version

Summary of OsREG578 (All List)

OrganismOryza sativa  
IDOsREG578  
SequenceCTGGGCCA  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count906  

Entry Sequences (906 entries)

LocusGene modelSequenceDescription
Os01g0104800AK067602TACTGGGCCAGSas10/Utp3 family protein. 
J013109E04TACTGGGCCAGNONE 
J033057M05TACTGGGCCAGNONE 
J043021M24TACTGGGCCAGNONE 
J090014N05TACTGGGCCAGNONE 
J090077H23TACTGGGCCAGNONE 
J090084H08TACTGGGCCAGNONE 
Os01g0139600AK073130TTGGCCCAGATSimilar to Lipid phosphate phosphatase 2 (EC 3.1.3.-) (AtLPP2) (Phosphatidic acid phosphatase 2) (AtPAP2) (Prenyl diphosphate phosphatase). 
Os01g0246100AK120732GGCTGGGCCAGProtein of unknown function DUF902, CREBbp domain containing protein. 
Os01g0248800009-103-G11CTGGCCCAGCNONE 
AK062766CTGGCCCAGCConserved hypothetical protein. 
Os01g0273300Os01g0273300TTGGCCCAGATBSD domain containing protein. 
Os01g0298400J065186D02TTGGCCCAGCMyb, DNA-binding domain containing protein. 
Os01g0618200AK102319CCTGGGCCAGCCCACCAProtein phosphatase 2C family protein. 
Os01g0633000006-075-A01TCTGGGCCAGNONE 
009-064-A11TCTGGGCCAGNONE 
009-153-F07TCTGGGCCAGNONE 
AK062051TCTGGGCCAGSimilar to 50S ribosomal protein L31. 
J013073B08TCTGGGCCAGNONE 
J065006K19TCTGGGCCAGNONE 
J065053P08TCTGGGCCAGNONE 
J065057D08TCTGGGCCAGNONE 
J065086P07TCTGGGCCAGNONE 
J065095C14TCTGGGCCAGNONE 
J065116B05TCTGGGCCAGNONE 
J065164L20TCTGGGCCAGNONE 
J065185K19TCTGGGCCAGNONE 
J065191E21TCTGGGCCAGNONE 
J065199P21TCTGGGCCAGNONE 
J065216M12TCTGGGCCAGNONE 
J075002M09TCTGGGCCAGNONE 
J075016N10TCTGGGCCAGNONE 
J075041K05TCTGGGCCAGNONE 
J075094E04TCTGGGCCAGNONE 
J075154O04TCTGGGCCAGNONE 
J075176D22TCTGGGCCAGNONE 
J075186M09TCTGGGCCAGNONE 
J075191H20TCTGGGCCAGNONE 
Os01g0633400AK108988TTGGCCCATCGTGGCCCAGTACBS domain containing protein. 
Os01g0692100J043022J20TTGGCCCAGCGlutathione S-transferase, N-terminal domain containing protein. 
J100032K22TTGGCCCAGCNONE 
Os01g0702700009-179-G10CTGGCCCAGTNONE 
AK111782CTGGCCCAGTSimilar to Transcription factor MYB86 (Myb-related protein 86) (AtMYB86) (Myb homolog 4) (AtMyb4). 
J023084H22CTGGCCCAGTNONE 
J100021C12CTGGCCCAGTNONE 
J100025N10CTGGCCCAGTNONE 
J100043F22CTGGCCCAGTNONE 
Os01g0719250AK105184GCTGGGCCACConserved hypothetical protein. 
Os01g0730500AK100064GTGGCCCAGASimilar to Ferredoxin (Bacterial type ferredoxin family). 
Os01g0784600AK067527TTGGCCCAGGConserved hypothetical protein. 
Os01g0785600AK111308TTGGCCCAGCCCAATAMethyltransferase type 11 domain containing protein. 
Os01g0785700AK100774TATTGGGCTGGGCCAANONE 
AK102081TATTGGGCTGGGCCAAProtein prenyltransferase domain containing protein. 
AY129829TATTGGGCTGGGCCAANONE 
J023120B17TATTGGGCTGGGCCAANONE 
J033082K10TATTGGGCTGGGCCAANONE 
Os01g0810100AK071916ATGGCCCAGCCCAATTRibonuclease III domain containing protein. 
AK099056ATGGCCCAGCCCAATTNONE 
AK104320ATGGCCCAGCCCAATTNONE 
Os01g0871800AK064787GTGGCCCAGTTNONE 
AK067087GTGGCCCAGTTTGF-beta receptor, type I/II extracellular region family protein. 
AK120109GTGGCCCAGTTNONE 
J013023O17GTGGCCCAGTTNONE 
J013108P12GTGGCCCAGTTNONE 
J013110E18GTGGCCCAGTTNONE 
J013110E22GTGGCCCAGTTNONE 
J013132E24GTGGCCCAGTTNONE 
J013160C03GTGGCCCAGTTNONE 
Os01g0874800016-042-F01TACTGGGCCAANONE 
AK065916TACTGGGCCAANONE 
AK065991TACTGGGCCAANONE 
AK103577TACTGGGCCAANONE 
AK105063TACTGGGCCAA5'-3' exonuclease domain containing protein. 
AK119315TACTGGGCCAANONE 
J023106C06TACTGGGCCAANONE 
J053023A11TACTGGGCCAANONE 
J053068H13TACTGGGCCAANONE 
J053071O13TACTGGGCCAANONE 
J053074M10TACTGGGCCAANONE 
Os01g0924000004-020-C09GCTGGGCCAANONE 
005-014-A06GCTGGGCCAANONE 
009-085-G12GCTGGGCCAANONE 
009-123-A08GCTGGGCCAANONE 
009-134-A05GCTGGGCCAANONE 
009-137-F06GCTGGGCCAANONE 
016-016-B08GCTGGGCCAANONE 
AF050674GCTGGGCCAANONE 
AK061690GCTGGGCCAASimilar to Chloroplast 50S ribosomal protein L27 (Fragment). 
AK120797GCTGGGCCAANONE 
J013040A15GCTGGGCCAANONE 
J013104L20GCTGGGCCAANONE 
J013127E12GCTGGGCCAANONE 
J013158O05GCTGGGCCAANONE 
J023012E09GCTGGGCCAANONE 
J023126L23GCTGGGCCAANONE 
J023143B03GCTGGGCCAANONE 
J065005B16GCTGGGCCAANONE 
J065101J15GCTGGGCCAANONE 
J065105K16GCTGGGCCAANONE 
J065155K16GCTGGGCCAANONE 
J065171M17GCTGGGCCAANONE 
J065182F07GCTGGGCCAANONE 
J065187D10GCTGGGCCAANONE 
J065194I24GCTGGGCCAANONE 
J065207E24GCTGGGCCAANONE 
J075001C24GCTGGGCCAANONE 
J075090O10GCTGGGCCAANONE 
J075095H17GCTGGGCCAANONE 
J075109M24GCTGGGCCAANONE 
J075123C18GCTGGGCCAANONE 
J075148G22GCTGGGCCAANONE 
J090009B09GCTGGGCCAANONE 
J090075K17GCTGGGCCAANONE 
J090081H23GCTGGGCCAANONE 
J090097H21GCTGGGCCAANONE 
J100063P14GCTGGGCCAANONE 
Os01g0949200AK102412AACTGGGCCAGANONE 
J033093A04AACTGGGCCAGANONE 
J065053P06AACTGGGCCAGANONE 
J100086D18AACTGGGCCAGANONE 
Os02g0106100AK072245AACTGGGCCAASimilar to Fructosyltransferase. 
