version

Summary of OsREG581 (All List)

OrganismOryza sativa  
IDOsREG581  
SequenceCTTGGGCC  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count1818  

Entry Sequences (1818 entries)

LocusGene modelSequenceDescription
Os01g0132700J065063N10GTGGCCCAAGSurfeit locus 5 family protein. 
J065164N24GTGGCCCAAGNONE 
J065167H04GTGGCCCAAGNONE 
J065187N12GTGGCCCAAGNONE 
Os01g0134200AK102394TTGGCCCAAGCAAGCCCAACAConserved hypothetical protein. 
Os01g0141100012-043-A12GCGGCCCAAGNONE 
AK062139GCGGCCCAAGNONE 
J013110M14GCGGCCCAAGNONE 
J013114F09GCGGCCCAAGNONE 
J033036J01GCGGCCCAAGNONE 
Os01g0150100J023078H07CTTGGGCCCACCTGTCNONE 
Os01g0196600AK101742CTTGGGCCAANONE 
U25430CTTGGGCCAASimilar to 260 kDa major acidic fibroblast growth factor-stimulated phosphoprotein (Fragment). 
Os01g0221300011-021-E12TCGGCCCAAGNONE 
AK073330TCGGCCCAAGConserved hypothetical protein. 
J013130J18TCGGCCCAAGNONE 
J033024A12TCGGCCCAAGNONE 
J065063H09TCGGCCCAAGNONE 
J065093G05TCGGCCCAAGNONE 
J090007K12TCGGCCCAAGNONE 
Os01g0231700012-002-F11GCCGGCCCAAGTAGGCCCAGCNONE 
013-082-F05GCCGGCCCAAGTAGGCCCAGCNONE 
AK107453GCCGGCCCAAGTAGGCCCAGCSimilar to 60S acidic ribosomal protein P2-B (CaRP2B). 
J065005L22GCCGGCCCAAGTAGGCCCAGCNONE 
J065023E21GCCGGCCCAAGTAGGCCCAGCNONE 
J065036H21GCCGGCCCAAGTAGGCCCAGCNONE 
J065037M24GCCGGCCCAAGTAGGCCCAGCNONE 
J065049L04GCCGGCCCAAGTAGGCCCAGCNONE 
J065072F17GCCGGCCCAAGTAGGCCCAGCNONE 
J065085H10GCCGGCCCAAGTAGGCCCAGCNONE 
J065109N19GCCGGCCCAAGTAGGCCCAGCNONE 
J065117M19GCCGGCCCAAGTAGGCCCAGCNONE 
J065144C15GCCGGCCCAAGTAGGCCCAGCNONE 
J065159G24GCCGGCCCAAGTAGGCCCAGCNONE 
J065164N14GCCGGCCCAAGTAGGCCCAGCNONE 
J075025K16GCCGGCCCAAGTAGGCCCAGCNONE 
J075057L05GCCGGCCCAAGTAGGCCCAGCNONE 
J075070I16GCCGGCCCAAGTAGGCCCAGCNONE 
J075089D10GCCGGCCCAAGTAGGCCCAGCNONE 
J075138F10GCCGGCCCAAGTAGGCCCAGCNONE 
J090018C11GCCGGCCCAAGTAGGCCCAGCNONE 
J100018L19GCCGGCCCAAGTAGGCCCAGCNONE 
J100024B14GCCGGCCCAAGTAGGCCCAGCNONE 
J100048L02GCCGGCCCAAGTAGGCCCAGCNONE 
J100055A22GCCGGCCCAAGTAGGCCCAGCNONE 
J100069K01GCCGGCCCAAGTAGGCCCAGCNONE 
Os01g0232700AK069972AAGGCCCAACGGCCCAAGCCCAAAASimilar to Histidinol dehydrogenase, chloroplast precursor (EC 1.1.1.23) (HDH). Splice isoform 2. 
J075090M12AAGGCCCAACGGCCCAAGCCCAAAANONE 
J075146A12AAGGCCCAACGGCCCAAGCCCAAAANONE 
Os01g0270100006-096-H09TCCGGCCCAAGNONE 
009-009-C10TCCGGCCCAAGNONE 
009-054-E06TCCGGCCCAAGNONE 
014-085-F09TCCGGCCCAAGNONE 
AK073275TCCGGCCCAAGNONE 
AK104155TCCGGCCCAAGNONE 
AK119511TCCGGCCCAAGSimilar to Cysteine protease inhibitor. 
