version

Summary of OsREG579 (All List)

OrganismOryza sativa  
IDOsREG579  
SequenceCTGGGCCC  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count1421  

Entry Sequences (1421 entries)

LocusGene modelSequenceDescription
Os01g0138900AK058378TGTGGGGCCCAGTAMandelate racemase/muconate lactonizing enzyme family protein. 
Os01g0145200J100017K24CAAGTGGGCCCAGTANONE 
Os01g0159800015-032-D03AGTGGGCCCAGGNONE 
AK106292AGTGGGCCCAGGBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
J053031O06AGTGGGCCCAGGNONE 
J053035H22AGTGGGCCCAGGNONE 
J065095A07AGTGGGCCCAGGNONE 
J100017I21AGTGGGCCCAGGNONE 
Os01g0180300AK120377GCTGGGCTGGGCCCACACLipoprotein, type 6 family protein. 
J013071N06GCTGGGCTGGGCCCACACNONE 
J023088F12GCTGGGCTGGGCCCACACNONE 
J100027H24GCTGGGCTGGGCCCACACNONE 
J100053K15GCTGGGCTGGGCCCACACNONE 
J100082M15GCTGGGCTGGGCCCACACNONE 
Os01g0218700J065010O15TGGGGCCCAGTNONE 
Os01g0253500J100088F12TCTGGGCCCACGAConserved hypothetical protein. 
Os01g0332100AK120720CAGGTGGGCCCAGCSimilar to Neutral invertase-like protein (Fragment). 
AY187621CAGGTGGGCCCAGCNONE 
J080021I24CAGGTGGGCCCAGCNONE 
Os01g0372100J075029A10CCTGGGCCCACAConserved hypothetical protein. 
Os01g0391100012-001-B05CCTGGGCCCACTTGNONE 
012-053-F01CCTGGGCCCACTTGNONE 
AK063499CCTGGGCCCACTTGNONE 
J065021A04CCTGGGCCCACTTGNONE 
J065076H06CCTGGGCCCACTTGNONE 
J065181E05CCTGGGCCCACTTGNONE 
J065187A05CCTGGGCCCACTTGNONE 
J075036C17CCTGGGCCCACTTGNONE 
J075051C18CCTGGGCCCACTTGNONE 
J075063L16CCTGGGCCCACTTGNONE 
J075079M08CCTGGGCCCACTTGNONE 
J075112H15CCTGGGCCCACTTGNONE 
J075135F10CCTGGGCCCACTTGNONE 
J075164H06CCTGGGCCCACTTGNONE 
J075195N02CCTGGGCCCACTTGNONE 
Os01g0530366J075001P06AACGGGCCCAGTTNONE 
J075006K21AACGGGCCCAGTTRNA polymerase Rbp10 domain containing protein. 
J075030G13AACGGGCCCAGTTNONE 
Os01g0549400AK122104ATCTGGGCCCAGASimilar to RNA helicase-like protein DB10. 
Os01g0558500AK099982TAATGGGCTTTTGGGCCCAGCCPWWP domain containing protein. 
J065096J12TAATGGGCTTTTGGGCCCAGCCNONE 
Os01g0596300016-083-D09AGTGGGCCCAGTNONE 
AK069151AGTGGGCCCAGTCyclin-like F-box domain containing protein. 
J023007D17AGTGGGCCCAGTNONE 
J065141M02AGTGGGCCCAGTNONE 
Os01g0688200AK120982ACTGGGCCCAATAlpha/beta hydrolase family protein. 
AK120982TAAGCCCATCTGGGCCCAACAAlpha/beta hydrolase family protein. 
Os01g0691500AK073675AGTGGGCCCAGGNONE 
AK107426AGTGGGCCCAGGCytidylyltransferase domain containing protein. 
J013055P17AGTGGGCCCAGGNONE 
J033050M21AGTGGGCCCAGGNONE 
Os01g0691600AK103297CCTGGGCCCACTSimilar to DNA repair helicase XPB2 (EC 3.6.1.-) (XPB homolog 2) (ERCC3 homolog 2) (RAD25 homolog 2) (AtXPB2). 
Os01g0710000AK111794AAATGGGCCCAGCCCACASimilar to WD-repeat protein RBAP1. 
J023006D22AAATGGGCCCAGCCCACANONE 
J065106P04AAATGGGCCCAGCCCACANONE 
J100036G13AAATGGGCCCAGCCCACANONE 
Os01g0729900AK064793CGGGCCCAGGNONE 
AK065503CGGGCCCAGGConserved hypothetical protein. 
AK104681CGGGCCCAGGNONE 
AK120504CGGGCCCAGGNONE 
Os01g0748600AK104674GGGGCCCAGCNONE 
Os01g0827200AK073922CCTGGGCCCCANONE 
AK120476CCTGGGCCCCAPhox-like domain containing protein. 
Os01g0844800AK099801CCACCAACTGGGCCCCACASimilar to Pumilio RBD (Fragment). 
AK102882CCACCAACTGGGCCCCACANONE 
AK103686CCACCAACTGGGCCCCACANONE 
Os01g0844900AK066659GCTGGGCCCCHomeodomain-like containing protein. 
Os01g0856500AK103981TGGATGGGCTACTGGGCCCGNONE 
Os01g0911700012-079-H01AGTGGGCCCAGANONE 
012-088-G05AGTGGGCCCAGANONE 
012-099-A01AGTGGGCCCAGANONE 
015-009-H07AGTGGGCCCAGANONE 
015-035-H12AGTGGGCCCAGANONE 
016-054-G03AGTGGGCCCAGANONE 
AK073805AGTGGGCCCAGASimilar to Regulatory protein viviparous-1. 
AK105441AGTGGGCCCAGANONE 
J033069I02AGTGGGCCCAGANONE 
J033086K01AGTGGGCCCAGANONE 
Os01g0913800011-060-B02AACTGGGCCCACCANONE 
016-088-H02AACTGGGCCCACCAProtein prenyltransferase domain containing protein. 
Os01g0931300012-055-E05CCTGGGCCCCACANONE 
AK068196CCTGGGCCCCACATafazzin family protein. 
AK099213CCTGGGCCCCACANONE 
Os01g0934300AK072640CCTGGGCCCCACNONE 
J013073H18CCTGGGCCCCACNONE 
J023133P13CCTGGGCCCCACNONE 
J075098G20CCTGGGCCCCACNONE 
Os01g0952600AK067525CAGGTGGGGCCCAGATNONE 
AK070047CAGGTGGGGCCCAGATSimilar to LacZ (Fragment). 
Os01g0965800AK107795AACTGGGCCCCACTCTConserved hypothetical protein. 
Os02g0120000AK067383AACTGGGCCCCAProtein prenyltransferase domain containing protein. 
AK101590AACTGGGCCCCANONE 
J013100B15AACTGGGCCCCANONE 
Os02g0140200AK066454ATTGGGCCCAGGCCCGCASimilar to Beta-amyrin synthase. 
Os02g0169300006-023-D12ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
006-062-B01ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
015-049-F11ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
015-057-G02ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
015-092-F04ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
015-095-H02ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
015-097-B07ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
AK070041ATCTGGGCCCCACGCCTCCCGGCCCCACASimilar to Phosphoglycerate kinase, cytosolic (EC 2.7.2.3). 
J013042K07ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J013134H23ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J013134J23ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J023036N24ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J023049C06ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J023077E10ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J023077F10ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J023105N12ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J033036O12ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J033064P11ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J033079F01ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J033123M22ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J033143E10ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
J075013D12ATCTGGGCCCCACGCCTCCCGGCCCCACANONE 
Os02g0178400009-151-B08AACTGGGCCCACTNONE 
AK063815AACTGGGCCCACTProtein transport protein SEC61 gamma subunit. 
AK121516AACTGGGCCCACTNONE 
J033026A17AACTGGGCCCACTNONE 
J065011K14AACTGGGCCCACTNONE 
J065056D01AACTGGGCCCACTNONE 
J065061L22AACTGGGCCCACTNONE 
J065076M01AACTGGGCCCACTNONE 
J075092E14AACTGGGCCCACTNONE 
Os02g0202600AK068376ACTGGGCCCCACCTGNONE 
AK099277ACTGGGCCCCACCTGNONE 
AK101844ACTGGGCCCCACCTGTetratricopeptide-like helical domain containing protein. 
J080001G13ACTGGGCCCCACCTGNONE 
J080011J23ACTGGGCCCCACCTGNONE 
J080015F12ACTGGGCCCCACCTGNONE 
J080017J03ACTGGGCCCCACCTGNONE 
J080030J24ACTGGGCCCCACCTGNONE 
J080038H02ACTGGGCCCCACCTGNONE 
J080041G13ACTGGGCCCCACCTGNONE 
J080044B13ACTGGGCCCCACCTGNONE 
J080044L10ACTGGGCCCCACCTGNONE 
J080046H11ACTGGGCCCCACCTGNONE 
J080057J01ACTGGGCCCCACCTGNONE 
J080062E13ACTGGGCCCCACCTGNONE 
J080062N11ACTGGGCCCCACCTGNONE 
J080063C17ACTGGGCCCCACCTGNONE 
J080064K11ACTGGGCCCCACCTGNONE 
J080064N09ACTGGGCCCCACCTGNONE 
J080067C17ACTGGGCCCCACCTGNONE 
J080067C23ACTGGGCCCCACCTGNONE 
J080069J21ACTGGGCCCCACCTGNONE 
J080070L23ACTGGGCCCCACCTGNONE 
J080085N15ACTGGGCCCCACCTGNONE 
J080094F03ACTGGGCCCCACCTGNONE 
Os02g0502500011-068-G11GCTGGGCCCACGTGTCNONE 
AK100111GCTGGGCCCACGTGTCNONE 
AK100315GCTGGGCCCACGTGTCProtein kinase-like domain containing protein. 
J013074C19GCTGGGCCCACGTGTCNONE 
J013153K16GCTGGGCCCACGTGTCNONE 
J023078O21GCTGGGCCCACGTGTCNONE 
J033127M18GCTGGGCCCACGTGTCNONE 
J043038D17GCTGGGCCCACGTGTCNONE 
J065090L08GCTGGGCCCACGTGTCNONE 
J065110P16GCTGGGCCCACGTGTCNONE 
J065163C03GCTGGGCCCACGTGTCNONE 
J065213D23GCTGGGCCCACGTGTCNONE 
J090010M14GCTGGGCCCACGTGTCNONE 
J090016E02GCTGGGCCCACGTGTCNONE 
J090044J20GCTGGGCCCACGTGTCNONE 
J090091M16GCTGGGCCCACGTGTCNONE 
J090099I23GCTGGGCCCACGTGTCNONE 
Os02g0510100AK058487ATCTGGGCCCGCNONE 
AK122107ATCTGGGCCCGCSimilar to U6 snRNA-associated Sm-like protein LSm6 (Sm protein F). 