Os02g0133800006-092-D12CCTGGGCCAAAGCCCAATTNONE 
006-111-G01CCTGGGCCAAAGCCCAATTNONE 
AK103646CCTGGGCCAAAGCCCAATTNONE 
AK109376CCTGGGCCAAAGCCCAATTProteasome subunit alpha type 1 (EC 3.4.25.1) (20S proteasome alpha subunit F) (20S proteasome subunit alpha-6) (Proteasome component C2). 
D37886CCTGGGCCAAAGCCCAATTNONE 
J033135B19CCTGGGCCAAAGCCCAATTNONE 
J065200F01CCTGGGCCAAAGCCCAATTNONE 
J065213J11CCTGGGCCAAAGCCCAATTNONE 
J075031N16CCTGGGCCAAAGCCCAATTNONE 
J075032N17CCTGGGCCAAAGCCCAATTNONE 
J075047P04CCTGGGCCAAAGCCCAATTNONE 
J075063D01CCTGGGCCAAAGCCCAATTNONE 
J075105F23CCTGGGCCAAAGCCCAATTNONE 
J075121E16CCTGGGCCAAAGCCCAATTNONE 
J075176F10CCTGGGCCAAAGCCCAATTNONE 
J075182M16CCTGGGCCAAAGCCCAATTNONE 
J075190E09CCTGGGCCAAAGCCCAATTNONE 
J075191B14CCTGGGCCAAAGCCCAATTNONE 
J100055J24CCTGGGCCAAAGCCCAATTNONE 
J100066H24CCTGGGCCAAAGCCCAATTNONE 
J100073N01CCTGGGCCAAAGCCCAATTNONE 
Os02g0162500009-181-F03TTGGCCCAGCCCATAANONE 
AK058907TTGGCCCAGCCCATAANONE 
AK121223TTGGCCCAGCCCATAASimilar to 40S ribosomal protein S14. 
J023090I10TTGGCCCAGCCCATAANONE 
J023136J11TTGGCCCAGCCCATAANONE 
J053097J20TTGGCCCAGCCCATAANONE 
J053098F01TTGGCCCAGCCCATAANONE 
J065065B09TTGGCCCAGCCCATAANONE 
J065082M04TTGGCCCAGCCCATAANONE 
J065188O05TTGGCCCAGCCCATAANONE 
J075057P15TTGGCCCAGCCCATAANONE 
J075061J08TTGGCCCAGCCCATAANONE 
J075061N15TTGGCCCAGCCCATAANONE 
J075131I08TTGGCCCAGCCCATAANONE 
J075141H13TTGGCCCAGCCCATAANONE 
J080062E14TTGGCCCAGCCCATAANONE 
J080062P15TTGGCCCAGCCCATAANONE 
J080318G17TTGGCCCAGCCCATAANONE 
J080319G19TTGGCCCAGCCCATAANONE 
J090001L10TTGGCCCAGCCCATAANONE 
J090024I18TTGGCCCAGCCCATAANONE 
J090033F24TTGGCCCAGCCCATAANONE 
J090036M16TTGGCCCAGCCCATAANONE 
J090040I24TTGGCCCAGCCCATAANONE 
J090048P06TTGGCCCAGCCCATAANONE 
J090049B12TTGGCCCAGCCCATAANONE 
J090068C02TTGGCCCAGCCCATAANONE 
J090069O04TTGGCCCAGCCCATAANONE 
J090084H22TTGGCCCAGCCCATAANONE 
J100022L03TTGGCCCAGCCCATAANONE 
J100028O14TTGGCCCAGCCCATAANONE 
J100028O18TTGGCCCAGCCCATAANONE 
J100032A15TTGGCCCAGCCCATAANONE 
J100033D21TTGGCCCAGCCCATAANONE 
J100034J23TTGGCCCAGCCCATAANONE 
J100043K22TTGGCCCAGCCCATAANONE 
J100052M22TTGGCCCAGCCCATAANONE 
J100053N03TTGGCCCAGCCCATAANONE 
J100074N24TTGGCCCAGCCCATAANONE 
J100082J10TTGGCCCAGCCCATAANONE 
Os02g0186900J100059N12TTGGCCCAGCCytochrome P450 family protein. 
Os02g0187600AK069783TTGGCCCAGTNONE 
AK109387TTGGCCCAGTConserved hypothetical protein. 
J090029C18TTGGCCCAGTNONE 
Os02g0316800009-104-A11GCTGGGCCAGNONE 
AK062767GCTGGGCCAGSimilar to MRNA binding protein precursor. 
Os02g0332700009-144-D04TTGGCCCAGGNONE 
AK062975TTGGCCCAGGConserved hypothetical protein. 
Os02g0520800AK102815TACTGGGCCTGGGCCAGSimilar to Ubiquinol-cytochrome c reductase iron-sulfur subunit, mitochondrial precursor (EC 1.10.2.2) (Rieske iron-sulfur protein) (RISP). 
J033108M09TACTGGGCCTGGGCCAGNONE 
J100038E09TACTGGGCCTGGGCCAGNONE 
J100076G11TACTGGGCCTGGGCCAGNONE 
Os02g0593500AK067498GCTGGGCCACPhosphate transporter family protein. 
AK104702GCTGGGCCACNONE 
Os02g0637900AK110708GCTGGGCCATGGCCCATGTConserved hypothetical protein. 
J065038O03GCTGGGCCATGGCCCATGTNONE 
J065052A19GCTGGGCCATGGCCCATGTNONE 
J065052A20GCTGGGCCATGGCCCATGTNONE 
J065063D06GCTGGGCCATGGCCCATGTNONE 
J065069D12GCTGGGCCATGGCCCATGTNONE 
J065074H07GCTGGGCCATGGCCCATGTNONE 
J065174K17GCTGGGCCATGGCCCATGTNONE 
J065215M12GCTGGGCCATGGCCCATGTNONE 
J075007E12GCTGGGCCATGGCCCATGTNONE 
J075057K20GCTGGGCCATGGCCCATGTNONE 
J075119I10GCTGGGCCATGGCCCATGTNONE 
Os02g0638400AK060633AGCCCAATGGCCCAGATGGGCCGABRO1 domain containing protein. 
AK060633GCTGGGCCAGBRO1 domain containing protein. 
J065083J17AGCCCAATGGCCCAGATGGGCCGANONE 
J065083J17GCTGGGCCAGNONE 
Os02g0673000AK108650TTGGCCCAGGProtein of unknown function UPF0005 family protein. 
Os02g0689200011-024-D04CTGGCCCAGANONE 
AK071254CTGGCCCAGANONE 
AK072660CTGGCCCAGAProtein of unknown function DUF250 domain containing protein. 
