version

Summary of OsREG580 (All List)

OrganismOryza sativa  
IDOsREG580  
SequenceCTGGGGCC  
Annotation  
PPDB Motif 
PLACE Motif 
Total Entry Count330  

Entry Sequences (330 entries)

LocusGene modelSequenceDescription
Os01g0224100011-010-A11CTGGGGCCCGNONE 
011-034-B03CTGGGGCCCGNONE 
011-067-G07CTGGGGCCCGNONE 
015-017-C02CTGGGGCCCGNONE 
015-090-E01CTGGGGCCCGNONE 
AK101054CTGGGGCCCGNONE 
AK106517CTGGGGCCCGSimilar to DNA binding protein-like protein. 
Os01g0233900011-038-E11CTGGGGCCNONE 
AK100714CTGGGGCCUbiquitin-conjugating enzyme, E2 domain containing protein. 
J023115K12CTGGGGCCNONE 
J033103B07CTGGGGCCNONE 
J075011L24CTGGGGCCNONE 
J075022O12CTGGGGCCNONE 
Os01g0273300Os01g0273300CTGGGGCCCACCCBSD domain containing protein. 
Os01g0281100AK109672GCTCAGCTGGGGCCConserved hypothetical protein. 
J065013K07GCTCAGCTGGGGCCNONE 
J065040E15GCTCAGCTGGGGCCNONE 
J065127F12GCTCAGCTGGGGCCNONE 
J075155K23GCTCAGCTGGGGCCNONE 
Os01g0323000AK059381CTGGGGCCNONE 
J013128J05CTGGGGCCNONE 
J023086G18CTGGGGCCNONE 
J023139B12CTGGGGCCNONE 
J023149C13CTGGGGCCNONE 
J033131A16CTGGGGCCNONE 
J043024H18CTGGGGCCNONE 
J053058B13CTGGGGCCNONE 
J065007E10CTGGGGCCNONE 
J065041P15CTGGGGCCNONE 
J065137H12CTGGGGCCNONE 
J090040I15CTGGGGCCNONE 
J090059E07CTGGGGCCNONE 
J090094M08CTGGGGCCNONE 
Os01g0530400016-019-E07AAATGGGCCCCAGNONE 
AK103724AAATGGGCCCCAGNONE 
AK106476AAATGGGCCCCAGGlutaredoxin-related protein family protein. 
J023108F14AAATGGGCCCCAGNONE 
J033138C10AAATGGGCCCCAGNONE 
Os01g0650000009-079-D11CTCGGCCCCAGNONE 
009-079-D11GGCCCCAGNONE 
AK062640CTCGGCCCCAGLipolytic enzyme, G-D-S-L family protein. 
AK062640GGCCCCAGLipolytic enzyme, G-D-S-L family protein. 
AK072891CTCGGCCCCAGNONE 
AK072891GGCCCCAGNONE 
J075163B04CTCGGCCCCAGNONE 
J075163B04GGCCCCAGNONE 
J075182F14CTCGGCCCCAGNONE 
J075182F14GGCCCCAGNONE 
Os01g0798500006-106-C11CTGGGGCCCGCANONE 
AK061244CTGGGGCCCGCANONE 
AK068219CTGGGGCCCGCAMalate synthase-like family protein. 
J065199O16CTGGGGCCCGCANONE 
Os01g0801100AK102132CTGGGGCCGGCSimilar to Apurinic endonuclease-redox protein (DNA-(apurinic or apyrimidinic site) lyase) (EC 4.2.99.18). 
J013149O18CTGGGGCCGGCNONE 
J033031K07CTGGGGCCGGCNONE 
J033044A19CTGGGGCCGGCNONE 
J043040M23CTGGGGCCGGCNONE 
J065082D02CTGGGGCCGGCNONE 
Os01g0869600AK060596TTTGGGCTGGGGCCCACATGTCAGTGTRAM, LAG1 and CLN8 homology domain containing protein. 
AK070678TTTGGGCTGGGGCCCACATGTCAGTGNONE 
Os02g0115700AK061923CTGGGGCCNONE 
Os02g0135600AK069843CTGGGGCCConserved hypothetical protein. 
J023034H09CTGGGGCCNONE 
J033090D08CTGGGGCCNONE 
J100025N07CTGGGGCCNONE 
J100075G18CTGGGGCCNONE 
Os02g0135700AK100570GGTGGGCCCCAGDNA polymerase V family protein. 