J033126F06ATCTGGGCCCGCNONE 
J053077L04ATCTGGGCCCGCNONE 
J065010C11ATCTGGGCCCGCNONE 
J075104O14ATCTGGGCCCGCNONE 
J080003G03ATCTGGGCCCGCNONE 
J080014K05ATCTGGGCCCGCNONE 
J080026F03ATCTGGGCCCGCNONE 
J080027O05ATCTGGGCCCGCNONE 
J080037K15ATCTGGGCCCGCNONE 
J080039D24ATCTGGGCCCGCNONE 
J080043G19ATCTGGGCCCGCNONE 
J080047P05ATCTGGGCCCGCNONE 
J080048D22ATCTGGGCCCGCNONE 
J080049F23ATCTGGGCCCGCNONE 
J080062A21ATCTGGGCCCGCNONE 
J080063H20ATCTGGGCCCGCNONE 
J080067P15ATCTGGGCCCGCNONE 
J080068P19ATCTGGGCCCGCNONE 
J080079J15ATCTGGGCCCGCNONE 
J080092K19ATCTGGGCCCGCNONE 
J080096M04ATCTGGGCCCGCNONE 
Os02g0586900013-044-D08AACGGGCCCAGANONE 
014-087-D07AACGGGCCCAGANONE 
AK063583AACGGGCCCAGASimilar to Glycine rich protein (Fragment). 
AK105378AACGGGCCCAGANONE 
Os02g0614400016-088-D04GCTGGGCCCTNONE 
AK071805GCTGGGCCCTConserved hypothetical protein. 
J023108N22GCTGGGCCCTNONE 
Os02g0638000AK103830AGATGGGCCCAGCNONE 
AK106548AGATGGGCCCAGCConserved hypothetical protein. 
Os02g0673600009-071-C12AGGGCCCAGANONE 
J023037G24AGGGCCCAGANONE 
J023038E07AGGGCCCAGAORMDL family protein. 
J023142L24AGGGCCCAGANONE 
J033115B14AGGGCCCAGANONE 
J075004B15AGGGCCCAGANONE 
J075067J21AGGGCCCAGANONE 
J075072K07AGGGCCCAGANONE 
J075147H21AGGGCCCAGANONE 
J075154F03AGGGCCCAGANONE 
Os02g0717100014-089-G06TTATGGGCCCAGATNONE 
AK063741TTATGGGCCCAGATEsterase/lipase/thioesterase domain containing protein. 
J065052A22TTATGGGCCCAGATNONE 
Os02g0753000AK121015GCTGGGCCCACTCCSimilar to Trehalose-6-phosphate phosphatase. 
Os02g0775200AB038319AAATGGGCTGGGCCCATANONE 
AK069984AAATGGGCTGGGCCCATASimilar to Activator 1 36 kDa subunit (Replication factor C 36 kDa subunit) (A1 36 kDa subunit) (RF-C 36 kDa subunit) (RFC36) (Replication factor C subunit 5). 
J065098G16AAATGGGCTGGGCCCATANONE 
Os02g0778200AK065948TCTGGGCCCCACCAminoacyl-tRNA synthetase, class I family protein. 
Os02g0780500AK072784GGGGCCCAGANONE 
AK121143GGGGCCCAGAConserved hypothetical protein. 
J023075M13GGGGCCCAGANONE 
J023077P14GGGGCCCAGANONE 
J023123C16GGGGCCCAGANONE 
J023142P06GGGGCCCAGANONE 
Os02g0810300AK059363AAATGGGCCAGGGCCCAGGSimilar to NBD-like protein. 
AK099203AAATGGGCCAGGGCCCAGGNONE 
Os02g0817600006-085-G03GACAGGTGGGGCCCAGGNONE 
AJ748648GACAGGTGGGGCCCAGGNONE 
AK069892GACAGGTGGGGCCCAGGAUX/IAA protein family protein. 
AK104501GACAGGTGGGGCCCAGGNONE 
AK104802GACAGGTGGGGCCCAGGNONE 
J013027H10GACAGGTGGGGCCCAGGNONE 
J013106L07GACAGGTGGGGCCCAGGNONE 
J013118N15GACAGGTGGGGCCCAGGNONE 
J013131H01GACAGGTGGGGCCCAGGNONE 
J013170C08GACAGGTGGGGCCCAGGNONE 
J023060C13GACAGGTGGGGCCCAGGNONE 
J033024K10GACAGGTGGGGCCCAGGNONE 
J033052I08GACAGGTGGGGCCCAGGNONE 
J090010H15GACAGGTGGGGCCCAGGNONE 
J090011J11GACAGGTGGGGCCCAGGNONE 
J090038P15GACAGGTGGGGCCCAGGNONE 
J090060B02GACAGGTGGGGCCCAGGNONE 
J100079J16GACAGGTGGGGCCCAGGNONE 
Os02g0823400AK105029ATCTGGGCCCACASimilar to S-adenosyl-L-methionine: beta-alanine N-methyltransferase (Fragment). 
J033140N12ATCTGGGCCCACANONE 
J075104C12ATCTGGGCCCACANONE 
J075120E03ATCTGGGCCCACANONE 
J075126M18ATCTGGGCCCACANONE 
J075189P21ATCTGGGCCCACANONE 
Os02g0830700AK101172AGGGCCCAGGCCCAACTLeucine rich repeat, N-terminal domain containing protein. 
Os03g0130700AK110670GGCTGGGCCCAACANONE 
Os03g0131400015-012-D11TCTGGGCCCATGANONE 
AK103714TCTGGGCCCATGAPoly-A polymerase/tRNA nucleotidyltransferase family protein. 
Os03g0131500AK109755TCATGGGCCCAGAVitamin K epoxide reductase domain containing protein. 
Os03g0181500AK100798CCTGGGCCCGCNONE 
Os03g0184100AK067400GGTGGGGCCCAGCHypothetical protein. 
J013030J24GGTGGGGCCCAGCNONE 
J013037M23GGTGGGGCCCAGCNONE 
J013106B15GGTGGGGCCCAGCNONE 
J013130H10GGTGGGGCCCAGCNONE 
J013152B03GGTGGGGCCCAGCNONE 
J013157J24GGTGGGGCCCAGCNONE 
J013157K04GGTGGGGCCCAGCNONE 
J033093A19GGTGGGGCCCAGCNONE 
J033106E24GGTGGGGCCCAGCNONE 
J090043G12GGTGGGGCCCAGCNONE 
Os03g0186800AK100356GGGGCCCAGTModifier of rudimentary, Modr family protein. 
Os03g0206400AK066494CCTGGGCCCCACConserved hypothetical protein. 
AK107011CCTGGGCCCCACNONE 
J065162G04CCTGGGCCCCACNONE 
Os03g0206600AK058618GCTGGGCCCACGCProtein of unknown function DUF588 family protein. 
Os03g0214400AK067931AGGGCCCAGGSimilar to Digalactosyldiacylglycerol synthase 2. 
Os03g0218200AK073971AGGGCCCAGCCyclin-like F-box domain containing protein. 
Os03g0255200AK058212GGTTGGGCTGGGCCCAATTNONE 
AK071625GGTTGGGCTGGGCCCAATTHeat shock protein DnaJ, N-terminal domain containing protein. 
Os03g0266000AK068775AACTGGGCCCCOvarian tumour, otubain domain containing protein. 
AK104949AACTGGGCCCCNONE 
J075149K24AACTGGGCCCCNONE 
J075184C19AACTGGGCCCCNONE 
Os03g0268300AK102684ATCTGGGCCCTSimilar to Digalactosyldiacylglycerol synthase 2. 
J013043J22ATCTGGGCCCTNONE 
J013057J23ATCTGGGCCCTNONE 
J013149I10ATCTGGGCCCTNONE 
J013149M20ATCTGGGCCCTNONE 
J013151D14ATCTGGGCCCTNONE 
J013162O11ATCTGGGCCCTNONE 
J023001F12ATCTGGGCCCTNONE 
J023031B21ATCTGGGCCCTNONE 
J023080A07ATCTGGGCCCTNONE 
J023081N04ATCTGGGCCCTNONE 
J023090C08ATCTGGGCCCTNONE 
J023134G05ATCTGGGCCCTNONE 
J023139G17ATCTGGGCCCTNONE 
J023143I10ATCTGGGCCCTNONE 
J023147D04ATCTGGGCCCTNONE 
J023147O15ATCTGGGCCCTNONE 
J033102K23ATCTGGGCCCTNONE 
J033106C17ATCTGGGCCCTNONE 
J075033G19ATCTGGGCCCTNONE 
J075039J18ATCTGGGCCCTNONE 
J075050K20ATCTGGGCCCTNONE 
J075075J03ATCTGGGCCCTNONE 
J075080E16ATCTGGGCCCTNONE 
J075086L08ATCTGGGCCCTNONE 
J075091K19ATCTGGGCCCTNONE 
J075099O20ATCTGGGCCCTNONE 
J075104I06ATCTGGGCCCTNONE 
J075137C16ATCTGGGCCCTNONE 
J075152G03ATCTGGGCCCTNONE 
J075176N12ATCTGGGCCCTNONE 
J100086K11ATCTGGGCCCTNONE 
Os03g0278400015-014-G10GCTGGGCCCGGGNONE 
AK070052GCTGGGCCCGGGSimilar to ADP ribosylation GTPase-like protein (Fragment). 
AY224461GCTGGGCCCGGGNONE 
J065218E15GCTGGGCCCGGGNONE 
J075115A06GCTGGGCCCGGGNONE 
J075134I05GCTGGGCCCGGGNONE 
J100032D08GCTGGGCCCGGGNONE 
J100044O13GCTGGGCCCGGGNONE 
J100051G15GCTGGGCCCGGGNONE 
J100052O21GCTGGGCCCGGGNONE 
J100071A12GCTGGGCCCGGGNONE 
Os03g0287900009-074-B07TCTGGGCCCAATANONE 
014-027-E07TCTGGGCCCAATANONE 
AK063663TCTGGGCCCAATASimilar to Protein disulfide isomerase. 
J065009N21TCTGGGCCCAATANONE 
Os03g0294200AK069285GCTGGGCCCACCTSimilar to Fructose-6-phosphate-2-kinase/fructose-2, 6-bisphosphatase. 
Os03g0370000AK100033CCTGGGCCCCACCACSimilar to Pyruvate dehydrogenase kinase isoform 1 (EC 2.7.1.99). 
Os03g0410700J065102A22AACTGGGCCCGNONE 
Os03g0410900J065067F10CGGGCCCAGTTNONE 
J065073D08CGGGCCCAGTTNONE 
J065176C06CGGGCCCAGTTNONE 
J065189O13CGGGCCCAGTTNONE 
J065214E05CGGGCCCAGTTNONE 
J080007H09CGGGCCCAGTTNONE 
J080012B19CGGGCCCAGTTNONE 
J080020J16CGGGCCCAGTTNONE 
J080038J22CGGGCCCAGTTNONE 
J080045I09CGGGCCCAGTTNONE 
J080059M16CGGGCCCAGTTNONE 
J080060C19CGGGCCCAGTTNONE 
J080080P22CGGGCCCAGTTNONE 
J080083C03CGGGCCCAGTTNONE 
J080093M17CGGGCCCAGTTNONE 
J100029F12CGGGCCCAGTTLike-Sm ribonucleoprotein, core family protein. 
Os03g0561249J065016H04CCTGGGCCCCConserved hypothetical protein. 
Os03g0570300AK069396GGGGCCCAGGTranslation protein SH3-like domain containing protein. 
J013036G06GGGGCCCAGGNONE 
J023014K13GGGGCCCAGGNONE 
Os03g0584300009-018-H09GGGCTTTTCTGGGCCCTNONE 
AK105133GGGCTTTTCTGGGCCCTProtein of unknown function UPF0136, Transmembrane family protein. 
