aaRS. 
Os08g0155000004-001-C12TTATGGGCTCGGCCCATATNONE 
014-030-C11TTATGGGCTCGGCCCATATNONE 
AK060859TTATGGGCTCGGCCCATATNONE 
AK099613TTATGGGCTCGGCCCATATBrix domain containing protein. 
J013154C17TTATGGGCTCGGCCCATATNONE 
J033039F14TTATGGGCTCGGCCCATATNONE 
J033126I18TTATGGGCTCGGCCCATATNONE 
J043005A17TTATGGGCTCGGCCCATATNONE 
J053027C13TTATGGGCTCGGCCCATATNONE 
J053033I07TTATGGGCTCGGCCCATATNONE 
J053054P04TTATGGGCTCGGCCCATATNONE 
J053060F22TTATGGGCTCGGCCCATATNONE 
J053061P10TTATGGGCTCGGCCCATATNONE 
J053065L13TTATGGGCTCGGCCCATATNONE 
J053099H19TTATGGGCTCGGCCCATATNONE 
J053101D09TTATGGGCTCGGCCCATATNONE 
J075062C16TTATGGGCTCGGCCCATATNONE 
J075129P09TTATGGGCTCGGCCCATATNONE 
J075135C02TTATGGGCTCGGCCCATATNONE 
J075147P13TTATGGGCTCGGCCCATATNONE 
J090007K03TTATGGGCTCGGCCCATATNONE 
J090050M06TTATGGGCTCGGCCCATATNONE 
J090057M20TTATGGGCTCGGCCCATATNONE 
J090070B06TTATGGGCTCGGCCCATATNONE 
J090080D11TTATGGGCTCGGCCCATATNONE 
J100021D15TTATGGGCTCGGCCCATATNONE 
Os08g0224200AK101331CTCGGCCCAGGSimilar to Ythdf2-prov protein. 
Os08g0224700AK121754AATGGGCCGAGSimilar to 26S proteasome subunit RPN2a. 
Os08g0260600AK108529AGTTGGGCCGAGACD9/CD37/CD63 antigen family protein. 
Os08g0379400006-033-C10CGGGCCGAGATNONE 
006-112-H05CGGGCCGAGATNONE 
AK069608CGGGCCGAGATSimilar to Quinone oxidoreductase-like protein. 
AK104318CGGGCCGAGATNONE 
AK109433CGGGCCGAGATNONE 
AK112013CGGGCCGAGATNONE 
J065163C05CGGGCCGAGATNONE 
Os08g0440000006-056-A06TCTCGGCCCAGTTNONE 
AK060959TCTCGGCCCAGTTNONE 
AK102539TCTCGGCCCAGTTVesicle transport v-SNARE family protein. 
J065012O03TCTCGGCCCAGTTNONE 
Os08g0441400011-033-F01CGGGCCGAGANONE 
015-084-B04CGGGCCGAGANONE 
AK063317CGGGCCGAGANONE 
AK064141CGGGCCGAGAConserved hypothetical protein. 
J065060F06CGGGCCGAGANONE 
J075110A22CGGGCCGAGANONE 
J080307P11CGGGCCGAGANONE 
J090041E06CGGGCCGAGANONE 
Os08g0484700J065041E01CTCGGCCCHomeodomain-like containing protein. 
Os08g0485700AK068131TAATGGGCCGAGNONE 
AK069097TAATGGGCCGAGMethyl-CpG binding domain containing protein. 
J013130L03TAATGGGCCGAGNONE 
Os08g0487100AK107150CTCGGCCCAAATSimilar to BZIP transcription factor BZI-2. 
Os08g0504400014-015-C10CGGGTGGGCCGAGNONE 
AK069190CGGGTGGGCCGAGSimilar to Uncharacterized enzyme involved in pigment biosynthesis. 
AK072089CGGGTGGGCCGAGNONE 
J023006O19CGGGTGGGCCGAGNONE 
J033041C11CGGGTGGGCCGAGNONE 
Os08g0515800006-067-C11AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
009-131-F05AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
016-026-E03AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
AK061787AGCCCATGGGCCTTATCTCGGCCCAAGMitochodrial transcription termination factor-related family protein. 
J013032E15AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
J013032E16AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
J033140O22AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
J065058M21AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
J065090D03AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
J065115G12AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
J065124N11AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
J100021K19AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
J100035P15AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
J100043J19AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
Os08g0525000AK103220CTCGGCCCCACCRas GTPase family protein. 
