version

Summary of OsREG577 (All List)

OrganismOryza sativa  
IDOsREG577  
SequenceCTGGCCCA  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count2031  

Entry Sequences (2031 entries)

LocusGene modelSequenceDescription
Os01g0104800AK067602TACTGGGCCAGSas10/Utp3 family protein. 
J013109E04TACTGGGCCAGNONE 
J033057M05TACTGGGCCAGNONE 
J043021M24TACTGGGCCAGNONE 
J090014N05TACTGGGCCAGNONE 
J090077H23TACTGGGCCAGNONE 
J090084H08TACTGGGCCAGNONE 
Os01g0132800AK068422CTGGCCCAAATPeptidyl-tRNA hydrolase family protein. 
Os01g0246100AK120732GGCTGGGCCAGProtein of unknown function DUF902, CREBbp domain containing protein. 
AK120732TCTGGCCCATCCACTGACProtein of unknown function DUF902, CREBbp domain containing protein. 
Os01g0248800009-103-G11CTGGCCCAGCNONE 
AK062766CTGGCCCAGCConserved hypothetical protein. 
Os01g0283000AK073165CTGGCCCATTTGCGGCCCAGTConserved hypothetical protein. 
AK073165GTATGGGCCAGConserved hypothetical protein. 
J033023G08CTGGCCCATTTGCGGCCCAGTNONE 
J033023G08GTATGGGCCAGNONE 
Os01g0283100004-018-B01ACTGGGCCGCAAATGGGCCAGNONE 
004-018-B01CTGGCCCATACNONE 
AK060908ACTGGGCCGCAAATGGGCCAGNONE 
AK060908CTGGCCCATACNONE 
AK071713ACTGGGCCGCAAATGGGCCAGSimilar to Ferripyochelin-binding protein-like. 
AK071713CTGGCCCATACSimilar to Ferripyochelin-binding protein-like. 
AK104205ACTGGGCCGCAAATGGGCCAGNONE 
AK104205CTGGCCCATACNONE 
AK122051ACTGGGCCGCAAATGGGCCAGNONE 
AK122051CTGGCCCATACNONE 
J023109L19ACTGGGCCGCAAATGGGCCAGNONE 
J023109L19CTGGCCCATACNONE 
Os01g0327600AK120216TCTGGCCCAATNONE 
AK121799TCTGGCCCAATConserved hypothetical protein. 
J065081I07TCTGGCCCAATNONE 
J065082D04TCTGGCCCAATNONE 
J065082G10TCTGGCCCAATNONE 
J065085G24TCTGGCCCAATNONE 
J065105J24TCTGGCCCAATNONE 
J065128D18TCTGGCCCAATNONE 
J065155D13TCTGGCCCAATNONE 
J065200C11TCTGGCCCAATNONE 
Os01g0331900013-026-D04TGTTGGGCCAGNONE 
AK064784TGTTGGGCCAGNONE 
AK121761TGTTGGGCCAGProtein of unknown function DUF846, eukaryotic family protein. 
J013000B15TGTTGGGCCAGNONE 
J033090D07TGTTGGGCCAGNONE 
J090006L21TGTTGGGCCAGNONE 
Os01g0369000AK064940AAATGGGCCAGSimilar to Cullin-1. 
AK104340AAATGGGCCAGNONE 
AY336990AAATGGGCCAGNONE 
J013000P07AAATGGGCCAGNONE 
J013056B18AAATGGGCCAGNONE 
J013056B20AAATGGGCCAGNONE 
J013098C09AAATGGGCCAGNONE 
J013099E23AAATGGGCCAGNONE 
J023007E10AAATGGGCCAGNONE 
J023064L04AAATGGGCCAGNONE 
J023119B15AAATGGGCCAGNONE 
J023126O19AAATGGGCCAGNONE 
J033120G16AAATGGGCCAGNONE 
J043007K19AAATGGGCCAGNONE 
J065037I22AAATGGGCCAGNONE 
J065051D18AAATGGGCCAGNONE 
J065073N09AAATGGGCCAGNONE 
J065084K20AAATGGGCCAGNONE 
J065115C15AAATGGGCCAGNONE 
J065115M01AAATGGGCCAGNONE 
J065121O10AAATGGGCCAGNONE 
J065197H21AAATGGGCCAGNONE 
J065211L23AAATGGGCCAGNONE 
J065214M19AAATGGGCCAGNONE 
J090006F13AAATGGGCCAGNONE 
J090012M21AAATGGGCCAGNONE 
J090029M05AAATGGGCCAGNONE 
J090048P16AAATGGGCCAGNONE 
J090051H13AAATGGGCCAGNONE 
J090062C14AAATGGGCCAGNONE 
J090072F21AAATGGGCCAGNONE 
J090085D11AAATGGGCCAGNONE 
J090090N24AAATGGGCCAGNONE 
J090095K17AAATGGGCCAGNONE 
J090099H12AAATGGGCCAGNONE 
J100031B11AAATGGGCCAGNONE 
J100053C15AAATGGGCCAGNONE 
J100075F19AAATGGGCCAGNONE 
J100087L22AAATGGGCCAGNONE 
Os01g0391100AK108533TCTGGCCCAAANONE 
AK121200TCTGGCCCAAASimilar to ATP-binding cassette, sub-family F, member 2 (Iron inhibited ABC transporter 2) (HUSSY-18). 
J023042H11TCTGGCCCAAANONE 
J023087I02TCTGGCCCAAANONE 
J065099C01TCTGGCCCAAANONE 
Os01g0517800J075194B21TCTGGCCCATAProtein of unknown function DUF597 family protein. 
Os01g0598400AK109846CTGGCCCACGAACyclin-like F-box domain containing protein. 
Os01g0618200AK102319CCTGGGCCAGCCCACCAProtein phosphatase 2C family protein. 
Os01g0618500011-019-D03ATTGGGCCAGGTTGGGCCATNONE 
AK067476ATTGGGCCAGGTTGGGCCATSimilar to RNA helicase (Fragment). 
J013020E19ATTGGGCCAGGTTGGGCCATNONE 
J033046J12ATTGGGCCAGGTTGGGCCATNONE 
J033055D06ATTGGGCCAGGTTGGGCCATNONE 
Os01g0621600AK100122ATTTGGGCCAGProtein of unknown function DUF1221 domain containing protein. 
Os01g0633000006-075-A01ACGCGTGGGCCAGANONE 
006-075-A01TCTGGGCCAGNONE 
009-064-A11ACGCGTGGGCCAGANONE 
009-064-A11TCTGGGCCAGNONE 
009-153-F07ACGCGTGGGCCAGANONE 
009-153-F07TCTGGGCCAGNONE 
AK062051ACGCGTGGGCCAGASimilar to 50S ribosomal protein L31. 
AK062051TCTGGGCCAGSimilar to 50S ribosomal protein L31. 
J013073B08ACGCGTGGGCCAGANONE 
J013073B08TCTGGGCCAGNONE 
J065006K19ACGCGTGGGCCAGANONE 
J065006K19TCTGGGCCAGNONE 
J065053P08ACGCGTGGGCCAGANONE 
J065053P08TCTGGGCCAGNONE 
J065057D08ACGCGTGGGCCAGANONE 
J065057D08TCTGGGCCAGNONE 
J065086P07ACGCGTGGGCCAGANONE 
J065086P07TCTGGGCCAGNONE 
J065095C14ACGCGTGGGCCAGANONE 
J065095C14TCTGGGCCAGNONE 
J065116B05ACGCGTGGGCCAGANONE 
J065116B05TCTGGGCCAGNONE 
J065164L20ACGCGTGGGCCAGANONE 
J065164L20TCTGGGCCAGNONE 
J065185K19ACGCGTGGGCCAGANONE 
J065185K19TCTGGGCCAGNONE 
J065191E21ACGCGTGGGCCAGANONE 
J065191E21TCTGGGCCAGNONE 
J065199P21ACGCGTGGGCCAGANONE 
J065199P21TCTGGGCCAGNONE 
J065216M12ACGCGTGGGCCAGANONE 
J065216M12TCTGGGCCAGNONE 
J075002M09ACGCGTGGGCCAGANONE 
J075002M09TCTGGGCCAGNONE 
J075016N10ACGCGTGGGCCAGANONE 
J075016N10TCTGGGCCAGNONE 
J075041K05ACGCGTGGGCCAGANONE 
J075041K05TCTGGGCCAGNONE 
J075094E04ACGCGTGGGCCAGANONE 
J075094E04TCTGGGCCAGNONE 
J075154O04ACGCGTGGGCCAGANONE 
J075154O04TCTGGGCCAGNONE 
J075176D22ACGCGTGGGCCAGANONE 
J075176D22TCTGGGCCAGNONE 
J075186M09ACGCGTGGGCCAGANONE 
J075186M09TCTGGGCCAGNONE 
J075191H20ACGCGTGGGCCAGANONE 
J075191H20TCTGGGCCAGNONE 
Os01g0649000AK073564TCTGGCCCAATWD40-like domain containing protein. 
Os01g0672700AK121375AAATGGGCCAGDNA polymerase, beta-like region domain containing protein. 
J023127C22AAATGGGCCAGNONE 
J033092B05AAATGGGCCAGNONE 
J033129P21AAATGGGCCAGNONE 
J065079H18AAATGGGCCAGNONE 
Os01g0702700009-179-G10CTGGCCCAGTNONE 
AK111782CTGGCCCAGTSimilar to Transcription factor MYB86 (Myb-related protein 86) (AtMYB86) (Myb homolog 4) (AtMyb4). 
J023084H22CTGGCCCAGTNONE 
J100021C12CTGGCCCAGTNONE 
J100025N10CTGGCCCAGTNONE 
J100043F22CTGGCCCAGTNONE 
Os01g0720700J033124M22ACGTGGGCCAGGCCCNONE 
J065006G21ACGTGGGCCAGGCCCNONE 
J065025M24ACGTGGGCCAGGCCCNONE 
J065041J02ACGTGGGCCAGGCCCNONE 
J065044B14ACGTGGGCCAGGCCCNONE 
J065061J06ACGTGGGCCAGGCCCNONE 
J065116L21ACGTGGGCCAGGCCCNONE 
J075030F18ACGTGGGCCAGGCCCNONE 
J075034K17ACGTGGGCCAGGCCCNONE 
J075063I02ACGTGGGCCAGGCCCNONE 
J075110D21ACGTGGGCCAGGCCCSimilar to Serine acetyltransferase. 
J075188L15ACGTGGGCCAGGCCCNONE 
J075197B17ACGTGGGCCAGGCCCNONE 
Os01g0764300J090053G03CTGGCCCATTTProtein of unknown function DUF155 family protein. 
Os01g0782300AK109175AGCCCACCTGGCCCAACAConserved hypothetical protein. 
Os01g0794900AK106644CTGGCCCATTTConserved hypothetical protein. 
Os01g0831900011-058-G07CCATGGGCCAGANONE 
AK063959CCATGGGCCAGANONE 
AK102106CCATGGGCCAGASimilar to Ammonium transporter. 
J033084D13CCATGGGCCAGANONE 
Os01g0842200003-126-E01TCTGGCCCAAGNONE 
AK102593TCTGGCCCAAGNONE 
AK119896TCTGGCCCAAGSimilar to Scarecrow-like 9 (Fragment). 
J013151G12TCTGGCCCAAGNONE 
J033098G15TCTGGCCCAAGNONE 
J090041L03TCTGGCCCAAGNONE 
J090069J20TCTGGCCCAAGNONE 
Os01g0919900006-027-D02ATTGGGCCAGANONE 
009-156-F01ATTGGGCCAGANONE 
AK060087ATTGGGCCAGANONE 
Os01g0936100AK101371ACATGGGCCAGASimilar to Protein kinase. 
Os01g0949200AK102412AACTGGGCCAGANONE 
J033093A04AACTGGGCCAGANONE 
J065053P06AACTGGGCCAGANONE 
J100086D18AACTGGGCCAGANONE 
Os01g0954400003-009-F12CGATGGGCCAGNONE 
012-080-B09CGATGGGCCAGNONE 
AK065709CGATGGGCCAGSimilar to Hydroxyproline-rich glycoprotein DZ-HRGP precursor. 
AK104335CGATGGGCCAGNONE 
J013039J02CGATGGGCCAGNONE 
J033081E17CGATGGGCCAGNONE 
J075058B02CGATGGGCCAGNONE 
J075067K19CGATGGGCCAGNONE 
J075120E23CGATGGGCCAGNONE 
J075147I16CGATGGGCCAGNONE 
Os01g0961200011-099-H06CTGGCCCACCAACNONE 
AK105424CTGGCCCACCAACCBS domain containing protein. 
J065169J18CTGGCCCACCAACNONE 
J075109H12CTGGCCCACCAACNONE 
Os01g0963300AK067544CTGGCCCACGGCCCACTSimilar to Syntaxin 61 (AtSYP61) (Osmotic stess-sensitive mutant 1). 
Os02g0116400AK072347CTGGCCCAAATOligopeptide transporter OPT superfamily protein. 
Os02g0119700AK108777TCTGGCCCAACCProtein prenyltransferase domain containing protein. 
Os02g0133900AK107180CTGGCCCACCProtein of unknown function DUF829, eukaryotic family protein. 
Os02g0143200AK070600AGGTGGGCCAGArmadillo-like helical domain containing protein. 
Os02g0158400006-048-F06ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
AK061569ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCAssDNA-binding transcriptional regulator family protein. 
AK099479ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
AK104768ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J013025B22ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J023009C03ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J033115N14ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J065036F05ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J065191K17ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J065202K16ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075053E14ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075101E04ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075111C06ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075137O04ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075139E07ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075143K07ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075144K15ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075164L14ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J075199D06ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J090010G24ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J090017C18ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J090066F01ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
J090088G01ATTGGGCCGTGGGCTGGCCCACCTGCCAGGCCCGCANONE 
Os02g0186700AK064492CTGGCCCATCAConserved hypothetical protein. 
J065210K09CTGGCCCATCANONE 
J075006A17CTGGCCCATCANONE 
J075108C18CTGGCCCATCANONE 
J075153E08CTGGCCCATCANONE 
Os02g0198000AK067695CTGGCCCATGAProtein of unknown function DUF1677, Oryza sativa family protein. 
Os02g0316800009-104-A11GCTGGGCCAGNONE 
AK062767GCTGGGCCAGSimilar to MRNA binding protein precursor. 
Os02g0452800J043024P15TGTGGGCCAGConserved hypothetical protein. 
Os02g0499300AK106994CTGGCCCACCAACCGTGGGCCACConserved hypothetical protein. 
Os02g0520800AK102815TACTGGGCCTGGGCCAGSimilar to Ubiquinol-cytochrome c reductase iron-sulfur subunit, mitochondrial precursor (EC 1.10.2.2) (Rieske iron-sulfur protein) (RISP). 
J033108M09TACTGGGCCTGGGCCAGNONE 
J100038E09TACTGGGCCTGGGCCAGNONE 
J100076G11TACTGGGCCTGGGCCAGNONE 
Os02g0525900003-101-C07CTGGCCCAAANONE 
AK060822CTGGCCCAAANONE 
J013038N07CTGGCCCAAANONE 
J013058P13CTGGCCCAAANONE 
J013070M20CTGGCCCAAANONE 
J013074B15CTGGCCCAAANONE 
J013123G17CTGGCCCAAANONE 
J013132H12CTGGCCCAAANONE 
J013160H21CTGGCCCAAANONE 
J023013O04CTGGCCCAAANONE 
J023066L21CTGGCCCAAANONE 
J023089C06CTGGCCCAAANONE 
J023091H21CTGGCCCAAANONE 
J023128K04CTGGCCCAAANONE 
J033027I17CTGGCCCAAANONE 
J033042N22CTGGCCCAAANONE 
J033055J03CTGGCCCAAANONE 
J033071C12CTGGCCCAAANONE 
J033074A19CTGGCCCAAANONE 
J033112A11CTGGCCCAAANONE 
J033118D15CTGGCCCAAANONE 
J033121K15CTGGCCCAAANONE 
J090010F18CTGGCCCAAANONE 
J090020A15CTGGCCCAAANONE 
J090033P12CTGGCCCAAANONE 
J090050E21CTGGCCCAAANONE 
J090070G22CTGGCCCAAANONE 
J090090E04CTGGCCCAAANONE 
J100026L11CTGGCCCAAANONE 
J100036N10CTGGCCCAAANONE 
J100041H24CTGGCCCAAANONE 
Os02g0527300AK101934CTGGCCCATCCSimilar to Heat shock transcription factor 31 (Fragment). 