J065053M11GGGCTTTTCTGGGCCCTNONE 
Os03g0604600J090093K23AGGGCCCAGTTConserved hypothetical protein. 
Os03g0643300AK099445CAAGTGGGCCCAGASimilar to AER123Wp. 
AK108010CAAGTGGGCCCAGANONE 
Os03g0648400005-003-D07CCCGGGCCCAGCNONE 
006-048-C12CCCGGGCCCAGCNONE 
006-049-A03CCCGGGCCCAGCNONE 
011-008-F07CCCGGGCCCAGCNONE 
011-039-A07CCCGGGCCCAGCNONE 
011-044-D10CCCGGGCCCAGCNONE 
011-099-C01CCCGGGCCCAGCNONE 
012-051-B09CCCGGGCCCAGCNONE 
012-051-D08CCCGGGCCCAGCNONE 
012-056-G07CCCGGGCCCAGCNONE 
012-062-A01CCCGGGCCCAGCNONE 
012-079-C03CCCGGGCCCAGCNONE 
014-003-A06CCCGGGCCCAGCNONE 
015-010-D02CCCGGGCCCAGCNONE 
AK102263CCCGGGCCCAGCSimilar to DnaJ protein homolog (DNAJ-1). 
AK103763CCCGGGCCCAGCNONE 
AK105028CCCGGGCCCAGCNONE 
AY224432CCCGGGCCCAGCNONE 
J013043H01CCCGGGCCCAGCNONE 
J013134K10CCCGGGCCCAGCNONE 
J023037D18CCCGGGCCCAGCNONE 
J023077K20CCCGGGCCCAGCNONE 
J023105M19CCCGGGCCCAGCNONE 
J023131M09CCCGGGCCCAGCNONE 
J033022F05CCCGGGCCCAGCNONE 
J033051J22CCCGGGCCCAGCNONE 
J033061D03CCCGGGCCCAGCNONE 
J033084H04CCCGGGCCCAGCNONE 
J033088M01CCCGGGCCCAGCNONE 
J033119H12CCCGGGCCCAGCNONE 
J033131C18CCCGGGCCCAGCNONE 
J043030C06CCCGGGCCCAGCNONE 
J080032A08CCCGGGCCCAGCNONE 
J090008C11CCCGGGCCCAGCNONE 
J090014D24CCCGGGCCCAGCNONE 
J090024C20CCCGGGCCCAGCNONE 
J090024H08CCCGGGCCCAGCNONE 
J090029F10CCCGGGCCCAGCNONE 
J090032K16CCCGGGCCCAGCNONE 
J090034L14CCCGGGCCCAGCNONE 
J090035C20CCCGGGCCCAGCNONE 
J090044H05CCCGGGCCCAGCNONE 
J090048M09CCCGGGCCCAGCNONE 
J090056I15CCCGGGCCCAGCNONE 
J090062B01CCCGGGCCCAGCNONE 
J090076F06CCCGGGCCCAGCNONE 
J090077A02CCCGGGCCCAGCNONE 
J090084E21CCCGGGCCCAGCNONE 
J090084J09CCCGGGCCCAGCNONE 
J090086G11CCCGGGCCCAGCNONE 
J090092C20CCCGGGCCCAGCNONE 
J100018G14CCCGGGCCCAGCNONE 
J100018I22CCCGGGCCCAGCNONE 
J100024N14CCCGGGCCCAGCNONE 
J100032K09CCCGGGCCCAGCNONE 
J100036F09CCCGGGCCCAGCNONE 
J100041M04CCCGGGCCCAGCNONE 
J100042H05CCCGGGCCCAGCNONE 
J100043P19CCCGGGCCCAGCNONE 
J100044B04CCCGGGCCCAGCNONE 
J100049L24CCCGGGCCCAGCNONE 
J100050M21CCCGGGCCCAGCNONE 
J100057F24CCCGGGCCCAGCNONE 
J100063I11CCCGGGCCCAGCNONE 
J100064J24CCCGGGCCCAGCNONE 
J100070B13CCCGGGCCCAGCNONE 
J100076A13CCCGGGCCCAGCNONE 
J100081C20CCCGGGCCCAGCNONE 
J100081L09CCCGGGCCCAGCNONE 
J100084G23CCCGGGCCCAGCNONE 
J100088H02CCCGGGCCCAGCNONE 
Os03g0669000AK067769GCTGGGCCCATTTSimilar to RNA helicase (Fragment). 
AK099820GCTGGGCCCATTTNONE 
Os03g0684400AK100086AACTGGGCCCCACCMg2+ transporter protein, CorA-like family protein. 
Os03g0712200AK073205AACTGGGCCCGGTTGGGCCAGZinc finger, RanBP2-type domain containing protein. 
AK098968AACTGGGCCCGGTTGGGCCAGNONE 
Os03g0712600015-008-G03TGGTGGGCCCAGANONE 
AK103705TGGTGGGCCCAGAHypothetical protein. 
J033136N14TGGTGGGCCCAGANONE 
Os03g0745600014-030-E09CCTGGGCCCCACANONE 
J053057E07CCTGGGCCCCACANONE 
J075044L08CCTGGGCCCCACANONE 
J075069C24CCTGGGCCCCACANONE 
J075127J02CCTGGGCCCCACAProtein of unknown function UPF0005 family protein. 
J075180G21CCTGGGCCCCACANONE 
J075189M22CCTGGGCCCCACANONE 
J075192P11CCTGGGCCCCACANONE 
Os03g0751400AK069033AGGGCCCAGASimilar to 50S ribosomal protein l6. 
J023004G24AGGGCCCAGANONE 
J065176D08AGGGCCCAGANONE 
Os03g0796600003-113-D10CCCGGGCCCAGCGCACCGCCACGTCNONE 
011-076-B12CCCGGGCCCAGCGCACCGCCACGTCNONE 
AK105257CCCGGGCCCAGCGCACCGCCACGTCProtein of unknown function DUF506, plant family protein. 
J075105C03CCCGGGCCCAGCGCACCGCCACGTCNONE 
J080036O17CCCGGGCCCAGCGCACCGCCACGTCNONE 
J080064E16CCCGGGCCCAGCGCACCGCCACGTCNONE 
J080069E03CCCGGGCCCAGCGCACCGCCACGTCNONE 
J080079E23CCCGGGCCCAGCGCACCGCCACGTCNONE 
J090036H20CCCGGGCCCAGCGCACCGCCACGTCNONE 
J100029L10CCCGGGCCCAGCGCACCGCCACGTCNONE 
J100055G09CCCGGGCCCAGCGCACCGCCACGTCNONE 
Os03g0798600AK121716TCTGGGCCCGSimilar to 40S ribosomal protein S15 (Fragment). 
J013120B18TCTGGGCCCGNONE 
J033079G18TCTGGGCCCGNONE 
J043038B19TCTGGGCCCGNONE 
J065091E15TCTGGGCCCGNONE 
J065092P10TCTGGGCCCGNONE 
J065189F18TCTGGGCCCGNONE 
J065189L12TCTGGGCCCGNONE 
J075021B11TCTGGGCCCGNONE 
J075022L15TCTGGGCCCGNONE 
J075046G12TCTGGGCCCGNONE 
J075080H15TCTGGGCCCGNONE 
J090045H01TCTGGGCCCGNONE 
J090077H16TCTGGGCCCGNONE 
J090083D22TCTGGGCCCGNONE 
J100021D24TCTGGGCCCGNONE 
J100023G04TCTGGGCCCGNONE 
J100049J23TCTGGGCCCGNONE 
J100075K23TCTGGGCCCGNONE 
J100077G22TCTGGGCCCGNONE 
Os03g0809300011-024-C02TATTGGGCCCAGATNONE 
016-071-E09TATTGGGCCCAGATNONE 
AK103140TATTGGGCCCAGATProtein phosphatase 2C-like domain containing protein. 
J013030O08TATTGGGCCCAGATNONE 
J013108D19TATTGGGCCCAGATNONE 
J013124D15TATTGGGCCCAGATNONE 
J013128F17TATTGGGCCCAGATNONE 
J013146J06TATTGGGCCCAGATNONE 
J013149D12TATTGGGCCCAGATNONE 
J013154P12TATTGGGCCCAGATNONE 
J013162N01TATTGGGCCCAGATNONE 
J013170G15TATTGGGCCCAGATNONE 
J013170H16TATTGGGCCCAGATNONE 
J023022I09TATTGGGCCCAGATNONE 
J023072B19TATTGGGCCCAGATNONE 
J023106H09TATTGGGCCCAGATNONE 
J023135C03TATTGGGCCCAGATNONE 
J023141C09TATTGGGCCCAGATNONE 
J033091K23TATTGGGCCCAGATNONE 
J033107I05TATTGGGCCCAGATNONE 
J033112M18TATTGGGCCCAGATNONE 
J033120G10TATTGGGCCCAGATNONE 
J033144G06TATTGGGCCCAGATNONE 
J043017L21TATTGGGCCCAGATNONE 
J043024O10TATTGGGCCCAGATNONE 
J053023K04TATTGGGCCCAGATNONE 
J053035D01TATTGGGCCCAGATNONE 
J053037P10TATTGGGCCCAGATNONE 
J053042K15TATTGGGCCCAGATNONE 
J053047C14TATTGGGCCCAGATNONE 
J053054A06TATTGGGCCCAGATNONE 
J053071H03TATTGGGCCCAGATNONE 
J053073G08TATTGGGCCCAGATNONE 
J053090D04TATTGGGCCCAGATNONE 
J053095E17TATTGGGCCCAGATNONE 
J090007O03TATTGGGCCCAGATNONE 
J090024G24TATTGGGCCCAGATNONE 
J090042M08TATTGGGCCCAGATNONE 
J090045I16TATTGGGCCCAGATNONE 
J090051E13TATTGGGCCCAGATNONE 
J090073B15TATTGGGCCCAGATNONE 
J090096F19TATTGGGCCCAGATNONE 
J100030M23TATTGGGCCCAGATNONE 
Os03g0819900006-058-B05ACTGGGCCCTNONE 
AK111912ACTGGGCCCTNONE 
AK112029ACTGGGCCCTSimilar to RAB8C. 
AY576526ACTGGGCCCTNONE 
AY579410ACTGGGCCCTNONE 
J075041G24ACTGGGCCCTNONE 
J100070N08ACTGGGCCCTNONE 
Os03g0822900AK099787CGGGCCCAGAZinc finger, BED-type predicted domain containing protein. 
J013042C24CGGGCCCAGANONE 
J013096O21CGGGCCCAGANONE 
J023109I23CGGGCCCAGANONE 
J033106N09CGGGCCCAGANONE 
J033107H03CGGGCCCAGANONE 
J033118G03CGGGCCCAGANONE 
J033145I24CGGGCCCAGANONE 
J065138D15CGGGCCCAGANONE 
J065140L13CGGGCCCAGANONE 
J065179M13CGGGCCCAGANONE 
J065200F05CGGGCCCAGANONE 
J075104F20CGGGCCCAGANONE 
J075143A15CGGGCCCAGANONE 
J075197J11CGGGCCCAGANONE 
Os03g0843500AK067985CGGGCCCAGCCCACGCNONE 
AK101661CGGGCCCAGCCCACGCSimilar to Sarcoplasmic reticulum protein (With alternative splicing). 