J033122O18CTCGGCCCCACCNONE 
J065026M15CTCGGCCCCACCNONE 
J075007I01CTCGGCCCCACCNONE 
J075031E01CTCGGCCCCACCNONE 
J075043N14CTCGGCCCCACCNONE 
J075074O16CTCGGCCCCACCNONE 
J075092O04CTCGGCCCCACCNONE 
J075141D16CTCGGCCCCACCNONE 
J075172C22CTCGGCCCCACCNONE 
J075173A05CTCGGCCCCACCNONE 
Os08g0544500AK071354CTCGGCCCACTSimilar to ARP2/3 regulatory protein subunit NAPP. 
Os09g0375700AK068295TTTGGGCTCGGCCCATTHypothetical protein. 
Os09g0385300AK073247GGGCCGAGHypothetical protein. 
AK120455GGGCCGAGNONE 
J013104G23GGGCCGAGNONE 
J023110A14GGGCCGAGNONE 
J033143F07GGGCCGAGNONE 
J065036P14GGGCCGAGNONE 
J065041I11GGGCCGAGNONE 
J065103K11GGGCCGAGNONE 
J065138M15GGGCCGAGNONE 
J065138P09GGGCCGAGNONE 
J065141J20GGGCCGAGNONE 
J075063J16GGGCCGAGNONE 
J075063K19GGGCCGAGNONE 
J075085H08GGGCCGAGNONE 
J075093C12GGGCCGAGNONE 
J075127N08GGGCCGAGNONE 
J075134E09GGGCCGAGNONE 
J075166D06GGGCCGAGNONE 
J075168K24GGGCCGAGNONE 
J075197G05GGGCCGAGNONE 
J080034J24GGGCCGAGNONE 
Os09g0397900AK101306AACTGGGCCGAGGCCCACAAAAGCCCAACTSimilar to FEG protein. 
Os09g0453000AK120561TCTCGGCCCAGAProtein of unknown function UPF0220 family protein. 
AK121475TCTCGGCCCAGANONE 
J013132I06TCTCGGCCCAGANONE 
J023148P12TCTCGGCCCAGANONE 
J033147G24TCTCGGCCCAGANONE 
J053089L13TCTCGGCCCAGANONE 
J053097D02TCTCGGCCCAGANONE 
J065013M20TCTCGGCCCAGANONE 
J075148M10TCTCGGCCCAGANONE 
J075153M04TCTCGGCCCAGANONE 
J075197C14TCTCGGCCCAGANONE 
J080311M12TCTCGGCCCAGANONE 
J090022J07TCTCGGCCCAGANONE 
J090026D19TCTCGGCCCAGANONE 
J090033D10TCTCGGCCCAGANONE 
J090084N05TCTCGGCCCAGANONE 
J090087H04TCTCGGCCCAGANONE 
J100028I02TCTCGGCCCAGANONE 
J100088N15TCTCGGCCCAGANONE 
Os09g0457900AK067195CACGTCACCTCGGCCCCACGSimilar to AP2 domain containing protein RAP2.6 (Fragment). 
J013098P10CACGTCACCTCGGCCCCACGNONE 
Os09g0458100AK109625GTTGGGCCGAGATXyloglucan fucosyltransferase family protein. 
Os09g0497400AK058354CTCGGCCCAATANONE 
AK068677CTCGGCCCAATAProtein of unknown function DUF850, transmembrane eukaryotic family protein. 
J013159B19CTCGGCCCAATANONE 
J023011D22CTCGGCCCAATANONE 
J023081K05CTCGGCCCAATANONE 
J033060O14CTCGGCCCAATANONE 
J075020I08CTCGGCCCAATANONE 
J075034J03CTCGGCCCAATANONE 
J075049M15CTCGGCCCAATANONE 
J075065K02CTCGGCCCAATANONE 
J075099L06CTCGGCCCAATANONE 
Os09g0528100009-173-A08ACTGGGCCGAGANONE 
009-190-G12ACTGGGCCGAGANONE 
AK059096ACTGGGCCGAGASimilar to 30S ribosomal protein S31, chloroplast (Fragment). 
Os09g0533900003-104-E05GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
012-076-C03GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
AK067774GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
AK100449GTGGCCCACCACGCCTCGGCCCCACCCGSimilar to CEL5=CELLULASE 5 (Fragment). 