J033025K21TCCGGCCCAAGNONE 
J075065H10TCCGGCCCAAGNONE 
J075143G10TCCGGCCCAAGNONE 
J100059J02TCCGGCCCAAGNONE 
Os01g0277500AK066984AGTTGGGCTCTTGGGCCTCSimilar to Dof3 gene (Fragment). 
J013074F19AGTTGGGCTCTTGGGCCTCNONE 
J013091E10AGTTGGGCTCTTGGGCCTCNONE 
J023077C19AGTTGGGCTCTTGGGCCTCNONE 
J033068A02AGTTGGGCTCTTGGGCCTCNONE 
J065137O05AGTTGGGCTCTTGGGCCTCNONE 
Os01g0555100AK111255CTTGGGCCCCASimilar to TATA-binding protein associated factor 2N (RNA-binding protein 56) (TAFII68) (TAF(II)68). 
Os01g0640800AK065688CTTGGGCCGCAConserved hypothetical protein 48 family protein. 
J013042L10CTTGGGCCGCANONE 
J013121H08CTTGGGCCGCANONE 
Os01g0666500AK102689CTTGGGCCGCAConserved hypothetical protein. 
Os01g0670500AK109750GTGGGACCCACTTGGGCCCCACGTGTCConserved hypothetical protein. 
Os01g0700200AK100961TAGGCCCAAGCCCATCCASimilar to Chromosome condensation regulator protein (Fragment). 
J023141C11TAGGCCCAAGCCCATCCANONE 
Os01g0706100AK072799CTTGGGCCGGTConserved hypothetical protein. 
J013049G14CTTGGGCCGGTNONE 
J023136E17CTTGGGCCGGTNONE 
Os01g0708700AK102451CAACGGCCCAAGIQ calmodulin-binding region domain containing protein. 
Os01g0725100J075035B02CTTGGGCCCGCANONE 
Os01g0733200AK066316GCGGCCCAAGCCCSimilar to Heat shock transcription factor 29 (Fragment). 
AY344493GCGGCCCAAGCCCNONE 
J013066G03GCGGCCCAAGCCCNONE 
J090034J08GCGGCCCAAGCCCNONE 
Os01g0738600AK073479GCGGCCCAAGENTH/VHS domain containing protein. 
AK120616GCGGCCCAAGNONE 
J013046M12GCGGCCCAAGNONE 
J013152B11GCGGCCCAAGNONE 
J023007A09GCGGCCCAAGNONE 
J023007N03GCGGCCCAAGNONE 
J023042A01GCGGCCCAAGNONE 
J023059P06GCGGCCCAAGNONE 
J023113A05GCGGCCCAAGNONE 
J033044K11GCGGCCCAAGNONE 
J033082E04GCGGCCCAAGNONE 
J090033B13GCGGCCCAAGNONE 
J090062H08GCGGCCCAAGNONE 
J100086G23GCGGCCCAAGNONE 
Os01g0748100AK071261GTGGCCCAAGCTGGGCCTAHypothetical protein. 
J023084C08GTGGCCCAAGCTGGGCCTANONE 
J065058A07GTGGCCCAAGCTGGGCCTANONE 
Os01g0760600011-038-B09CTTGGGCCACNONE 
AB110193CTTGGGCCACNONE 
AK103133CTTGGGCCACNONE 
AK104829CTTGGGCCACNONE 
D14673CTTGGGCCACNONE 
J023110C16CTTGGGCCACNONE 
J033028M22CTTGGGCCACNONE 
J033038A21CTTGGGCCACNONE 
J033044D24CTTGGGCCACNONE 
J033095C16CTTGGGCCACNONE 
J090003F07CTTGGGCCACNONE 
J090009P10CTTGGGCCACNONE 
J090023K01CTTGGGCCACNONE 
J090033G02CTTGGGCCACNONE 
J090037I22CTTGGGCCACNONE 
J090038A17CTTGGGCCACNONE 
J090048K09CTTGGGCCACNONE 
J090069N01CTTGGGCCACNONE 
J090078C19CTTGGGCCACNONE 
J090089P15CTTGGGCCACNONE 
J090093D07CTTGGGCCACNONE 
J090095H01CTTGGGCCACNONE 
J100057J03CTTGGGCCACNONE 
Os01g0772200AK060471GCGGCCCAAGTranscription initiation factor IIF, beta subunit family protein. 
AK103491GCGGCCCAAGNONE 
J023093E05GCGGCCCAAGNONE 
J023101M03GCGGCCCAAGNONE 
J033130N17GCGGCCCAAGNONE 
J043021L02GCGGCCCAAGNONE 
J065001E22GCGGCCCAAGNONE 
J065070G06GCGGCCCAAGNONE 
J065081D15GCGGCCCAAGNONE 
J065123G09GCGGCCCAAGNONE 
J065170K04GCGGCCCAAGNONE 
J065187A01GCGGCCCAAGNONE 
J065210E10GCGGCCCAAGNONE 
J075172K06GCGGCCCAAGNONE 
Os01g0801700AK073813TTCGGCCCAAGGCCCConserved hypothetical protein. 