AY224454CGGGCCCAGCCCACGCNONE 
J080302L23CGGGCCCAGCCCACGCNONE 
Os03g0844000AK059033GGGGCCCAGCNONE 
AK065633GGGGCCCAGCProtein prenyltransferase domain containing protein. 
J013031L22GGGGCCCAGCNONE 
J065099H18GGGGCCCAGCNONE 
Os03g0848300AK059137AGGGCCCAGATNONE 
AK102089AGGGCCCAGATSimilar to Actin-related protein 2/3 complex subunit 4 (ARP2/3 complex 20 kDa subunit) (p20-ARC). 
J033037E05AGGGCCCAGATNONE 
J033082P03AGGGCCCAGATNONE 
J065110J17AGGGCCCAGATNONE 
J075012L14AGGGCCCAGATNONE 
J075013G06AGGGCCCAGATNONE 
J075021D21AGGGCCCAGATNONE 
J075162K12AGGGCCCAGATNONE 
Os03g0852600009-174-G04ATATGGGCCCAGCCCAAGNONE 
AK063101ATATGGGCCCAGCCCAAGProtein of unknown function DUF565 family protein. 
J065131H12ATATGGGCCCAGCCCAAGNONE 
J090046K24ATATGGGCCCAGCCCAAGNONE 
Os03g0854000009-186-C03GGCTGGGCCCACGCGNONE 
AK061374GGCTGGGCCCACGCGProtein of unknown function UPF0131 family protein. 
J065138B11GGCTGGGCCCACGCGNONE 
Os03g0855700AK070400GCTGGGCCCGGTNucleic acid-binding, OB-fold domain containing protein. 
Os04g0231800AK068417CCTGGGCCCACANONE 
J013153L19CCTGGGCCCACANONE 
J065020J04CCTGGGCCCACANONE 
J065201K08CCTGGGCCCACANONE 
J065214C10CCTGGGCCCACANONE 
Os04g0259200AK119366CGGGCCCAGCCCAAATHypothetical protein. 
Os04g0270100AK063713CGGGCCCAGGNONE 
AK107968CGGGCCCAGGNONE 
Os04g0282400AK120187GCTGGGCCCCACCSimilar to FPF1 protein-like (RAA1). 
J013034O10GCTGGGCCCCACCNONE 
J013071G20GCTGGGCCCCACCNONE 
Os04g0387600009-148-E01CGGGCCCAGCNONE 
009-155-A11CGGGCCCAGCNONE 
009-175-F04CGGGCCCAGCNONE 
AK063862CGGGCCCAGCConserved hypothetical protein. 
J065035F12CGGGCCCAGCNONE 
J065162C13CGGGCCCAGCNONE 
J065169L19CGGGCCCAGCNONE 
Os04g0390000AK067777CACGCCACTGACATCTGGGCCCCACCNONE 
AK068713CACGCCACTGACATCTGGGCCCCACCNONE 
AK098921CACGCCACTGACATCTGGGCCCCACCSimilar to 2-oxoglutarate dehydrogenase, E1 component. 
Os04g0440100AK101324GCTGGGCCCACTCTNONE 
AK105415GCTGGGCCCACTCTNonsense-mediated decay UPF3 domain containing protein. 
Os04g0497000006-097-G07GCGGGCCCAGCNONE 
AK069136GCGGGCCCAGCNONE 
AK109382GCGGGCCCAGCSimilar to Allyl alcohol dehydrogenase. 
J023008C06GCGGGCCCAGCNONE 
J043007K16GCGGGCCCAGCNONE 
J065110K06GCGGGCCCAGCNONE 
J080012F02GCGGGCCCAGCNONE 
J080020N21GCGGGCCCAGCNONE 
J080026H09GCGGGCCCAGCNONE 
J080029D13GCGGGCCCAGCNONE 
J080034C08GCGGGCCCAGCNONE 
J080050J07GCGGGCCCAGCNONE 
Os04g0498600006-068-G08AGGGCCCAGATNONE 
006-095-H08AGGGCCCAGATNONE 
006-108-E12AGGGCCCAGATNONE 
009-194-E05AGGGCCCAGATNONE 
AK062001AGGGCCCAGATNONE 
Os04g0504600J065162K24TCTGGGCCCATGANONE 
Os04g0529400J013039I24CCTGGGCCCCCGCGNONE 
J013055M04CCTGGGCCCCCGCGNONE 
J023050E21CCTGGGCCCCCGCGNONE 
J033060K22CCTGGGCCCCCGCGNONE 
J075026D13CCTGGGCCCCCGCGNONE 
J075033M03CCTGGGCCCCCGCGNONE 
J075138F11CCTGGGCCCCCGCGNONE 
J090022B15CCTGGGCCCCCGCGNONE 
Os04g0538400AK108230ATCTGGGCCCTSimilar to Nodulin 21 (N-21). 
J090006J20ATCTGGGCCCTNONE 
Os04g0559400AK106376CCTGGGCCCACGCSimilar to Branched-chain-amino-acid aminotransferase 5, chloroplast precursor (EC 2.6.1.42) (Atbcat-5). 
Os04g0577500006-039-C03TCTGGGCCCACGANONE 
006-043-H01TCTGGGCCCACGANONE 
AK061538TCTGGGCCCACGANONE 
AK065648TCTGGGCCCACGATatD-related deoxyribonuclease family protein. 
AK104763TCTGGGCCCACGANONE 
J013035E21TCTGGGCCCACGANONE 
J013066M11TCTGGGCCCACGANONE 
J100026B02TCTGGGCCCACGANONE 
Os04g0580700AF095646GCTGGGCCCCNONE 
AK070540GCTGGGCCCCNONE 
AY551918GCTGGGCCCCMADS box transcription factor MADS17. 
J023057B01GCTGGGCCCCNONE 
Os04g0592500AK066893ATCTGGGCCCATCCPhosphoenolpyruvate carboxykinase (ATP) family protein. 
J013090K18ATCTGGGCCCATCCNONE 
Os04g0602900AK065982CCTGGGCCCAACTNONE 
AK100414CCTGGGCCCAACTIsoprenylcysteine carboxyl methyltransferase family protein. 
J013045J05CCTGGGCCCAACTNONE 
J065196I21CCTGGGCCCAACTNONE 
J065205B13CCTGGGCCCAACTNONE 
J090017J24CCTGGGCCCAACTNONE 
Os04g0617050J065197A20GCTGGGCCCCACNONE 
J090067K01GCTGGGCCCCACAuxin responsive SAUR protein family protein. 
Os04g0669600AK110767GGGGCCCAGGCCCAAAAPhospholipase/Carboxylesterase family protein. 
J065195K10GGGGCCCAGGCCCAAAANONE 
Os04g0674600AK069645TGTGGGGCCCAGAOligopeptide transporter OPT superfamily protein. 
Os05g0112101J065141G20TGGGGCCCAGTEpsin, N-terminal domain containing protein. 
Os05g0116100006-049-G01CCTGGGCCCCACANONE 
006-064-F09CCTGGGCCCCACANONE 
006-082-A03CCTGGGCCCCACANONE 
006-092-G06CCTGGGCCCCACANONE 
006-102-F09CCTGGGCCCCACANONE 
AB037970CCTGGGCCCCACANONE 
AK061836CCTGGGCCCCACANONE 
AK070895CCTGGGCCCCACADehydroascorbate reductase. 
AY074786CCTGGGCCCCACANONE 
J013022K21CCTGGGCCCCACANONE 
J013154A03CCTGGGCCCCACANONE 
J023074C02CCTGGGCCCCACANONE 
J023091I19CCTGGGCCCCACANONE 
J023135M05CCTGGGCCCCACANONE 
J065027L11CCTGGGCCCCACANONE 
J065065A08CCTGGGCCCCACANONE 
J065120A08CCTGGGCCCCACANONE 
J065174A05CCTGGGCCCCACANONE 
J065184O22CCTGGGCCCCACANONE 
J065191D07CCTGGGCCCCACANONE 
J065209D04CCTGGGCCCCACANONE 
J075014F11CCTGGGCCCCACANONE 
J075036D03CCTGGGCCCCACANONE 
J075157D23CCTGGGCCCCACANONE 
J080007F15CCTGGGCCCCACANONE 
J080008N12CCTGGGCCCCACANONE 
J080010F22CCTGGGCCCCACANONE 
J080011C19CCTGGGCCCCACANONE 
J080011F12CCTGGGCCCCACANONE 
J080012E11CCTGGGCCCCACANONE 
J080015B12CCTGGGCCCCACANONE 
J080015O16CCTGGGCCCCACANONE 
J080016G24CCTGGGCCCCACANONE 
J080016K13CCTGGGCCCCACANONE 
J080018A02CCTGGGCCCCACANONE 
J080018H03CCTGGGCCCCACANONE 
J080022M01CCTGGGCCCCACANONE 
J080023D20CCTGGGCCCCACANONE 
J080023I01CCTGGGCCCCACANONE 
J080023J05CCTGGGCCCCACANONE 
J080024A09CCTGGGCCCCACANONE 
J080024I09CCTGGGCCCCACANONE 
J080025A10CCTGGGCCCCACANONE 
J080025G04CCTGGGCCCCACANONE 
J080027D21CCTGGGCCCCACANONE 
J080029M05CCTGGGCCCCACANONE 
J080030J01CCTGGGCCCCACANONE 
J080034D10CCTGGGCCCCACANONE 
J080036F18CCTGGGCCCCACANONE 
J080038N11CCTGGGCCCCACANONE 
J080039B07CCTGGGCCCCACANONE 
J080039E01CCTGGGCCCCACANONE 
J080039K11CCTGGGCCCCACANONE 
J080040B09CCTGGGCCCCACANONE 
J080040G11CCTGGGCCCCACANONE 
J080041H08CCTGGGCCCCACANONE 
J080041H19CCTGGGCCCCACANONE 
J080041O20CCTGGGCCCCACANONE 
J080042C15CCTGGGCCCCACANONE 
J080043C16CCTGGGCCCCACANONE 
J080043F18CCTGGGCCCCACANONE 
J080044B17CCTGGGCCCCACANONE 
J080044N10CCTGGGCCCCACANONE 
J080044O07CCTGGGCCCCACANONE 
J080045H15CCTGGGCCCCACANONE 
J080045I03CCTGGGCCCCACANONE 
J080046A05CCTGGGCCCCACANONE 
J080048I06CCTGGGCCCCACANONE 
J080049L04CCTGGGCCCCACANONE 
J080049M09CCTGGGCCCCACANONE 
J080050G11CCTGGGCCCCACANONE 
J080051G20CCTGGGCCCCACANONE 
J080053C09CCTGGGCCCCACANONE 
J080053I05CCTGGGCCCCACANONE 
J080053P18CCTGGGCCCCACANONE 
J080054K10CCTGGGCCCCACANONE 
J080054P14CCTGGGCCCCACANONE 
J080057L05CCTGGGCCCCACANONE 
J080062K11CCTGGGCCCCACANONE 
J080063C19CCTGGGCCCCACANONE 
J080065B03CCTGGGCCCCACANONE 
J080066E15CCTGGGCCCCACANONE 
J080066H05CCTGGGCCCCACANONE 
J080066I05CCTGGGCCCCACANONE 
J080068O11CCTGGGCCCCACANONE 
J080070L22CCTGGGCCCCACANONE 
J080071I12CCTGGGCCCCACANONE 
J080071N20CCTGGGCCCCACANONE 
J080072D10CCTGGGCCCCACANONE 
J080072I10CCTGGGCCCCACANONE 
J080074G03CCTGGGCCCCACANONE 
J080076E23CCTGGGCCCCACANONE 
J080076N03CCTGGGCCCCACANONE 
J080077N23CCTGGGCCCCACANONE 
J080084B13CCTGGGCCCCACANONE 
J080084F07CCTGGGCCCCACANONE 
J080085J15CCTGGGCCCCACANONE 
J080085P20CCTGGGCCCCACANONE 
J080090F21CCTGGGCCCCACANONE 
J080093H16CCTGGGCCCCACANONE 
J080093J01CCTGGGCCCCACANONE 
J080093L04CCTGGGCCCCACANONE 
J080097E24CCTGGGCCCCACANONE 
J090012G04CCTGGGCCCCACANONE 
J090054K05CCTGGGCCCCACANONE 
Os05g0116600AK109828GCTGGGCCCTGGGCCATF-box associated type 1 domain containing protein. 