J013048F07GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J023026E11GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J023028B20GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J023050P11GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J023052K08GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J023075J03GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J023078E15GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J023090P12GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J023120E01GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J023142K01GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J033027K23GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J033058A09GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J033058C12GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J033125A04GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J043040L01GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J053061D06GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J053096N13GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J065193H10GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J090075L17GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
J100050D10GTGGCCCACCACGCCTCGGCCCCACCCGNONE 
Os09g0547200016-021-H03AGTTGGGCCGAGCCGNONE 
AK073078AGTTGGGCCGAGCCGProtein of unknown function DUF292, eukaryotic domain containing protein. 
AK104984AGTTGGGCCGAGCCGNONE 
J065005L05AGTTGGGCCGAGCCGNONE 
J065039C06AGTTGGGCCGAGCCGNONE 
J065116H17AGTTGGGCCGAGCCGNONE 
J100046A17AGTTGGGCCGAGCCGNONE 
Os09g0572900AK069270TCGTGGGCCTCTCGGCCCAAGSimilar to Dynamin-related protein 1E (Dynamin-like protein E) (Dynamin-like protein 4) (Dynamin-like protein DLP2). 
Os09g0573000AK073399CTTGGGCCGAGAGGCCCACGAProtein prenyltransferase domain containing protein. 
Os11g0115800AK106102CTCGGCCCATAAConserved hypothetical protein. 
J065057N13CTCGGCCCATAANONE 
Os11g0139100009-099-H06TCTCGGCCCACTNONE 
AK121443TCTCGGCCCACTSimilar to 50S ribosomal protein L24. 
J023140O18TCTCGGCCCACTNONE 
J023143M23TCTCGGCCCACTNONE 
J033079G04TCTCGGCCCACTNONE 
J043004D20TCTCGGCCCACTNONE 
J065097F05TCTCGGCCCACTNONE 
Os11g0148600AK100066AAATGGGCCGAGAConserved hypothetical protein. 
AK100066ACATGGGCCGAGConserved hypothetical protein. 
AK102442AAATGGGCCGAGANONE 
AK102442ACATGGGCCGAGNONE 
J065167F17AAATGGGCCGAGANONE 
J065167F17ACATGGGCCGAGNONE 
Os11g0182400016-077-B04AGTTGGGCCGAGNONE 
AK112089AGTTGGGCCGAGCyclin-like F-box domain containing protein. 
Os11g0219400AK069850CTCGGCCCAGGAnkyrin repeat containing protein. 
AK099123CTCGGCCCAGGNONE 
J023143G18CTCGGCCCAGGNONE 
Os11g0484300AK121422AAATGGGCCGGGCCGAGGCCCAAASimilar to Mcm2-prov protein. 
Os11g0544000AK066017GCCGGCCCAACTCGGCCCAAGConserved hypothetical protein. 
AK071393GCCGGCCCAACTCGGCCCAAGNONE 
J013050C10GCCGGCCCAACTCGGCCCAAGNONE 
J013118O12GCCGGCCCAACTCGGCCCAAGNONE 
Os11g0544600AK064128CTCGGCCCGGCCCGGCCCGGCCConserved hypothetical protein. 
J075118L07CTCGGCCCGGCCCGGCCCGGCCNONE 
Os11g0602600006-046-H02ATCTCGGCCCATTTNONE 
006-046-H02TAATGGGCCGAGANONE 
006-056-H08ATCTCGGCCCATTTNONE 
006-056-H08TAATGGGCCGAGANONE 
009-116-D05ATCTCGGCCCATTTNONE 
009-116-D05TAATGGGCCGAGANONE 
AK072671ATCTCGGCCCATTTSimilar to 40S ribosomal protein S9. 
AK072671TAATGGGCCGAGASimilar to 40S ribosomal protein S9. 