J033067K14TTCGGCCCAAGGCCCNONE 
Os01g0805000009-045-H11TTGGCCCAAGNONE 
009-196-H08TTGGCCCAAGNONE 
J013094D22TTGGCCCAAGRibosomal protein L34 family protein. 
J013119F23TTGGCCCAAGNONE 
J065128B11TTGGCCCAAGNONE 
Os01g0805800006-057-H04GCCGGCCCAAGNONE 
006-106-H01GCCGGCCCAAGNONE 
AK059963GCCGGCCCAAGNONE 
AK103408GCCGGCCCAAGRNA polymerase Rpb5, N-terminal domain containing protein. 
Os01g0825500AK060613CTTGGGCCATNONE 
AK072321CTTGGGCCATNONE 
AK103941CTTGGGCCATNodulin-like domain containing protein. 
J075053A14CTTGGGCCATNONE 
J075151J22CTTGGGCCATNONE 
J075174K14CTTGGGCCATNONE 
Os01g0842200003-126-E01TCTGGCCCAAGNONE 
AK102593TCTGGCCCAAGNONE 
AK119896TCTGGCCCAAGSimilar to Scarecrow-like 9 (Fragment). 
J013151G12TCTGGCCCAAGNONE 
J033098G15TCTGGCCCAAGNONE 
J090041L03TCTGGCCCAAGNONE 
J090069J20TCTGGCCCAAGNONE 
Os01g0851100AK071217GCGGCCCAAGNONE 
Os01g0852200AK063954CCAGGCCCAAGCCCNONE 
Os01g0854800AK109676CTTGGGCCGASimilar to Cytochrome P450 86A1 (EC 1.14.-.-) (CYPLXXXVI) (P450-dependent fatty acid omega-hydroxylase). 
J100041A10CTTGGGCCGANONE 
Os01g0863166J065007F23CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
J065124H21CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGConserved hypothetical protein. 
Os01g0887700AF045571TCTGGGCCTTGGGCCTTNONE 
AF047428TCTGGGCCTTGGGCCTTNONE 
AK071139TCTGGGCCTTGGGCCTTZinc finger, FYVE/PHD-type domain containing protein. 
J023082D05TCTGGGCCTTGGGCCTTNONE 
J065062L19TCTGGGCCTTGGGCCTTNONE 
J065116H15TCTGGGCCTTGGGCCTTNONE 
J065194N09TCTGGGCCTTGGGCCTTNONE 
J100074C19TCTGGGCCTTGGGCCTTNONE 
Os01g0939700AK059803GCGGCCCAAGNONE 
AK070588GCGGCCCAAGSimilar to Esterase D (EC 3.1.1.1). 
AK111469GCGGCCCAAGNONE 
J090021L11GCGGCCCAAGNONE 
Os01g0944700006-058-E06CTTGGGCCGTGGNONE 
006-065-A04CTTGGGCCGTGGNONE 
006-076-E07CTTGGGCCGTGGNONE 
006-087-A09CTTGGGCCGTGGNONE 
006-091-B05CTTGGGCCGTGGNONE 
006-105-C12CTTGGGCCGTGGNONE 
006-108-G03CTTGGGCCGTGGNONE 
006-113-C02CTTGGGCCGTGGNONE 
006-115-G03CTTGGGCCGTGGNONE 
009-047-H03CTTGGGCCGTGGNONE 
009-120-E11CTTGGGCCGTGGNONE 
009-195-C06CTTGGGCCGTGGNONE 
009-199-D12CTTGGGCCGTGGNONE 
013-006-E01CTTGGGCCGTGGNONE 
013-025-C06CTTGGGCCGTGGNONE 
013-035-D10CTTGGGCCGTGGNONE 
AF443600CTTGGGCCGTGGNONE 
AK070056CTTGGGCCGTGGSimilar to Beta-1,3-glucanase precursor. 