Os05g0119300004-011-B09GCTGGGCCCCACGCGNONE 
006-063-A03GCTGGGCCCCACGCGNONE 
006-077-E12GCTGGGCCCCACGCGNONE 
006-079-E12GCTGGGCCCCACGCGNONE 
006-100-B11GCTGGGCCCCACGCGNONE 
009-109-A12GCTGGGCCCCACGCGNONE 
009-123-C07GCTGGGCCCCACGCGNONE 
009-163-D09GCTGGGCCCCACGCGNONE 
009-170-D11GCTGGGCCCCACGCGNONE 
009-173-C01GCTGGGCCCCACGCGNONE 
009-192-E01GCTGGGCCCCACGCGNONE 
011-048-G01GCTGGGCCCCACGCGNONE 
AK060883GCTGGGCCCCACGCGNONE 
AK068289GCTGGGCCCCACGCGNONE 
AK071554GCTGGGCCCCACGCGNONE 
AK099495GCTGGGCCCCACGCGXYPPX repeat containing protein. 
AY348312GCTGGGCCCCACGCGNONE 
J013037L16GCTGGGCCCCACGCGNONE 
J013088P04GCTGGGCCCCACGCGNONE 
J013099D14GCTGGGCCCCACGCGNONE 
J013146E19GCTGGGCCCCACGCGNONE 
J013147E18GCTGGGCCCCACGCGNONE 
J023104E19GCTGGGCCCCACGCGNONE 
J023128O20GCTGGGCCCCACGCGNONE 
J023132D16GCTGGGCCCCACGCGNONE 
J023143E13GCTGGGCCCCACGCGNONE 
J033028F15GCTGGGCCCCACGCGNONE 
J033133D24GCTGGGCCCCACGCGNONE 
J053091M07GCTGGGCCCCACGCGNONE 
J075029L15GCTGGGCCCCACGCGNONE 
J075097M12GCTGGGCCCCACGCGNONE 
J075103J11GCTGGGCCCCACGCGNONE 
J075138J10GCTGGGCCCCACGCGNONE 
J075172K18GCTGGGCCCCACGCGNONE 
J080001C15GCTGGGCCCCACGCGNONE 
J080002M13GCTGGGCCCCACGCGNONE 
J080009K01GCTGGGCCCCACGCGNONE 
J080010N01GCTGGGCCCCACGCGNONE 
J080011D23GCTGGGCCCCACGCGNONE 
J080013C13GCTGGGCCCCACGCGNONE 
J080013M16GCTGGGCCCCACGCGNONE 
J080018J02GCTGGGCCCCACGCGNONE 
J080020F03GCTGGGCCCCACGCGNONE 
J080020G05GCTGGGCCCCACGCGNONE 
J080021D05GCTGGGCCCCACGCGNONE 
J080030A19GCTGGGCCCCACGCGNONE 
J080031A16GCTGGGCCCCACGCGNONE 
J080033J23GCTGGGCCCCACGCGNONE 
J080035H07GCTGGGCCCCACGCGNONE 
J080039M24GCTGGGCCCCACGCGNONE 
J080042B16GCTGGGCCCCACGCGNONE 
J080043B03GCTGGGCCCCACGCGNONE 
J080045G01GCTGGGCCCCACGCGNONE 
J080045K17GCTGGGCCCCACGCGNONE 
J080047A09GCTGGGCCCCACGCGNONE 
J080047I22GCTGGGCCCCACGCGNONE 
J080048M14GCTGGGCCCCACGCGNONE 
J080049J02GCTGGGCCCCACGCGNONE 
J080052C15GCTGGGCCCCACGCGNONE 
J080052E11GCTGGGCCCCACGCGNONE 
J080052M22GCTGGGCCCCACGCGNONE 
J080056O21GCTGGGCCCCACGCGNONE 
J080059J04GCTGGGCCCCACGCGNONE 
J080059O17GCTGGGCCCCACGCGNONE 
J080064N04GCTGGGCCCCACGCGNONE 
J080066A03GCTGGGCCCCACGCGNONE 
J080066I22GCTGGGCCCCACGCGNONE 
J080069C13GCTGGGCCCCACGCGNONE 
J080069J03GCTGGGCCCCACGCGNONE 
J080069N04GCTGGGCCCCACGCGNONE 
J080071A01GCTGGGCCCCACGCGNONE 
J080071C03GCTGGGCCCCACGCGNONE 
J080071J02GCTGGGCCCCACGCGNONE 
J080080D17GCTGGGCCCCACGCGNONE 
J080084O06GCTGGGCCCCACGCGNONE 
J080085O20GCTGGGCCCCACGCGNONE 
J080086H15GCTGGGCCCCACGCGNONE 
J080094K06GCTGGGCCCCACGCGNONE 
J080095C05GCTGGGCCCCACGCGNONE 
J080095G04GCTGGGCCCCACGCGNONE 
J080096F03GCTGGGCCCCACGCGNONE 
J080096F20GCTGGGCCCCACGCGNONE 
J090004H05GCTGGGCCCCACGCGNONE 
J090012P10GCTGGGCCCCACGCGNONE 
J090021B09GCTGGGCCCCACGCGNONE 
J090034M08GCTGGGCCCCACGCGNONE 
J090046G21GCTGGGCCCCACGCGNONE 
J090055K24GCTGGGCCCCACGCGNONE 
J090055L05GCTGGGCCCCACGCGNONE 
J090057H17GCTGGGCCCCACGCGNONE 
J090082K21GCTGGGCCCCACGCGNONE 
J100022A07GCTGGGCCCCACGCGNONE 
J100022M02GCTGGGCCCCACGCGNONE 
J100069K11GCTGGGCCCCACGCGNONE 
J100086C24GCTGGGCCCCACGCGNONE 
Os05g0123400AK069521TCTGGGCCCTConserved hypothetical protein. 
J023022O05TCTGGGCCCTNONE 
Os05g0172800AK108688CCTGGGCCCACCTGConserved hypothetical protein. 
J075027E19CCTGGGCCCACCTGNONE 
J075174L13CCTGGGCCCACCTGNONE 
Os05g0184901Os05g0184901CCTGGGCCCAGTTSigma factor, regions 3 and 4 domain containing protein. 
Os05g0255600AK073067CTTGGGCTGGGCCCTThioredoxin domain 2 containing protein. 
J033022A04CTTGGGCTGGGCCCTNONE 
J033022B03CTTGGGCTGGGCCCTNONE 
J033116F22CTTGGGCTGGGCCCTNONE 
J065017H13CTTGGGCTGGGCCCTNONE 
J065038G20CTTGGGCTGGGCCCTNONE 
J065076J16CTTGGGCTGGGCCCTNONE 
J065135D06CTTGGGCTGGGCCCTNONE 
J065168P22CTTGGGCTGGGCCCTNONE 
J065188G21CTTGGGCTGGGCCCTNONE 
J065207C14CTTGGGCTGGGCCCTNONE 
J080014C23CTTGGGCTGGGCCCTNONE 
J080018G12CTTGGGCTGGGCCCTNONE 
J080021F03CTTGGGCTGGGCCCTNONE 
J100068C14CTTGGGCTGGGCCCTNONE 
Os05g0361900006-033-D04ACTGACAGGTGGGCCCAGCCCNONE 
AK060107ACTGACAGGTGGGCCCAGCCCMitochondrial substrate carrier family protein. 
AK104602ACTGACAGGTGGGCCCAGCCCNONE 
AK104747ACTGACAGGTGGGCCCAGCCCNONE 
J033133L03ACTGACAGGTGGGCCCAGCCCNONE 
J080001O06ACTGACAGGTGGGCCCAGCCCNONE 
J080004F05ACTGACAGGTGGGCCCAGCCCNONE 
J080005D12ACTGACAGGTGGGCCCAGCCCNONE 
J080008G19ACTGACAGGTGGGCCCAGCCCNONE 
J080015D10ACTGACAGGTGGGCCCAGCCCNONE 
J080015H22ACTGACAGGTGGGCCCAGCCCNONE 
J080016K15ACTGACAGGTGGGCCCAGCCCNONE 
J080018D12ACTGACAGGTGGGCCCAGCCCNONE 
J080020A01ACTGACAGGTGGGCCCAGCCCNONE 
J080027A09ACTGACAGGTGGGCCCAGCCCNONE 
J080032F05ACTGACAGGTGGGCCCAGCCCNONE 
J080039D09ACTGACAGGTGGGCCCAGCCCNONE 
J080043J19ACTGACAGGTGGGCCCAGCCCNONE 
J080052G22ACTGACAGGTGGGCCCAGCCCNONE 
J080052M15ACTGACAGGTGGGCCCAGCCCNONE 
J080053D22ACTGACAGGTGGGCCCAGCCCNONE 
J080061I18ACTGACAGGTGGGCCCAGCCCNONE 
J080064O14ACTGACAGGTGGGCCCAGCCCNONE 
J080075K01ACTGACAGGTGGGCCCAGCCCNONE 
J080082I02ACTGACAGGTGGGCCCAGCCCNONE 
J080095C14ACTGACAGGTGGGCCCAGCCCNONE 
J100028N14ACTGACAGGTGGGCCCAGCCCNONE 
Os05g0386900AK071425GCTGGGCCCCACCCGNONE 
AK073634GCTGGGCCCCACCCGReticulon family protein. 
Os05g0411300014-098-D05TTGTGGGCCCAGATNONE 
015-093-F04TTGTGGGCCCAGATNONE 
AK071931TTGTGGGCCCAGATConserved hypothetical protein. 
AK073142TTGTGGGCCCAGATNONE 
Os05g0415600AK065818GTGGCCCACAAACTGGGCCCTNONE 
J013042K21GTGGCCCACAAACTGGGCCCTNONE 
J013114E15GTGGCCCACAAACTGGGCCCTNONE 
J013131H02GTGGCCCACAAACTGGGCCCTNONE 
J023041G06GTGGCCCACAAACTGGGCCCTNONE 
J100037M21GTGGCCCACAAACTGGGCCCTNONE 
Os05g0503000AK068335CCTGGGCCCACCSimilar to Secretory carrier membrane protein. 