AK104660ATCTCGGCCCATTTNONE 
AK104660TAATGGGCCGAGANONE 
J023134P20ATCTCGGCCCATTTNONE 
J023134P20TAATGGGCCGAGANONE 
J023141O13ATCTCGGCCCATTTNONE 
J023141O13TAATGGGCCGAGANONE 
J033066I15ATCTCGGCCCATTTNONE 
J033066I15TAATGGGCCGAGANONE 
J033076A08ATCTCGGCCCATTTNONE 
J033076A08TAATGGGCCGAGANONE 
J033150J23ATCTCGGCCCATTTNONE 
J033150J23TAATGGGCCGAGANONE 
J065114P19ATCTCGGCCCATTTNONE 
J065114P19TAATGGGCCGAGANONE 
J065176B01ATCTCGGCCCATTTNONE 
J065176B01TAATGGGCCGAGANONE 
J065207H21ATCTCGGCCCATTTNONE 
J065207H21TAATGGGCCGAGANONE 
J080301L21ATCTCGGCCCATTTNONE 
J080301L21TAATGGGCCGAGANONE 
J080308A08ATCTCGGCCCATTTNONE 
J080308A08TAATGGGCCGAGANONE 
J080318K23ATCTCGGCCCATTTNONE 
J080318K23TAATGGGCCGAGANONE 
J080319F17ATCTCGGCCCATTTNONE 
J080319F17TAATGGGCCGAGANONE 
J080319I10ATCTCGGCCCATTTNONE 
J080319I10TAATGGGCCGAGANONE 
J090028C08ATCTCGGCCCATTTNONE 
J090028C08TAATGGGCCGAGANONE 
J090051I24ATCTCGGCCCATTTNONE 
J090051I24TAATGGGCCGAGANONE 
J090053L21ATCTCGGCCCATTTNONE 
J090053L21TAATGGGCCGAGANONE 
J090069C20ATCTCGGCCCATTTNONE 
J090069C20TAATGGGCCGAGANONE 
J100017G08ATCTCGGCCCATTTNONE 
J100017G08TAATGGGCCGAGANONE 
J100042B06ATCTCGGCCCATTTNONE 
J100042B06TAATGGGCCGAGANONE 
J100045G24ATCTCGGCCCATTTNONE 
J100045G24TAATGGGCCGAGANONE 
J100050J19ATCTCGGCCCATTTNONE 
J100050J19TAATGGGCCGAGANONE 
J100052D23ATCTCGGCCCATTTNONE 
J100052D23TAATGGGCCGAGANONE 
J100053M03ATCTCGGCCCATTTNONE 
J100053M03TAATGGGCCGAGANONE 
J100056D08ATCTCGGCCCATTTNONE 
J100056D08TAATGGGCCGAGANONE 
J100066B19ATCTCGGCCCATTTNONE 
J100066B19TAATGGGCCGAGANONE 
J100071N23ATCTCGGCCCATTTNONE 
J100071N23TAATGGGCCGAGANONE 
J100074H01ATCTCGGCCCATTTNONE 
J100074H01TAATGGGCCGAGANONE 
J100074H19ATCTCGGCCCATTTNONE 
J100074H19TAATGGGCCGAGANONE 
J100077C06ATCTCGGCCCATTTNONE 
J100077C06TAATGGGCCGAGANONE 
Os11g0657200AK059959TCTCGGCCCATT2OG-Fe(II) oxygenase domain containing protein. 
Os11g0657300009-101-D07AATGGGCCGAGANONE 
AK062752AATGGGCCGAGASimilar to Small nuclear ribonucleoprotein F (snRNP-F) (Sm protein F) (Sm-F) (SmF). 