J013106C20CTTGGGCCGTGGNONE 
J023023O17CTTGGGCCGTGGNONE 
J023038J21CTTGGGCCGTGGNONE 
J023041A20CTTGGGCCGTGGNONE 
J023066P09CTTGGGCCGTGGNONE 
J023072F21CTTGGGCCGTGGNONE 
J023090L19CTTGGGCCGTGGNONE 
J023093M17CTTGGGCCGTGGNONE 
J023120D21CTTGGGCCGTGGNONE 
J023134O19CTTGGGCCGTGGNONE 
J023141D14CTTGGGCCGTGGNONE 
J033026N18CTTGGGCCGTGGNONE 
J033048M05CTTGGGCCGTGGNONE 
J033070N13CTTGGGCCGTGGNONE 
J033143C11CTTGGGCCGTGGNONE 
J033143O12CTTGGGCCGTGGNONE 
J043015L22CTTGGGCCGTGGNONE 
J053048D16CTTGGGCCGTGGNONE 
J053053L14CTTGGGCCGTGGNONE 
J053059O17CTTGGGCCGTGGNONE 
J053060N14CTTGGGCCGTGGNONE 
J053077B10CTTGGGCCGTGGNONE 
J053090L06CTTGGGCCGTGGNONE 
J053090M04CTTGGGCCGTGGNONE 
J075032N21CTTGGGCCGTGGNONE 
J075074O15CTTGGGCCGTGGNONE 
J075078I24CTTGGGCCGTGGNONE 
J090081N23CTTGGGCCGTGGNONE 
Os01g0946200AK071060CACGGCCCAAGNo apical meristem (NAM) protein domain containing protein. 
J023080K20CACGGCCCAAGNONE 
Os01g0949700AK069037ATGGCCCAAGNONE 
J023004F17ATGGCCCAAGNONE 
J065063D04ATGGCCCAAGNONE 
J065196H02ATGGCCCAAGNONE 
J075198A05ATGGCCCAAGNONE 
Os01g0952600AK067525CTTGGGCCCATACNONE 
AK070047CTTGGGCCCATACSimilar to LacZ (Fragment). 
Os01g0954000009-097-H04CTTGGGCCATNONE 
AK062729CTTGGGCCATNADPH-dependent FMN reductase family protein. 
Os01g0960300AK100099TGCGGCCCAAGSimilar to Glucose inhibited division protein A. 
Os01g0970900011-018-A07AAGGCCCAAGNONE 
011-022-E12AAGGCCCAAGNONE 
AK063285AAGGCCCAAGNONE 
AK101688AAGGCCCAAGProtein prenyltransferase domain containing protein. 
J100042L01AAGGCCCAAGNONE 
J100053B11AAGGCCCAAGNONE 
Os01g0978100005-013-E01GTGGCCCAAGNONE 
011-026-E02GTGGCCCAAGNONE 
011-064-C01GTGGCCCAAGNONE 
AK065007GTGGCCCAAGNONE 
AK065652GTGGCCCAAGSimilar to Cysteine synthase, mitochondrial precursor (EC 2.5.1.47) (O- acetylserine sulfhydrylase) (O-acetylserine (Thiol)-lyase) (CSase C) (CS-C) (OAS-TL C) (AtCS-C). 
AK099217GTGGCCCAAGNONE 
AK104704GTGGCCCAAGNONE 
J013001E19GTGGCCCAAGNONE 
J013034J22GTGGCCCAAGNONE 
J013037A05GTGGCCCAAGNONE 
J013038D12GTGGCCCAAGNONE 
J013043A14GTGGCCCAAGNONE 
J013044E11GTGGCCCAAGNONE 
J013058F11GTGGCCCAAGNONE 
J013059C10GTGGCCCAAGNONE 
J013059E23GTGGCCCAAGNONE 
J013071O13GTGGCCCAAGNONE 
J013072D12GTGGCCCAAGNONE 
J013096G01GTGGCCCAAGNONE 
J013110E17GTGGCCCAAGNONE 
J013130A19GTGGCCCAAGNONE 
J013158G08GTGGCCCAAGNONE 
J023037H20GTGGCCCAAGNONE 
J023038G11GTGGCCCAAGNONE 
J023042A17GTGGCCCAAGNONE 
J023045C21GTGGCCCAAGNONE 
J023052H13GTGGCCCAAGNONE 
J023055O19GTGGCCCAAGNONE 
J023065I12GTGGCCCAAGNONE 
J023087I12GTGGCCCAAGNONE 
J023114D12GTGGCCCAAGNONE 
J023126P03GTGGCCCAAGNONE 
J023132E20GTGGCCCAAGNONE 
J023133N04GTGGCCCAAGNONE 
J023134C14GTGGCCCAAGNONE 
J033039O20GTGGCCCAAGNONE 
J033067L02GTGGCCCAAGNONE 
J033094O10GTGGCCCAAGNONE 
J043017P11GTGGCCCAAGNONE 
J043036C15GTGGCCCAAGNONE 