J013047O11CTGGCCCATCCNONE 
J033073P11CTGGCCCATCCNONE 
Os02g0595400AK069935CTGGCCCAAATConserved hypothetical protein. 
AK069935CTGGCCCATATConserved hypothetical protein. 
AK099175CTGGCCCAAATNONE 
AK099175CTGGCCCATATNONE 
AK103993CTGGCCCAAATNONE 
AK103993CTGGCCCATATNONE 
J065021M23CTGGCCCAAATNONE 
J065021M23CTGGCCCATATNONE 
J065021M24CTGGCCCAAATNONE 
J065021M24CTGGCCCATATNONE 
J065205M09CTGGCCCAAATNONE 
J065205M09CTGGCCCATATNONE 
J100082C06CTGGCCCAAATNONE 
J100082C06CTGGCCCATATNONE 
Os02g0595700006-057-E01TCTGGCCCAAACNONE 
006-082-F10TCTGGCCCAAACNONE 
006-087-C10TCTGGCCCAAACNONE 
006-091-H03TCTGGCCCAAACNONE 
006-094-A11TCTGGCCCAAACNONE 
AF145053TCTGGCCCAAACNONE 
AK064937TCTGGCCCAAACNONE 
AK066858TCTGGCCCAAACNONE 
AK104785TCTGGCCCAAACNONE 
AK119587TCTGGCCCAAACChloroplast translational elongation factor Tu. 
J013000P03TCTGGCCCAAACNONE 
Os02g0634800003-004-F03TCTGGCCCATCTNONE 
AK059694TCTGGCCCATCTUbiquitin-conjugating enzyme, E2 domain containing protein. 
J013067H17TCTGGCCCATCTNONE 
J053077G20TCTGGCCCATCTNONE 
J075195F14TCTGGCCCATCTNONE 
Os02g0634900006-032-G12AGATGGGCCAGANONE 
006-033-E09AGATGGGCCAGANONE 
006-117-F10AGATGGGCCAGANONE 
006-118-E01AGATGGGCCAGANONE 
013-056-G08AGATGGGCCAGANONE 
AK059769AGATGGGCCAGANONE 
AK068583AGATGGGCCAGANONE 
AK072855AGATGGGCCAGAProteasome subunit alpha type 2 (EC 3.4.25.1) (20S proteasome alpha subunit B) (20S proteasome subunit alpha-2). 
AK106210AGATGGGCCAGANONE 
J023138P05AGATGGGCCAGANONE 
J023143J07AGATGGGCCAGANONE 
J033022O09AGATGGGCCAGANONE 
J033111L02AGATGGGCCAGANONE 
J033135O03AGATGGGCCAGANONE 
J065005K19AGATGGGCCAGANONE 
J065044C17AGATGGGCCAGANONE 
J065116K09AGATGGGCCAGANONE 
J065119O21AGATGGGCCAGANONE 
J075014L05AGATGGGCCAGANONE 
J075109H16AGATGGGCCAGANONE 
J075117D04AGATGGGCCAGANONE 
Os02g0638400AK060633AATTGGGCCAGABRO1 domain containing protein. 
AK060633GCTGGGCCAGBRO1 domain containing protein. 
J065083J17AATTGGGCCAGANONE 
J065083J17GCTGGGCCAGNONE 
Os02g0655300006-024-H05TCTGGCCCAACTNONE 
006-032-G04TCTGGCCCAACTNONE 
006-045-F03TCTGGCCCAACTNONE 
006-076-D04TCTGGCCCAACTNONE 
006-086-C09TCTGGCCCAACTNONE 
006-104-C07TCTGGCCCAACTNONE 
AK061544TCTGGCCCAACTNONE 
AK103778TCTGGCCCAACTNONE 
AK106107TCTGGCCCAACTNONE 
AK120006TCTGGCCCAACTNONE 
AY363174TCTGGCCCAACTSimilar to 3-isopropylmalate dehydratase, small subunit. 
J033145B21TCTGGCCCAACTNONE 
J065021C16TCTGGCCCAACTNONE 
J065182F01TCTGGCCCAACTNONE 
J075063I18TCTGGCCCAACTNONE 
J075151E01TCTGGCCCAACTNONE 
J075198K18TCTGGCCCAACTNONE 
J090026M06TCTGGCCCAACTNONE 
J090081H02TCTGGCCCAACTNONE 
J100061E20TCTGGCCCAACTNONE 
Os02g0658300AK073923TCTGGCCCAACAConserved hypothetical protein. 
J065152M15TCTGGCCCAACANONE 
Os02g0658500AK120166CTGGCCCACCANONE 
Os02g0661300016-077-C09AAATGGGCCAGCCCATAANONE 
AK106503AAATGGGCCAGCCCATAAConserved hypothetical protein. 
Os02g0666200006-021-D11CTGGCCCACCAGGGCCCACGCNONE 
006-022-F02CTGGCCCACCAGGGCCCACGCNONE 
006-022-H11CTGGCCCACCAGGGCCCACGCNONE 
006-024-C03CTGGCCCACCAGGGCCCACGCNONE 
006-026-G05CTGGCCCACCAGGGCCCACGCNONE 
006-027-F11CTGGCCCACCAGGGCCCACGCNONE 
006-028-G06CTGGCCCACCAGGGCCCACGCNONE 
006-028-H05CTGGCCCACCAGGGCCCACGCNONE 
006-030-H06CTGGCCCACCAGGGCCCACGCNONE 
006-030-H12CTGGCCCACCAGGGCCCACGCNONE 
006-031-C07CTGGCCCACCAGGGCCCACGCNONE 
006-031-G01CTGGCCCACCAGGGCCCACGCNONE 
006-033-F09CTGGCCCACCAGGGCCCACGCNONE 
006-035-A01CTGGCCCACCAGGGCCCACGCNONE 
006-035-A12CTGGCCCACCAGGGCCCACGCNONE 
006-035-F04CTGGCCCACCAGGGCCCACGCNONE 
006-036-G09CTGGCCCACCAGGGCCCACGCNONE 
006-038-A01CTGGCCCACCAGGGCCCACGCNONE 
006-038-A03CTGGCCCACCAGGGCCCACGCNONE 
006-039-D08CTGGCCCACCAGGGCCCACGCNONE 
006-042-C11CTGGCCCACCAGGGCCCACGCNONE 
006-042-H06CTGGCCCACCAGGGCCCACGCNONE 
006-044-E01CTGGCCCACCAGGGCCCACGCNONE 
006-045-E05CTGGCCCACCAGGGCCCACGCNONE 
006-046-G05CTGGCCCACCAGGGCCCACGCNONE 
006-047-A03CTGGCCCACCAGGGCCCACGCNONE 
006-048-H08CTGGCCCACCAGGGCCCACGCNONE 
006-052-A07CTGGCCCACCAGGGCCCACGCNONE 
006-053-A05CTGGCCCACCAGGGCCCACGCNONE 
006-054-G06CTGGCCCACCAGGGCCCACGCNONE 
006-056-D10CTGGCCCACCAGGGCCCACGCNONE 
006-057-B07CTGGCCCACCAGGGCCCACGCNONE 
006-058-F12CTGGCCCACCAGGGCCCACGCNONE 
006-060-D01CTGGCCCACCAGGGCCCACGCNONE 
006-061-A12CTGGCCCACCAGGGCCCACGCNONE 
006-062-E02CTGGCCCACCAGGGCCCACGCNONE 
006-063-F11CTGGCCCACCAGGGCCCACGCNONE 
006-063-H02CTGGCCCACCAGGGCCCACGCNONE 
006-066-F12CTGGCCCACCAGGGCCCACGCNONE 
006-067-H12CTGGCCCACCAGGGCCCACGCNONE 
006-068-B09CTGGCCCACCAGGGCCCACGCNONE 
006-068-D08CTGGCCCACCAGGGCCCACGCNONE 
006-071-A12CTGGCCCACCAGGGCCCACGCNONE 
006-072-H06CTGGCCCACCAGGGCCCACGCNONE 
006-074-A02CTGGCCCACCAGGGCCCACGCNONE 
006-074-F10CTGGCCCACCAGGGCCCACGCNONE 
006-077-H10CTGGCCCACCAGGGCCCACGCNONE 
006-078-G02CTGGCCCACCAGGGCCCACGCNONE 
006-081-B03CTGGCCCACCAGGGCCCACGCNONE 
006-084-H01CTGGCCCACCAGGGCCCACGCNONE 
006-084-H02CTGGCCCACCAGGGCCCACGCNONE 
006-084-H04CTGGCCCACCAGGGCCCACGCNONE 
006-087-H08CTGGCCCACCAGGGCCCACGCNONE 
006-090-B08CTGGCCCACCAGGGCCCACGCNONE 
006-091-E10CTGGCCCACCAGGGCCCACGCNONE 
006-093-G02CTGGCCCACCAGGGCCCACGCNONE 
006-094-B12CTGGCCCACCAGGGCCCACGCNONE 
006-094-E03CTGGCCCACCAGGGCCCACGCNONE 
006-095-G07CTGGCCCACCAGGGCCCACGCNONE 
006-095-H07CTGGCCCACCAGGGCCCACGCNONE 
006-097-G08CTGGCCCACCAGGGCCCACGCNONE 
006-098-E12CTGGCCCACCAGGGCCCACGCNONE 
006-099-A04CTGGCCCACCAGGGCCCACGCNONE 
006-099-E08CTGGCCCACCAGGGCCCACGCNONE 
006-103-F12CTGGCCCACCAGGGCCCACGCNONE 
006-104-G02CTGGCCCACCAGGGCCCACGCNONE 
006-105-F02CTGGCCCACCAGGGCCCACGCNONE 
006-107-D12CTGGCCCACCAGGGCCCACGCNONE 
006-108-F10CTGGCCCACCAGGGCCCACGCNONE 
006-108-H05CTGGCCCACCAGGGCCCACGCNONE 
006-110-G11CTGGCCCACCAGGGCCCACGCNONE 
006-111-D10CTGGCCCACCAGGGCCCACGCNONE 
006-111-E03CTGGCCCACCAGGGCCCACGCNONE 
006-111-H01CTGGCCCACCAGGGCCCACGCNONE 
006-113-C12CTGGCCCACCAGGGCCCACGCNONE 
006-114-C10CTGGCCCACCAGGGCCCACGCNONE 
006-115-B02CTGGCCCACCAGGGCCCACGCNONE 
006-117-D11CTGGCCCACCAGGGCCCACGCNONE 
006-117-E01CTGGCCCACCAGGGCCCACGCNONE 
009-131-C02CTGGCCCACCAGGGCCCACGCNONE 
009-133-G05CTGGCCCACCAGGGCCCACGCNONE 
009-152-E01CTGGCCCACCAGGGCCCACGCNONE 
009-154-E08CTGGCCCACCAGGGCCCACGCNONE 
009-196-C11CTGGCCCACCAGGGCCCACGCNONE 
012-010-E10CTGGCCCACCAGGGCCCACGCNONE 
013-018-C05CTGGCCCACCAGGGCCCACGCNONE 
013-074-A06CTGGCCCACCAGGGCCCACGCNONE 
013-078-E06CTGGCCCACCAGGGCCCACGCNONE 
AB009665CTGGCCCACCAGGGCCCACGCNONE 
AF022737CTGGCCCACCAGGGCCCACGCNONE 
AJ224327CTGGCCCACCAGGGCCCACGCNONE 
AK061769CTGGCCCACCAGGGCCCACGCNONE 
AK103807CTGGCCCACCAGGGCCCACGCAquaporin. 
AK104658CTGGCCCACCAGGGCCCACGCNONE 
J013065I12CTGGCCCACCAGGGCCCACGCNONE 
J013067L09CTGGCCCACCAGGGCCCACGCNONE 
J013089I10CTGGCCCACCAGGGCCCACGCNONE 
J013095N22CTGGCCCACCAGGGCCCACGCNONE 
J013130E17CTGGCCCACCAGGGCCCACGCNONE 
J013131A06CTGGCCCACCAGGGCCCACGCNONE 
J013154E06CTGGCCCACCAGGGCCCACGCNONE 
J023004D16CTGGCCCACCAGGGCCCACGCNONE 
J023010A15CTGGCCCACCAGGGCCCACGCNONE 
J023010H04CTGGCCCACCAGGGCCCACGCNONE 
J023049K10CTGGCCCACCAGGGCCCACGCNONE 
J023056H24CTGGCCCACCAGGGCCCACGCNONE 
J023064J12CTGGCCCACCAGGGCCCACGCNONE 
J023078I06CTGGCCCACCAGGGCCCACGCNONE 
J023081D05CTGGCCCACCAGGGCCCACGCNONE 
J023099I19CTGGCCCACCAGGGCCCACGCNONE 
J023100F05CTGGCCCACCAGGGCCCACGCNONE 
J023131F16CTGGCCCACCAGGGCCCACGCNONE 
J033025F16CTGGCCCACCAGGGCCCACGCNONE 
J033028F10CTGGCCCACCAGGGCCCACGCNONE 
J033058H13CTGGCCCACCAGGGCCCACGCNONE 
J033064P18CTGGCCCACCAGGGCCCACGCNONE 
J033070H04CTGGCCCACCAGGGCCCACGCNONE 
J033107P20CTGGCCCACCAGGGCCCACGCNONE 
J033114E09CTGGCCCACCAGGGCCCACGCNONE 
J033125G23CTGGCCCACCAGGGCCCACGCNONE 
J033136G05CTGGCCCACCAGGGCCCACGCNONE 
J033147A07CTGGCCCACCAGGGCCCACGCNONE 
J053048M24CTGGCCCACCAGGGCCCACGCNONE 
J053056K02CTGGCCCACCAGGGCCCACGCNONE 
J053057N24CTGGCCCACCAGGGCCCACGCNONE 
J053060C13CTGGCCCACCAGGGCCCACGCNONE 
J065053C22CTGGCCCACCAGGGCCCACGCNONE 
J065067J11CTGGCCCACCAGGGCCCACGCNONE 
J065085A01CTGGCCCACCAGGGCCCACGCNONE 
J065189K01CTGGCCCACCAGGGCCCACGCNONE 
J075024G24CTGGCCCACCAGGGCCCACGCNONE 
J075060O04CTGGCCCACCAGGGCCCACGCNONE 
J075075M07CTGGCCCACCAGGGCCCACGCNONE 
J075090A10CTGGCCCACCAGGGCCCACGCNONE 
J075110P11CTGGCCCACCAGGGCCCACGCNONE 
J075114H02CTGGCCCACCAGGGCCCACGCNONE 
J075127L13CTGGCCCACCAGGGCCCACGCNONE 
J075151B19CTGGCCCACCAGGGCCCACGCNONE 
J075187M17CTGGCCCACCAGGGCCCACGCNONE 
J075198E22CTGGCCCACCAGGGCCCACGCNONE 
J080006J20CTGGCCCACCAGGGCCCACGCNONE 
J080081J10CTGGCCCACCAGGGCCCACGCNONE 
J080087C03CTGGCCCACCAGGGCCCACGCNONE 
J090029E22CTGGCCCACCAGGGCCCACGCNONE 
J090037C19CTGGCCCACCAGGGCCCACGCNONE 
J090037P10CTGGCCCACCAGGGCCCACGCNONE 
J090047M10CTGGCCCACCAGGGCCCACGCNONE 
J090055K05CTGGCCCACCAGGGCCCACGCNONE 
J090057N19CTGGCCCACCAGGGCCCACGCNONE 
J090062M13CTGGCCCACCAGGGCCCACGCNONE 
J090066F22CTGGCCCACCAGGGCCCACGCNONE 
J090066N12CTGGCCCACCAGGGCCCACGCNONE 
J090071K08CTGGCCCACCAGGGCCCACGCNONE 
J090080F16CTGGCCCACCAGGGCCCACGCNONE 
J090081J21CTGGCCCACCAGGGCCCACGCNONE 
J090083F22CTGGCCCACCAGGGCCCACGCNONE 
J090083I12CTGGCCCACCAGGGCCCACGCNONE 
J090088B16CTGGCCCACCAGGGCCCACGCNONE 
J090088E01CTGGCCCACCAGGGCCCACGCNONE 
J090091C11CTGGCCCACCAGGGCCCACGCNONE 
J090091F17CTGGCCCACCAGGGCCCACGCNONE 
J090097A05CTGGCCCACCAGGGCCCACGCNONE 
J090098B15CTGGCCCACCAGGGCCCACGCNONE 
J100018B04CTGGCCCACCAGGGCCCACGCNONE 
J100021J08CTGGCCCACCAGGGCCCACGCNONE 
J100026M12CTGGCCCACCAGGGCCCACGCNONE 
J100032F02CTGGCCCACCAGGGCCCACGCNONE 
J100034B03CTGGCCCACCAGGGCCCACGCNONE 
J100037D13CTGGCCCACCAGGGCCCACGCNONE 
J100041C16CTGGCCCACCAGGGCCCACGCNONE 
J100044D14CTGGCCCACCAGGGCCCACGCNONE 
J100044E21CTGGCCCACCAGGGCCCACGCNONE 
J100047M16CTGGCCCACCAGGGCCCACGCNONE 
J100051D22CTGGCCCACCAGGGCCCACGCNONE 
J100056M13CTGGCCCACCAGGGCCCACGCNONE 
J100061J12CTGGCCCACCAGGGCCCACGCNONE 
J100065A22CTGGCCCACCAGGGCCCACGCNONE 
J100067L12CTGGCCCACCAGGGCCCACGCNONE 
J100068F06CTGGCCCACCAGGGCCCACGCNONE 
J100070C24CTGGCCCACCAGGGCCCACGCNONE 
J100072N09CTGGCCCACCAGGGCCCACGCNONE 
J100073A10CTGGCCCACCAGGGCCCACGCNONE 
J100073B15CTGGCCCACCAGGGCCCACGCNONE 
J100077F05CTGGCCCACCAGGGCCCACGCNONE 
J100078B03CTGGCCCACCAGGGCCCACGCNONE 
J100078F01CTGGCCCACCAGGGCCCACGCNONE 
J100079B08CTGGCCCACCAGGGCCCACGCNONE 
J100083J06CTGGCCCACCAGGGCCCACGCNONE 
Os02g0689200011-024-D04CTGGCCCAGANONE 
AK071254CTGGCCCAGANONE 
AK072660CTGGCCCAGAProtein of unknown function DUF250 domain containing protein. 