Os11g0703900011-004-D05CTCGGCCCATGTNONE 
011-014-C03CTCGGCCCATGTNONE 
011-016-C01CTCGGCCCATGTNONE 
011-017-B04CTCGGCCCATGTNONE 
011-017-E09CTCGGCCCATGTNONE 
011-019-E12CTCGGCCCATGTNONE 
011-021-H12CTCGGCCCATGTNONE 
011-025-H02CTCGGCCCATGTNONE 
011-027-B09CTCGGCCCATGTNONE 
011-039-G07CTCGGCCCATGTNONE 
011-044-G07CTCGGCCCATGTNONE 
011-046-F11CTCGGCCCATGTNONE 
011-070-F02CTCGGCCCATGTNONE 
011-071-A07CTCGGCCCATGTNONE 
011-082-A03CTCGGCCCATGTNONE 
011-086-B09CTCGGCCCATGTNONE 
011-092-C04CTCGGCCCATGTNONE 
012-006-F02CTCGGCCCATGTNONE 
012-011-G08CTCGGCCCATGTNONE 
012-026-C06CTCGGCCCATGTNONE 
012-026-G06CTCGGCCCATGTNONE 
012-028-E05CTCGGCCCATGTNONE 
012-040-A05CTCGGCCCATGTNONE 
012-045-C01CTCGGCCCATGTNONE 
012-046-A10CTCGGCCCATGTNONE 
012-047-H09CTCGGCCCATGTNONE 
012-059-A12CTCGGCCCATGTNONE 
012-072-D06CTCGGCCCATGTNONE 
012-073-D05CTCGGCCCATGTNONE 
012-076-D08CTCGGCCCATGTNONE 
012-079-G05CTCGGCCCATGTNONE 
012-080-A04CTCGGCCCATGTNONE 
012-080-E01CTCGGCCCATGTNONE 
012-083-C03CTCGGCCCATGTNONE 
012-083-G06CTCGGCCCATGTNONE 
012-086-G02CTCGGCCCATGTNONE 
012-091-A07CTCGGCCCATGTNONE 
012-094-G10CTCGGCCCATGTNONE 
012-098-A07CTCGGCCCATGTNONE 
012-100-G04CTCGGCCCATGTNONE 
015-001-A11CTCGGCCCATGTNONE 
015-033-E01CTCGGCCCATGTNONE 
015-047-F12CTCGGCCCATGTNONE 
015-054-E05CTCGGCCCATGTNONE 
015-063-H02CTCGGCCCATGTNONE 
015-075-E10CTCGGCCCATGTNONE 
015-086-F05CTCGGCCCATGTNONE 
016-031-A08CTCGGCCCATGTNONE 
016-053-A03CTCGGCCCATGTNONE 
016-054-C09CTCGGCCCATGTNONE 
016-079-C08CTCGGCCCATGTNONE 
AK065431CTCGGCCCATGTHeat shock protein 70. 
AK119255CTCGGCCCATGTNONE 
J013021C12CTCGGCCCATGTNONE 
J013021C17CTCGGCCCATGTNONE 
J023027B08CTCGGCCCATGTNONE 
J023078A21CTCGGCCCATGTNONE 
J023097M06CTCGGCCCATGTNONE 
J023100O04CTCGGCCCATGTNONE 
J023107B17CTCGGCCCATGTNONE 
J023108L24CTCGGCCCATGTNONE 
J023109L05CTCGGCCCATGTNONE 
J033022M22CTCGGCCCATGTNONE 
J033023K21CTCGGCCCATGTNONE 
J033031L11CTCGGCCCATGTNONE 
J033034H10CTCGGCCCATGTNONE 
J033037B16CTCGGCCCATGTNONE 
J033037F16CTCGGCCCATGTNONE 
J033037H07CTCGGCCCATGTNONE 
J033046E22CTCGGCCCATGTNONE 
J033050N12CTCGGCCCATGTNONE 
J033064F10CTCGGCCCATGTNONE 
J033064N10CTCGGCCCATGTNONE 
J033066O09CTCGGCCCATGTNONE 
J033068H01CTCGGCCCATGTNONE 
J033068J07CTCGGCCCATGTNONE 
J033070B10CTCGGCCCATGTNONE 
J033070G13CTCGGCCCATGTNONE 
J033073O13CTCGGCCCATGTNONE 
J033075B07CTCGGCCCATGTNONE 
J033079L15CTCGGCCCATGTNONE 
J033081J06CTCGGCCCATGTNONE 
J033086G13CTCGGCCCATGTNONE 
J033086N07CTCGGCCCATGTNONE 
J033086O05CTCGGCCCATGTNONE 
J033091A15CTCGGCCCATGTNONE 
J033091D05CTCGGCCCATGTNONE 
J033094C12CTCGGCCCATGTNONE 
J033099P03CTCGGCCCATGTNONE 
J033107L09CTCGGCCCATGTNONE 
J033108D16CTCGGCCCATGTNONE 