J053090I03GTGGCCCAAGNONE 
J065013F14GTGGCCCAAGNONE 
J065019J10GTGGCCCAAGNONE 
J065036E05GTGGCCCAAGNONE 
J065040L23GTGGCCCAAGNONE 
J065050A13GTGGCCCAAGNONE 
J065089D03GTGGCCCAAGNONE 
J065193N04GTGGCCCAAGNONE 
J080011O20GTGGCCCAAGNONE 
J080015K08GTGGCCCAAGNONE 
J080022G05GTGGCCCAAGNONE 
J080027N24GTGGCCCAAGNONE 
J080032G19GTGGCCCAAGNONE 
J080046A18GTGGCCCAAGNONE 
J080046B08GTGGCCCAAGNONE 
J080051L24GTGGCCCAAGNONE 
J080053C23GTGGCCCAAGNONE 
J080054I20GTGGCCCAAGNONE 
J080074J03GTGGCCCAAGNONE 
J080080M04GTGGCCCAAGNONE 
J080080P15GTGGCCCAAGNONE 
J080086L08GTGGCCCAAGNONE 
J090019O07GTGGCCCAAGNONE 
J090033L11GTGGCCCAAGNONE 
J090036M14GTGGCCCAAGNONE 
J100054D04GTGGCCCAAGNONE 
J100064M06GTGGCCCAAGNONE 
Os02g0135600AK069843GAGGCCCAAGConserved hypothetical protein. 
J023034H09GAGGCCCAAGNONE 
J033090D08GAGGCCCAAGNONE 
J100025N07GAGGCCCAAGNONE 
J100075G18GAGGCCCAAGNONE 
Os02g0135700AK100570CTTGGGCCTCDNA polymerase V family protein. 
Os02g0169000AK101628CAAGGCCCAAGConserved hypothetical protein. 
Os02g0176300AK066588TGTTGGGCTTGGGCCTCGGCCCAGGConserved hypothetical protein. 
J013072N24TGTTGGGCTTGGGCCTCGGCCCAGGNONE 
Os02g0190900AK111037GTGGGGGCCCAAGPhytoene dehydrogenase-like protein. 
Os02g0190950J075001E02CTTGGGCCCCCACConserved hypothetical protein. 
J075117E23CTTGGGCCCCCACNONE 
J075117F23CTTGGGCCCCCACNONE 
J075144M12CTTGGGCCCCCACNONE 
J075145H10CTTGGGCCCCCACNONE 
J075186B15CTTGGGCCCCCACNONE 
Os02g0255200AK121591AAGGCCCAAGGCCCATTASimilar to Ribosomal protein S15a homolog. 
J033023N03AAGGCCCAAGGCCCATTANONE 
J033031C22AAGGCCCAAGGCCCATTANONE 
J033037P22AAGGCCCAAGGCCCATTANONE 
J090013J10AAGGCCCAAGGCCCATTANONE 
J090030I04AAGGCCCAAGGCCCATTANONE 
Os02g0301400AK121646GCGGCCCAAGThioredoxin-like fold domain containing protein. 
J033028E10GCGGCCCAAGNONE 
J033058J23GCGGCCCAAGNONE 
Os02g0317800J033050F18TTTTGGGCCCAAGNONE 
J075032I21TTTTGGGCCCAAGNONE 
J075108K06TTTTGGGCCCAAGNONE 
J075120B04TTTTGGGCCCAAGNONE 
J080315C12TTTTGGGCCCAAGConserved hypothetical protein. 
J100056L07TTTTGGGCCCAAGNONE 
Os02g0441000AK108073CTTGGGCCCACTTGConserved hypothetical protein. 
Os02g0445700011-046-C10GCGGCCCAAGNONE 
Os02g0525400011-008-B01CAAGGCCCAAGNONE 
AK065368CAAGGCCCAAGSimilar to Molybdenum cofactor synthesis protein 3 (Molybdopterin synthase sulfurylase) (MPT synthase sulfurylase). 
J013021B13CAAGGCCCAAGNONE 
J033046H10CAAGGCCCAAGNONE 
Os02g0543200AK100963GTGGCCCAAGCyclin-like F-box domain containing protein. 
Os02g0593400016-051-C08CTTGGGCCGGCCCNONE 
AK064226CTTGGGCCGGCCCNONE 
AK072362CTTGGGCCGGCCCConserved hypothetical protein. 
AK109015CTTGGGCCGGCCCNONE 
J023063B12CTTGGGCCGGCCCNONE 
J065192M02CTTGGGCCGGCCCNONE 
J075182N05CTTGGGCCGGCCCNONE 
Os02g0634800003-004-F03CTTGGGCCGGANONE 
AK059694CTTGGGCCGGAUbiquitin-conjugating enzyme, E2 domain containing protein. 