AK104049CCTGGGCCCACCNONE 
J013149D04CCTGGGCCCACCNONE 
J075085A06CCTGGGCCCACCNONE 
Os05g0533600AK067577GGTGGGGCCCAGASimilar to Starch synthase IVa (Glycogen (Starch) synthase-like). 
AY224560GGTGGGGCCCAGANONE 
AY373258GGTGGGGCCCAGANONE 
Os05g0543700AK071113GGTGGGGCCCAGCCSimilar to Chaperone protein dnaJ. 
AK103912GGTGGGGCCCAGCCNONE 
Os05g0567500AK073046TTATGGGCCCAGATCACGGCCCGNONE 
AK121133TTATGGGCCCAGATCACGGCCCGDNA glycosylase family protein. 
J023075P20TTATGGGCCCAGATCACGGCCCGNONE 
Os05g0577700AK107217GCTGGGCTGGGCCCCTCGCGCGCGACGCGACSimilar to Protein kinase. 
AY224453GCTGGGCTGGGCCCCTCGCGCGCGACGCGACNONE 
Os05g0579500AK121528CCTGGGCCCACGAConserved hypothetical protein. 
J033030I07CCTGGGCCCACGANONE 
Os05g0586600AB096011GGTGGGCCCAGGGACCCGPlastid sigma factor SIG5. 
AB096071GGTGGGCCCAGGGACCCGNONE 
AK105697GGTGGGCCCAGGGACCCGNONE 
Os05g0596200009-059-G06AGTTGGGCCCAGGNONE 
AK062521AGTTGGGCCCAGGNONE 
AK107887AGTTGGGCCCAGGConserved hypothetical protein. 
AK108209AGTTGGGCCCAGGNONE 
J065154B01AGTTGGGCCCAGGNONE 
Os06g0105900AK072638ACTGGGCCCCACACConserved hypothetical protein. 
Os06g0128400AK064390AACGGGCCCAGATNONE 
AK121983AACGGGCCCAGATWD40-like domain containing protein. 
Os06g0134000AJ417525AACTGGGCCCACTNONE 
AK062184AACTGGGCCCACTNONE 
AK106717AACTGGGCCCACTSimilar to 40S ribosomal protein S20. 
AK120319AACTGGGCCCACTNONE 
D10402AACTGGGCCCACTNONE 
D12632AACTGGGCCCACTNONE 
J013056N13AACTGGGCCCACTNONE 
J023100G01AACTGGGCCCACTNONE 
J053059F04AACTGGGCCCACTNONE 
J053068M21AACTGGGCCCACTNONE 
J053078H15AACTGGGCCCACTNONE 
J065050O15AACTGGGCCCACTNONE 
J065060G15AACTGGGCCCACTNONE 
J065080K10AACTGGGCCCACTNONE 
J065108G05AACTGGGCCCACTNONE 
J065186K16AACTGGGCCCACTNONE 
J075150J12AACTGGGCCCACTNONE 
J080002I18AACTGGGCCCACTNONE 
J080005H04AACTGGGCCCACTNONE 
J080008I06AACTGGGCCCACTNONE 
J080010G20AACTGGGCCCACTNONE 
J080010N10AACTGGGCCCACTNONE 
J080018H02AACTGGGCCCACTNONE 
J080022O14AACTGGGCCCACTNONE 
J080023F23AACTGGGCCCACTNONE 
J080025D16AACTGGGCCCACTNONE 
J080027L12AACTGGGCCCACTNONE 
J080030F16AACTGGGCCCACTNONE 
J080038N04AACTGGGCCCACTNONE 
J080048O17AACTGGGCCCACTNONE 
J080056B05AACTGGGCCCACTNONE 
J080061D02AACTGGGCCCACTNONE 
J080062H18AACTGGGCCCACTNONE 
J080064E06AACTGGGCCCACTNONE 
J080066D23AACTGGGCCCACTNONE 
J080071F08AACTGGGCCCACTNONE 
J080089E06AACTGGGCCCACTNONE 
J080089K22AACTGGGCCCACTNONE 
J080091C18AACTGGGCCCACTNONE 
J080095G10AACTGGGCCCACTNONE 
J090038G01AACTGGGCCCACTNONE 
J090062K07AACTGGGCCCACTNONE 
J100051G19AACTGGGCCCACTNONE 
Os06g0134300AK071534TCTGGGCCCATAAConserved hypothetical protein. 
J023106E03TCTGGGCCCATAANONE 
J075172D02TCTGGGCCCATAANONE 
J100047B13TCTGGGCCCATAANONE 
Os06g0199500AK060939TACTGGGCCCAAGGCCCAAATNONE 
AK064613TACTGGGCCCAAGGCCCAAATSimilar to Phosphopantothenoylcysteine decarboxylase (EC 4.1.1.36) (Halotolerance protein Hal3a) (AtHal3a) (PPCDC) (AtCoaC). 
AK100138TACTGGGCCCAAGGCCCAAATNONE 
Os06g0316100011-089-C01ACATGGGCCGGGCCCAGGNONE 
015-030-D11ACATGGGCCGGGCCCAGGNONE 
015-044-H10ACATGGGCCGGGCCCAGGNONE 
AK105260ACATGGGCCGGGCCCAGGConserved hypothetical protein. 
AK119646ACATGGGCCGGGCCCAGGNONE 
Os06g0320000009-030-C04ACTGGGCCCTNONE 
009-135-F08ACTGGGCCCTNONE 
J075103B05ACTGGGCCCTProtein of unknown function DUF953, thioredoxin-like family protein. 
J075187J24ACTGGGCCCTNONE 
Os06g0476200AK065566CCCGGGCCCAGANONE 
AK068502CCCGGGCCCAGASimilar to Phosphoglucomutase precursor (EC 5.4.2.2). 
Os06g0486900AK064610CCTGGGCCCTSimilar to Formate dehydrogenase, mitochondrial precursor (EC 1.2.1.2) (NAD- dependent formate dehydrogenase) (FDH). 
Os06g0505700009-010-E06CCTGGGCCCACANONE 
AK121505CCTGGGCCCACAHypothetical protein. 
J033022N03CCTGGGCCCACANONE 
Os06g0560400AK103575TCAGGCCCAGGGCCCAGGNONE 
AK108074TCAGGCCCAGGGCCCAGGProtein of unknown function DUF862, eukaryotic domain containing protein. 
Os06g0601000AK071330AAATGGGCCCAGAHomeodomain-like containing protein. 
AY224485AAATGGGCCCAGANONE 
Os06g0609600AK072533CCTGGGCCCCACCTGEF-Hand type domain containing protein. 
AK099872CCTGGGCCCCACCTGNONE 
BT014680CCTGGGCCCCACCTGNONE 
J023008M02CCTGGGCCCCACCTGNONE 
J023127M12CCTGGGCCCCACCTGNONE 
J065049L24CCTGGGCCCCACCTGNONE 
J065102K24CCTGGGCCCCACCTGNONE 
J065205O14CCTGGGCCCCACCTGNONE 
J075127F01CCTGGGCCCCACCTGNONE 
J080033F07CCTGGGCCCCACCTGNONE 
Os06g0642900AK073896ATCTGGGCCCACCTGTCUbiquitin system component Cue domain containing protein. 
J033042P11ATCTGGGCCCACCTGTCNONE 
J033072G12ATCTGGGCCCACCTGTCNONE 
J090050C02ATCTGGGCCCACCTGTCNONE 
Os06g0673500J100018J12TATGGGCCCAGANONE 
J100072F13TATGGGCCCAGASimilar to Ubiquitin. 
Os06g0695900011-023-F07ACTGGGCCCCACCNONE 
J023143A16ACTGGGCCCCACCZinc finger, RING-type domain containing protein. 
Os06g0704700AK120907GGGGCCCAGCNmrA-like family protein. 
AY224493GGGGCCCAGCNONE 
Os07g0101500AK059667ATCTGGGCCCCACNONE 
AK071749ATCTGGGCCCCACSimilar to Sterol 4-alpha-methyl-oxidase (Fragment). 
J023112L07ATCTGGGCCCCACNONE 
J065050F03ATCTGGGCCCCACNONE 
J090015C05ATCTGGGCCCCACNONE 
J090045C11ATCTGGGCCCCACNONE 
Os07g0139400AB096864TGTGGGGCCCAGCNONE 
AK065558TGTGGGGCCCAGCUDP-glucose 4-epimerase family protein. 
AK099140TGTGGGGCCCAGCNONE 
AK099183TGTGGGGCCCAGCNONE 
J013033B01TGTGGGGCCCAGCNONE 
J013157B14TGTGGGGCCCAGCNONE 
J023052E04TGTGGGGCCCAGCNONE 
J023086K05TGTGGGGCCCAGCNONE 
J023099C15TGTGGGGCCCAGCNONE 
J033025C08TGTGGGGCCCAGCNONE 
J033072I24TGTGGGGCCCAGCNONE 
J043020I04TGTGGGGCCCAGCNONE 
J090039I21TGTGGGGCCCAGCNONE 
J090078P20TGTGGGGCCCAGCNONE 
J090084C18TGTGGGGCCCAGCNONE 
J100024F07TGTGGGGCCCAGCNONE 
J100054D22TGTGGGGCCCAGCNONE 
J100062O08TGTGGGGCCCAGCNONE 
Os07g0152800AK065458TACTGGGCCCACGTGTConserved hypothetical protein. 
J013022G05TACTGGGCCCACGTGTNONE 
J013023D18TACTGGGCCCACGTGTNONE 
J013048J16TACTGGGCCCACGTGTNONE 
J013055I03TACTGGGCCCACGTGTNONE 
J013057F12TACTGGGCCCACGTGTNONE 
J023109A22TACTGGGCCCACGTGTNONE 
J023148E09TACTGGGCCCACGTGTNONE 
J033069G17TACTGGGCCCACGTGTNONE 
J033092I18TACTGGGCCCACGTGTNONE 
J033093C02TACTGGGCCCACGTGTNONE 
J033141M17TACTGGGCCCACGTGTNONE 
J043016M18TACTGGGCCCACGTGTNONE 
J090016D12TACTGGGCCCACGTGTNONE 
J090071B10TACTGGGCCCACGTGTNONE 
J090098K07TACTGGGCCCACGTGTNONE 
J100035K14TACTGGGCCCACGTGTNONE 
Os07g0185200AK066157CCACTGACAGGTGGGCCCAGATSimilar to Membrane related protein-like. 
Os07g0242600AK065752GTTTGGGCCCAGCCCATAACyclin-like F-box domain containing protein. 
J013037K22GTTTGGGCCCAGCCCATAANONE 
Os07g0258400AK121534AACTGGGCCCATTNONE 
L41217AACTGGGCCCATTNONE 
S81897AACTGGGCCCATTOsNramp1 (Integral membrane protein). 
Os07g0262950J033120B02CCTGGGCCCCConserved hypothetical protein. 
J075040G05CCTGGGCCCCNONE 
J075160F23CCTGGGCCCCNONE 
Os07g0459400AK101767GCTGGGCCCACTRegulator of chromosome condensation/beta-lactamase-inhibitor protein II domain containing protein. 
Os07g0486000AK069343AAATGGGCCCAGGCCCSimilar to MSH4. 