Os02g0290500AK065628GGCCCCAGSimilar to Ubiquitin. 
J013027K22GGCCCCAGNONE 
J023027B07GGCCCCAGNONE 
J023077P07GGCCCCAGNONE 
J023106G17GGCCCCAGNONE 
J033034O13GGCCCCAGNONE 
J033044M18GGCCCCAGNONE 
J033103D02GGCCCCAGNONE 
J090009D03GGCCCCAGNONE 
Os02g0473000AK065460CCAGGCCCCAGRiboflavin biosynthesis protein RibD family protein. 
Os02g0523800AK072296CTGGGGCCCACTInositol polyphosphate kinase family protein. 
J065081E24CTGGGGCCCACTNONE 
Os02g0589400009-182-H08GGGACCCACCTGGGGCCCACCAUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
009-199-B01GGGACCCACCTGGGGCCCACCANONE 
011-015-G12GGGACCCACCTGGGGCCCACCANONE 
J023113C24GGGACCCACCTGGGGCCCACCANONE 
Os02g0760200AK101423GGCCCCAGC2 calcium/lipid-binding region, CaLB domain containing protein. 
Os02g0778200AK065948GCGGGCCCCAGAminoacyl-tRNA synthetase, class I family protein. 
Os03g0109300AK099538GCCCGGCCCCAGSimilar to Lysine decarboxylase-like protein. 
J013032C19GCCCGGCCCCAGNONE 
Os03g0113700AK103835CTGGGGCCCACCCGSimilar to Heat shock 70 kDa protein, mitochondrial precursor. 
Os03g0113800AK065925CGGGTGGGCCCCAGProtein prenyltransferase domain containing protein. 
J013047E20CGGGTGGGCCCCAGNONE 
J065026F21CGGGTGGGCCCCAGNONE 
J065047B03CGGGTGGGCCCCAGNONE 
J065054J12CGGGTGGGCCCCAGNONE 
J065079M24CGGGTGGGCCCCAGNONE 
J065093M07CGGGTGGGCCCCAGNONE 
J065153F02CGGGTGGGCCCCAGNONE 
J065155E21CGGGTGGGCCCCAGNONE 
J065179H15CGGGTGGGCCCCAGNONE 
J075019N02CGGGTGGGCCCCAGNONE 
J075089E01CGGGTGGGCCCCAGNONE 
J090066I18CGGGTGGGCCCCAGNONE 
J090087K20CGGGTGGGCCCCAGNONE 
J100079F05CGGGTGGGCCCCAGNONE 
Os03g0124100AK107007CTGGGGCCFringe-like family protein. 
Os03g0169500Os03g0169500CTGGGGCCCCACCTGTCSimilar to Cellulose synthase-like A4. 
Os03g0300400AF395880CTGGGGCCNONE 
AK121376CTGGGGCCPathogen-related protein (JIOsPR10). 
J013036K14CTGGGGCCNONE 
J023019C05CTGGGGCCNONE 
J023068B20CTGGGGCCNONE 
J023074O20CTGGGGCCNONE 
J023093P15CTGGGGCCNONE 
J023119D19CTGGGGCCNONE 
J023127E15CTGGGGCCNONE 
J023143G09CTGGGGCCNONE 
J033087E12CTGGGGCCNONE 
J075191C11CTGGGGCCNONE 
J100023P07CTGGGGCCNONE 
J100032G15CTGGGGCCNONE 
J100074L17CTGGGGCCNONE 
Os03g0306900AK073626CACGTGGGGTCGTGGGCCCCAGTENA/THI-4 protein domain containing protein. 
J033050J24CACGTGGGGTCGTGGGCCCCAGNONE 
J075180K24CACGTGGGGTCGTGGGCCCCAGNONE 
Os03g0307000J065032I03CTGGGGCCCACGACCCCACGTGHypothetical protein. 
J065110H17CTGGGGCCCACGACCCCACGTGNONE 
J065156H13CTGGGGCCCACGACCCCACGTGNONE 
J065175P03CTGGGGCCCACGACCCCACGTGNONE 
J075007D24CTGGGGCCCACGACCCCACGTGNONE 
J100040M24CTGGGGCCCACGACCCCACGTGNONE 
Os03g0405100AK108624GGGCCCCAGRpsU-divergently transcribed family protein. 