J013067H17CTTGGGCCGGANONE 
J053077G20CTTGGGCCGGANONE 
J075195F14CTTGGGCCGGANONE 
Os02g0634900006-032-G12TCCGGCCCAAGNONE 
006-033-E09TCCGGCCCAAGNONE 
006-117-F10TCCGGCCCAAGNONE 
006-118-E01TCCGGCCCAAGNONE 
013-056-G08TCCGGCCCAAGNONE 
AK059769TCCGGCCCAAGNONE 
AK068583TCCGGCCCAAGNONE 
AK072855TCCGGCCCAAGProteasome subunit alpha type 2 (EC 3.4.25.1) (20S proteasome alpha subunit B) (20S proteasome subunit alpha-2). 
AK106210TCCGGCCCAAGNONE 
J023138P05TCCGGCCCAAGNONE 
J023143J07TCCGGCCCAAGNONE 
J033022O09TCCGGCCCAAGNONE 
J033111L02TCCGGCCCAAGNONE 
J033135O03TCCGGCCCAAGNONE 
J065005K19TCCGGCCCAAGNONE 
J065044C17TCCGGCCCAAGNONE 
J065116K09TCCGGCCCAAGNONE 
J065119O21TCCGGCCCAAGNONE 
J075014L05TCCGGCCCAAGNONE 
J075109H16TCCGGCCCAAGNONE 
J075117D04TCCGGCCCAAGNONE 
Os02g0646400AK067828AATGGGCCCAAGSimilar to Glutaredoxin. 
J013120N01AATGGGCCCAAGNONE 
J065021N01AATGGGCCCAAGNONE 
J065021N02AATGGGCCCAAGNONE 
J065053O18AATGGGCCCAAGNONE 
J090067J17AATGGGCCCAAGNONE 
Os02g0651500AK066333TGGGGCCCAAGNONE 
AK121865TGGGGCCCAAGHypothetical protein. 
J090038J11TGGGGCCCAAGNONE 
Os02g0655300006-024-H05TACGGCCCAAGNONE 
006-032-G04TACGGCCCAAGNONE 
006-045-F03TACGGCCCAAGNONE 
006-076-D04TACGGCCCAAGNONE 
006-086-C09TACGGCCCAAGNONE 
006-104-C07TACGGCCCAAGNONE 
AK061544TACGGCCCAAGNONE 
AK103778TACGGCCCAAGNONE 
AK106107TACGGCCCAAGNONE 
AK120006TACGGCCCAAGNONE 
AY363174TACGGCCCAAGSimilar to 3-isopropylmalate dehydratase, small subunit. 
J033145B21TACGGCCCAAGNONE 
J065021C16TACGGCCCAAGNONE 
J065182F01TACGGCCCAAGNONE 
J075063I18TACGGCCCAAGNONE 
J075151E01TACGGCCCAAGNONE 
J075198K18TACGGCCCAAGNONE 
J090026M06TACGGCCCAAGNONE 
J090081H02TACGGCCCAAGNONE 
J100061E20TACGGCCCAAGNONE 
Os02g0658300AK073923CTTGGGCCAAConserved hypothetical protein. 
J065152M15CTTGGGCCAANONE 
Os02g0665400AK073914CTTGGGCCACNONE 
AK073914CTTGGGCCTANONE 
AK109787CTTGGGCCACNONE 
AK109787CTTGGGCCTANONE 
AK120141CTTGGGCCACSimilar to Interleukin-1 receptor-associated kinase 1 (EC 2.7.1.37) (IRAK-1). Splice isoform 2. 
AK120141CTTGGGCCTASimilar to Interleukin-1 receptor-associated kinase 1 (EC 2.7.1.37) (IRAK-1). Splice isoform 2. 
J065021I19CTTGGGCCACNONE 
J065021I19CTTGGGCCTANONE 
J075165B08CTTGGGCCACNONE 
J075165B08CTTGGGCCTANONE 
J075177B03CTTGGGCCACNONE 
J075177B03CTTGGGCCTANONE 
J075191K02CTTGGGCCACNONE 
J075191K02CTTGGGCCTANONE 
J090051I12CTTGGGCCACNONE 
J090051I12CTTGGGCCTANONE 
J090057E21CTTGGGCCACNONE 
J090057E21CTTGGGCCTANONE 
J090058E01CTTGGGCCACNONE 
J090058E01CTTGGGCCTANONE 
J090087C06CTTGGGCCACNONE 
J090087C06CTTGGGCCTANONE 
J100025K07CTTGGGCCACNONE 
J100025K07CTTGGGCCTANONE 
J100026I21CTTGGGCCACNONE 
J100026I21CTTGGGCCTANONE 
J100041E12CTTGGGCCACNONE 
J100041E12CTTGGGCCTANONE 
J100083B01CTTGGGCCACNONE 
J100083B01CTTGGGCCTANONE 
Os02g0667300009-057-D01GTATGGGCCCAAGNONE 
AK058228GTATGGGCCCAAGAlcohol dehydrogenase superfamily, zinc-containing protein. 