J023087G23CTGGCCCAGANONE 
J023134O11CTGGCCCAGANONE 
J033095E21CTGGCCCAGANONE 
J033113F12CTGGCCCAGANONE 
J033124F02CTGGCCCAGANONE 
J065070A01CTGGCCCAGANONE 
J065129C05CTGGCCCAGANONE 
J065165M19CTGGCCCAGANONE 
J090015K07CTGGCCCAGANONE 
J090066D21CTGGCCCAGANONE 
J090075M20CTGGCCCAGANONE 
Os02g0714700AK067734TTGGCCCAGCConserved hypothetical protein. 
Os02g0725300AK120054CTGGCCCAGGNONE 
J013000L05CTGGCCCAGGNONE 
J065194M19CTGGCCCAGGNONE 
Os02g0729400J075028G02GTGGCCCAGANONE 
Os02g0773200AK108499ACTGGGCCACUniversal stress protein (Usp) family protein. 
J075062A04ACTGGGCCACNONE 
J075150C10ACTGGGCCACNONE 
J090086A09ACTGGGCCACNONE 
Os02g0795100016-001-E07CTGGCCCAGGNONE 
AK106456CTGGCCCAGGEukaryotic transcription factor, DNA-binding domain containing protein. 
Os02g0795200AK059349AACTGGGCCACConserved hypothetical protein. 
Os02g0805600006-054-D07ATCTGGGCCAANONE 
AK059822ATCTGGGCCAANONE 
AK099516ATCTGGGCCAASimilar to Alcohol dehydrogenase, zinc-containing. 
AK104587ATCTGGGCCAANONE 
J065037H22ATCTGGGCCAANONE 
J090015P17ATCTGGGCCAANONE 
Os02g0819100AK100156TTGGCCCAGTTZinc finger, DHHC-type domain containing protein. 
J013088C21TTGGCCCAGTTNONE 
Os03g0127000AK068479TTGGCCCAGTTConserved hypothetical protein. 
J013152D10TTGGCCCAGTTNONE 
J075167I20TTGGCCCAGTTNONE 
J090067O04TTGGCCCAGTTNONE 
Os03g0130700AK110670TTGGCCCAGGNONE 
Os03g0143600AB110188TTGGCCCAGCNONE 
AK068424TTGGCCCAGCSimilar to Inhibitor of growth protein 1. Splice isoform 2. 
AY224464TTGGCCCAGCNONE 
AY224545TTGGCCCAGCNONE 
J013154F02TTGGCCCAGCNONE 
Os03g0162200009-031-E05ATGGCCCAGTNONE 
013-049-D04ATGGCCCAGTNONE 
013-082-E03ATGGCCCAGTNONE 
014-039-G04ATGGCCCAGTNONE 
014-098-G11ATGGCCCAGTNONE 
AK061605ATGGCCCAGTNONE 
AK121533ATGGCCCAGTSimilar to Histone H2A. 
J033024D06ATGGCCCAGTNONE 
J033030P21ATGGCCCAGTNONE 
J065063C20ATGGCCCAGTNONE 
J065064A18ATGGCCCAGTNONE 
J065147G02ATGGCCCAGTNONE 
J065204K06ATGGCCCAGTNONE 
J090004C22ATGGCCCAGTNONE 
J090014K02ATGGCCCAGTNONE 
J090074E10ATGGCCCAGTNONE 
J090086L09ATGGCCCAGTNONE 
Os03g0197400AK071413CCTGGGCCATSimilar to COP9 signalosome complex subunit 4 (Signalosome subunit 4) (Constitutive photomorphogenesis protein 8) (FUSCA protein 4) (FUSCA4) (AtS4). 
AK104905CCTGGGCCATNONE 
J053023D18CCTGGGCCATNONE 
Os03g0205500Os03g0205500CCCGGGCCCGGCCCACTGGCCCAGTCytochrome b5 domain containing protein. 
Os03g0284000Os03g0284000CCTGGGCCATConserved hypothetical protein. 
Os03g0292800012-077-B05ATCTGGGCCAANONE 
AK069970ATCTGGGCCAASimilar to Ran binding protein 1 homolog. 
J065138F22ATCTGGGCCAANONE 
Os03g0300700AK071770TTGGCCCAGCRetrotransposon gag protein family protein. 
J023112P05TTGGCCCAGCNONE 
Os03g0310600AK109731TCTGGGCCAAProtein of unknown function DUF247, plant family protein. 
Os03g0333000AK109811TATGGGCTGGGCCAAConserved hypothetical protein. 
J065152D04TATGGGCTGGGCCAANONE 
J090011B05TATGGGCTGGGCCAANONE 
Os03g0333100AK101050TTGGCCCAGCCCATAProtein of unknown function DUF663 domain containing protein. 
Os03g0360500009-103-B05ATTTGGGCCCAAAGTGGCCCAGTNONE 
AK059166ATTTGGGCCCAAAGTGGCCCAGTNONE 
AK101285ATTTGGGCCCAAAGTGGCCCAGTProtein of unknown function DUF1077 family protein. 
J033061G19ATTTGGGCCCAAAGTGGCCCAGTNONE 
J065169P12ATTTGGGCCCAAAGTGGCCCAGTNONE 
J075104C18ATTTGGGCCCAAAGTGGCCCAGTNONE 
J075166G07ATTTGGGCCCAAAGTGGCCCAGTNONE 
J075170J04ATTTGGGCCCAAAGTGGCCCAGTNONE 
Os03g0388100AK059680GCTGGGCCATHeavy metal transport/detoxification protein domain containing protein. 
AK099133GCTGGGCCATNONE 
Os03g0405500AK104893ATGGCCCAGTANONE 
Os03g0583800AK064786CTGGCCCAGCCMpv17/PMP22 family protein. 
AK099233CTGGCCCAGCCNONE 
J013000B17CTGGCCCAGCCNONE 
J013071N13CTGGCCCAGCCNONE 
J013095M11CTGGCCCAGCCNONE 
J080068F05CTGGCCCAGCCNONE 
J080069C02CTGGCCCAGCCNONE 
J080072E22CTGGCCCAGCCNONE 
J100052H10CTGGCCCAGCCNONE 
J100053H09CTGGCCCAGCCNONE 
J100056G03CTGGCCCAGCCNONE 
Os03g0598900J053098D07AATTGGGCCTGGGCCATNONE 
J065063O13AATTGGGCCTGGGCCATDSBA oxidoreductase family protein. 
Os03g0668400AK119454AGCCCACGATGGCCCAGGCCCAGGCCCAGGProtein of unknown function DUF860, plant family protein. 
Os03g0701100014-015-E11AACTGGGCCAANONE 
AK109455AACTGGGCCAANONE 
AK110740AACTGGGCCAANONE 
Os03g0746400AK063445CCTGGGCCATProtein prenyltransferase domain containing protein. 
AK070923CCTGGGCCATNONE 
J065008K24CCTGGGCCATNONE 
Os03g0753100AB003324GCTGGGCCAGNONE 
AK100227GCTGGGCCAGTranscription factor, MADS-box domain containing protein. 
AY551917GCTGGGCCAGNONE 
AY551922GCTGGGCCAGNONE 
AY551926GCTGGGCCAGNONE 
J023012N20GCTGGGCCAGNONE 
J023048E14GCTGGGCCAGNONE 
Os03g0758700AK106620TACTGGGCCAAWD40-like domain containing protein. 