J023087G23CTGGCCCAGANONE 
J023134O11CTGGCCCAGANONE 
J033095E21CTGGCCCAGANONE 
J033113F12CTGGCCCAGANONE 
J033124F02CTGGCCCAGANONE 
J065070A01CTGGCCCAGANONE 
J065129C05CTGGCCCAGANONE 
J065165M19CTGGCCCAGANONE 
J090015K07CTGGCCCAGANONE 
J090066D21CTGGCCCAGANONE 
J090075M20CTGGCCCAGANONE 
Os02g0725300AK120054CTGGCCCAGGNONE 
J013000L05CTGGCCCAGGNONE 
J065194M19CTGGCCCAGGNONE 
Os02g0767900009-154-G01AGGTGGGCCTGGCCCATCANONE 
009-172-H09AGGTGGGCCTGGCCCATCANONE 
AK099885AGGTGGGCCTGGCCCATCAGlutaredoxin 2 family protein. 
Os02g0771700011-075-D10CTGGCCCACTNONE 
011-086-E10CTGGCCCACTNONE 
AK058571CTGGCCCACTGlycoside hydrolase, family 17 protein. 
AK102185CTGGCCCACTNONE 
J023001D03CTGGCCCACTNONE 
J023041N11CTGGCCCACTNONE 
J033086N13CTGGCCCACTNONE 
J033106K14CTGGCCCACTNONE 
J033125P22CTGGCCCACTNONE 
Os02g0782200AK070439TCTGGCCCATCANONE 
AK101869TCTGGCCCATCANOT2/NOT3/NOT5 domain containing protein. 
Os02g0795100016-001-E07CTGGCCCAGGNONE 
AK106456CTGGCCCAGGEukaryotic transcription factor, DNA-binding domain containing protein. 
Os02g0810300AK059363AAATGGGCCAGGGCCCAGGSimilar to NBD-like protein. 
AK099203AAATGGGCCAGGGCCCAGGNONE 
Os02g0814300AK111376TTTTGGGCCAGCytochrome c, monohaem domain containing protein. 
J065063I24TTTTGGGCCAGNONE 
Os02g0818000005-003-E01TGGTGGGCCAGNONE 
006-055-D08TGGTGGGCCAGNONE 
006-060-D05TGGTGGGCCAGNONE 
006-086-H02TGGTGGGCCAGNONE 
006-091-B04TGGTGGGCCAGNONE 
009-152-H12TGGTGGGCCAGNONE 
009-184-D08TGGTGGGCCAGNONE 
AK071580TGGTGGGCCAGNONE 
AK104103TGGTGGGCCAGNONE 
AK104525TGGTGGGCCAGNONE 
AK104684TGGTGGGCCAGNONE 
AK104947TGGTGGGCCAGNONE 
J013032M21TGGTGGGCCAGNONE 
J013032M22TGGTGGGCCAGNONE 
J013044P09TGGTGGGCCAGNONE 
J013056P03TGGTGGGCCAGNONE 
J013070P08TGGTGGGCCAGNONE 
J013106H15TGGTGGGCCAGNONE 
J013146O03TGGTGGGCCAGNONE 
J013170F21TGGTGGGCCAGNONE 
J023038I01TGGTGGGCCAGNONE 
J023049P19TGGTGGGCCAGNONE 
J023106O04TGGTGGGCCAGNONE 
J053100K06TGGTGGGCCAGNONE 
J075026E09TGGTGGGCCAGNONE 
J075043L03TGGTGGGCCAGNONE 
J075049B11TGGTGGGCCAGNONE 
J080301G04TGGTGGGCCAGNONE 
J080305H10TGGTGGGCCAGNONE 
J080308H05TGGTGGGCCAGNONE 
J080311I19TGGTGGGCCAGNONE 
J080315G02TGGTGGGCCAGNONE 
J080315J24TGGTGGGCCAGNONE 
J080316D10TGGTGGGCCAGNONE 
J080317H09TGGTGGGCCAGNONE 
J080317J05TGGTGGGCCAGNONE 
J080318H15TGGTGGGCCAGNONE 
J090047M14TGGTGGGCCAGNONE 
J100025F05TGGTGGGCCAGNONE 
J100060C16TGGTGGGCCAGNONE 
J100064H07TGGTGGGCCAGNONE 
J100075N11TGGTGGGCCAGNONE 
J100081E01TGGTGGGCCAGNONE 
J100085G12TGGTGGGCCAGNONE 
Os02g0823000AK122065CTGGCCCATGAPeptidase A22B, minor histocompatibility antigen H13 family protein. 
Os02g0827900AK099911TGATGGGCCAGCGGCCCATACSimilar to Signal peptidase 18 subunit (Fragment). 
Os03g0108500AK108704CTGGCCCATCGSimilar to 4,4-dimethyl-sterol C4-methyl-oxidase (Fragment). 
Os03g0142800015-062-B07CTGGCCCAAACNONE 
AK064325CTGGCCCAAACNONE 
Os03g0171700J065192H12AGCCCATGGGCCAGBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
Os03g0198400AK059522CTGGCCCAACTTGGGCCCATCCNONE 
AK103101CTGGCCCAACTTGGGCCCATCCSimilar to Seryl-tRNA synthetase (EC 6.1.1.11) (Serine--tRNA ligase) (SerRS) (Fragment). 
J075015H19CTGGCCCAACTTGGGCCCATCCNONE 
J075036K08CTGGCCCAACTTGGGCCCATCCNONE 
J075040J23CTGGCCCAACTTGGGCCCATCCNONE 
J075041H18CTGGCCCAACTTGGGCCCATCCNONE 
J075053H18CTGGCCCAACTTGGGCCCATCCNONE 
J075055K15CTGGCCCAACTTGGGCCCATCCNONE 
J075111K03CTGGCCCAACTTGGGCCCATCCNONE 
J075125B22CTGGCCCAACTTGGGCCCATCCNONE 
J075195L10CTGGCCCAACTTGGGCCCATCCNONE 
Os03g0205500Os03g0205500CCCGGGCCCGGCCCACTGGCCCAGTCytochrome b5 domain containing protein. 
Os03g0219200011-045-E01CTGGCCCAAAANONE 
AK073785CTGGCCCAAAASimilar to Superoxide dismutase (EC 1.15.1.1). 
J033068D19CTGGCCCAAAANONE 
J043009H23CTGGCCCAAAANONE 
Os03g0227000AK068454CTGGCCCAACASimilar to Coatomer gamma subunit (Gamma-coat protein) (Gamma-COP). 
Os03g0277000AK100522TCTGGCCCAAAASimilar to GDP dissociation inhibitor protein OsGDI1. 
Os03g0294600AK110762TCTGGCCCAAGSimilar to Importin-beta1. 
Os03g0295500009-083-F02TGTGGGCCAGANONE 
J053029J05TGTGGGCCAGANONE 
J053054B07TGTGGGCCAGACHCH domain containing protein. 
J065024G23TGTGGGCCAGANONE 
J065036F08TGTGGGCCAGANONE 
J065066M11TGTGGGCCAGANONE 
J065143G19TGTGGGCCAGANONE 
Os03g0297100006-113-D12CTGGCCCAACNONE 
AK059192CTGGCCCAACNONE 
AK061276CTGGCCCAACSimilar to 40S ribosomal protein S7. 
AK122143CTGGCCCAACNONE 
J023012D24CTGGCCCAACNONE 
J023041A08CTGGCCCAACNONE 
J033067H08CTGGCCCAACNONE 
J033119B03CTGGCCCAACNONE 
J033131K19CTGGCCCAACNONE 
J033136J20CTGGCCCAACNONE 
J053027D07CTGGCCCAACNONE 
J065191B01CTGGCCCAACNONE 
J065205G10CTGGCCCAACNONE 
J075112A12CTGGCCCAACNONE 
J075136D05CTGGCCCAACNONE 
J080069C17CTGGCCCAACNONE 
J090073P06CTGGCCCAACNONE 
J100026B16CTGGCCCAACNONE 
J100068P21CTGGCCCAACNONE 
J100069E15CTGGCCCAACNONE 
J100081D07CTGGCCCAACNONE 
J100088C15CTGGCCCAACNONE 
Os03g0298300AK061180AGTGGGCCAGProtein of unknown function DUF588 family protein. 
AK099089AGTGGGCCAGNONE 
Os03g0308000016-023-H09CTGGCCCAACNONE 
AK100355CTGGCCCAACUbiquitin-conjugating enzyme, E2 domain containing protein. 
J023013H05CTGGCCCAACNONE 
J023043K04CTGGCCCAACNONE 
J023083I20CTGGCCCAACNONE 
J033068F22CTGGCCCAACNONE 
J033125P21CTGGCCCAACNONE 
J065207A22CTGGCCCAACNONE 
J100018D20CTGGCCCAACNONE 
J100026L17CTGGCCCAACNONE 
J100055D14CTGGCCCAACNONE 
J100060P03CTGGCCCAACNONE 
J100078A20CTGGCCCAACNONE 
Os03g0312600AK073391TGATGGGCCAGSimilar to XPA-binding protein 1 (HUSSY-23). 
Os03g0342900006-032-D01CTGGCCCACCTCGCCCCACGNONE 
006-033-E10CTGGCCCACCTCGCCCCACGNONE 
006-051-G06CTGGCCCACCTCGCCCCACGNONE 
006-053-E05CTGGCCCACCTCGCCCCACGNONE 
006-056-B05CTGGCCCACCTCGCCCCACGNONE 
006-058-F04CTGGCCCACCTCGCCCCACGNONE 
006-059-E05CTGGCCCACCTCGCCCCACGNONE 
006-060-F10CTGGCCCACCTCGCCCCACGNONE 
006-104-D12CTGGCCCACCTCGCCCCACGNONE 
009-129-C12CTGGCCCACCTCGCCCCACGNONE 
AK060136CTGGCCCACCTCGCCCCACGNONE 
AK060980CTGGCCCACCTCGCCCCACGNONE 
AK064815CTGGCCCACCTCGCCCCACGDormancyauxin associated family protein. 
AK104244CTGGCCCACCTCGCCCCACGNONE 
AK104391CTGGCCCACCTCGCCCCACGNONE 
AK104590CTGGCCCACCTCGCCCCACGNONE 
AK104744CTGGCCCACCTCGCCCCACGNONE 
AK106100CTGGCCCACCTCGCCCCACGNONE 
J013000E10CTGGCCCACCTCGCCCCACGNONE 
J075027O22CTGGCCCACCTCGCCCCACGNONE 
J075052J03CTGGCCCACCTCGCCCCACGNONE 
J075066E15CTGGCCCACCTCGCCCCACGNONE 
J075095C17CTGGCCCACCTCGCCCCACGNONE 
J075118N05CTGGCCCACCTCGCCCCACGNONE 
J075187K22CTGGCCCACCTCGCCCCACGNONE 
J090026L04CTGGCCCACCTCGCCCCACGNONE 
J090059G16CTGGCCCACCTCGCCCCACGNONE 
J100055P20CTGGCCCACCTCGCCCCACGNONE 
J100062A10CTGGCCCACCTCGCCCCACGNONE 
J100068G20CTGGCCCACCTCGCCCCACGNONE 
Os03g0343700AK060603ACATGGGCCAGABrix domain containing protein. 
AK102274ACATGGGCCAGANONE 
J033089C06ACATGGGCCAGANONE 
J090089A17ACATGGGCCAGANONE 
Os03g0363800AK103387AGATGGGCCGCTGGCCCATGGGCCCATGGGCCTTSimilar to SC35-like splicing factor SCL28, 28 kD. 
Os03g0379300006-039-F11CTGGCCCACCACNONE 
AK061515CTGGCCCACCACBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
AK068704CTGGCCCACCACNONE 
J013159M16CTGGCCCACCACNONE 
J090067F01CTGGCCCACCACNONE 
J090083F21CTGGCCCACCACNONE 
J100040M08CTGGCCCACCACNONE 
J100048C03CTGGCCCACCACNONE 
J100056M07CTGGCCCACCACNONE 
J100062N22CTGGCCCACCACNONE 
J100086L07CTGGCCCACCACNONE 
Os03g0383100AK107106AGCCCAATGGGCCAGAConserved hypothetical protein. 
AK107106CTGGCCCATGAConserved hypothetical protein. 
Os03g0415500AK108435TGGTGGGCCCTGGCCCATCAMitochondrial import inner membrane translocase, subunit Tim17/22 family protein. 
J065182P12TGGTGGGCCCTGGCCCATCANONE 
Os03g0567100AK109220CTCGCGCGCCGCGTGGGCTGTATGGGCCAGConserved hypothetical protein. 
Os03g0583800AK064786CTGGCCCAGCCMpv17/PMP22 family protein. 
AK099233CTGGCCCAGCCNONE 
J013000B17CTGGCCCAGCCNONE 
J013071N13CTGGCCCAGCCNONE 
J013095M11CTGGCCCAGCCNONE 
J080068F05CTGGCCCAGCCNONE 
J080069C02CTGGCCCAGCCNONE 
J080072E22CTGGCCCAGCCNONE 
J100052H10CTGGCCCAGCCNONE 
J100053H09CTGGCCCAGCCNONE 
J100056G03CTGGCCCAGCCNONE 
Os03g0586800003-114-H11TCATGGGCCAGGCCCNONE 
AK063765TCATGGGCCAGGCCCSimilar to Lysyl-tRNA synthetase (EC 6.1.1.6) (Lysine--tRNA ligase) (LysRS). 