AK099066GTATGGGCCCAAGNONE 
Os02g0697600011-021-B01CTTGGGCCGCANONE 
AK121757CTTGGGCCGCAAAA ATPase domain containing protein. 
Os02g0741500AK068867CCATGGGCCTTGGGCCGAGRibbon-helix-helix domain containing protein. 
Os02g0778200AK065948ACCGGCCCAAGTTGGCCCAAGAminoacyl-tRNA synthetase, class I family protein. 
Os02g0780500AK072784CTTGGGCCGGANONE 
AK121143CTTGGGCCGGAConserved hypothetical protein. 
J023075M13CTTGGGCCGGANONE 
J023077P14CTTGGGCCGGANONE 
J023123C16CTTGGGCCGGANONE 
J023142P06CTTGGGCCGGANONE 
Os02g0788500006-024-A02AAACGGCCCAAGNONE 
006-031-G02AAACGGCCCAAGNONE 
006-081-F11AAACGGCCCAAGNONE 
006-082-H05AAACGGCCCAAGNONE 
AK061452AAACGGCCCAAGConserved hypothetical protein. 
AK104117AAACGGCCCAAGNONE 
AK104526AAACGGCCCAAGNONE 
J075024D11AAACGGCCCAAGNONE 
J075056B12AAACGGCCCAAGNONE 
J075108H12AAACGGCCCAAGNONE 
J075156P10AAACGGCCCAAGNONE 
J075197A19AAACGGCCCAAGNONE 
Os02g0800000J100043O08GCTGGGCCTTGGGCCTTGGGCTNONE 
J100064O18GCTGGGCCTTGGGCCTTGGGCTNONE 
Os02g0801900006-113-E02CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
AK109488CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
AK109498CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGConserved hypothetical protein. 
J065007D19CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
J065035G11CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
J065044E05CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
J065112N01CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
J065143B03CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
J065159A16CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
J090007K23CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
J090045N09CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
J090049L20CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGNONE 
Os02g0805600006-054-D07CCAGGCCCAAGGCCCATCTNONE 
AK059822CCAGGCCCAAGGCCCATCTNONE 
AK099516CCAGGCCCAAGGCCCATCTSimilar to Alcohol dehydrogenase, zinc-containing. 
AK104587CCAGGCCCAAGGCCCATCTNONE 
J065037H22CCAGGCCCAAGGCCCATCTNONE 
J090015P17CCAGGCCCAAGGCCCATCTNONE 
Os02g0810300AK059363TCGGCCCAAGGCCCAGTASimilar to NBD-like protein. 
AK099203TCGGCCCAAGGCCCAGTANONE 
Os03g0124300AK069148CTTGGGCCAAConserved hypothetical protein. 
AK106076CTTGGGCCAANONE 
J023003G19CTTGGGCCAANONE 
Os03g0132900006-025-D05CACGGCCCAAGNONE 
006-080-C01CACGGCCCAAGNONE 
AF001501CACGGCCCAAGNONE 
AK059871CACGGCCCAAGNONE 
AK099355CACGGCCCAAGSimilar to Chitinase (EC 3.2.1.14) (Fragment). 
J033022O03CACGGCCCAAGNONE 
J033044P19CACGGCCCAAGNONE 
J033119B12CACGGCCCAAGNONE 
J075009H20CACGGCCCAAGNONE 
J075122E04CACGGCCCAAGNONE 
J075161D07CACGGCCCAAGNONE 
Os03g0146400AK111974GCGGCCCAAGSimilar to Lethal leaf-spot 1 (Fragment). 
AK120554GCGGCCCAAGNONE 
J075060J10GCGGCCCAAGNONE 
Os03g0182600006-028-E05CTTGGGCCGGCCCATGNONE 
006-047-F10CTTGGGCCGGCCCATGNONE 
009-123-C08CTTGGGCCGGCCCATGNONE 
016-033-G05CTTGGGCCGGCCCATGNONE 
AK061289CTTGGGCCGGCCCATGRibosomal protein S2 family protein. 