Os03g0763000AK120812GGCTGGGCCATSimilar to Casein kinase II alpha subunit. 
Os03g0811800AK063320ACTGGGCCACTAATGGGCTTGGRibosomal protein L36 family protein. 
J065094F18ACTGGGCCACTAATGGGCTTGGNONE 
J090029B04ACTGGGCCACTAATGGGCTTGGNONE 
Os03g0829100AK072669CCTGGGCCACSimilar to Soluble epoxide hydrolase. 
J013073C22CCTGGGCCACNONE 
J033067O15CCTGGGCCACNONE 
J065021D04CCTGGGCCACNONE 
J065102E20CCTGGGCCACNONE 
Os03g0843400009-195-F11CCTGGGCCAANONE 
AK061198CCTGGGCCAASimilar to 30S ribosomal protein S6, chloroplast precursor (Fragment). 
AK099076CCTGGGCCAANONE 
Os04g0129300AK109511AACTGGGCCAAYT521-B-like protein family protein. 
Os04g0270100AK063713ATGGCCCAGTNONE 
AK107968ATGGCCCAGTNONE 
Os04g0350000011-080-B03ATCTGGGCCATNONE 
AK063387ATCTGGGCCATNONE 
AK121263ATCTGGGCCATNONE 
Os04g0390700AK107261ATGGCCCAGCGlucose/ribitol dehydrogenase family protein. 
Os04g0407300AK101793GCTGGGCCAGNONE 
AK121980GCTGGGCCAGHypothetical protein. 
J033065K23GCTGGGCCAGNONE 
J033108L11GCTGGGCCAGNONE 
Os04g0445200009-034-A06ATCTGGGCCACNONE 
AK062427ATCTGGGCCACProtein of unknown function DUF861, cupin_3 domain containing protein. 
AK119720ATCTGGGCCACNONE 
J065022E20ATCTGGGCCACNONE 
J065062D16ATCTGGGCCACNONE 
J065081I02ATCTGGGCCACNONE 
J065087C10ATCTGGGCCACNONE 
J065116N16ATCTGGGCCACNONE 
J065132F10ATCTGGGCCACNONE 
J065140F18ATCTGGGCCACNONE 
J065143M22ATCTGGGCCACNONE 
J065158K17ATCTGGGCCACNONE 
J065162D07ATCTGGGCCACNONE 
J065207H19ATCTGGGCCACNONE 
J075155B20ATCTGGGCCACNONE 
J075167E24ATCTGGGCCACNONE 
J075178B19ATCTGGGCCACNONE 
J080301D22ATCTGGGCCACNONE 
J080301J15ATCTGGGCCACNONE 
J080308J02ATCTGGGCCACNONE 
Os04g0447600006-023-A01CTGGCCCAGGNONE 
006-080-D11CTGGCCCAGGNONE 
006-095-D01CTGGCCCAGGNONE 
006-114-F03CTGGCCCAGGNONE 
AK061282CTGGCCCAGGSimilar to NADPH-dependent codeinone reductase (EC 1.1.1.247). 
Os04g0461100009-136-H10GCTGGGCCATATTGGGCTTTNONE 
009-147-H12GCTGGGCCATATTGGGCTTTNONE 
AK068022GCTGGGCCATATTGGGCTTTPlastid and cyanobacterial ribosomal protein PSRP-3/Ycf65 family protein. 
J013130N24GCTGGGCCATATTGGGCTTTNONE 
J065019D10GCTGGGCCATATTGGGCTTTNONE 
J065168O21GCTGGGCCATATTGGGCTTTNONE 
J075051G06GCTGGGCCATATTGGGCTTTNONE 
J075148G11GCTGGGCCATATTGGGCTTTNONE 
Os04g0539000009-165-H09TTGGCCCAGANONE 
014-012-F10TTGGCCCAGANONE 
AK105343TTGGCCCAGALambda integrase-like, N-terminal domain containing protein. 
Os04g0626400006-050-B09CAAGGCCCTGGCCCAGCNONE 
006-072-C12CAAGGCCCTGGCCCAGCNONE 
006-092-C11CAAGGCCCTGGCCCAGCNONE 
AK059851CAAGGCCCTGGCCCAGCCalycin-like family protein. 
AK100069CAAGGCCCTGGCCCAGCNONE 
AK104062CAAGGCCCTGGCCCAGCNONE 
AK104663CAAGGCCCTGGCCCAGCNONE 
Os04g0640800AK065522GTGGCCCAGAProgrammed cell death protein 2, C-terminal domain containing protein. 
Os04g0673400Os04g0673400TCTGGGCCAASimilar to Uracil-DNA glycosylase (EC 3.2.2.-) (UDG). 
Os04g0686600AK068427GTTTGGGCTGGGCCTGGCCCAGTTProtein kinase domain containing protein. 
J013155F22GTTTGGGCTGGGCCTGGCCCAGTTNONE 
J023020E07GTTTGGGCTGGGCCTGGCCCAGTTNONE 
Os04g0692200006-047-H10ATGGCCCAGGCCCAACANONE 
006-107-D08ATGGCCCAGGCCCAACANONE 
009-122-B09ATGGCCCAGGCCCAACANONE 
AK059807ATGGCCCAGGCCCAACANONE 
AK060875ATGGCCCAGGCCCAACANONE 
AK071726ATGGCCCAGGCCCAACAConserved hypothetical protein. 
J023110I24ATGGCCCAGGCCCAACANONE 
J033091O06ATGGCCCAGGCCCAACANONE 
J053027N16ATGGCCCAGGCCCAACANONE 
J053089E19ATGGCCCAGGCCCAACANONE 
J053098H12ATGGCCCAGGCCCAACANONE 
J053099N13ATGGCCCAGGCCCAACANONE 
J075031B15ATGGCCCAGGCCCAACANONE 
J080013D12ATGGCCCAGGCCCAACANONE 
J080013H05ATGGCCCAGGCCCAACANONE 
J080013H07ATGGCCCAGGCCCAACANONE 
J080088I03ATGGCCCAGGCCCAACANONE 
Os05g0116600AK109828GCTGGGCCCTGGGCCATF-box associated type 1 domain containing protein. 
Os05g0161200AB042936CTGGCCCAGGGCCGGCCCNONE 
AK121808CTGGCCCAGGGCCGGCCCDNA polymerase III clamp loader subunit, C-terminal domain containing protein. 
Os05g0193800AK058865TTGGCCCAGCNONE 
AK067940TTGGCCCAGCConserved hypothetical protein. 