Os03g0445700AK071624CCAGGCCCCAGSimilar to LOB domain protein 39. 
J023106M18CCAGGCCCCAGNONE 
J065178J05CCAGGCCCCAGNONE 
J065196F10CCAGGCCCCAGNONE 
Os03g0572900AK102204CTGGGGCCGGCMulti antimicrobial extrusion protein MatE family protein. 
Os03g0710000006-023-G11GGCCCCAGNONE 
006-050-E05GGCCCCAGNONE 
AK060065GGCCCCAGProtein of unknown function DUF292, eukaryotic domain containing protein. 
AK099364GGCCCCAGNONE 
AK104418GGCCCCAGNONE 
J033051P12GGCCCCAGNONE 
J065046L09GGCCCCAGNONE 
J075021F06GGCCCCAGNONE 
J075106P12GGCCCCAGNONE 
Os03g0713100J013039M09CCCACTCCCTGGGGCCCACCTGNONE 
J023007K01CCCACTCCCTGGGGCCCACCTGNONE 
J023073H01CCCACTCCCTGGGGCCCACCTGNONE 
J023087M20CCCACTCCCTGGGGCCCACCTGNONE 
J023142E01CCCACTCCCTGGGGCCCACCTGNONE 
J033048E03CCCACTCCCTGGGGCCCACCTGNONE 
J033048F03CCCACTCCCTGGGGCCCACCTGSimilar to Dynamin-related protein 1C (Dynamin-like protein C) (Dynamin-like protein 5) (Dynamin-like protein DLP1). 
J033058C11CCCACTCCCTGGGGCCCACCTGNONE 
J033074M20CCCACTCCCTGGGGCCCACCTGNONE 
J033084M11CCCACTCCCTGGGGCCCACCTGNONE 
J033091I23CCCACTCCCTGGGGCCCACCTGNONE 
J033100C08CCCACTCCCTGGGGCCCACCTGNONE 
J033123K19CCCACTCCCTGGGGCCCACCTGNONE 
J090006P21CCCACTCCCTGGGGCCCACCTGNONE 
J090045O16CCCACTCCCTGGGGCCCACCTGNONE 
J100087M13CCCACTCCCTGGGGCCCACCTGNONE 
Os03g0741400AK121838CTGGGGCCCACTSimilar to SUSIBA2. 
J100032E12CTGGGGCCCACTNONE 
Os03g0806600AK070959GGCCCCAGConserved hypothetical protein. 
J075036P17GGCCCCAGNONE 
J075168O13GGCCCCAGNONE 
J075177J23GGCCCCAGNONE 
Os04g0266900011-064-A07CTGGGGCCCACCNONE 
AK069447CTGGGGCCCACCBacterial transketolase family protein. 
J023019B19CTGGGGCCCACCNONE 
Os04g0432600AK058925CTGGGGCCCAAGConserved hypothetical protein. 
AK103967CTGGGGCCCAAGNONE 
AK121724CTGGGGCCCAAGNONE 
J033081P13CTGGGGCCCAAGNONE 
J033128L11CTGGGGCCCAAGNONE 
J065038G19CTGGGGCCCAAGNONE 
J065129A21CTGGGGCCCAAGNONE 
J065131P11CTGGGGCCCAAGNONE 
J065166I03CTGGGGCCCAAGNONE 
J065181L05CTGGGGCCCAAGNONE 
J100018I15CTGGGGCCCAAGNONE 
J100019H22CTGGGGCCCAAGNONE 
J100037O10CTGGGGCCCAAGNONE 
Os04g0444800AB126084CTGGGGCCNONE 
AK067009CTGGGGCCFerric reductase-like transmembrane component family protein. 
AK070312CTGGGGCCNONE 
J065053C14CTGGGGCCNONE 
Os04g0548000011-097-D07CTGGGGCCNONE 
AK073099CTGGGGCCNONE 
AK104979CTGGGGCCProtein of unknown function DUF862, eukaryotic domain containing protein. 
J065102C18CTGGGGCCNONE 
J075076A16CTGGGGCCNONE 
J075082L09CTGGGGCCNONE 
J075092L18CTGGGGCCNONE 
J075092N01CTGGGGCCNONE 
J075122P14CTGGGGCCNONE 
J075148L06CTGGGGCCNONE 
Os04g0623600AK068129AAATGGGCCCCAGGCCCACTGTCAGTSimilar to (S)-2-hydroxy-acid oxidase, peroxisomal (EC 1.1.3.15) (Glycolate oxidase) (GOX) (Short chain alpha-hydroxy acid oxidase). 