Os07g0498900AK073263CTTGGGCCCAGCCCACCAACProtein of unknown function DUF231, plant domain containing protein. 
J033024K20CTTGGGCCCAGCCCACCAACNONE 
J065207I19CTTGGGCCCAGCCCACCAACNONE 
Os07g0537300015-019-C12GCTGGGCCCCACCTGTCSimilar to Serine/threonine kinase receptor-like protein. 
J033140L16GCTGGGCCCCACCTGTCNONE 
J043034B12GCTGGGCCCCACCTGTCNONE 
Os07g0558300AK120618CGGGCCCAGTInositol monophosphatase family protein. 
J080068G22CGGGCCCAGTNONE 
Os07g0568900009-083-H02AACTGGGCCCATTTTGGGCTAAGCCCATCGNONE 
AK062660AACTGGGCCCATTTTGGGCTAAGCCCATCGConserved hypothetical protein. 
Os07g0569000AK073915CGATGGGCTTAGCCCAAAATGGGCCCAGTTConserved hypothetical protein. 
Os07g0582400003-104-B09CCTGGGCCCACCTNONE 
AK059423CCTGGGCCCACCTNONE 
AK102676CCTGGGCCCACCTNONE 
J065001F09CCTGGGCCCACCTNONE 
J065005K22CCTGGGCCCACCTNONE 
J065006D10CCTGGGCCCACCTNONE 
J065006P17CCTGGGCCCACCTNONE 
J065015G23CCTGGGCCCACCTNONE 
J065020F21CCTGGGCCCACCTNONE 
J065028I05CCTGGGCCCACCTNONE 
J065042N09CCTGGGCCCACCTNONE 
J065043P03CCTGGGCCCACCTNONE 
J065059E15CCTGGGCCCACCTNONE 
J065090I12CCTGGGCCCACCTNONE 
J065130I02CCTGGGCCCACCTNONE 
J065131P05CCTGGGCCCACCTNONE 
J065163I24CCTGGGCCCACCTNONE 
J065168I21CCTGGGCCCACCTNONE 
J065174A12CCTGGGCCCACCTNONE 
J065178K16CCTGGGCCCACCTNONE 
J065182P03CCTGGGCCCACCTNONE 
J065186B07CCTGGGCCCACCTNONE 
J065189M13CCTGGGCCCACCTNONE 
J065208J22CCTGGGCCCACCTNONE 
J065211E11CCTGGGCCCACCTNONE 
J075054E08CCTGGGCCCACCTNONE 
J075067K14CCTGGGCCCACCTNONE 
J075104E20CCTGGGCCCACCTNONE 
J075152M07CCTGGGCCCACCTNONE 
Os07g0585800006-106-A05AACTGGGCCCAGCNONE 
AK066419AACTGGGCCCAGCNONE 
AK105064AACTGGGCCCAGCSimilar to NADH-ubiquinone oxidoreductase 18 kDa subunit (EC 1.6.5.3) (EC 1.6.99.3) (Complex I-18KD) (CI-18KD) (Fragment). 
J065065N01AACTGGGCCCAGCNONE 
J065085B08AACTGGGCCCAGCNONE 
J065099I23AACTGGGCCCAGCNONE 
J065169A01AACTGGGCCCAGCNONE 
J065187N13AACTGGGCCCAGCNONE 
J065191L18AACTGGGCCCAGCNONE 
J065194D04AACTGGGCCCAGCNONE 
J065211M09AACTGGGCCCAGCNONE 
J065212I02AACTGGGCCCAGCNONE 
J090003C10AACTGGGCCCAGCNONE 
J090025O11AACTGGGCCCAGCNONE 
J090092F10AACTGGGCCCAGCNONE 
J100055A04AACTGGGCCCAGCNONE 
J100064A01AACTGGGCCCAGCNONE 
J100080L02AACTGGGCCCAGCNONE 
Os07g0614100AB032062TCTGGGCCCACTCCNONE 
AK058885TCTGGGCCCACTCCNONE 
AK069145TCTGGGCCCACTCCNONE 
AK102448TCTGGGCCCACTCCAlpha 1-2 subunit of 20S proteasome. 
J023007E07TCTGGGCCCACTCCNONE 
J033093O06TCTGGGCCCACTCCNONE 
Os07g0623300AK070292AACTGGGCCCGTTSimilar to Splicing factor SC35. 
J023050C05AACTGGGCCCGTTNONE 
J090025O12AACTGGGCCCGTTNONE 
Os07g0637300AF323611CCACTGACACCTGGGCCCCACCNONE 
AK069157CCACTGACACCTGGGCCCCACCNONE 
J023007C01CCACTGACACCTGGGCCCCACCNONE 
Os07g0647100AK065269TCTGGGCCCACCTGTCAGArmadillo-like helical domain containing protein. 
J013002K24TCTGGGCCCACCTGTCAGNONE 
Os07g0661600006-050-D12CCTGGGCCCCACCNONE 
009-124-B10CCTGGGCCCCACCNONE 
AK061123CCTGGGCCCCACCNONE 
AK066432CCTGGGCCCCACCSimilar to RNA-binding protein-like protein. 
AK104664CCTGGGCCCCACCNONE 
J013064M13CCTGGGCCCCACCNONE 
J013122O12CCTGGGCCCCACCNONE 
J033044A16CCTGGGCCCCACCNONE 
J033144D14CCTGGGCCCCACCNONE 
J090078P13CCTGGGCCCCACCNONE 
Os07g0671400AK067933CCTGGGCCCACAHeavy metal transport/detoxification protein domain containing protein. 
Os07g0673500005-016-H01TCTGGGCCCACGAAAGCCCACACGNONE 
AK072839TCTGGGCCCACGAAAGCCCACACGNONE 
AK106176TCTGGGCCCACGAAAGCCCACACGSimilar to ASF/SF2-like pre-mRNA splicing factor SRP32''. 
J013030G14TCTGGGCCCACGAAAGCCCACACGNONE 
J013153M24TCTGGGCCCACGAAAGCCCACACGNONE 
J023129E21TCTGGGCCCACGAAAGCCCACACGNONE 
J023141I23TCTGGGCCCACGAAAGCCCACACGNONE 
J033069A22TCTGGGCCCACGAAAGCCCACACGNONE 
J075021G17TCTGGGCCCACGAAAGCCCACACGNONE 
J075022B06TCTGGGCCCACGAAAGCCCACACGNONE 
J075049O15TCTGGGCCCACGAAAGCCCACACGNONE 
J075060O14TCTGGGCCCACGAAAGCCCACACGNONE 
J075073G03TCTGGGCCCACGAAAGCCCACACGNONE 
J075095D13TCTGGGCCCACGAAAGCCCACACGNONE 
J075120M18TCTGGGCCCACGAAAGCCCACACGNONE 
J075130D09TCTGGGCCCACGAAAGCCCACACGNONE 
J075152C20TCTGGGCCCACGAAAGCCCACACGNONE 
J075158L19TCTGGGCCCACGAAAGCCCACACGNONE 
J075199P18TCTGGGCCCACGAAAGCCCACACGNONE 
J090011K21TCTGGGCCCACGAAAGCCCACACGNONE 
J090078O10TCTGGGCCCACGAAAGCCCACACGNONE 
Os07g0683900004-013-C10GGTGGGCCCAGCNONE 
006-064-B09GGTGGGCCCAGCNONE 
006-084-B03GGTGGGCCCAGCNONE 
006-102-F10GGTGGGCCCAGCNONE 
011-057-F12GGTGGGCCCAGCNONE 
011-098-A02GGTGGGCCCAGCNONE 
012-012-H02GGTGGGCCCAGCNONE 
013-099-D06GGTGGGCCCAGCNONE 
AK060899GGTGGGCCCAGCNONE 
AK103324GGTGGGCCCAGCRicin B-related lectin domain containing protein. 
J013098G05GGTGGGCCCAGCNONE 
J023138L02GGTGGGCCCAGCNONE 
J033030M14GGTGGGCCCAGCNONE 
J033111J21GGTGGGCCCAGCNONE 
J033125K07GGTGGGCCCAGCNONE 
J033131O15GGTGGGCCCAGCNONE 
J033135I19GGTGGGCCCAGCNONE 
J043016G14GGTGGGCCCAGCNONE 
J043020F07GGTGGGCCCAGCNONE 
J043022F24GGTGGGCCCAGCNONE 
J043022J03GGTGGGCCCAGCNONE 
J065005N24GGTGGGCCCAGCNONE 
J065083B02GGTGGGCCCAGCNONE 
J065093J20GGTGGGCCCAGCNONE 
J065096G16GGTGGGCCCAGCNONE 
J065096H24GGTGGGCCCAGCNONE 
J065111H06GGTGGGCCCAGCNONE 
J065128C09GGTGGGCCCAGCNONE 
J065136L13GGTGGGCCCAGCNONE 
J065137I02GGTGGGCCCAGCNONE 
J065147B15GGTGGGCCCAGCNONE 
J065163I16GGTGGGCCCAGCNONE 
J075013E11GGTGGGCCCAGCNONE 
J075018H08GGTGGGCCCAGCNONE 
J075019C23GGTGGGCCCAGCNONE 
J075051C07GGTGGGCCCAGCNONE 
J075062A21GGTGGGCCCAGCNONE 
J075065K07GGTGGGCCCAGCNONE 
J075095E05GGTGGGCCCAGCNONE 
J075128H08GGTGGGCCCAGCNONE 
J075137J06GGTGGGCCCAGCNONE 
J075180M24GGTGGGCCCAGCNONE 
J075193A04GGTGGGCCCAGCNONE 
J075198J06GGTGGGCCCAGCNONE 
J075199C21GGTGGGCCCAGCNONE 
J090003A20GGTGGGCCCAGCNONE 
J090021J16GGTGGGCCCAGCNONE 
J090029K24GGTGGGCCCAGCNONE 
J090055L04GGTGGGCCCAGCNONE 
J090058E17GGTGGGCCCAGCNONE 
J090069J18GGTGGGCCCAGCNONE 
J090081H06GGTGGGCCCAGCNONE 
J100028P13GGTGGGCCCAGCNONE 
J100034E19GGTGGGCCCAGCNONE 
J100046H21GGTGGGCCCAGCNONE 
J100048P04GGTGGGCCCAGCNONE 
J100052M01GGTGGGCCCAGCNONE 
J100066L01GGTGGGCCCAGCNONE 
J100078H20GGTGGGCCCAGCNONE 
J100081K17GGTGGGCCCAGCNONE 
Y08987GGTGGGCCCAGCNONE 
Os07g0686100AK110915GGTTGGGCCCAGCCAGCCCAGSimilar to Abscisic acid responsive elements-binding factor. 
Os08g0127600AK058365CCCACGCGTGCTGGGCCCCHeat shock protein DnaJ, N-terminal domain containing protein. 
AK068373CCCACGCGTGCTGGGCCCCNONE 
J013149L10CCCACGCGTGCTGGGCCCCNONE 
J075027H17CCCACGCGTGCTGGGCCCCNONE 
J075060F10CCCACGCGTGCTGGGCCCCNONE 
Os08g0127700012-086-F03GGGGCCCAGCACGCGTGGGNONE 
AK059350GGGGCCCAGCACGCGTGGGNONE 
AK099242GGGGCCCAGCACGCGTGGGNONE 
AK121348GGGGCCCAGCACGCGTGGGConserved hypothetical protein. 