J065043K19TTGGCCCAGCNONE 
J065095O10TTGGCCCAGCNONE 
J065095O12TTGGCCCAGCNONE 
J080002K02TTGGCCCAGCNONE 
J080012L17TTGGCCCAGCNONE 
J080013J02TTGGCCCAGCNONE 
J080013O11TTGGCCCAGCNONE 
J080020A17TTGGCCCAGCNONE 
J080028E18TTGGCCCAGCNONE 
J080036P11TTGGCCCAGCNONE 
J080042E10TTGGCCCAGCNONE 
J080042L10TTGGCCCAGCNONE 
J080047B11TTGGCCCAGCNONE 
J080048N05TTGGCCCAGCNONE 
J080057E20TTGGCCCAGCNONE 
J080057K13TTGGCCCAGCNONE 
J080058L03TTGGCCCAGCNONE 
J080063H07TTGGCCCAGCNONE 
J080066L23TTGGCCCAGCNONE 
J080069G22TTGGCCCAGCNONE 
J080072E12TTGGCCCAGCNONE 
J080076D06TTGGCCCAGCNONE 
J080077A22TTGGCCCAGCNONE 
J080081A01TTGGCCCAGCNONE 
J080090M13TTGGCCCAGCNONE 
J080093G07TTGGCCCAGCNONE 
J080094O20TTGGCCCAGCNONE 
J080097F13TTGGCCCAGCNONE 
Os05g0317300AK064846ATGGCCCAGATFAR1 domain containing protein. 
AK122018ATGGCCCAGATNONE 
J013000G11ATGGCCCAGATNONE 
J023041M02ATGGCCCAGATNONE 
J023056G01ATGGCCCAGATNONE 
J023064M23ATGGCCCAGATNONE 
J023107F08ATGGCCCAGATNONE 
J033060K06ATGGCCCAGATNONE 
J033097H11ATGGCCCAGATNONE 
J065139C02ATGGCCCAGATNONE 
J090034K18ATGGCCCAGATNONE 
J090048K22ATGGCCCAGATNONE 
J090067G18ATGGCCCAGATNONE 
J090089F08ATGGCCCAGATNONE 
Os05g0327000014-005-A12CCTGGGCCATNONE 
AK064059CCTGGGCCATCyclin-like domain containing protein. 
AK101588CCTGGGCCATNONE 
J033051A05CCTGGGCCATNONE 
J065106E02CCTGGGCCATNONE 
J065183D01CCTGGGCCATNONE 
Os05g0377000Os05g0377000GCTGGGCCAGATGGGCCGGASimilar to Acyl carrier protein (ACP). 
Os05g0382000AK072704ATGGCCCAGCNONE 
AK121203ATGGCCCAGCSimilar to ABL164Cp. 
Os05g0437200014-036-D04TACTGGGCCAGANONE 
AK059283TACTGGGCCAGANONE 
AK121867TACTGGGCCAGAProtein of unknown function DUF502 family protein. 
Os05g0455500AK101985TCTGGGCCAANONE 
AK102633TCTGGGCCAADelta 1-pyrroline-5-carboxylate synthetase (P5CS) [Includes: Glutamate 5-kinase (EC 2.7.2.11) (Gamma-glutamyl kinase) (GK); Gamma-glutamyl phosphate reductase (GPR) (EC 1.2.1.41) (Glutamate-5-semialdehyde dehydrogenase) (Glutamyl-gamma-semialdehyde dehydrogenase)]. 
AY574031TCTGGGCCAANONE 
D49714TCTGGGCCAANONE 
J013002F07TCTGGGCCAANONE 
J033085C02TCTGGGCCAANONE 
Os05g0486200009-099-B03CCTGGGCCACNONE 
AK121022CCTGGGCCACConserved hypothetical protein. 
J023049I09CCTGGGCCACNONE 
J033029N07CCTGGGCCACNONE 
J075074I18CCTGGGCCACNONE 
Os05g0502800016-060-H05ATGGCCCAGTNONE 
AK064242ATGGCCCAGTNONE 
AK065486ATGGCCCAGTNAF1 domain containing protein. 
Os05g0519800AK069435CTGGCCCAGCProtein of unknown function DUF28 family protein. 
J023024L22CTGGCCCAGCNONE 
Os05g0545500AK101095AACTGGGCCACConserved hypothetical protein. 
AK119499AACTGGGCCACNONE 
Os05g0554100AK073023TCTGGGCCAARibosomal protein L7/L12 family protein. 
AK101756TCTGGGCCAANONE 
Os05g0571400009-019-B04GTGGCCCAGATNONE 
009-043-H02GTGGCCCAGATNONE 
AK062369GTGGCCCAGATConserved hypothetical protein. 
Os05g0589000AK061980AACTGGGCCAANONE 
AK099181AACTGGGCCAAConserved hypothetical protein. 
Os06g0125200015-099-F09TTGGCCCAGGGCCGTCNONE 
AK102200TTGGCCCAGGGCCGTCProtein of unknown function DUF581 family protein. 
J033030E04TTGGCCCAGGGCCGTCNONE 
J033058K06TTGGCCCAGGGCCGTCNONE 
J033060O13TTGGCCCAGGGCCGTCNONE 
J033068B04TTGGCCCAGGGCCGTCNONE 
J033087E11TTGGCCCAGGGCCGTCNONE 
J033113N12TTGGCCCAGGGCCGTCNONE 
J065110P15TTGGCCCAGGGCCGTCNONE 
J075174B01TTGGCCCAGGGCCGTCNONE 
Os06g0134300AK071534TTGTGGGCTACTGGGCCATConserved hypothetical protein. 
J023106E03TTGTGGGCTACTGGGCCATNONE 
J075172D02TTGTGGGCTACTGGGCCATNONE 
J100047B13TTGTGGGCTACTGGGCCATNONE 
Os06g0226600006-083-D04TTGGCCCAGCNONE 
AK061806TTGGCCCAGCNONE 
AK102752TTGGCCCAGCTB2/DP1 and HVA22 related protein family protein. 
J013089J11TTGGCCCAGCNONE 
J033106M05TTGGCCCAGCNONE 
J100044M21TTGGCCCAGCNONE 
J100056E06TTGGCCCAGCNONE 
J100059F06TTGGCCCAGCNONE 
Os06g0246500AK105105ATCTGGGCCACSimilar to Pyruvate dehydrogenase E1 alpha subunit (EC 1.2.4.1). 
Os06g0320500004-013-F05TTGGCCCAGCNONE 
006-021-B06TTGGCCCAGCNONE 
006-021-D12TTGGCCCAGCNONE 
006-022-A12TTGGCCCAGCNONE 
006-024-B10TTGGCCCAGCNONE 
006-029-F07TTGGCCCAGCNONE 
006-029-H12TTGGCCCAGCNONE 
006-031-A05TTGGCCCAGCNONE 
006-033-C03TTGGCCCAGCNONE 
006-036-B12TTGGCCCAGCNONE 
006-048-C08TTGGCCCAGCNONE 
006-050-F03TTGGCCCAGCNONE 
006-051-C12TTGGCCCAGCNONE 
006-054-C03TTGGCCCAGCNONE 
006-057-D12TTGGCCCAGCNONE 
006-067-F01TTGGCCCAGCNONE 
006-071-G12TTGGCCCAGCNONE 
006-072-G11TTGGCCCAGCNONE 
006-072-H01TTGGCCCAGCNONE 
006-081-E02TTGGCCCAGCNONE 
006-082-A11TTGGCCCAGCNONE 
006-084-A04TTGGCCCAGCNONE 
006-085-C08TTGGCCCAGCNONE 
006-086-D03TTGGCCCAGCNONE 
006-088-B05TTGGCCCAGCNONE 
006-088-G02TTGGCCCAGCNONE 
006-092-G10TTGGCCCAGCNONE 
006-094-D11TTGGCCCAGCNONE 
006-094-E04TTGGCCCAGCNONE 
006-103-G12TTGGCCCAGCNONE 
006-106-G08TTGGCCCAGCNONE 
006-111-E06TTGGCCCAGCNONE 
006-114-C07TTGGCCCAGCNONE 
006-115-A04TTGGCCCAGCNONE 
006-117-G11TTGGCCCAGCNONE 
006-118-G09TTGGCCCAGCNONE 
009-010-F03TTGGCCCAGCNONE 
009-076-G01TTGGCCCAGCNONE 
009-134-E10TTGGCCCAGCNONE 
009-193-D07TTGGCCCAGCNONE 
AF094776TTGGCCCAGCNONE 
AK060904TTGGCCCAGCSimilar to Light-harvesting complex I (Fragment). 