J013126M17AAATGGGCCCCAGGCCCACTGTCAGTNONE 
J013131A08AAATGGGCCCCAGGCCCACTGTCAGTNONE 
J023133N08AAATGGGCCCCAGGCCCACTGTCAGTNONE 
Os05g0553400AK108452CTGGGGCCCAACCSimilar to Myb-related transcription factor-like protein (MYB transcription factor). 
Os06g0129200AK061998CAAGGCCCCAGNONE 
AK102435CAAGGCCCCAGConserved hypothetical protein. 
J013020E23CAAGGCCCCAGNONE 
J013156N13CAAGGCCCCAGNONE 
J023004K16CAAGGCCCCAGNONE 
J023030K17CAAGGCCCCAGNONE 
J033042G24CAAGGCCCCAGNONE 
J033042K20CAAGGCCCCAGNONE 
J033093J06CAAGGCCCCAGNONE 
J033101D07CAAGGCCCCAGNONE 
J033103H15CAAGGCCCCAGNONE 
J033119L13CAAGGCCCCAGNONE 
J033131F18CAAGGCCCCAGNONE 
J065163G16CAAGGCCCCAGNONE 
J090088B06CAAGGCCCCAGNONE 
Os06g0140700009-041-G05CTGGGGCCCCACCNONE 
AF145726CTGGGGCCCCACCNONE 
AK105150CTGGGGCCCCACCNONE 
AY206864CTGGGGCCCCACCSimilar to Homeodomain leucine zipper protein (Fragment). 
Os06g0144000AK068998TTTTGGGCCCCAGBRCT domain containing protein. 
J023001F16TTTTGGGCCCCAGNONE 
Os06g0705000J075046P19CCCACTCCCATCCACCACGGCCCCAGConserved hypothetical protein. 
J075169H23CCCACTCCCATCCACCACGGCCCCAGNONE 
Os07g0242000AK107347GGCCCCAGCCCConserved hypothetical protein. 
Os07g0474300AK108961CTGGGGCCCACAConserved hypothetical protein. 
Os07g0615900AK066317GCGGGCCCCAGZinc finger, GATA-type domain containing protein. 
AK073803GCGGGCCCCAGNONE 
J013026A07GCGGGCCCCAGNONE 
J013064I12GCGGGCCCCAGNONE 
J033068D01GCGGGCCCCAGNONE 
J033074A10GCGGGCCCCAGNONE 
J033129C06GCGGGCCCCAGNONE 
J100035K20GCGGGCCCCAGNONE 
J100044G13GCGGGCCCCAGNONE 
J100050K01GCGGGCCCCAGNONE 
J100069P20GCGGGCCCCAGNONE 
J100071O09GCGGGCCCCAGNONE 
J100086K01GCGGGCCCCAGNONE 
J100089G11GCGGGCCCCAGNONE 
Os08g0107900014-055-C03GGCCCCAGCCCNONE 
J065062G20GGCCCCAGCCCNONE 
Os08g0440500AK058761TCTGGGCCCCAGMIR domain containing protein. 
Os08g0499900J033080E06TCGTGGGCCCCAGNONE 
Os09g0133000AK099484CTGGGGCCCSWIB/MDM2 domain containing protein. 
J065132D12CTGGGGCCCNONE 
J065218C16CTGGGGCCCNONE 
Os09g0424600AK073882CTGGGGCCCACGAHAD superfamily (subfamily IG) hydrolase, 5'-Nucleotidase protein. 
Os09g0464000AK060777TAATGGGCCCCAGNONE 
AK069530TAATGGGCCCCAGSimilar to Carbonate dehydratase-like protein. 
Os09g0491660AK108335AGGTGGGCCCCAGHomeodomain-like containing protein. 
Os09g0499500J075050M22GGCCCCAGHypothetical protein. 
J075157M01GGCCCCAGNONE 
Os09g0506900AK059251CTGGGGCCNONE 
AK066669CTGGGGCCConserved hypothetical protein. 