AK099302TCATGGGCCAGGCCCNONE 
J090004H06TCATGGGCCAGGCCCNONE 
J090022N15TCATGGGCCAGGCCCNONE 
J100035E05TCATGGGCCAGGCCCNONE 
J100041L05TCATGGGCCAGGCCCNONE 
J100041M18TCATGGGCCAGGCCCNONE 
J100057P04TCATGGGCCAGGCCCNONE 
J100089H06TCATGGGCCAGGCCCNONE 
J100090C23TCATGGGCCAGGCCCNONE 
Os03g0606200009-030-E09TCTGGCCCACGTGNONE 
009-076-H10TCTGGCCCACGTGNONE 
009-122-H12TCTGGCCCACGTGNONE 
009-153-F09TCTGGCCCACGTGNONE 
AB055076TCTGGCCCACGTGMitochondrial ATP synthase 6 KD subunit. 
AK072384TCTGGCCCACGTGNONE 
AK107928TCTGGCCCACGTGNONE 
J023078E13TCTGGCCCACGTGNONE 
J053031N01TCTGGCCCACGTGNONE 
J053046K19TCTGGCCCACGTGNONE 
J053062P07TCTGGCCCACGTGNONE 
J053091C23TCTGGCCCACGTGNONE 
J053099N19TCTGGCCCACGTGNONE 
J065005E06TCTGGCCCACGTGNONE 
J065030N03TCTGGCCCACGTGNONE 
J065138O21TCTGGCCCACGTGNONE 
J065159K03TCTGGCCCACGTGNONE 
J075030M08TCTGGCCCACGTGNONE 
J080006E23TCTGGCCCACGTGNONE 
J080010D10TCTGGCCCACGTGNONE 
J080016N17TCTGGCCCACGTGNONE 
J080024N09TCTGGCCCACGTGNONE 
J080028E23TCTGGCCCACGTGNONE 
J080035I11TCTGGCCCACGTGNONE 
J080038D15TCTGGCCCACGTGNONE 
J080040H08TCTGGCCCACGTGNONE 
J080043L04TCTGGCCCACGTGNONE 
J080047C06TCTGGCCCACGTGNONE 
J080061G04TCTGGCCCACGTGNONE 
J080066E10TCTGGCCCACGTGNONE 
J080067P03TCTGGCCCACGTGNONE 
J080082D07TCTGGCCCACGTGNONE 
J080089M13TCTGGCCCACGTGNONE 
J080094O09TCTGGCCCACGTGNONE 
J080095C24TCTGGCCCACGTGNONE 
J080309E21TCTGGCCCACGTGNONE 
J090016G15TCTGGCCCACGTGNONE 
J090031C20TCTGGCCCACGTGNONE 
J090033A15TCTGGCCCACGTGNONE 
J090037L07TCTGGCCCACGTGNONE 
J090038I10TCTGGCCCACGTGNONE 
J090072P19TCTGGCCCACGTGNONE 
J100040J02TCTGGCCCACGTGNONE 
J100047N05TCTGGCCCACGTGNONE 
J100048M10TCTGGCCCACGTGNONE 
J100076C02TCTGGCCCACGTGNONE 
J100077G23TCTGGCCCACGTGNONE 
J100080O08TCTGGCCCACGTGNONE 
J100085C06TCTGGCCCACGTGNONE 
J100085F16TCTGGCCCACGTGNONE 
Os03g0685900009-026-A09CTGGCCCATCANONE 
009-145-C09CTGGCCCATCANONE 
AK062981CTGGCCCATCAConserved hypothetical protein. 
J065001D12CTGGCCCATCANONE 
J065023B10CTGGCCCATCANONE 
J065041E10CTGGCCCATCANONE 
J065046C01CTGGCCCATCANONE 
J065146I22CTGGCCCATCANONE 
J065184F20CTGGCCCATCANONE 
J075011E15CTGGCCCATCANONE 
J075048H17CTGGCCCATCANONE 
J075070H15CTGGCCCATCANONE 
J075133C01CTGGCCCATCANONE 
J075170D02CTGGCCCATCANONE 
J090001G08CTGGCCCATCANONE 
J090026B09CTGGCCCATCANONE 
J100055M03CTGGCCCATCANONE 
Os03g0701000J075172J23CTGGCCCATGGGCCCCNONE 
Os03g0701900AK068404CTGGCCCAAAAConserved hypothetical protein. 
Os03g0704400AK101297CTTGGGCCAGProtein kinase domain containing protein. 
J033033I19CTTGGGCCAGNONE 
J090009M06CTTGGGCCAGNONE 
Os03g0712200AK073205AACTGGGCCCGGTTGGGCCAGZinc finger, RanBP2-type domain containing protein. 
AK098968AACTGGGCCCGGTTGGGCCAGNONE 
Os03g0712600015-008-G03CGCGTGGGCCTGGCCCACTNONE 
AK103705CGCGTGGGCCTGGCCCACTHypothetical protein. 
J033136N14CGCGTGGGCCTGGCCCACTNONE 
Os03g0727100AK068587ATTGGGCCAGAConserved hypothetical protein. 
J013153F04ATTGGGCCAGANONE 
J065165J09ATTGGGCCAGANONE 
Os03g0744700AK071178GTATGGGCCAGGCCCAACTConserved hypothetical protein. 
J075006D24GTATGGGCCAGGCCCAACTNONE 
J075165F21GTATGGGCCAGGCCCAACTNONE 
Os03g0753100AB003324GCTGGGCCAGNONE 
AK100227GCTGGGCCAGTranscription factor, MADS-box domain containing protein. 
AY551917GCTGGGCCAGNONE 
AY551922GCTGGGCCAGNONE 
AY551926GCTGGGCCAGNONE 
J023012N20GCTGGGCCAGNONE 
J023048E14GCTGGGCCAGNONE 
Os03g0766900AK066137TAATGGGCCAGAllene oxide synthase. 
AK071361TAATGGGCCAGNONE 
AK103989TAATGGGCCAGNONE 
J023090K09TAATGGGCCAGNONE 
J043022H11TAATGGGCCAGNONE 
J053078F12TAATGGGCCAGNONE 
Os03g0774200AK065851AGATGGGCCAGANONE 
AK119532AGATGGGCCAGASimilar to NADH-ubiquinone oxidoreductase subunit 8 (EC 1.6.5.3). 
J013041L15AGATGGGCCAGANONE 
J023107I03AGATGGGCCAGANONE 
J065156I19AGATGGGCCAGANONE 
J065176L07AGATGGGCCAGANONE 
J100066F15AGATGGGCCAGANONE 
Os03g0792400AK064808AGTTGGGCCAGPeptidase M50 family protein. 
J013000D19AGTTGGGCCAGNONE 
J013106E22AGTTGGGCCAGNONE 
J075053A21AGTTGGGCCAGNONE 
Os03g0798600AK121716AAATGGGCCAGSimilar to 40S ribosomal protein S15 (Fragment). 
J013120B18AAATGGGCCAGNONE 
J033079G18AAATGGGCCAGNONE 
J043038B19AAATGGGCCAGNONE 
J065091E15AAATGGGCCAGNONE 
J065092P10AAATGGGCCAGNONE 
J065189F18AAATGGGCCAGNONE 
J065189L12AAATGGGCCAGNONE 
J075021B11AAATGGGCCAGNONE 
J075022L15AAATGGGCCAGNONE 
J075046G12AAATGGGCCAGNONE 
J075080H15AAATGGGCCAGNONE 
J090045H01AAATGGGCCAGNONE 
J090077H16AAATGGGCCAGNONE 
J090083D22AAATGGGCCAGNONE 
J100021D24AAATGGGCCAGNONE 
J100023G04AAATGGGCCAGNONE 
J100049J23AAATGGGCCAGNONE 
J100075K23AAATGGGCCAGNONE 
J100077G22AAATGGGCCAGNONE 
Os03g0802300AK120564TGTTGGGCCAGConserved hypothetical protein. 
AK120687TGTTGGGCCAGNONE 
Os03g0828100009-088-D04CTGGCCCATCANONE 
009-125-F01CTGGCCCATCANONE 
009-169-C06CTGGCCCATCANONE 
AK059132CTGGCCCATCANONE 
AK062799CTGGCCCATCANONE 
AK099043CTGGCCCATCASimilar to 50S ribosomal protein L18. 
J013146D01CTGGCCCATCANONE 
J065057J16CTGGCCCATCANONE 
Os03g0832200AK070712CCCGTGGGCCAGSimilar to Calcium-binding protein precursor (Calreticulin). 
Os03g0832600AK120137CGTGTGGGCCAGSimilar to Galactokinase (EC 2.7.1.6) (Galactose kinase). 
Os03g0833900AK073655CAGGCCCATGGGCTGGCCCACCCGSimilar to Cytosine deaminase (EC 3.5.4.1). 
AK103800CAGGCCCATGGGCTGGCCCACCCGNONE 
AK104068CAGGCCCATGGGCTGGCCCACCCGNONE 
J075031J11CAGGCCCATGGGCTGGCCCACCCGNONE 
J075051N01CAGGCCCATGGGCTGGCCCACCCGNONE 
J075166D18CAGGCCCATGGGCTGGCCCACCCGNONE 
J075171E14CAGGCCCATGGGCTGGCCCACCCGNONE 
Os03g0853800006-064-F07CTGGCCCATATCGGCCCATGTNONE 
006-069-B11CTGGCCCATATCGGCCCATGTNONE 
006-104-B10CTGGCCCATATCGGCCCATGTNONE 
AK059849CTGGCCCATATCGGCCCATGTNONE 
AK102872CTGGCCCATATCGGCCCATGTNONE 
AK120043CTGGCCCATATCGGCCCATGTProtein of unknown function DUF1301 family protein. 
J033112B07CTGGCCCATATCGGCCCATGTNONE 
J053059J20CTGGCCCATATCGGCCCATGTNONE 
J065155F15CTGGCCCATATCGGCCCATGTNONE 
Os04g0105700004-005-E05ATTGGGCCAGNONE 
006-037-C11ATTGGGCCAGNONE 
006-039-E07ATTGGGCCAGNONE 
006-049-A02ATTGGGCCAGNONE 
006-076-D05ATTGGGCCAGNONE 
006-089-E04ATTGGGCCAGNONE 
006-097-F12ATTGGGCCAGNONE 
AK060872ATTGGGCCAGNONE 
AK065082ATTGGGCCAGNONE 
AK104254ATTGGGCCAGConserved hypothetical protein. 
AK104546ATTGGGCCAGNONE 
AK104634ATTGGGCCAGNONE 
AY224557ATTGGGCCAGNONE 
J013001L09ATTGGGCCAGNONE 
J013151B18ATTGGGCCAGNONE 
J023054G18ATTGGGCCAGNONE 
Os04g0370600AK103855AATGGGCCAGGAGGCCCAGG4Fe-4S ferredoxin, iron-sulfur binding domain containing protein. 
J023115N20AATGGGCCAGGAGGCCCAGGNONE 
J033148N10AATGGGCCAGGAGGCCCAGGNONE 
J090031L24AATGGGCCAGGAGGCCCAGGNONE 
J090089F12AATGGGCCAGGAGGCCCAGGNONE 
Os04g0407300AK101793GCTGGGCCAGNONE 
AK121980GCTGGGCCAGHypothetical protein. 
J033065K23GCTGGGCCAGNONE 
J033108L11GCTGGGCCAGNONE 
Os04g0428900009-068-A06AGATGGGCCAGANONE 
AK061355AGATGGGCCAGASimilar to CSN8. 
AK099153AGATGGGCCAGANONE 
AY336991AGATGGGCCAGANONE 
J023069F08AGATGGGCCAGANONE 
J065112H12AGATGGGCCAGANONE 
J075022F23AGATGGGCCAGANONE 
J090045D23AGATGGGCCAGANONE 
J090067E18AGATGGGCCAGANONE 
J090099H14AGATGGGCCAGANONE 
Os04g0447600006-023-A01CTGGCCCAGGNONE 
006-080-D11CTGGCCCAGGNONE 
006-095-D01CTGGCCCAGGNONE 
006-114-F03CTGGCCCAGGNONE 
AK061282CTGGCCCAGGSimilar to NADPH-dependent codeinone reductase (EC 1.1.1.247). 
Os04g0475500Os04g0475500CTGGCCCACCCConserved hypothetical protein. 
Os04g0486500AK111976GAAGCCCACTGGCCCACCGCCCACACGACCGTTGSimilar to Mitotic spindle checkpoint protein MAD2. 
Os04g0496400011-042-H11CTGGCCCAATNONE 
AK111787CTGGCCCAATRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
AY224465CTGGCCCAATNONE 
J033106N02CTGGCCCAATNONE 
J043026P11CTGGCCCAATNONE 
J065134J18CTGGCCCAATNONE 
Os04g0503800J065116G03TTTTGGGCCAGNONE 
Os04g0529600Os04g0529600TCTGGCCCACACGTCACLanthionine synthetase C-like family protein. 
Os04g0530300009-053-E04GACACGTGCTGGGCTGCTGGCCCACATGTCAGTGNONE 
009-074-E03GACACGTGCTGGGCTGCTGGCCCACATGTCAGTGNONE 
AK066705GACACGTGCTGGGCTGCTGGCCCACATGTCAGTGConserved hypothetical protein. 
Os04g0530400AK067634CACTGACATGTGGGCCAGCAGCCCAGCACGTGTCt-snare domain containing protein. 
Os04g0550200AK108473CTGGCCCACAAPathogenesis-related transcriptional factor and ERF domain containing protein. 
Os04g0564700AK111806ATTGGGCCAGQuinonprotein alcohol dehydrogenase-like domain containing protein. 
Os04g0570600AK106747AGATGGGCCAGACytochrome P450 family protein. 
J080319G08AGATGGGCCAGANONE 
Os04g0577000AK073711CTGGCCCATATUbiquitin fusion degradation protein UFD1 family protein. 
AK119957CTGGCCCATATNONE 
J013127H04CTGGCCCATATNONE 
J033035G06CTGGCCCATATNONE 
J033061G23CTGGCCCATATNONE 
J033127L07CTGGCCCATATNONE 
J065015F17CTGGCCCATATNONE 
J065062G08CTGGCCCATATNONE 
J065132M07CTGGCCCATATNONE 
J065155C12CTGGCCCATATNONE 
J075055I08CTGGCCCATATNONE 
J075140D07CTGGCCCATATNONE 
J090055B21CTGGCCCATATNONE 
J100031D23CTGGCCCATATNONE 
Os04g0585600006-117-A02TCTGGCCCAAAANONE 
AK106073TCTGGCCCAAAAConserved hypothetical protein. 
J053089I23TCTGGCCCAAAANONE 
J065112K06TCTGGCCCAAAANONE 
J065128D09TCTGGCCCAAAANONE 
J100038D09TCTGGCCCAAAANONE 
Os04g0611300009-006-G08TATTGGGCTGGCCCAATTNONE 
009-011-C01TATTGGGCTGGCCCAATTNONE 
009-036-B09TATTGGGCTGGCCCAATTNONE 
009-116-G09TATTGGGCTGGCCCAATTNONE 
009-126-E09TATTGGGCTGGCCCAATTNONE 
009-132-F09TATTGGGCTGGCCCAATTNONE 
009-151-G07TATTGGGCTGGCCCAATTNONE 
009-155-C07TATTGGGCTGGCCCAATTNONE 
009-163-G01TATTGGGCTGGCCCAATTNONE 
009-169-G08TATTGGGCTGGCCCAATTNONE 
009-191-B02TATTGGGCTGGCCCAATTNONE 
009-196-A08TATTGGGCTGGCCCAATTNONE 
009-198-E07TATTGGGCTGGCCCAATTNONE 
014-015-F04TATTGGGCTGGCCCAATTNONE 
015-087-H04TATTGGGCTGGCCCAATTNONE 
AK062605TATTGGGCTGGCCCAATTNONE 
AK063022TATTGGGCTGGCCCAATTConserved hypothetical protein. 