J033027J18GGGGCCCAGCACGCGTGGGNONE 
J065012F22GGGGCCCAGCACGCGTGGGNONE 
J065046N17GGGGCCCAGCACGCGTGGGNONE 
J065197B02GGGGCCCAGCACGCGTGGGNONE 
J100018P04GGGGCCCAGCACGCGTGGGNONE 
J100052C14GGGGCCCAGCACGCGTGGGNONE 
J100083A12GGGGCCCAGCACGCGTGGGNONE 
Os08g0133600AK073987AACGGGCCCAGGNONE 
AK105436AACGGGCCCAGGConserved hypothetical protein. 
Os08g0135100AK108618TTGTGGGCCCAGGSimilar to Phosphate/phosphoenolpyruvate translocator protein-like. 
Os08g0439900AK110628AACTGGGCCCATTMitochondrial glycoprotein family protein. 
J065118D13AACTGGGCCCATTNONE 
Os08g0440500AK058761TCTGGGCCCCAGMIR domain containing protein. 
Os08g0474700AK064878AACTGGGCCCTGGGCCTGGSimilar to COPII subunit Sec23 (Fragment). 
Os08g0490300011-064-F08GGGGCCCAGGNONE 
015-050-C06GGGGCCCAGGNONE 
AK066895GGGGCCCAGGRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J013090I22GGGGCCCAGGNONE 
J090060F02GGGGCCCAGGNONE 
Os08g0517600009-066-H05GCTGGGCCCAAACNONE 
AK073374GCTGGGCCCAAACNONE 
AK105385GCTGGGCCCAAACSAM (and some other nucleotide) binding motif domain containing protein. 
J065165P07GCTGGGCCCAAACNONE 
J075004A12GCTGGGCCCAAACNONE 
J075062F16GCTGGGCCCAAACNONE 
J075115K05GCTGGGCCCAAACNONE 
J075116H09GCTGGGCCCAAACNONE 
Os08g0520100AK059686GGTGTGTGGGCCCACCACGCGTGCTGGGCCCACCNONE 
AK120052GGTGTGTGGGCCCACCACGCGTGCTGGGCCCACCPseudouridine synthase domain containing protein. 
Os08g0557100AK070743AATTGGGCCCAGTANONE 
AK101214AATTGGGCCCAGTASimilar to Nucleic acid-binding protein precursor. 
AK105901AATTGGGCCCAGTANONE 
J033031B04AATTGGGCCCAGTANONE 
J080004F08AATTGGGCCCAGTANONE 
J080004H12AATTGGGCCCAGTANONE 
J080005H08AATTGGGCCCAGTANONE 
J080005I02AATTGGGCCCAGTANONE 
J080008N16AATTGGGCCCAGTANONE 
J080009H23AATTGGGCCCAGTANONE 
J080012H17AATTGGGCCCAGTANONE 
J080012J21AATTGGGCCCAGTANONE 
J080013I20AATTGGGCCCAGTANONE 
J080016E07AATTGGGCCCAGTANONE 
J080018O04AATTGGGCCCAGTANONE 
J080020B18AATTGGGCCCAGTANONE 
J080021I16AATTGGGCCCAGTANONE 
J080022N01AATTGGGCCCAGTANONE 
J080023G08AATTGGGCCCAGTANONE 
J080023N09AATTGGGCCCAGTANONE 
J080024J24AATTGGGCCCAGTANONE 
J080025M12AATTGGGCCCAGTANONE 
J080028A22AATTGGGCCCAGTANONE 
J080028I01AATTGGGCCCAGTANONE 
J080029D22AATTGGGCCCAGTANONE 
J080030M02AATTGGGCCCAGTANONE 
J080031B06AATTGGGCCCAGTANONE 
J080035G08AATTGGGCCCAGTANONE 
J080036F19AATTGGGCCCAGTANONE 
J080038P14AATTGGGCCCAGTANONE 
J080039C17AATTGGGCCCAGTANONE 
J080043A10AATTGGGCCCAGTANONE 
J080044H02AATTGGGCCCAGTANONE 
J080044P12AATTGGGCCCAGTANONE 
J080047L06AATTGGGCCCAGTANONE 
J080050L06AATTGGGCCCAGTANONE 
J080052J11AATTGGGCCCAGTANONE 
J080052M10AATTGGGCCCAGTANONE 
J080053E20AATTGGGCCCAGTANONE 
J080054J01AATTGGGCCCAGTANONE 
J080059N09AATTGGGCCCAGTANONE 
J080064F19AATTGGGCCCAGTANONE 
J080064N22AATTGGGCCCAGTANONE 
J080065K14AATTGGGCCCAGTANONE 
J080065M12AATTGGGCCCAGTANONE 
J080068O07AATTGGGCCCAGTANONE 
J080076P20AATTGGGCCCAGTANONE 
J080087D08AATTGGGCCCAGTANONE 
J080087H16AATTGGGCCCAGTANONE 
J080090N23AATTGGGCCCAGTANONE 
J080091H04AATTGGGCCCAGTANONE 
J080091P13AATTGGGCCCAGTANONE 
J080094O15AATTGGGCCCAGTANONE 
J080094P14AATTGGGCCCAGTANONE 
J080095I07AATTGGGCCCAGTANONE 
J080097E22AATTGGGCCCAGTANONE 
Os09g0265050J065112H09CCTGGGCCCCConserved hypothetical protein. 
Os09g0330200AK111018GCCGGGCCCAGGCCACGTCConserved hypothetical protein. 
Os09g0360400009-192-H06CGCGGGGGTGGGGCCCACTGGGCCCCCACCCGNONE 
AK071395CGCGGGGGTGGGGCCCACTGGGCCCCCACCCGConserved hypothetical protein. 
J013045J21CGCGGGGGTGGGGCCCACTGGGCCCCCACCCGNONE 
J023095O09CGCGGGGGTGGGGCCCACTGGGCCCCCACCCGNONE 
J065207K01CGCGGGGGTGGGGCCCACTGGGCCCCCACCCGNONE 
Os09g0369500013-023-F11TGCGGGCCCCACGCCTGGGCCCCNONE 
AK105322TGCGGGCCCCACGCCTGGGCCCCNONE 
AK105479TGCGGGCCCCACGCCTGGGCCCCConserved hypothetical protein. 
Os09g0392000AK120392CCATGGGCCCAGCConserved hypothetical protein. 
J013074N02CCATGGGCCCAGCNONE 
Os09g0406900012-044-F05AGGGCCCAGGNONE 
AK063485AGGGCCCAGGNONE 
AK067460AGGGCCCAGGConserved hypothetical protein. 
Os09g0424850J065006K24GGTGGGGCCCAGTConserved hypothetical protein. 
Os09g0451500AK062254GTGTGGGCCCAGTTThioredoxin domain 2 containing protein. 
AK072941GTGTGGGCCCAGTTNONE 
Os09g0493700015-091-G11AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
AK068501AGCCCACCCTCATGGGCCCAGATGTCAGTGACACSimilar to CUC2. 
AK099237AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J013155B08AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J023006E01AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J023060K23AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J023100B11AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J033026L19AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J033129J12AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J033149K09AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J065045I06AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J065061A10AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J065101H05AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J065135A03AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J065169C16AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J100047C11AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
J100047K07AGCCCACCCTCATGGGCCCAGATGTCAGTGACACNONE 
Os09g0547200016-021-H03ACTGGGCCCCGCCCACCACNONE 
AK073078ACTGGGCCCCGCCCACCACProtein of unknown function DUF292, eukaryotic domain containing protein. 
AK104984ACTGGGCCCCGCCCACCACNONE 
J065005L05ACTGGGCCCCGCCCACCACNONE 
J065039C06ACTGGGCCCCGCCCACCACNONE 
J065116H17ACTGGGCCCCGCCCACCACNONE 
J100046A17ACTGGGCCCCGCCCACCACNONE 
Os11g0209100016-063-F03AAATGGGCCCAGCNONE 
AK064391AAATGGGCCCAGCCyclin-like F-box domain containing protein. 
J075027K02AAATGGGCCCAGCNONE 
J075154K15AAATGGGCCCAGCNONE 
Os11g0417700J075031P16CCTGGGCCCACAConserved hypothetical protein. 
J075034C16CCTGGGCCCACANONE 
J075034J22CCTGGGCCCACANONE 
J075042C07CCTGGGCCCACANONE 
J075046O07CCTGGGCCCACANONE 
J075062O13CCTGGGCCCACANONE 
J075091G08CCTGGGCCCACANONE 
J075135H20CCTGGGCCCACANONE 
J075172B13CCTGGGCCCACANONE 
J075179G14CCTGGGCCCACANONE 
Os11g0642100AK107010TAATGGGCCCAGCCCCyclin-like F-box domain containing protein. 
Os11g0648000AK066444GTGGTGGGCCCAGCCSimilar to Na+/H+ antiporter. 
AK072026GTGGTGGGCCCAGCCNONE 
Os11g0677400AK069580TCTGGGCCCACAPectinesterase inhibitor domain containing protein. 
J023020A19TCTGGGCCCACANONE 
Os12g0134000AK066940CTGGGGCCCAGGSimilar to Hydroxymethylglutaryl-CoA lyase. 
Os12g0151500AK058389CCCGGCCCCTGGGCCCCACCSimilar to Alpha-2,8-sialyltransferase 8B (EC 2.4.99.-) (ST8Sia II) (Sialyltransferase X) (STX). 
AK105865CCCGGCCCCTGGGCCCCACCNONE 
Os12g0244500AK102026CCTGGGCCCTConserved hypothetical protein. 
J023014D06CCTGGGCCCTNONE 
J023060C12CCTGGGCCCTNONE 
J033080M18CCTGGGCCCTNONE 
J090017I22CCTGGGCCCTNONE 
J090023D21CCTGGGCCCTNONE 
J090036J05CCTGGGCCCTNONE 
J090053M19CCTGGGCCCTNONE 
Os12g0255866J075127N18CCTGGGCCCCConserved hypothetical protein. 
Os12g0266000J075093G23GCGGGCCCAGCNONE 
Os12g0433200AK058760CTGGGGCCCAGAConserved hypothetical protein. 
Os12g0538500006-077-B08AGTGGGCCCAGCCCNONE 
AK059316AGTGGGCCCAGCCCSimilar to PGPD14 protein. 
AK069502AGTGGGCCCAGCCCNONE 
AK104170AGTGGGCCCAGCCCNONE 
AK104287AGTGGGCCCAGCCCNONE 
J023020D18AGTGGGCCCAGCCCNONE 
J090079P08AGTGGGCCCAGCCCNONE 
Os12g0580300AK102871GCTGGGCCCCACCSimilar to TATA-binding protein TBP2. 
Os12g0597500AK101904CCCACTCCTGGGCCCAGCCCATCCANONE 
AK103799CCCACTCCTGGGCCCAGCCCATCCAAmidase, hydantoinase/carbamoylase family protein. 
J065206A02CCCACTCCTGGGCCCAGCCCATCCANONE 
J100078O15CCCACTCCTGGGCCCAGCCCATCCANONE 
Os12g0609600AK111050TCTGGGCCCCAHypothetical protein. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.