Os09g0557900AK107999CTGGGGCCNONE 
AK108807CTGGGGCCSimilar to Protein phosphatase 2C gamma isoform (EC 3.1.3.16) (PP2C-gamma) (Protein phosphatase magnesium-dependent 1 gamma) (Protein phosphatase 1C) (Fibroblast growth factor inducible protein 13) (FIN13). 
J075028G15CTGGGGCCNONE 
J075129K23CTGGGGCCNONE 
J075159K01CTGGGGCCNONE 
J075192F10CTGGGGCCNONE 
J080018P13CTGGGGCCNONE 
J080021E17CTGGGGCCNONE 
J080022I11CTGGGGCCNONE 
J080029C07CTGGGGCCNONE 
J080034N15CTGGGGCCNONE 
J080038L24CTGGGGCCNONE 
J080039C15CTGGGGCCNONE 
J080040E11CTGGGGCCNONE 
J080055L15CTGGGGCCNONE 
J080077G08CTGGGGCCNONE 
J080080A20CTGGGGCCNONE 
Os11g0152700015-069-C04CTGGGGCCNONE 
AK069411CTGGGGCCSimilar to Transcription factor HBP-1b(C38) (Fragment). 
AK102690CTGGGGCCNONE 
Os11g0220300AK068820AATTGGGCCCCAGConserved hypothetical protein. 
Os11g0580000AK119421CTGACAGGTGGGCCCCAGArmadillo-like helical domain containing protein. 
AK121905CTGACAGGTGGGCCCCAGNONE 
J033105I06CTGACAGGTGGGCCCCAGNONE 
J090022C10CTGACAGGTGGGCCCCAGNONE 
J090024J23CTGACAGGTGGGCCCCAGNONE 
J090044F24CTGACAGGTGGGCCCCAGNONE 
Os12g0106900006-093-E08CTGGGGCCGTANONE 
AK099547CTGGGGCCGTANONE 
Os12g0134000AK066940CTGGGGCCCAGGSimilar to Hydroxymethylglutaryl-CoA lyase. 
Os12g0197400J013068J02CTGGGGCCCACCTGTCAGNONE 
J013074K04CTGGGGCCCACCTGTCAGNONE 
J013089J21CTGGGGCCCACCTGTCAGNONE 
J013170B12CTGGGGCCCACCTGTCAGNONE 
J033029L11CTGGGGCCCACCTGTCAGNONE 
J033051A07CTGGGGCCCACCTGTCAGGTP-binding protein, HSR1-related domain containing protein. 
J033092L18CTGGGGCCCACCTGTCAGNONE 
J065101D01CTGGGGCCCACCTGTCAGNONE 
J065144J23CTGGGGCCCACCTGTCAGNONE 
J065206D18CTGGGGCCCACCTGTCAGNONE 
Os12g0433200AK058760CTGGGGCCCAGAConserved hypothetical protein. 
Os12g0437800AK063833CTGGGGCCSimilar to MPI. 
AK121693CTGGGGCCNONE 
AY878693CTGGGGCCNONE 
J065021K01CTGGGGCCNONE 
J065027K12CTGGGGCCNONE 
J065031I22CTGGGGCCNONE 
J065031L17CTGGGGCCNONE 
J065056K14CTGGGGCCNONE 
J065083J01CTGGGGCCNONE 
J065095J18CTGGGGCCNONE 
J065096N19CTGGGGCCNONE 
J065098F20CTGGGGCCNONE 
J065131F07CTGGGGCCNONE 
J065135H05CTGGGGCCNONE 
J065137E03CTGGGGCCNONE 
J065141F13CTGGGGCCNONE 
J065152E02CTGGGGCCNONE 
J065159J20CTGGGGCCNONE 
J065174J02CTGGGGCCNONE 
J065175I19CTGGGGCCNONE 
J065189P13CTGGGGCCNONE 
J065198J01CTGGGGCCNONE 
J065205F13CTGGGGCCNONE 
J065216A18CTGGGGCCNONE 
J100026N16CTGGGGCCNONE 
J100032E21CTGGGGCCNONE 
J100061K15CTGGGGCCNONE 
J100087B09CTGGGGCCNONE 
Os12g0613500009-028-C05CTGGGGCCNONE 
011-081-E10CTGGGGCCNONE 
AB118018CTGGGGCCNONE 
AK058205CTGGGGCCNONE 
AK101273CTGGGGCCLissencephaly type-1-like homology motif domain containing protein. 
J033033A11CTGGGGCCNONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.