AK066749TATTGGGCTGGCCCAATTNONE 
AK104924TATTGGGCTGGCCCAATTNONE 
J065002M20TATTGGGCTGGCCCAATTNONE 
J065045L23TATTGGGCTGGCCCAATTNONE 
J065101E05TATTGGGCTGGCCCAATTNONE 
J065140J23TATTGGGCTGGCCCAATTNONE 
J065179G11TATTGGGCTGGCCCAATTNONE 
J065191B18TATTGGGCTGGCCCAATTNONE 
J065192E03TATTGGGCTGGCCCAATTNONE 
J065199H21TATTGGGCTGGCCCAATTNONE 
J075067F01TATTGGGCTGGCCCAATTNONE 
J075089L01TATTGGGCTGGCCCAATTNONE 
J075147K22TATTGGGCTGGCCCAATTNONE 
J080069G23TATTGGGCTGGCCCAATTNONE 
J100053D10TATTGGGCTGGCCCAATTNONE 
J100078C10TATTGGGCTGGCCCAATTNONE 
Os04g0626400006-050-B09CAAGGCCCTGGCCCAGCNONE 
006-072-C12CAAGGCCCTGGCCCAGCNONE 
006-092-C11CAAGGCCCTGGCCCAGCNONE 
AK059851CAAGGCCCTGGCCCAGCCalycin-like family protein. 
AK100069CAAGGCCCTGGCCCAGCNONE 
AK104062CAAGGCCCTGGCCCAGCNONE 
AK104663CAAGGCCCTGGCCCAGCNONE 
Os04g0658300AK067399CTTGGGCCAGSimilar to Ribulose bisphosphate carboxylase/oxygenase activase, chloroplast precursor (RuBisCO activase) (RA). 
Os04g0658800AK111108CTGGCCCATCCConserved hypothetical protein. 
Os04g0663200006-074-D02CTGGCCCAAGNONE 
AK105958CTGGCCCAAGZinc finger, CCCH-type domain containing protein. 
AK111925CTGGCCCAAGNONE 
Os04g0674350J065104O14CTGGCCCAATANONE 
J065118J19CTGGCCCAATANONE 
J065167I12CTGGCCCAATAHypothetical protein. 
Os04g0674400015-042-B08TATTGGGCCAGNONE 
AK102124TATTGGGCCAGSimilar to Anamorsin (Cytokine induced apoptosis inhibitor 1) (CUA001). Splice isoform 2. 
J013129O22TATTGGGCCAGNONE 
J023022I24TATTGGGCCAGNONE 
J023120A15TATTGGGCCAGNONE 
J023123P20TATTGGGCCAGNONE 
J033068P09TATTGGGCCAGNONE 
J033107G22TATTGGGCCAGNONE 
J033116G12TATTGGGCCAGNONE 
J033133F03TATTGGGCCAGNONE 
J033143B20TATTGGGCCAGNONE 
J043006G12TATTGGGCCAGNONE 
J043027M18TATTGGGCCAGNONE 
J043034H17TATTGGGCCAGNONE 
J090091E20TATTGGGCCAGNONE 
J100035H09TATTGGGCCAGNONE 
J100037J04TATTGGGCCAGNONE 
J100047J24TATTGGGCCAGNONE 
J100059G06TATTGGGCCAGNONE 
J100066O12TATTGGGCCAGNONE 
J100074G23TATTGGGCCAGNONE 
J100077M12TATTGGGCCAGNONE 
Os04g0676100Os04g0676100TCTGGGCCTACATGGGCCAGGCCGAAASimilar to Thioredoxin X, chloroplast precursor. 
Os04g0678800AK072212CTGGCCCATTAN-acetylglucosaminylphosphatidylinositol deacetylase family protein. 
AK099065CTGGCCCATTANONE 
Os04g0681500AK105582AAATGGGCCAGGCCCAACEF-Hand type domain containing protein. 
Os04g0685800AK070891GTGTGGGCCTGGCCCAACTSimilar to Diadenosine 5',5'''-P1,P4-tetraphosphate hydrolase (EC 3.6.1.17). 
AK071345GTGTGGGCCTGGCCCAACTNONE 
J023069G19GTGTGGGCCTGGCCCAACTNONE 
J023097E09GTGTGGGCCTGGCCCAACTNONE 
J065071A01GTGTGGGCCTGGCCCAACTNONE 
J065186F08GTGTGGGCCTGGCCCAACTNONE 
J075044B21GTGTGGGCCTGGCCCAACTNONE 
J075120N18GTGTGGGCCTGGCCCAACTNONE 
J075131B22GTGTGGGCCTGGCCCAACTNONE 
J100041H18GTGTGGGCCTGGCCCAACTNONE 
J100042P13GTGTGGGCCTGGCCCAACTNONE 
Os04g0686600AK068427GTTTGGGCTGGGCCTGGCCCAGTTProtein kinase domain containing protein. 
J013155F22GTTTGGGCTGGGCCTGGCCCAGTTNONE 
J023020E07GTTTGGGCTGGGCCTGGCCCAGTTNONE 
Os04g0687300AK060617ACATGGGCCAGAHeat shock protein DnaJ, N-terminal domain containing protein. 
J065072M04ACATGGGCCAGANONE 
Os05g0118000AK110694CTGGCCCAACASRR1 domain containing protein. 
AK110694TCTGGCCCATCTSRR1 domain containing protein. 
Os05g0161200AB042936CTGGCCCAGGGCCGGCCCNONE 
AK121808CTGGCCCAGGGCCGGCCCDNA polymerase III clamp loader subunit, C-terminal domain containing protein. 
Os05g0163700AK071561ACTGACAGGTGGGCCAGASimilar to Acyl-coenzyme A oxidase 4, peroxisomal (EC 1.3.3.6) (AOX 4) (Short- chain acyl-CoA oxidase) (SAOX) (AtCX4) (G6p) (AtG6). 
Os05g0193800AK058865TATTGGGCCAGCCCATGNONE 
AK067940TATTGGGCCAGCCCATGConserved hypothetical protein. 
J065043K19TATTGGGCCAGCCCATGNONE 
J065095O10TATTGGGCCAGCCCATGNONE 
J065095O12TATTGGGCCAGCCCATGNONE 
J080002K02TATTGGGCCAGCCCATGNONE 
J080012L17TATTGGGCCAGCCCATGNONE 
J080013J02TATTGGGCCAGCCCATGNONE 
J080013O11TATTGGGCCAGCCCATGNONE 
J080020A17TATTGGGCCAGCCCATGNONE 
J080028E18TATTGGGCCAGCCCATGNONE 
J080036P11TATTGGGCCAGCCCATGNONE 
J080042E10TATTGGGCCAGCCCATGNONE 
J080042L10TATTGGGCCAGCCCATGNONE 
J080047B11TATTGGGCCAGCCCATGNONE 
J080048N05TATTGGGCCAGCCCATGNONE 
J080057E20TATTGGGCCAGCCCATGNONE 
J080057K13TATTGGGCCAGCCCATGNONE 
J080058L03TATTGGGCCAGCCCATGNONE 
J080063H07TATTGGGCCAGCCCATGNONE 
J080066L23TATTGGGCCAGCCCATGNONE 
J080069G22TATTGGGCCAGCCCATGNONE 
J080072E12TATTGGGCCAGCCCATGNONE 
J080076D06TATTGGGCCAGCCCATGNONE 
J080077A22TATTGGGCCAGCCCATGNONE 
J080081A01TATTGGGCCAGCCCATGNONE 
J080090M13TATTGGGCCAGCCCATGNONE 
J080093G07TATTGGGCCAGCCCATGNONE 
J080094O20TATTGGGCCAGCCCATGNONE 
J080097F13TATTGGGCCAGCCCATGNONE 
Os05g0194550J075140P14GGATGGGCCAGAConserved hypothetical protein. 
Os05g0256000AK104927TATTGGGCCAGGACGGCCCAACASimilar to TGF-beta receptor-interacting protein 1. 
AK111524TATTGGGCCAGGACGGCCCAACANONE 
J023025D23TATTGGGCCAGGACGGCCCAACANONE 
J033086I23TATTGGGCCAGGACGGCCCAACANONE 
J033087F17TATTGGGCCAGGACGGCCCAACANONE 
J033091C01TATTGGGCCAGGACGGCCCAACANONE 
J090048L01TATTGGGCCAGGACGGCCCAACANONE 
J090087G08TATTGGGCCAGGACGGCCCAACANONE 
J100040G23TATTGGGCCAGGACGGCCCAACANONE 
Os05g0365500AK072352CTGGCCCAACTProtein prenyltransferase domain containing protein. 
J043027P13CTGGCCCAACTNONE 
Os05g0366600015-093-D12ACGTGGGCCAGNONE 
AK071469ACGTGGGCCAGSimilar to Hydroxyisourate hydrolase. 
Os05g0375400003-125-H02GTTGGGCCAGNONE 
003-128-D02GTTGGGCCAGNONE 
003-128-F08GTTGGGCCAGNONE 
004-007-B08GTTGGGCCAGNONE 
006-026-D11GTTGGGCCAGNONE 
006-027-A12GTTGGGCCAGNONE 
006-029-G06GTTGGGCCAGNONE 
006-047-B10GTTGGGCCAGNONE 
006-053-D08GTTGGGCCAGNONE 
006-070-H11GTTGGGCCAGNONE 
006-078-C06GTTGGGCCAGNONE 
006-079-A04GTTGGGCCAGNONE 
006-084-C10GTTGGGCCAGNONE 
006-099-G02GTTGGGCCAGNONE 
006-112-F07GTTGGGCCAGNONE 
006-118-A02GTTGGGCCAGNONE 
006-119-G04GTTGGGCCAGNONE 
009-039-D09GTTGGGCCAGNONE 
009-053-C11GTTGGGCCAGNONE 
009-178-E07GTTGGGCCAGNONE 
011-004-H01GTTGGGCCAGNONE 
011-010-A04GTTGGGCCAGNONE 
011-010-H04GTTGGGCCAGNONE 
011-018-A04GTTGGGCCAGNONE 
011-023-H04GTTGGGCCAGNONE 
011-025-H01GTTGGGCCAGNONE 
011-044-B04GTTGGGCCAGNONE 
011-044-H08GTTGGGCCAGNONE 
011-049-F01GTTGGGCCAGNONE 
011-056-C03GTTGGGCCAGNONE 
011-064-H01GTTGGGCCAGNONE 
011-070-D07GTTGGGCCAGNONE 
011-081-H09GTTGGGCCAGNONE 
011-087-D03GTTGGGCCAGNONE 
011-090-E01GTTGGGCCAGNONE 
011-094-F08GTTGGGCCAGNONE 
011-097-E08GTTGGGCCAGNONE 
011-099-C03GTTGGGCCAGNONE 
012-027-H12GTTGGGCCAGNONE 
012-031-H01GTTGGGCCAGNONE 
012-040-G01GTTGGGCCAGNONE 
012-047-A03GTTGGGCCAGNONE 
012-055-E06GTTGGGCCAGNONE 
012-076-H11GTTGGGCCAGNONE 
012-086-B03GTTGGGCCAGNONE 
012-091-A05GTTGGGCCAGNONE 
012-096-C03GTTGGGCCAGNONE 
013-001-F09GTTGGGCCAGNONE 
013-003-D02GTTGGGCCAGNONE 
013-006-C08GTTGGGCCAGNONE 
013-006-G04GTTGGGCCAGNONE 
013-007-D08GTTGGGCCAGNONE 
013-008-B10GTTGGGCCAGNONE 
013-008-C12GTTGGGCCAGNONE 
013-011-A10GTTGGGCCAGNONE 
013-011-D04GTTGGGCCAGNONE 
013-014-B10GTTGGGCCAGNONE 
013-015-F02GTTGGGCCAGNONE 
013-018-F08GTTGGGCCAGNONE 
013-021-D03GTTGGGCCAGNONE 
013-021-E12GTTGGGCCAGNONE 
013-026-A06GTTGGGCCAGNONE 
013-026-E12GTTGGGCCAGNONE 
013-028-F08GTTGGGCCAGNONE 
013-032-B01GTTGGGCCAGNONE 
013-032-H07GTTGGGCCAGNONE 
013-037-B09GTTGGGCCAGNONE 
013-038-F11GTTGGGCCAGNONE 
013-039-C04GTTGGGCCAGNONE 
013-040-E11GTTGGGCCAGNONE 
013-050-E12GTTGGGCCAGNONE 
013-050-G09GTTGGGCCAGNONE 
013-053-G07GTTGGGCCAGNONE 
013-055-D04GTTGGGCCAGNONE 
013-056-E10GTTGGGCCAGNONE 
013-056-F04GTTGGGCCAGNONE 
013-060-G06GTTGGGCCAGNONE 
013-066-E12GTTGGGCCAGNONE 
013-068-A09GTTGGGCCAGNONE 
013-068-G07GTTGGGCCAGNONE 
013-072-B02GTTGGGCCAGNONE 
013-073-F07GTTGGGCCAGNONE 
013-075-G07GTTGGGCCAGNONE 
013-082-E04GTTGGGCCAGNONE 
013-083-B04GTTGGGCCAGNONE 
013-085-F08GTTGGGCCAGNONE 
013-087-D08GTTGGGCCAGNONE 
013-089-C08GTTGGGCCAGNONE 
013-090-A01GTTGGGCCAGNONE 
013-093-B03GTTGGGCCAGNONE 
013-099-A07GTTGGGCCAGNONE 
013-099-E03GTTGGGCCAGNONE 
014-024-E04GTTGGGCCAGNONE 
014-049-C09GTTGGGCCAGNONE 
014-078-E06GTTGGGCCAGNONE 
015-038-A11GTTGGGCCAGNONE 
015-070-G03GTTGGGCCAGNONE 
015-074-D01GTTGGGCCAGNONE 
015-082-G04GTTGGGCCAGNONE 
016-006-E05GTTGGGCCAGNONE 
016-011-E07GTTGGGCCAGNONE 
016-040-F10GTTGGGCCAGNONE 
016-042-F10GTTGGGCCAGNONE 
016-052-B11GTTGGGCCAGNONE 
016-069-B04GTTGGGCCAGNONE 
016-079-C01GTTGGGCCAGNONE 
016-080-A10GTTGGGCCAGNONE 
016-085-C09GTTGGGCCAGNONE 
016-093-D08GTTGGGCCAGNONE 
AF323610GTTGGGCCAGNONE 
AK060867GTTGGGCCAGNONE 
AK121825GTTGGGCCAGBeta-glucanase precursor. 
AY768944GTTGGGCCAGNONE 
J013099L04GTTGGGCCAGNONE 
J013153K08GTTGGGCCAGNONE 
J033099G01GTTGGGCCAGNONE 
J065176D10GTTGGGCCAGNONE 
J065176G02GTTGGGCCAGNONE 
J075138B12GTTGGGCCAGNONE 
J075170I16GTTGGGCCAGNONE 
J075194A22GTTGGGCCAGNONE 
J100036M10GTTGGGCCAGNONE 
J100037E23GTTGGGCCAGNONE 
J100037I10GTTGGGCCAGNONE 
J100041D24GTTGGGCCAGNONE 
J100053D13GTTGGGCCAGNONE 
J100054F07GTTGGGCCAGNONE 
J100087M21GTTGGGCCAGNONE 
J100090H22GTTGGGCCAGNONE 
Os05g0377000Os05g0377000GCTGGGCCAGATGGGCCGGASimilar to Acyl carrier protein (ACP). 
Os05g0437200014-036-D04TACTGGGCCAGANONE 
014-036-D04TCTGGCCCACTNONE 
AK059283TACTGGGCCAGANONE 
AK059283TCTGGCCCACTNONE 
AK121867TACTGGGCCAGAProtein of unknown function DUF502 family protein. 
AK121867TCTGGCCCACTProtein of unknown function DUF502 family protein. 
Os05g0443800AK106590CTTGGGCCAGSimilar to Plastid division protein ftsZ1 precursor. 
Os05g0445500009-021-C05TCTGGCCCATTNONE 
009-129-D11TCTGGCCCATTNONE 
009-147-E04TCTGGCCCATTNONE 
009-169-C11TCTGGCCCATTNONE 
AK121459TCTGGCCCATTSimilar to 60S acidic ribosomal protein P2B. 
D21114TCTGGCCCATTNONE 
J023001K23TCTGGCCCATTNONE 
J023107J19TCTGGCCCATTNONE 
J023143J09TCTGGCCCATTNONE 
J065049D04TCTGGCCCATTNONE 
J065092I06TCTGGCCCATTNONE 
J065188H04TCTGGCCCATTNONE 
Os05g0461300AK111917CTGGCCCACCAACSimilar to RAB8C. 