J033109E12CTCGGCCCATGTNONE 
J033109K14CTCGGCCCATGTNONE 
J033112P22CTCGGCCCATGTNONE 
J033116F12CTCGGCCCATGTNONE 
J033116K01CTCGGCCCATGTNONE 
J033118F19CTCGGCCCATGTNONE 
J033121J10CTCGGCCCATGTNONE 
J033126H04CTCGGCCCATGTNONE 
J033131G17CTCGGCCCATGTNONE 
J033131L05CTCGGCCCATGTNONE 
J033136A08CTCGGCCCATGTNONE 
J033136H22CTCGGCCCATGTNONE 
J033143F01CTCGGCCCATGTNONE 
J065040M10CTCGGCCCATGTNONE 
J065046F17CTCGGCCCATGTNONE 
J065048G20CTCGGCCCATGTNONE 
J065071N06CTCGGCCCATGTNONE 
J065084I24CTCGGCCCATGTNONE 
J065171B01CTCGGCCCATGTNONE 
J065191J21CTCGGCCCATGTNONE 
J065199I20CTCGGCCCATGTNONE 
J075076C02CTCGGCCCATGTNONE 
J090002P12CTCGGCCCATGTNONE 
J090003A11CTCGGCCCATGTNONE 
J090003H11CTCGGCCCATGTNONE 
J090009M22CTCGGCCCATGTNONE 
J090009O11CTCGGCCCATGTNONE 
J090014N09CTCGGCCCATGTNONE 
J090015A18CTCGGCCCATGTNONE 
J090016E16CTCGGCCCATGTNONE 
J090016I07CTCGGCCCATGTNONE 
J090017O07CTCGGCCCATGTNONE 
J090019E10CTCGGCCCATGTNONE 
J090020D24CTCGGCCCATGTNONE 
J090021M16CTCGGCCCATGTNONE 
J090022F13CTCGGCCCATGTNONE 
J090023H03CTCGGCCCATGTNONE 
J090024E15CTCGGCCCATGTNONE 
J090024G19CTCGGCCCATGTNONE 
J090026J19CTCGGCCCATGTNONE 
J090030E20CTCGGCCCATGTNONE 
J090030I15CTCGGCCCATGTNONE 
J090032F04CTCGGCCCATGTNONE 
J090033N22CTCGGCCCATGTNONE 
J090033O19CTCGGCCCATGTNONE 
J090036F08CTCGGCCCATGTNONE 
J090039A13CTCGGCCCATGTNONE 
J090042N07CTCGGCCCATGTNONE 
J090043C15CTCGGCCCATGTNONE 
J090043N09CTCGGCCCATGTNONE 
J090053J10CTCGGCCCATGTNONE 
J090054F14CTCGGCCCATGTNONE 
J090057N12CTCGGCCCATGTNONE 
J090061P13CTCGGCCCATGTNONE 
J090062F17CTCGGCCCATGTNONE 
J090065H15CTCGGCCCATGTNONE 
J090067P11CTCGGCCCATGTNONE 
J090068M09CTCGGCCCATGTNONE 
J090069E24CTCGGCCCATGTNONE 
J090069K16CTCGGCCCATGTNONE 
J090070N07CTCGGCCCATGTNONE 
J090072M09CTCGGCCCATGTNONE 
J090075I24CTCGGCCCATGTNONE 
J090075M04CTCGGCCCATGTNONE 
J090077D24CTCGGCCCATGTNONE 
J090080M17CTCGGCCCATGTNONE 
J090080O14CTCGGCCCATGTNONE 
J090081C12CTCGGCCCATGTNONE 
J090084N21CTCGGCCCATGTNONE 
J090084O21CTCGGCCCATGTNONE 
J090087J18CTCGGCCCATGTNONE 
J090092L17CTCGGCCCATGTNONE 
J090097A08CTCGGCCCATGTNONE 
J100017E24CTCGGCCCATGTNONE 
J100018K11CTCGGCCCATGTNONE 
J100019A16CTCGGCCCATGTNONE 
J100023I23CTCGGCCCATGTNONE 
J100024D07CTCGGCCCATGTNONE 
J100025H12CTCGGCCCATGTNONE 
J100027K19CTCGGCCCATGTNONE 
J100028C23CTCGGCCCATGTNONE 
J100029A14CTCGGCCCATGTNONE 
J100029O19CTCGGCCCATGTNONE 
J100030I09CTCGGCCCATGTNONE 
J100030J16CTCGGCCCATGTNONE 
J100031C01CTCGGCCCATGTNONE 
J100031N06CTCGGCCCATGTNONE 
J100033H04CTCGGCCCATGTNONE 
J100034L20CTCGGCCCATGTNONE 
J100036K13CTCGGCCCATGTNONE 
J100039M02CTCGGCCCATGTNONE 
J100040J01CTCGGCCCATGTNONE 
J100042O21CTCGGCCCATGTNONE 