AK098864TTGGCCCAGCNONE 
J013001A03TTGGCCCAGCNONE 
J013098P14TTGGCCCAGCNONE 
J013127B16TTGGCCCAGCNONE 
J013169J24TTGGCCCAGCNONE 
J023084H23TTGGCCCAGCNONE 
J023093F05TTGGCCCAGCNONE 
J033041I05TTGGCCCAGCNONE 
J065196G15TTGGCCCAGCNONE 
J075019K01TTGGCCCAGCNONE 
J075053H16TTGGCCCAGCNONE 
J075055M09TTGGCCCAGCNONE 
J075099G10TTGGCCCAGCNONE 
J075099L23TTGGCCCAGCNONE 
J075127I09TTGGCCCAGCNONE 
J080001C14TTGGCCCAGCNONE 
J080016B11TTGGCCCAGCNONE 
J080029C14TTGGCCCAGCNONE 
J080029I17TTGGCCCAGCNONE 
J080034F13TTGGCCCAGCNONE 
J080039E02TTGGCCCAGCNONE 
J080040N05TTGGCCCAGCNONE 
J080042O17TTGGCCCAGCNONE 
J080043N15TTGGCCCAGCNONE 
J080056K02TTGGCCCAGCNONE 
J080063N15TTGGCCCAGCNONE 
J080069H05TTGGCCCAGCNONE 
J080070N15TTGGCCCAGCNONE 
J080075J22TTGGCCCAGCNONE 
J080076F12TTGGCCCAGCNONE 
J080086G05TTGGCCCAGCNONE 
J090046G07TTGGCCCAGCNONE 
J090059H01TTGGCCCAGCNONE 
J090099C09TTGGCCCAGCNONE 
J100028E12TTGGCCCAGCNONE 
J100048J04TTGGCCCAGCNONE 
J100054O05TTGGCCCAGCNONE 
J100062C09TTGGCCCAGCNONE 
J100075C17TTGGCCCAGCNONE 
J100075C23TTGGCCCAGCNONE 
J100075I23TTGGCCCAGCNONE 
Os06g0564700AK070508GCTGGGCCATSimilar to Cysteine synthase (EC 4.2.99.8). 
J023050D23GCTGGGCCATNONE 
Os06g0701400013-010-G06CTGGCCCAGANONE 
013-010-G06GGCTGGGCCAANONE 
AK121229CTGGCCCAGASimilar to 60S acidic ribosomal protein P3 (P1/P2-like) (P3A). 
AK121229GGCTGGGCCAASimilar to 60S acidic ribosomal protein P3 (P1/P2-like) (P3A). 
J023091M16CTGGCCCAGANONE 
J023091M16GGCTGGGCCAANONE 
J033023L12CTGGCCCAGANONE 
J033023L12GGCTGGGCCAANONE 
J065043I07CTGGCCCAGANONE 
J065043I07GGCTGGGCCAANONE 
J065049E09CTGGCCCAGANONE 
J065049E09GGCTGGGCCAANONE 
J065054I05CTGGCCCAGANONE 
J065054I05GGCTGGGCCAANONE 
J065072H13CTGGCCCAGANONE 
J065072H13GGCTGGGCCAANONE 
J065073L10CTGGCCCAGANONE 
J065073L10GGCTGGGCCAANONE 
J065079P09CTGGCCCAGANONE 
J065079P09GGCTGGGCCAANONE 
J065112I06CTGGCCCAGANONE 
J065112I06GGCTGGGCCAANONE 
J065167C03CTGGCCCAGANONE 
J065167C03GGCTGGGCCAANONE 
J065167I03CTGGCCCAGANONE 
J065167I03GGCTGGGCCAANONE 
J065176P13CTGGCCCAGANONE 
J065176P13GGCTGGGCCAANONE 
J065205M07CTGGCCCAGANONE 
J065205M07GGCTGGGCCAANONE 
J075018E13CTGGCCCAGANONE 
J075018E13GGCTGGGCCAANONE 
J075021E04CTGGCCCAGANONE 
J075021E04GGCTGGGCCAANONE 
J075038F13CTGGCCCAGANONE 
J075038F13GGCTGGGCCAANONE 
J075051E05CTGGCCCAGANONE 
J075051E05GGCTGGGCCAANONE 
J075067C10CTGGCCCAGANONE 
J075067C10GGCTGGGCCAANONE 
J075079A12CTGGCCCAGANONE 
J075079A12GGCTGGGCCAANONE 
J075084A13CTGGCCCAGANONE 
J075084A13GGCTGGGCCAANONE 
J075103E20CTGGCCCAGANONE 
J075103E20GGCTGGGCCAANONE 
J075116E09CTGGCCCAGANONE 
J075116E09GGCTGGGCCAANONE 
J075118F15CTGGCCCAGANONE 
J075118F15GGCTGGGCCAANONE 
J075121I15CTGGCCCAGANONE 
J075121I15GGCTGGGCCAANONE 
J075129B01CTGGCCCAGANONE 
J075129B01GGCTGGGCCAANONE 
J075138A22CTGGCCCAGANONE 
J075138A22GGCTGGGCCAANONE 
J075159B22CTGGCCCAGANONE 
J075159B22GGCTGGGCCAANONE 
J075165I11CTGGCCCAGANONE 
J075165I11GGCTGGGCCAANONE 
J075186E09CTGGCCCAGANONE 
J075186E09GGCTGGGCCAANONE 
J075190J09CTGGCCCAGANONE 
J075190J09GGCTGGGCCAANONE 
J075191I07CTGGCCCAGANONE 
J075191I07GGCTGGGCCAANONE 
J080301C05CTGGCCCAGANONE 
J080301C05GGCTGGGCCAANONE 
J080302L02CTGGCCCAGANONE 
J080302L02GGCTGGGCCAANONE 
J100035C19CTGGCCCAGANONE 
J100035C19GGCTGGGCCAANONE 
J100059P06CTGGCCCAGANONE 
J100059P06GGCTGGGCCAANONE 
Os06g0702800009-039-E05ATGGCCCAGAAGGCCCACCANONE 
AK073948ATGGCCCAGAAGGCCCACCAHypothetical protein. 