AK111946CTGGCCCACCAACNONE 
AK111972CTGGCCCACCAACNONE 
AK112021CTGGCCCACCAACNONE 
J033135H16CTGGCCCACCAACNONE 
J043036O11CTGGCCCACCAACNONE 
Os05g0478200J023113C02GCCCAACCTGGCCCACCANONE 
J023150G23GCCCAACCTGGCCCACCANONE 
J033101K13GCCCAACCTGGCCCACCANONE 
Os05g0488900AK071883CTGGCCCATGSimilar to Cytochrome b5 reductase. 
AK073699CTGGCCCATGNONE 
AK105459CTGGCCCATGNONE 
J080009C06CTGGCCCATGNONE 
J080021N09CTGGCCCATGNONE 
J080041K24CTGGCCCATGNONE 
J080058H15CTGGCCCATGNONE 
J080064P06CTGGCCCATGNONE 
J080077B16CTGGCCCATGNONE 
Os05g0493800AK110589CTGGCCCACCCSimilar to MtN21 nodulin protein-like. 
Os05g0499300009-151-H01GGATGGGCCAGNONE 
013-049-G05GGATGGGCCAGNONE 
AK066855GGATGGGCCAGNONE 
AK104950GGATGGGCCAGSimilar to Peroxidase (EC 1.11.1.7). 
D14997GGATGGGCCAGNONE 
Os05g0519800AK069435CTGGCCCAGCProtein of unknown function DUF28 family protein. 
J023024L22CTGGCCCAGCNONE 
Os05g0520200006-031-F07TACGGCCCACTGGCCCATTANONE 
AK061451TACGGCCCACTGGCCCATTAThioredoxin-related domain containing protein. 
AK099433TACGGCCCACTGGCCCATTANONE 
Os05g0555300009-032-C03CGCGTGCGCTGGCCCACGGNONE 
009-125-E08CGCGTGCGCTGGCCCACGGNONE 
009-149-C12CGCGTGCGCTGGCCCACGGNONE 
009-172-C01CGCGTGCGCTGGCCCACGGNONE 
AK062890CGCGTGCGCTGGCCCACGGFerredoxin domain containing protein. 
AK062997CGCGTGCGCTGGCCCACGGNONE 
Os05g0559900AK067197GGGCCTGGCCCAAGtRNA-binding arm domain containing protein. 
J013074C15GGGCCTGGCCCAAGNONE 
J013098O16GGGCCTGGCCCAAGNONE 
J033030M01GGGCCTGGCCCAAGNONE 
J090058H12GGGCCTGGCCCAAGNONE 
J090075M06GGGCCTGGCCCAAGNONE 
Os05g0565200004-015-E06ATATGGGCCAGNONE 
AK067090ATATGGGCCAGSimilar to Urease accessory protein G. 
AK104200ATATGGGCCAGNONE 
AK104368ATATGGGCCAGNONE 
Os05g0567300013-039-F11TTTTGGGCCAGCCCAAGNONE 
AK112068TTTTGGGCCAGCCCAAGGTP-binding protein, HSR1-related domain containing protein. 
Os05g0571300AK072262TTGGCCCATCTGGCCCATAConserved hypothetical protein. 
AK109853TTGGCCCATCTGGCCCATANONE 
AK111014TTGGCCCATCTGGCCCATANONE 
Os05g0577900016-028-C02CTGGCCCATANONE 
AK064201CTGGCCCATAConserved hypothetical protein. 
Os05g0578000AK065040TATGGGCCAGSimilar to PEX14 protein. 
J013001H17TATGGGCCAGNONE 
J013036A06TATGGGCCAGNONE 
J033122K08TATGGGCCAGNONE 
Os05g0588200AK109323TCTGGCCCATCCRuvA domain 2-like containing protein. 
Os06g0101000J023143D21TCTGGCCCATCCANONE 
J033027A19TCTGGCCCATCCANONE 
J033131O18TCTGGCCCATCCANONE 
J043040N17TCTGGCCCATCCANONE 
J090007I16TCTGGCCCATCCANONE 
Os06g0106100009-197-E09CTGGGCTGGCCCATTTNONE 
AK111784CTGGGCTGGCCCATTTCwf15/Cwc15 cell cycle control protein family protein. 
AK112060CTGGGCTGGCCCATTTNONE 
Os06g0113600016-067-E03ACGTGGGCCAGNONE 
AK062095ACGTGGGCCAGNONE 
AK101235ACGTGGGCCAGCyclin-like F-box domain containing protein. 
AK122025ACGTGGGCCAGNONE 
J013022O19ACGTGGGCCAGNONE 
J023045P05ACGTGGGCCAGNONE 
J033031K01ACGTGGGCCAGNONE 
J033034I09ACGTGGGCCAGNONE 
J033041O04ACGTGGGCCAGNONE 
J033071K03ACGTGGGCCAGNONE 
J033075K16ACGTGGGCCAGNONE 
J033097M01ACGTGGGCCAGNONE 
J033099M22ACGTGGGCCAGNONE 
J033108N15ACGTGGGCCAGNONE 
J033121D18ACGTGGGCCAGNONE 
J033125O06ACGTGGGCCAGNONE 
J033139M16ACGTGGGCCAGNONE 
J033145P18ACGTGGGCCAGNONE 
J033149D05ACGTGGGCCAGNONE 
Os06g0124900009-128-B12GGTTGGGCCAGNONE 
009-186-H09GGTTGGGCCAGNONE 
AK062901GGTTGGGCCAGConserved hypothetical protein. 
J013056D13GGTTGGGCCAGNONE 
J013056D17GGTTGGGCCAGNONE 
J013066A13GGTTGGGCCAGNONE 
J013066C03GGTTGGGCCAGNONE 
J013066F01GGTTGGGCCAGNONE 
J023078D03GGTTGGGCCAGNONE 
J033113N02GGTTGGGCCAGNONE 
J065019F09GGTTGGGCCAGNONE 
J065048C21GGTTGGGCCAGNONE 
J065077L13GGTTGGGCCAGNONE 
J065082J09GGTTGGGCCAGNONE 
J065113H16GGTTGGGCCAGNONE 
J065147A20GGTTGGGCCAGNONE 
J065180A13GGTTGGGCCAGNONE 
J065198M18GGTTGGGCCAGNONE 
J065207K19GGTTGGGCCAGNONE 
J075109H13GGTTGGGCCAGNONE 
Os06g0134000AK102796CCATGGGCCAGNONE 
Os06g0140900AK058823ATTGGGCCAGSigma factor, regions 3 and 4 domain containing protein. 
J065159C22ATTGGGCCAGNONE 
J090061D18ATTGGGCCAGNONE 
J100066L20ATTGGGCCAGNONE 
J100085F19ATTGGGCCAGNONE 
J100088E11ATTGGGCCAGNONE 
Os06g0147200013-026-F09CTGGCCCAACNONE 
AK064042CTGGCCCAACConserved hypothetical protein. 
AK070059CTGGCCCAACNONE 
J023042A02CTGGCCCAACNONE 
J100047A15CTGGCCCAACNONE 
J100070B03CTGGCCCAACNONE 
Os06g0219800011-090-C04CTGGCCCATGGAGCCCATCAGCCCAAACNONE 
AK072030CTGGCCCATGGAGCCCATCAGCCCAAACSimilar to Protein phosphatase 2A, regulatory subunit B' (PP2A, subunit B', PR53 isoform) (Phosphotyrosyl phosphatase activator) (PTPA). Splice isoform 3. 
AK100405CTGGCCCATGGAGCCCATCAGCCCAAACNONE 
J065063P03CTGGCCCATGGAGCCCATCAGCCCAAACNONE 
J100032E17CTGGCCCATGGAGCCCATCAGCCCAAACNONE 
J100081I18CTGGCCCATGGAGCCCATCAGCCCAAACNONE 
Os06g0318300004-006-E12TGTGGGCCAGNONE 
014-001-H07TGTGGGCCAGNONE 
AK060873TGTGGGCCAGNONE 
AK065671TGTGGGCCAGSimilar to Rho GDP-dissociation inhibitor 1 (Rho GDI-1) (AtRhoGDI1). 
AY364312TGTGGGCCAGNONE 
J013041C14TGTGGGCCAGNONE 
J065180A18TGTGGGCCAGNONE 
J075013P16TGTGGGCCAGNONE 
Os06g0325500011-037-D06TAATGGGCCAGNONE 
011-093-G07TAATGGGCCAGNONE 
AK063974TAATGGGCCAGProtein of unknown function DUF89 family protein. 
AK099286TAATGGGCCAGNONE 
J065124G18TAATGGGCCAGNONE 
J065160K08TAATGGGCCAGNONE 
J065207O08TAATGGGCCAGNONE 
J075011D18TAATGGGCCAGNONE 
J075012D02TAATGGGCCAGNONE 
J075090F13TAATGGGCCAGNONE 
J075164A04TAATGGGCCAGNONE 
J075198I19TAATGGGCCAGNONE 
Os06g0337100006-100-G05CTGGCCCACGGGTCAGTGGNONE 
AK061222CTGGCCCACGGGTCAGTGGConserved hypothetical protein. 
Os06g0573700015-015-F02GGATGGGCCAGNONE 
AK106254GGATGGGCCAGConserved hypothetical protein. 
J065172G24GGATGGGCCAGNONE 
Os06g0602600AK121619AGTTGGGCCAGAAlba, DNA/RNA-binding protein family protein. 
J033044O03AGTTGGGCCAGANONE 
J043036G04AGTTGGGCCAGANONE 
J075107E08AGTTGGGCCAGANONE 
J090060N14AGTTGGGCCAGANONE 
J090094K04AGTTGGGCCAGANONE 
Os06g0608500AK060097CTGGCCCACAANONE 
AK070667CTGGCCCACAASnf7 family protein. 
Os06g0622700AK107021TCTGGCCCAAAAGGCCCACAEukaryotic transcription factor, DNA-binding domain containing protein. 
J065053P05TCTGGCCCAAAAGGCCCACANONE 
J065100L18TCTGGCCCAAAAGGCCCACANONE 
J065129N15TCTGGCCCAAAAGGCCCACANONE 
J065152M08TCTGGCCCAAAAGGCCCACANONE 
J065198M12TCTGGCCCAAAAGGCCCACANONE 
J090077J22TCTGGCCCAAAAGGCCCACANONE 
J100024G23TCTGGCCCAAAAGGCCCACANONE 
J100027L01TCTGGCCCAAAAGGCCCACANONE 
J100047C06TCTGGCCCAAAAGGCCCACANONE 
J100055D01TCTGGCCCAAAAGGCCCACANONE 
J100067M05TCTGGCCCAAAAGGCCCACANONE 
J100077M16TCTGGCCCAAAAGGCCCACANONE 
J100078M22TCTGGCCCAAAAGGCCCACANONE 
Os06g0656800AK109762AAAGCCCAATGGGCCAGABeta-Ig-H3/fasciclin domain containing protein. 
Os06g0670100AK102577CTGGCCCATCAHypothetical protein. 
Os06g0701400013-010-G06ACATGGGCTTTTCATGGGCCAGANONE 
013-010-G06CTGGCCCAGANONE 
AK121229ACATGGGCTTTTCATGGGCCAGASimilar to 60S acidic ribosomal protein P3 (P1/P2-like) (P3A). 
AK121229CTGGCCCAGASimilar to 60S acidic ribosomal protein P3 (P1/P2-like) (P3A). 
J023091M16ACATGGGCTTTTCATGGGCCAGANONE 
J023091M16CTGGCCCAGANONE 
J033023L12ACATGGGCTTTTCATGGGCCAGANONE 
J033023L12CTGGCCCAGANONE 
J065043I07ACATGGGCTTTTCATGGGCCAGANONE 
J065043I07CTGGCCCAGANONE 
J065049E09ACATGGGCTTTTCATGGGCCAGANONE 
J065049E09CTGGCCCAGANONE 
J065054I05ACATGGGCTTTTCATGGGCCAGANONE 
J065054I05CTGGCCCAGANONE 
J065072H13ACATGGGCTTTTCATGGGCCAGANONE 
J065072H13CTGGCCCAGANONE 
J065073L10ACATGGGCTTTTCATGGGCCAGANONE 
J065073L10CTGGCCCAGANONE 
J065079P09ACATGGGCTTTTCATGGGCCAGANONE 
J065079P09CTGGCCCAGANONE 
J065112I06ACATGGGCTTTTCATGGGCCAGANONE 
J065112I06CTGGCCCAGANONE 
J065167C03ACATGGGCTTTTCATGGGCCAGANONE 
J065167C03CTGGCCCAGANONE 
J065167I03ACATGGGCTTTTCATGGGCCAGANONE 
J065167I03CTGGCCCAGANONE 
J065176P13ACATGGGCTTTTCATGGGCCAGANONE 
J065176P13CTGGCCCAGANONE 
J065205M07ACATGGGCTTTTCATGGGCCAGANONE 
J065205M07CTGGCCCAGANONE 
J075018E13ACATGGGCTTTTCATGGGCCAGANONE 
J075018E13CTGGCCCAGANONE 
J075021E04ACATGGGCTTTTCATGGGCCAGANONE 
J075021E04CTGGCCCAGANONE 
J075038F13ACATGGGCTTTTCATGGGCCAGANONE 
J075038F13CTGGCCCAGANONE 
J075051E05ACATGGGCTTTTCATGGGCCAGANONE 
J075051E05CTGGCCCAGANONE 
J075067C10ACATGGGCTTTTCATGGGCCAGANONE 
J075067C10CTGGCCCAGANONE 
J075079A12ACATGGGCTTTTCATGGGCCAGANONE 
J075079A12CTGGCCCAGANONE 
J075084A13ACATGGGCTTTTCATGGGCCAGANONE 
J075084A13CTGGCCCAGANONE 
J075103E20ACATGGGCTTTTCATGGGCCAGANONE 
J075103E20CTGGCCCAGANONE 
J075116E09ACATGGGCTTTTCATGGGCCAGANONE 
J075116E09CTGGCCCAGANONE 
J075118F15ACATGGGCTTTTCATGGGCCAGANONE 
J075118F15CTGGCCCAGANONE 
J075121I15ACATGGGCTTTTCATGGGCCAGANONE 
J075121I15CTGGCCCAGANONE 
J075129B01ACATGGGCTTTTCATGGGCCAGANONE 
J075129B01CTGGCCCAGANONE 
J075138A22ACATGGGCTTTTCATGGGCCAGANONE 
J075138A22CTGGCCCAGANONE 
J075159B22ACATGGGCTTTTCATGGGCCAGANONE 
J075159B22CTGGCCCAGANONE 
J075165I11ACATGGGCTTTTCATGGGCCAGANONE 
J075165I11CTGGCCCAGANONE 
J075186E09ACATGGGCTTTTCATGGGCCAGANONE 
J075186E09CTGGCCCAGANONE 
J075190J09ACATGGGCTTTTCATGGGCCAGANONE 
J075190J09CTGGCCCAGANONE 
J075191I07ACATGGGCTTTTCATGGGCCAGANONE 
J075191I07CTGGCCCAGANONE 
J080301C05ACATGGGCTTTTCATGGGCCAGANONE 
J080301C05CTGGCCCAGANONE 
J080302L02ACATGGGCTTTTCATGGGCCAGANONE 
J080302L02CTGGCCCAGANONE 
J100035C19ACATGGGCTTTTCATGGGCCAGANONE 
J100035C19CTGGCCCAGANONE 
J100059P06ACATGGGCTTTTCATGGGCCAGANONE 
J100059P06CTGGCCCAGANONE 
Os06g0702800009-039-E05ACATGGGCCAGNONE 
009-039-E05ACATGGGCCAGGCCCAAATNONE 
AK073948ACATGGGCCAGHypothetical protein. 
AK073948ACATGGGCCAGGCCCAAATHypothetical protein. 