J100042P20CTCGGCCCATGTNONE 
J100047K22CTCGGCCCATGTNONE 
J100049B16CTCGGCCCATGTNONE 
J100052M10CTCGGCCCATGTNONE 
J100053B05CTCGGCCCATGTNONE 
J100053B20CTCGGCCCATGTNONE 
J100055I11CTCGGCCCATGTNONE 
J100056A13CTCGGCCCATGTNONE 
J100057C08CTCGGCCCATGTNONE 
J100057N11CTCGGCCCATGTNONE 
J100057P07CTCGGCCCATGTNONE 
J100059E16CTCGGCCCATGTNONE 
J100063N14CTCGGCCCATGTNONE 
J100069H01CTCGGCCCATGTNONE 
J100071C17CTCGGCCCATGTNONE 
J100071K09CTCGGCCCATGTNONE 
J100077D07CTCGGCCCATGTNONE 
J100078P22CTCGGCCCATGTNONE 
J100080F11CTCGGCCCATGTNONE 
J100081L07CTCGGCCCATGTNONE 
J100083B10CTCGGCCCATGTNONE 
J100083K17CTCGGCCCATGTNONE 
J100085B22CTCGGCCCATGTNONE 
J100085L21CTCGGCCCATGTNONE 
J100086B11CTCGGCCCATGTNONE 
J100087E06CTCGGCCCATGTNONE 
J100087P07CTCGGCCCATGTNONE 
J100089H24CTCGGCCCATGTNONE 
Os12g0145700AK071391CGGCTCGGCCCACCACPyruvate kinase family protein. 
J023013N02CGGCTCGGCCCACCACNONE 
J033085D15CGGCTCGGCCCACCACNONE 
J043021I09CGGCTCGGCCCACCACNONE 
J100055L05CGGCTCGGCCCACCACNONE 
Os12g0146300J065162K17TGTTGGGCTTTACATGGGCCGAGHypothetical protein. 
Os12g0168700AK065708GTTTGGGCCGAGAMP-dependent synthetase and ligase domain containing protein. 
AK065718GTTTGGGCCGAGNONE 
Os12g0182200009-110-C10CTCGGCCCGNONE 
AK069414CTCGGCCCGNONE 
Os12g0244000AK106408CTTGGGCTCGGCCCAAGHypothetical protein. 
Os12g0279600AK070295CTCGGCCCATTAExodeoxyribonuclease III xth family protein. 
Os12g0507600009-155-B05GGGTGGGCCCATCTCGGCCCATGANONE 
AK070613GGGTGGGCCCATCTCGGCCCATGAConserved hypothetical protein. 
J023063G03GGGTGGGCCCATCTCGGCCCATGANONE 
Os12g0599900AK101252TCTCGGCCCGGCCTetratricopeptide region domain containing protein. 
J033032F05TCTCGGCCCGGCCNONE 
Os12g0605400009-005-G05CTCGGCCCAACCCAGCCCACCTNONE 
016-024-B01CTCGGCCCAACCCAGCCCACCTNONE 
016-043-A11CTCGGCCCAACCCAGCCCACCTNONE 
AK068060CTCGGCCCAACCCAGCCCACCTSimilar to CROC-1-like protein (Fragment). 
J013130B07CTCGGCCCAACCCAGCCCACCTNONE 
J023141C14CTCGGCCCAACCCAGCCCACCTNONE 
J033037O04CTCGGCCCAACCCAGCCCACCTNONE 
J033081L17CTCGGCCCAACCCAGCCCACCTNONE 
J033108C03CTCGGCCCAACCCAGCCCACCTNONE 
J065079G22CTCGGCCCAACCCAGCCCACCTNONE 
J065082D03CTCGGCCCAACCCAGCCCACCTNONE 
J065207O15CTCGGCCCAACCCAGCCCACCTNONE 
J075027C23CTCGGCCCAACCCAGCCCACCTNONE 
J075037A17CTCGGCCCAACCCAGCCCACCTNONE 
J075056D17CTCGGCCCAACCCAGCCCACCTNONE 
J075064O21CTCGGCCCAACCCAGCCCACCTNONE 
J075096E08CTCGGCCCAACCCAGCCCACCTNONE 
J090036I15CTCGGCCCAACCCAGCCCACCTNONE 
J100018P15CTCGGCCCAACCCAGCCCACCTNONE 
J100074O06CTCGGCCCAACCCAGCCCACCTNONE 
Os12g0605800AK121511GGGCCGAGSimilar to 3-methylcrotonyl CoA carboxylase biotin-containing subunit (Fragment). 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.