J023108K23ATGGCCCAGAAGGCCCACCANONE 
J033072H04ATGGCCCAGAAGGCCCACCANONE 
J065008G05ATGGCCCAGAAGGCCCACCANONE 
J065128J12ATGGCCCAGAAGGCCCACCANONE 
J065131A01ATGGCCCAGAAGGCCCACCANONE 
J065173B12ATGGCCCAGAAGGCCCACCANONE 
Os06g0707200006-022-G09GCTGGGCCACNONE 
AK059411GCTGGGCCACNONE 
AK071568GCTGGGCCACProtein of unknown function DUF563 family protein. 
J065101E21GCTGGGCCACNONE 
Os07g0112600AK109561GTGGCCCAGCCConserved hypothetical protein. 
Os07g0112800AK058206TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGSimilar to Eukaryotic translation initiation factor 5A-4 (eIF-5A-4). 
J023052P13TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGNONE 
J033064G11TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGNONE 
J065044F12TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGNONE 
J065047I05TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGNONE 
J065059P17TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGNONE 
J065180P17TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGNONE 
J075131M22TGATGGGCCTGATCTGGGCCACTTTGGGCCTTGNONE 
Os07g0164100AK111557TCTGGCCCAGTTHistone deacetylase superfamily protein. 
Os07g0164200009-038-C11AACTGGGCCAGANONE 
AK059382AACTGGGCCAGATranslation factor domain containing protein. 
AK107096AACTGGGCCAGANONE 
Os07g0191000AK071379TTGGCCCAGAInositol monophosphatase family protein. 
AK103440TTGGCCCAGANONE 
Os07g0205700AK120553CTGGCCCAGTSimilar to Xaa-Pro dipeptidase (EC 3.4.-.-). 
J065022J24CTGGCCCAGTNONE 
Os07g0300900AK061941TCTGGGCCAASimilar to Lysine-sensitive aspartate kinase. 
AK102162TCTGGGCCAANONE 
Os07g0410300AK108503ATCTGGGCCACPathogenesis-related transcriptional factor and ERF domain containing protein. 
Os07g0438800AK060412GTGGCCCAGGNONE 
AK100065GTGGCCCAGGSimilar to Phosphate starvation regulator protein (Regulatory protein of P- starvation acclimation response Psr1). 
AK103195GTGGCCCAGGNONE 
AY224478GTGGCCCAGGNONE 
J013160O05GTGGCCCAGGNONE 
J023030C05GTGGCCCAGGNONE 
J033025O04GTGGCCCAGGNONE 
J033121P15GTGGCCCAGGNONE 
J043034I23GTGGCCCAGGNONE 
J065022N01GTGGCCCAGGNONE 
J065022N02GTGGCCCAGGNONE 
J065023M01GTGGCCCAGGNONE 
J065101G13GTGGCCCAGGNONE 
J075058P13GTGGCCCAGGNONE 
J075186K10GTGGCCCAGGNONE 
J075199F17GTGGCCCAGGNONE 
Os07g0472400AK105684GCTGGGCCAAATGGGCProtein kinase domain containing protein. 
Os07g0498900AK073263ATGGCCCAGCProtein of unknown function DUF231, plant domain containing protein. 
J033024K20ATGGCCCAGCNONE 
J065207I19ATGGCCCAGCNONE 
Os07g0506700AK073959CTGGCCCAGGWD40-like domain containing protein. 
Os07g0541500AK111550CTGGCCCAGCSimilar to KI domain interacting kinase 1. 
Os07g0541600AK110523CTGGCCCAGCHypothetical protein. 
Os07g0546000AF188065ATGGCCCAGATNONE 
AK061800ATGGCCCAGATNONE 
AK065871ATGGCCCAGATSimilar to Isopentenyl pyrophosphate:dimethyllallyl pyrophosphate isomerase (EC 5.3.3.2) (Fragment). 
J013024C02ATGGCCCAGATNONE 
J013035F03ATGGCCCAGATNONE 
J013044J20ATGGCCCAGATNONE 
Os07g0564400Os07g0564400GTGGCCCAGTTNucleic acid-binding, OB-fold domain containing protein. 
Os07g0621300006-055-E10CTGGCCCAGTTNONE 
AK059824CTGGCCCAGTTNONE 
AK071567CTGGCCCAGTTGRAM domain containing protein. 
Os07g0647800AK102332TCTGGGCCAGConserved hypothetical protein. 
Os07g0689300AK068511TCTGGGCCACNONE 
J013153J24TCTGGGCCACNONE 
Os07g0695100AB189039GTGGCCCAGCNONE 
AB189042GTGGCCCAGCNONE 
AK059514GTGGCCCAGCNONE 
AK066112GTGGCCCAGCCheY-like domain containing protein. 
J013051N02GTGGCCCAGCNONE 
J013127M02GTGGCCCAGCNONE 
J023007I05GTGGCCCAGCNONE 
Os08g0119500J080315K03TCTGGGCCACMethyltransferase type 11 domain containing protein. 
Os08g0126700AK111805AACTGGGCCAANONE 
AK111902AACTGGGCCAAZinc finger, CCCH-type domain containing protein. 
Os08g0129700AB099292CTGGCCCAGANONE 
AK065715CTGGCCCAGAUDP-glucose 4-epimerase family protein. 
AK099222CTGGCCCAGANONE 
J013041C03CTGGCCCAGANONE 
J023061B05CTGGCCCAGANONE 
J033036N10CTGGCCCAGANONE 
Os08g0172300AK111274TTGGCCCAGCHAT dimerisation domain containing protein. 
J065184J06TTGGCCCAGCNONE 
Os08g0234400J065186B17GGCCGTCCACGTGGCCCAGCConserved hypothetical protein. 
Os08g0323400006-027-G07TTGGCCCAGCNONE 
009-152-D11TTGGCCCAGCNONE 
009-160-B08TTGGCCCAGCNONE 
AK068722TTGGCCCAGCSimilar to Rubredoxin (Rd). 
AK104226TTGGCCCAGCNONE 
J065086N20TTGGCCCAGCNONE 
J065138B16TTGGCCCAGCNONE 
J065138O10TTGGCCCAGCNONE 
J075089M06TTGGCCCAGCNONE 
Os08g0414300AK072217ATGGCCCAGCCConserved hypothetical protein. 
J065039C07ATGGCCCAGCCNONE 
J065098N11ATGGCCCAGCCNONE 
J065120J15ATGGCCCAGCCNONE 
J075076H12ATGGCCCAGCCNONE 
J075101N16ATGGCCCAGCCNONE 
J080010A07ATGGCCCAGCCNONE 
J080023C16ATGGCCCAGCCNONE 
J080027G22ATGGCCCAGCCNONE 
J080053D02ATGGCCCAGCCNONE 
J080065E17ATGGCCCAGCCNONE 
J080068C15ATGGCCCAGCCNONE 
J090061J10ATGGCCCAGCCNONE 
Os08g0442300006-067-F05GCTGGGCCAGGCCGGGCCGGANONE 
AK059843GCTGGGCCAGGCCGGGCCGGANONE 
AK071719GCTGGGCCAGGCCGGGCCGGASimilar to Calcineurin-like protein. 
AK102411GCTGGGCCAGGCCGGGCCGGANONE 
J023108H11GCTGGGCCAGGCCGGGCCGGANONE 
J033092P05GCTGGGCCAGGCCGGGCCGGANONE 
J075109C09GCTGGGCCAGGCCGGGCCGGANONE 
J090070B02GCTGGGCCAGGCCGGGCCGGANONE 
J090076M14GCTGGGCCAGGCCGGGCCGGANONE 
J100064B16GCTGGGCCAGGCCGGGCCGGANONE 
Os08g0495300Os08g0495300TTGGCCCAGAConserved hypothetical protein. 