J023108K23ACATGGGCCAGNONE 
J023108K23ACATGGGCCAGGCCCAAATNONE 
J033072H04ACATGGGCCAGNONE 
J033072H04ACATGGGCCAGGCCCAAATNONE 
J065008G05ACATGGGCCAGNONE 
J065008G05ACATGGGCCAGGCCCAAATNONE 
J065128J12ACATGGGCCAGNONE 
J065128J12ACATGGGCCAGGCCCAAATNONE 
J065131A01ACATGGGCCAGNONE 
J065131A01ACATGGGCCAGGCCCAAATNONE 
J065173B12ACATGGGCCAGNONE 
J065173B12ACATGGGCCAGGCCCAAATNONE 
Os06g0704300AK107008CTGGCCCACTZinc finger, CCCH-type domain containing protein. 
J065038I12CTGGCCCACTNONE 
J065079E03CTGGCCCACTNONE 
J075035B15CTGGCCCACTNONE 
J090072D21CTGGCCCACTNONE 
Os06g0710900AK073326CTGGCCCACCACConserved hypothetical protein. 
Os06g0727400AK069558AGATGGGCCAGSimilar to Protein kinase APK1A, chloroplast precursor (EC 2.7.1.-). 
Os07g0146600J075074M15GGGGCCCATGGGCCAGAConserved hypothetical protein. 
J075120F11GGGGCCCATGGGCCAGANONE 
J075170L13GGGGCCCATGGGCCAGANONE 
J080302A21GGGGCCCATGGGCCAGANONE 
J080304J04GGGGCCCATGGGCCAGANONE 
J080308I12GGGGCCCATGGGCCAGANONE 
J080312F11GGGGCCCATGGGCCAGANONE 
J080315M22GGGGCCCATGGGCCAGANONE 
Os07g0146700014-006-H11AGCCCATGGGCCAGANONE 
AK063631AGCCCATGGGCCAGAConserved hypothetical protein. 
AK101150AGCCCATGGGCCAGANONE 
J065038C21AGCCCATGGGCCAGANONE 
Os07g0164100AK111557TCTGGCCCAGTTHistone deacetylase superfamily protein. 
Os07g0164200009-038-C11AACTGGGCCAGANONE 
AK059382AACTGGGCCAGATranslation factor domain containing protein. 
AK107096AACTGGGCCAGANONE 
Os07g0205700AK120553CTGGCCCAGTSimilar to Xaa-Pro dipeptidase (EC 3.4.-.-). 
J065022J24CTGGCCCAGTNONE 
Os07g0213400003-104-B01CCGTGGGCCAGNONE 
AK062273CCGTGGGCCAGConserved hypothetical protein. 
J065122P17CCGTGGGCCAGNONE 
J065160A01CCGTGGGCCAGNONE 
J090065M11CCGTGGGCCAGNONE 
Os07g0246200012-046-B07CTGGCCCACCCGCGCNONE 
AB021259CTGGCCCACCCGCGCNONE 
AK065341CTGGCCCACCCGCGCSimilar to Calreticulin (Fragment). 
AK099348CTGGCCCACCCGCGCNONE 
AK104328CTGGCCCACCCGCGCNONE 
AK104826CTGGCCCACCCGCGCNONE 
J013000E04CTGGCCCACCCGCGCNONE 
J013093M19CTGGCCCACCCGCGCNONE 
J013108J08CTGGCCCACCCGCGCNONE 
J013118G03CTGGCCCACCCGCGCNONE 
J013121I07CTGGCCCACCCGCGCNONE 
J013153K07CTGGCCCACCCGCGCNONE 
J023028N07CTGGCCCACCCGCGCNONE 
J023034F12CTGGCCCACCCGCGCNONE 
J023043J11CTGGCCCACCCGCGCNONE 
J023087A03CTGGCCCACCCGCGCNONE 
J023099N05CTGGCCCACCCGCGCNONE 
J023105B02CTGGCCCACCCGCGCNONE 
J023110H02CTGGCCCACCCGCGCNONE 
J023112E15CTGGCCCACCCGCGCNONE 
J023132C20CTGGCCCACCCGCGCNONE 
J023134G12CTGGCCCACCCGCGCNONE 
J023138O12CTGGCCCACCCGCGCNONE 
J033031E05CTGGCCCACCCGCGCNONE 
J033032C03CTGGCCCACCCGCGCNONE 
J033039K10CTGGCCCACCCGCGCNONE 
J033050P09CTGGCCCACCCGCGCNONE 
J033074D03CTGGCCCACCCGCGCNONE 
J033075G14CTGGCCCACCCGCGCNONE 
J033075I23CTGGCCCACCCGCGCNONE 
J033081H23CTGGCCCACCCGCGCNONE 
J033087N08CTGGCCCACCCGCGCNONE 
J033110B03CTGGCCCACCCGCGCNONE 
J033148H22CTGGCCCACCCGCGCNONE 
J043027F13CTGGCCCACCCGCGCNONE 
J043031H01CTGGCCCACCCGCGCNONE 
J080003O10CTGGCCCACCCGCGCNONE 
J080022D10CTGGCCCACCCGCGCNONE 
J080029I12CTGGCCCACCCGCGCNONE 
J080034A09CTGGCCCACCCGCGCNONE 
J080035H20CTGGCCCACCCGCGCNONE 
J080049C10CTGGCCCACCCGCGCNONE 
J080053G14CTGGCCCACCCGCGCNONE 
J080055J22CTGGCCCACCCGCGCNONE 
J080058J04CTGGCCCACCCGCGCNONE 
J080069E14CTGGCCCACCCGCGCNONE 
J080069M23CTGGCCCACCCGCGCNONE 
J080072E19CTGGCCCACCCGCGCNONE 
J080072I03CTGGCCCACCCGCGCNONE 
J080075B13CTGGCCCACCCGCGCNONE 
J080078I11CTGGCCCACCCGCGCNONE 
J080081F16CTGGCCCACCCGCGCNONE 
J080088O10CTGGCCCACCCGCGCNONE 
J080089G18CTGGCCCACCCGCGCNONE 
J090009C10CTGGCCCACCCGCGCNONE 
J090022D23CTGGCCCACCCGCGCNONE 
J090023A15CTGGCCCACCCGCGCNONE 
J090024M10CTGGCCCACCCGCGCNONE 
J090038F24CTGGCCCACCCGCGCNONE 
J090039O13CTGGCCCACCCGCGCNONE 
J090040N12CTGGCCCACCCGCGCNONE 
J090054I18CTGGCCCACCCGCGCNONE 
J090061C16CTGGCCCACCCGCGCNONE 
J090063H23CTGGCCCACCCGCGCNONE 
J090067F21CTGGCCCACCCGCGCNONE 
J090075A01CTGGCCCACCCGCGCNONE 
J090076K11CTGGCCCACCCGCGCNONE 
J090078L11CTGGCCCACCCGCGCNONE 
J090079P03CTGGCCCACCCGCGCNONE 
J090087D23CTGGCCCACCCGCGCNONE 
J090087G22CTGGCCCACCCGCGCNONE 
J090089F03CTGGCCCACCCGCGCNONE 
J090092A04CTGGCCCACCCGCGCNONE 
J100024L17CTGGCCCACCCGCGCNONE 
J100031P13CTGGCCCACCCGCGCNONE 
J100032H05CTGGCCCACCCGCGCNONE 
J100036P03CTGGCCCACCCGCGCNONE 
J100038L07CTGGCCCACCCGCGCNONE 
J100043I20CTGGCCCACCCGCGCNONE 
J100069A21CTGGCCCACCCGCGCNONE 
J100078G06CTGGCCCACCCGCGCNONE 
J100081J24CTGGCCCACCCGCGCNONE 
J100081N04CTGGCCCACCCGCGCNONE 
J100084K16CTGGCCCACCCGCGCNONE 
J100085O06CTGGCCCACCCGCGCNONE 
J100088L13CTGGCCCACCCGCGCNONE 
J100090O21CTGGCCCACCCGCGCNONE 
Os07g0486000AK069343GGATGGGCCAGASimilar to MSH4. 
Os07g0506700AK073959CTGGCCCAGGWD40-like domain containing protein. 
Os07g0541500AK111550CTGGCCCAGCSimilar to KI domain interacting kinase 1. 
Os07g0541600AK110523CTGGCCCAGCHypothetical protein. 
Os07g0543000AB110196TCTGGCCCAAANONE 
AK058889TCTGGCCCAAASimilar to Helix-loop-helix-like protein (Fragment). 
Os07g0565600AK071983CTGGCCCAAAASimilar to Peptidyl-prolyl cis-trans isomerase TLP38, chloroplast precursor (EC 5.2.1.8) (PPIase) (Rotamase) (Thylakoid lumen PPIase of 38 kDa) (p38). 
AK107481CTGGCCCAAAANONE 
Os07g0611700AK109158GAAGCCCATACTGGCCCAATTPeptidase C1A, papain family protein. 
Os07g0611800Os07g0611800GAAGCCCATACTGGCCCAATTNONE 
Os07g0621300006-055-E10CTGGCCCAGTTNONE 
AK059824CTGGCCCAGTTNONE 
AK071567CTGGCCCAGTTGRAM domain containing protein. 
Os07g0625500AK064628TCTGGCCCAACASimilar to Fimbriata-associated protein (Fragment). 
Os07g0647800AK102332TCTGGGCCAGConserved hypothetical protein. 
Os07g0695400015-036-B08GCTGGGCTGCTGGCCCATGGNONE 
AK100615GCTGGGCTGCTGGCCCATGGNONE 
AK106304GCTGGGCTGCTGGCCCATGGKIP1-like domain containing protein. 
J023108B01GCTGGGCTGCTGGCCCATGGNONE 
Os08g0105800AK065355AATGGGCCAGANONE 
AK067200AATGGGCCAGACytochrome P450 family protein. 
Os08g0129700AB099292CTGGCCCAGANONE 
AK065715CTGGCCCAGAUDP-glucose 4-epimerase family protein. 
AK099222CTGGCCCAGANONE 
J013041C03CTGGCCCAGANONE 
J023061B05CTGGCCCAGANONE 
J033036N10CTGGCCCAGANONE 
Os08g0178100AK101717TAATGGGCCAGAPep3/Vps18/deep orange domain containing protein. 
Os08g0192900AK103422AGTGGGCCAGCCCATGARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
AY644645AGTGGGCCAGCCCATGANONE 
Os08g0243900011-052-H03TTTTGGGCCAGNONE 
AK102707TTTTGGGCCAGNONE 
AK121452TTTTGGGCCAGMu2 adaptin subunit (AP50) of AP2 domain containing protein. 
J023142L20TTTTGGGCCAGNONE 
J065168E04TTTTGGGCCAGNONE 
Os08g0316900013-024-A06CTGGCCCACANONE 
J033112J20CTGGCCCACANONE 
J065025M22CTGGCCCACANONE 
J065026E15CTGGCCCACANONE 
Os08g0442300006-067-F05GCTGGGCCAGGCCGGGCCGGANONE 
AK059843GCTGGGCCAGGCCGGGCCGGANONE 
AK071719GCTGGGCCAGGCCGGGCCGGASimilar to Calcineurin-like protein. 
AK102411GCTGGGCCAGGCCGGGCCGGANONE 
J023108H11GCTGGGCCAGGCCGGGCCGGANONE 
J033092P05GCTGGGCCAGGCCGGGCCGGANONE 
J075109C09GCTGGGCCAGGCCGGGCCGGANONE 
J090070B02GCTGGGCCAGGCCGGGCCGGANONE 
J090076M14GCTGGGCCAGGCCGGGCCGGANONE 
J100064B16GCTGGGCCAGGCCGGGCCGGANONE 
Os08g0447200AK067377GTGGTGGGCCAGSGT1 family protein. 
J013106M17GTGGTGGGCCAGNONE 
J033133D18GTGGTGGGCCAGNONE 
J033140B09GTGGTGGGCCAGNONE 
J100028I17GTGGTGGGCCAGNONE 
J100086C22GTGGTGGGCCAGNONE 
Os08g0455800006-050-A09TCTGGCCCAAACNONE 
AK061573TCTGGCCCAAACProtein of unknown function DUF985 family protein. 
AK099156TCTGGCCCAAACNONE 
J023067L05TCTGGCCCAAACNONE 
J065101A05TCTGGCCCAAACNONE 
J065171H09TCTGGCCCAAACNONE 
J100022D08TCTGGCCCAAACNONE 
J100029K04TCTGGCCCAAACNONE 
J100029O10TCTGGCCCAAACNONE 
Os08g0463900AK120178AGTGGGCCAGConserved hypothetical protein. 
J013033H06AGTGGGCCAGNONE 
J075006G17AGTGGGCCAGNONE 
Os08g0465000J065121H01CTGGCCCATGHomeobox domain containing protein. 
Os08g0471900015-099-E10TCTGGCCCATCANONE 
AK069434TCTGGCCCATCAZinc finger, ZPR1-type domain containing protein. 
Os08g0474750J075009C13TCTGGCCCAAATNONE 
J075122O14TCTGGCCCAAATHypothetical protein. 
Os08g0474800Os08g0474800TCTGGCCCAAATEsterase/lipase/thioesterase domain containing protein. 
Os08g0511000AK107578AGTGGGCCAGAProtein prenyltransferase domain containing protein. 
Os08g0526500016-063-D04TTTTGGGCCAGANONE 
AK073431TTTTGGGCCAGASimilar to SOX-1 protein. 
J033042D10TTTTGGGCCAGANONE 
J065019E02TTTTGGGCCAGANONE 
Os08g0530200009-166-A09AGCCCACAATAATGGGCCAGNONE 
AK062052AGCCCACAATAATGGGCCAGNONE 
AK120448AGCCCACAATAATGGGCCAGSimilar to 60S ribosomal protein L17. 
J013100M19AGCCCACAATAATGGGCCAGNONE 
J023045K22AGCCCACAATAATGGGCCAGNONE 
J033046D13AGCCCACAATAATGGGCCAGNONE 
J033066N01AGCCCACAATAATGGGCCAGNONE 
J033143N05AGCCCACAATAATGGGCCAGNONE 
J053070P13AGCCCACAATAATGGGCCAGNONE 
J065011C18AGCCCACAATAATGGGCCAGNONE 
J065013C23AGCCCACAATAATGGGCCAGNONE 
J065016B09AGCCCACAATAATGGGCCAGNONE 
J065016C21AGCCCACAATAATGGGCCAGNONE 
J065023K18AGCCCACAATAATGGGCCAGNONE 
J065028F12AGCCCACAATAATGGGCCAGNONE 
J065030L02AGCCCACAATAATGGGCCAGNONE 
J065042H15AGCCCACAATAATGGGCCAGNONE 
J065078H02AGCCCACAATAATGGGCCAGNONE 
J065092D07AGCCCACAATAATGGGCCAGNONE 
J065092E01AGCCCACAATAATGGGCCAGNONE 
J065104M21AGCCCACAATAATGGGCCAGNONE 
J065119P21AGCCCACAATAATGGGCCAGNONE 
J065124B15AGCCCACAATAATGGGCCAGNONE 
J065146H09AGCCCACAATAATGGGCCAGNONE 
J065149L09AGCCCACAATAATGGGCCAGNONE 
J065156A09AGCCCACAATAATGGGCCAGNONE 
J065157H23AGCCCACAATAATGGGCCAGNONE 
J065165L14AGCCCACAATAATGGGCCAGNONE 
J065165M18AGCCCACAATAATGGGCCAGNONE 
J065172O03AGCCCACAATAATGGGCCAGNONE 
J065192M18AGCCCACAATAATGGGCCAGNONE 
J065198D21AGCCCACAATAATGGGCCAGNONE 
J065200D05AGCCCACAATAATGGGCCAGNONE 
J065202B20AGCCCACAATAATGGGCCAGNONE 
J065212P11AGCCCACAATAATGGGCCAGNONE 
J065215E08AGCCCACAATAATGGGCCAGNONE 
J065217P19AGCCCACAATAATGGGCCAGNONE 
J075005I19AGCCCACAATAATGGGCCAGNONE 
J075134J06AGCCCACAATAATGGGCCAGNONE 
J075162G12AGCCCACAATAATGGGCCAGNONE 
J075178H07AGCCCACAATAATGGGCCAGNONE 
J075186K01AGCCCACAATAATGGGCCAGNONE 
J080315I17AGCCCACAATAATGGGCCAGNONE 
J080318P19AGCCCACAATAATGGGCCAGNONE 
J090004H16AGCCCACAATAATGGGCCAGNONE 
J090020A16AGCCCACAATAATGGGCCAGNONE 
J090047J12AGCCCACAATAATGGGCCAGNONE 
J090080E07AGCCCACAATAATGGGCCAGNONE 
J090090H23AGCCCACAATAATGGGCCAGNONE 
J100021G24AGCCCACAATAATGGGCCAGNONE 
J100037L04AGCCCACAATAATGGGCCAGNONE 
J100043L09AGCCCACAATAATGGGCCAGNONE 
J100044A10AGCCCACAATAATGGGCCAGNONE 
Os08g0536300AF358777CTGGCCCACTGACANONE 
AK099722CTGGCCCACTGACASimilar to Hd1. 