Os08g0529400J100040D07ATGGCCCAGCCyclin-like F-box domain containing protein. 
Os08g0542100AK058490AACTGGGCCACRibosomal protein L7, eukaryotic form family protein. 
AK058490AACTGGGCCACRibosomal protein L7, eukaryotic form family protein. 
AK101416AACTGGGCCACNONE 
AK101416AACTGGGCCACNONE 
J033037N08AACTGGGCCACNONE 
J033037N08AACTGGGCCACNONE 
J033086B16AACTGGGCCACNONE 
J033086B16AACTGGGCCACNONE 
J043036J02AACTGGGCCACNONE 
J043036J02AACTGGGCCACNONE 
J065137E02AACTGGGCCACNONE 
J065137E02AACTGGGCCACNONE 
J090015L07AACTGGGCCACNONE 
J090015L07AACTGGGCCACNONE 
J100036D02AACTGGGCCACNONE 
J100036D02AACTGGGCCACNONE 
Os08g0565800009-034-G02AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCANONE 
009-111-D12AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCANONE 
AK062431AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCASimilar to Glutaredoxin. 
AK062820AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCANONE 
J075022E05AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCANONE 
J075066F07AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCANONE 
J075146B21AATGGGCCGCACCGCACGGCCCATTGGCCCAGCCCATCANONE 
Os09g0112400AK109186CAAGCCCATAAGCCCAATTGGCCCAGCCCAACCSimilar to DCL protein, chloroplast precursor (Defective chloroplasts and leaves protein). 
Os09g0120033AK069069TTGGCCCAGCCConserved hypothetical protein. 
Os09g0338400AK059171GTGGCCCAGTTNONE 
AK068798GTGGCCCAGTTNONE 
AK072043GTGGCCCAGTTNONE 
AK098947GTGGCCCAGTTSimilar to Cysteine desulfurase, mitochondrial precursor (EC 2.8.1.7) (m-Nfs1). 
Os09g0385300AK073247AATTGGGCCTGGGCCATHypothetical protein. 
AK120455AATTGGGCCTGGGCCATNONE 
J013104G23AATTGGGCCTGGGCCATNONE 
J023110A14AATTGGGCCTGGGCCATNONE 
J033143F07AATTGGGCCTGGGCCATNONE 
J065036P14AATTGGGCCTGGGCCATNONE 
J065041I11AATTGGGCCTGGGCCATNONE 
J065103K11AATTGGGCCTGGGCCATNONE 
J065138M15AATTGGGCCTGGGCCATNONE 
J065138P09AATTGGGCCTGGGCCATNONE 
J065141J20AATTGGGCCTGGGCCATNONE 
J075063J16AATTGGGCCTGGGCCATNONE 
J075063K19AATTGGGCCTGGGCCATNONE 
J075085H08AATTGGGCCTGGGCCATNONE 
J075093C12AATTGGGCCTGGGCCATNONE 
J075127N08AATTGGGCCTGGGCCATNONE 
J075134E09AATTGGGCCTGGGCCATNONE 
J075166D06AATTGGGCCTGGGCCATNONE 
J075168K24AATTGGGCCTGGGCCATNONE 
J075197G05AATTGGGCCTGGGCCATNONE 
J080034J24AATTGGGCCTGGGCCATNONE 
Os09g0534000AK100026CTGGCCCAGCConserved hypothetical protein. 
Os09g0545700009-127-C10TCTGGGCCATNONE 
AK062898TCTGGGCCATSimilar to Auxin induced protein. 
Os09g0554000J065123C23CCTGGGCCATSimilar to Mitochondrial phosphate transporter. 
J065123C23CTGGCCCAGCSimilar to Mitochondrial phosphate transporter. 
Os11g0233900J065063O08CCTGGGCCATHypothetical protein. 
Os11g0256000J065001O05TTGGCCCAGCAcetolactate synthase, small subunit family protein. 
J065019G09TTGGCCCAGCNONE 
J065039G02TTGGCCCAGCNONE 
J065054A11TTGGCCCAGCNONE 
J065059K07TTGGCCCAGCNONE 
J065077D22TTGGCCCAGCNONE 
Os11g0417700J075031P16CCTGGGCCATConserved hypothetical protein. 
J075034C16CCTGGGCCATNONE 
J075034J22CCTGGGCCATNONE 
J075042C07CCTGGGCCATNONE 
J075046O07CCTGGGCCATNONE 
J075062O13CCTGGGCCATNONE 
J075091G08CCTGGGCCATNONE 
J075135H20CCTGGGCCATNONE 
J075172B13CCTGGGCCATNONE 
J075179G14CCTGGGCCATNONE 
Os11g0423200AK111297ATGGCCCAGCHypothetical protein. 
Os11g0484300AK121422AACTGGGCCAGASimilar to Mcm2-prov protein. 
Os11g0587100J065046D15GCTGGGCCATProtein prenyltransferase domain containing protein. 
Os12g0109600AK107606TCTGGGCCGACGGCCCATGGCCCAGProtein of unknown function DUF1677, Oryza sativa family protein. 
J053026B13TCTGGGCCGACGGCCCATGGCCCAGNONE 
J053033C09TCTGGGCCGACGGCCCATGGCCCAGNONE 
J053059G21TCTGGGCCGACGGCCCATGGCCCAGNONE 
J053071A13TCTGGGCCGACGGCCCATGGCCCAGNONE 
J075007L19TCTGGGCCGACGGCCCATGGCCCAGNONE 
J075071J20TCTGGGCCGACGGCCCATGGCCCAGNONE 
J075110F18TCTGGGCCGACGGCCCATGGCCCAGNONE 
Os12g0145200AK111428CTGGCCCAGASimilar to Protein MONOCULM 1. 
J065208D22CTGGCCCAGANONE 
Os12g0233500Os12g0233500TTGGCCCAGANONE 
Os12g0516300AK065092ATCTGGGCCAGNONE 
J013001M05ATCTGGGCCAGNONE 
Os12g0550800006-091-A05ATGGCCCAGCNONE 
AK061828ATGGCCCAGCNONE 
AK098944ATGGCCCAGCNONE 
AK102550ATGGCCCAGCHypothetical protein. 
J013045G24ATGGCCCAGCNONE 
J065156K11ATGGCCCAGCNONE 
J065201E21ATGGCCCAGCNONE 
Os12g0565800AK072828GCTGGGCCACCGCACZinc finger, TTF-type domain containing protein. 
Os12g0569900Os12g0569900ACTGGGCCAGSimilar to Zn finger protein (Fragment). 
Os12g0628100AK121150GTGGCCCAGCCSimilar to Actin-depolymerizing factor 6 (ADF-6) (AtADF6). 
J023078I07GTGGCCCAGCCNONE 
J075153L01GTGGCCCAGCCNONE 
J100050C05GTGGCCCAGCCNONE 
Os12g0632000J080016B03CCTGGGCCACNONE 
J080071M07CCTGGGCCACNONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.