J100054G13CTGGCCCACTGACANONE 
Os09g0109500AK067482GTATGGGCTGGCCCAATTUNC-50 family protein. 
J013107E18GTATGGGCTGGCCCAATTNONE 
J023138C21GTATGGGCTGGCCCAATTNONE 
J065117D01GTATGGGCTGGCCCAATTNONE 
J065179F23GTATGGGCTGGCCCAATTNONE 
J100029N14GTATGGGCTGGCCCAATTNONE 
Os09g0120033AK069069CTTGGGCCAGCCCAGCConserved hypothetical protein. 
AK069069TCTGGCCCATCTConserved hypothetical protein. 
Os09g0321300AK122141TATTGGGCCAGATTGGGCCATNONE 
Os09g0325300011-005-H08CTGGCCCAACGCGGAGAGNONE 
AK068435CTGGCCCAACGCGGAGAGConserved hypothetical protein. 
AK073998CTGGCCCAACGCGGAGAGNONE 
J033071H21CTGGCCCAACGCGGAGAGNONE 
J065214H05CTGGCCCAACGCGGAGAGNONE 
Os09g0329800AK069775CGGGCCGATGGGCCAGGCCCConserved hypothetical protein. 
Os09g0329900Os09g0329900CGGGCCGATGGGCCAGGCCCNONE 
Os09g0370300AK108199AAATGGGCCAGASimilar to Iron sulfur subunit of succinate dehydrogenase (Truncated) and ribosomal protein S14 precursor. 
Os09g0401200AK063980CTGGCCCAAATAGGCCCAAGGCCCATTTSimilar to HSP associated protein like. 
Os09g0411700005-017-C05TCTGGCCCATTANONE 
009-163-B01TCTGGCCCATTANONE 
AK058290TCTGGCCCATTAPpiC-type peptidyl-prolyl cis-trans isomerase domain containing protein. 
AK104919TCTGGCCCATTANONE 
AK121091TCTGGCCCATTANONE 
J013039D20TCTGGCCCATTANONE 
J023066F16TCTGGCCCATTANONE 
J023082H09TCTGGCCCATTANONE 
J023088H05TCTGGCCCATTANONE 
J065013G09TCTGGCCCATTANONE 
J065065C12TCTGGCCCATTANONE 
J065111I04TCTGGCCCATTANONE 
J065179H22TCTGGCCCATTANONE 
J075023N14TCTGGCCCATTANONE 
J090041J17TCTGGCCCATTANONE 
J100031J21TCTGGCCCATTANONE 
J100057A18TCTGGCCCATTANONE 
J100068P22TCTGGCCCATTANONE 
Os09g0437900AK107833CTGGCCCAATASimilar to Adrenodoxin. 
AK107833GGTGGGCCAGASimilar to Adrenodoxin. 
Os09g0458700J065112J22TCTGGCCCATCTCalcium-binding EF-hand domain containing protein. 
J065207F05TCTGGCCCATCTNONE 
Os09g0485800AK108749ATTTGGGCCAGAConserved hypothetical protein. 
J065137H03ATTTGGGCCAGANONE 
Os09g0534000AK100026CTGGCCCAGCConserved hypothetical protein. 
AK100026TATTGGGCCAGGCCCAAAAConserved hypothetical protein. 
Os09g0542200006-092-A09ATATGGGCCAGANONE 
AK064887ATATGGGCCAGAThioredoxin fold domain containing protein. 
AK104804ATATGGGCCAGANONE 
J013000K12ATATGGGCCAGANONE 
J013170A19ATATGGGCCAGANONE 
J033103B02ATATGGGCCAGANONE 
J065196J20ATATGGGCCAGANONE 
J075037H17ATATGGGCCAGANONE 
J075069H14ATATGGGCCAGANONE 
J075071C16ATATGGGCCAGANONE 
J075095N02ATATGGGCCAGANONE 
J075136N03ATATGGGCCAGANONE 
J075192L16ATATGGGCCAGANONE 
J100057N23ATATGGGCCAGANONE 
J100060O07ATATGGGCCAGANONE 
J100062F10ATATGGGCCAGANONE 
J100077I08ATATGGGCCAGANONE 
J100086B07ATATGGGCCAGANONE 
J100088L14ATATGGGCCAGANONE 
Os09g0552300AK111721CTGGCCCATCTProtein kinase-like domain containing protein. 
J043013E21CTGGCCCATCTNONE 
Os09g0554000J065123C23CTGGCCCAGCSimilar to Mitochondrial phosphate transporter. 
Os11g0118000AK100743CTGGCCCACAAEsterase/lipase/thioesterase domain containing protein. 
J023031M08CTGGCCCACAANONE 
J023118F07CTGGCCCACAANONE 
Os11g0148000AK108267CTGGCCCATGGSodium/calcium exchanger membrane region domain containing protein. 
J065051O11CTGGCCCATGGNONE 
J065110G12CTGGCCCATGGNONE 
Os11g0150400006-104-E01CTGGCCCAATNONE 
009-067-G02CTGGCCCAATNONE 
AK058243CTGGCCCAATDimeric alpha-beta barrel domain containing protein. 
AK061232CTGGCCCAATNONE 
AK099186CTGGCCCAATNONE 
Os11g0168200005-010-H01TTGTGGGCCAGAGCCCATCCNONE 
009-156-F07TTGTGGGCCAGAGCCCATCCNONE 
012-025-F01TTGTGGGCCAGAGCCCATCCNONE 
012-089-A02TTGTGGGCCAGAGCCCATCCNONE 
016-016-E08TTGTGGGCCAGAGCCCATCCNONE 
AK073392TTGTGGGCCAGAGCCCATCC60S ribosomal protein L3. 
AK099225TTGTGGGCCAGAGCCCATCCNONE 
AK101469TTGTGGGCCAGAGCCCATCCNONE 
AY236158TTGTGGGCCAGAGCCCATCCNONE 
J013152M22TTGTGGGCCAGAGCCCATCCNONE 
J023013N11TTGTGGGCCAGAGCCCATCCNONE 
J023038J11TTGTGGGCCAGAGCCCATCCNONE 
J023054N21TTGTGGGCCAGAGCCCATCCNONE 
J033041E13TTGTGGGCCAGAGCCCATCCNONE 
J033050O09TTGTGGGCCAGAGCCCATCCNONE 
J033093G05TTGTGGGCCAGAGCCCATCCNONE 
J033094J17TTGTGGGCCAGAGCCCATCCNONE 
J033112J24TTGTGGGCCAGAGCCCATCCNONE 
J033113D05TTGTGGGCCAGAGCCCATCCNONE 
J033120K10TTGTGGGCCAGAGCCCATCCNONE 
J033121H19TTGTGGGCCAGAGCCCATCCNONE 
J033129C08TTGTGGGCCAGAGCCCATCCNONE 
J033140H24TTGTGGGCCAGAGCCCATCCNONE 
J065020I18TTGTGGGCCAGAGCCCATCCNONE 
J065058L01TTGTGGGCCAGAGCCCATCCNONE 
J065059G22TTGTGGGCCAGAGCCCATCCNONE 
J065212L09TTGTGGGCCAGAGCCCATCCNONE 
J075047P09TTGTGGGCCAGAGCCCATCCNONE 
J075063C18TTGTGGGCCAGAGCCCATCCNONE 
J075076E07TTGTGGGCCAGAGCCCATCCNONE 
J075077F14TTGTGGGCCAGAGCCCATCCNONE 
J075086C22TTGTGGGCCAGAGCCCATCCNONE 
J075161L09TTGTGGGCCAGAGCCCATCCNONE 
J075177K20TTGTGGGCCAGAGCCCATCCNONE 
J090007L06TTGTGGGCCAGAGCCCATCCNONE 
J090010M02TTGTGGGCCAGAGCCCATCCNONE 
J090013M20TTGTGGGCCAGAGCCCATCCNONE 
J090044I15TTGTGGGCCAGAGCCCATCCNONE 
J090045O06TTGTGGGCCAGAGCCCATCCNONE 
J090060L04TTGTGGGCCAGAGCCCATCCNONE 
J090061C17TTGTGGGCCAGAGCCCATCCNONE 
J090062F10TTGTGGGCCAGAGCCCATCCNONE 
J090066L03TTGTGGGCCAGAGCCCATCCNONE 
J090089E13TTGTGGGCCAGAGCCCATCCNONE 
J090096D21TTGTGGGCCAGAGCCCATCCNONE 
J100039F12TTGTGGGCCAGAGCCCATCCNONE 
J100053N06TTGTGGGCCAGAGCCCATCCNONE 
Os11g0182400016-077-B04TGTCAGTGTAATGGGCCATTGGGCCAGANONE 
AK112089TGTCAGTGTAATGGGCCATTGGGCCAGACyclin-like F-box domain containing protein. 
Os11g0202600AK102530CTGGCCCAAAAHypothetical protein. 
J090084P12CTGGCCCAAAANONE 
Os11g0484300AK121422AACTGGGCCAGASimilar to Mcm2-prov protein. 
Os11g0497000AK111924GGGCCTGGCCCATCAGCCCATATAGCCCATCASimilar to Ubiquitin activating enzyme-like protein (SUMO activating enzyme 1a). 
J065090J11GGGCCTGGCCCATCAGCCCATATAGCCCATCANONE 
J065097A08GGGCCTGGCCCATCAGCCCATATAGCCCATCANONE 
J065123J10GGGCCTGGCCCATCAGCCCATATAGCCCATCANONE 
J075096F04GGGCCTGGCCCATCAGCCCATATAGCCCATCANONE 
J080065C15GGGCCTGGCCCATCAGCCCATATAGCCCATCANONE 
J090033J04GGGCCTGGCCCATCAGCCCATATAGCCCATCANONE 
J090072N23GGGCCTGGCCCATCAGCCCATATAGCCCATCANONE 
J100021E08GGGCCTGGCCCATCAGCCCATATAGCCCATCANONE 
J100063H21GGGCCTGGCCCATCAGCCCATATAGCCCATCANONE 
Os11g0606300J075039E08CTGGCCCAACGGCCCACGANONE 
J075044E18CTGGCCCAACGGCCCACGANONE 
J075053G16CTGGCCCAACGGCCCACGAConserved hypothetical protein. 
Os11g0617800009-105-D10CACGGCCCATTCTGGCCCAACANONE 
AK062778CACGGCCCATTCTGGCCCAACAConserved hypothetical protein. 
Os11g0620300AJ704770TCTGGCCCATGNONE 
AK107901TCTGGCCCATGSimilar to Nonspecific lipid-transfer protein 2 (LTP 2). 
J075006M12TCTGGCCCATGNONE 
J075046J22TCTGGCCCATGNONE 
Os11g0645300003-107-E03ATTTGGGCCAGCCCAACCNONE 
006-108-C01ATTTGGGCCAGCCCAACCNONE 
009-015-H10ATTTGGGCCAGCCCAACCNONE 
009-020-G11ATTTGGGCCAGCCCAACCNONE 
009-047-F04ATTTGGGCCAGCCCAACCNONE 
009-053-A12ATTTGGGCCAGCCCAACCNONE 
009-059-B03ATTTGGGCCAGCCCAACCNONE 
009-067-A06ATTTGGGCCAGCCCAACCNONE 
009-084-C03ATTTGGGCCAGCCCAACCNONE 
009-108-G09ATTTGGGCCAGCCCAACCNONE 
009-122-G05ATTTGGGCCAGCCCAACCNONE 
009-124-D08ATTTGGGCCAGCCCAACCNONE 
009-136-C07ATTTGGGCCAGCCCAACCNONE 
013-049-E07ATTTGGGCCAGCCCAACCNONE 
014-056-G04ATTTGGGCCAGCCCAACCNONE 
AK062126ATTTGGGCCAGCCCAACCNONE 
AK120284ATTTGGGCCAGCCCAACCPlant disease resistance response protein family protein. 
J013043F05ATTTGGGCCAGCCCAACCNONE 
J013049N05ATTTGGGCCAGCCCAACCNONE 
J013050H05ATTTGGGCCAGCCCAACCNONE 
J065053N22ATTTGGGCCAGCCCAACCNONE 
J065218J04ATTTGGGCCAGCCCAACCNONE 
J075064K03ATTTGGGCCAGCCCAACCNONE 
J075073L24ATTTGGGCCAGCCCAACCNONE 
J075108C10ATTTGGGCCAGCCCAACCNONE 
Os12g0145200AK111428CTGGCCCAGASimilar to Protein MONOCULM 1. 
J065208D22CTGGCCCAGANONE 
Os12g0230600AK072568CTGGCCCACCACCCCCCAProtein of unknown function DUF1685 family protein. 
Os12g0236900AK068145CTGGCCCAATNuclear protein SET domain containing protein. 
Os12g0285600AK069104CTGGCCCACGCGOxysterol-binding protein family protein. 
Os12g0405700AK061920TGATGGGCCAGASimilar to Wound-induced basic protein. 
AK120436TGATGGGCCAGANONE 
Os12g0431100014-071-A04TCTGGCCCATGNONE 
AK063710TCTGGCCCATGAAA ATPase domain containing protein. 
Os12g0516300AK065092ATCTGGGCCAGNONE 
J013001M05ATCTGGGCCAGNONE 
Os12g0517100012-071-A03AAATGGGCCAGNONE 
AK073020AAATGGGCCAGCyclin-like F-box domain containing protein. 
J023149K21AAATGGGCCAGNONE 
Os12g0540000AK108630TCATGGGCCAGAConserved hypothetical protein. 
J065046N02TCATGGGCCAGANONE 
J065100H24TCATGGGCCAGANONE 
J065142M24TCATGGGCCAGANONE 
Os12g0548700J065076A08CATGGGCCAGNONE 
Os12g0569900Os12g0569900ACTGGGCCAGSimilar to Zn finger protein (Fragment). 
Os12g0569900TATGGGCCAGASimilar to Zn finger protein (Fragment). 
Os12g0605400009-005-G05CTGGCCCAATNONE 
016-024-B01CTGGCCCAATNONE 
016-043-A11CTGGCCCAATNONE 
AK068060CTGGCCCAATSimilar to CROC-1-like protein (Fragment). 
J013130B07CTGGCCCAATNONE 
J023141C14CTGGCCCAATNONE 
J033037O04CTGGCCCAATNONE 
J033081L17CTGGCCCAATNONE 
J033108C03CTGGCCCAATNONE 
J065079G22CTGGCCCAATNONE 
J065082D03CTGGCCCAATNONE 
J065207O15CTGGCCCAATNONE 
J075027C23CTGGCCCAATNONE 
J075037A17CTGGCCCAATNONE 
J075056D17CTGGCCCAATNONE 
J075064O21CTGGCCCAATNONE 
J075096E08CTGGCCCAATNONE 
J090036I15CTGGCCCAATNONE 
J100018P15CTGGCCCAATNONE 
J100074O06CTGGCCCAATNONE 
Os12g0605900AK109696AGGGCCCATGGGCCCTGGCCCATTASimilar to Kinase like protein. 
Os12g0609800AK101303CTGGCCCATGGAGCCCATCACytochrome cd1-nitrite reductase-like, C-terminal haem d1 domain containing protein. 
J033032I01CTGGCCCATGGAGCCCATCANONE 
J033033K21CTGGCCCATGGAGCCCATCANONE 
J033082L13CTGGCCCATGGAGCCCATCANONE 
J043034M20CTGGCCCATGGAGCCCATCANONE 
J065137J24CTGGCCCATGGAGCCCATCANONE 
J065141A11CTGGCCCATGGAGCCCATCANONE 
J065217H09CTGGCCCATGGAGCCCATCANONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.