AK066899CTTGGGCCGGCCCATGNONE 
J013065H05CTTGGGCCGGCCCATGNONE 
J023012F15CTTGGGCCGGCCCATGNONE 
J023065M10CTTGGGCCGGCCCATGNONE 
J033079N15CTTGGGCCGGCCCATGNONE 
J033109E21CTTGGGCCGGCCCATGNONE 
J033148M14CTTGGGCCGGCCCATGNONE 
J043015G23CTTGGGCCGGCCCATGNONE 
J043022M01CTTGGGCCGGCCCATGNONE 
J053060D01CTTGGGCCGGCCCATGNONE 
J053062E24CTTGGGCCGGCCCATGNONE 
J053096N12CTTGGGCCGGCCCATGNONE 
J053098N02CTTGGGCCGGCCCATGNONE 
J090024N09CTTGGGCCGGCCCATGNONE 
J090027G22CTTGGGCCGGCCCATGNONE 
J090043C10CTTGGGCCGGCCCATGNONE 
J090063F05CTTGGGCCGGCCCATGNONE 
J090066J05CTTGGGCCGGCCCATGNONE 
J090073I17CTTGGGCCGGCCCATGNONE 
J090087L04CTTGGGCCGGCCCATGNONE 
J100075O12CTTGGGCCGGCCCATGNONE 
Os03g0184600AK065264CTTGGGCCCGCNAD-dependent epimerase/dehydratase family protein. 
Os03g0198400AK059522CTGGCCCAACTTGGGCCCATCCNONE 
AK103101CTGGCCCAACTTGGGCCCATCCSimilar to Seryl-tRNA synthetase (EC 6.1.1.11) (Serine--tRNA ligase) (SerRS) (Fragment). 
J075015H19CTGGCCCAACTTGGGCCCATCCNONE 
J075036K08CTGGCCCAACTTGGGCCCATCCNONE 
J075040J23CTGGCCCAACTTGGGCCCATCCNONE 
J075041H18CTGGCCCAACTTGGGCCCATCCNONE 
J075053H18CTGGCCCAACTTGGGCCCATCCNONE 
J075055K15CTGGCCCAACTTGGGCCCATCCNONE 
J075111K03CTGGCCCAACTTGGGCCCATCCNONE 
J075125B22CTGGCCCAACTTGGGCCCATCCNONE 
J075195L10CTGGCCCAACTTGGGCCCATCCNONE 
Os03g0263500006-112-E09GTGGGCTTGGGCCCAAAANONE 
009-122-C01GTGGGCTTGGGCCCAAAANONE 
AK106060GTGGGCTTGGGCCCAAAASimilar to Splicing factor 3A subunit 2 (Spliceosome associated protein 62) (SAP 62) (SF3a66). 
Os03g0268300AK102684AGGGCCCAAGSimilar to Digalactosyldiacylglycerol synthase 2. 
AK102684TAGGCCCAAGCCCAACCSimilar to Digalactosyldiacylglycerol synthase 2. 
J013043J22AGGGCCCAAGNONE 
J013043J22TAGGCCCAAGCCCAACCNONE 
J013057J23AGGGCCCAAGNONE 
J013057J23TAGGCCCAAGCCCAACCNONE 
J013149I10AGGGCCCAAGNONE 
J013149I10TAGGCCCAAGCCCAACCNONE 
J013149M20AGGGCCCAAGNONE 
J013149M20TAGGCCCAAGCCCAACCNONE 
J013151D14AGGGCCCAAGNONE 
J013151D14TAGGCCCAAGCCCAACCNONE 
J013162O11AGGGCCCAAGNONE 
J013162O11TAGGCCCAAGCCCAACCNONE 
J023001F12AGGGCCCAAGNONE 
J023001F12TAGGCCCAAGCCCAACCNONE 
J023031B21AGGGCCCAAGNONE 
J023031B21TAGGCCCAAGCCCAACCNONE 
J023080A07AGGGCCCAAGNONE 
J023080A07TAGGCCCAAGCCCAACCNONE 
J023081N04AGGGCCCAAGNONE 
J023081N04TAGGCCCAAGCCCAACCNONE 
J023090C08AGGGCCCAAGNONE 
J023090C08TAGGCCCAAGCCCAACCNONE 
J023134G05AGGGCCCAAGNONE 
J023134G05TAGGCCCAAGCCCAACCNONE 
J023139G17AGGGCCCAAGNONE 
J023139G17TAGGCCCAAGCCCAACCNONE 
J023143I10AGGGCCCAAGNONE 
J023143I10TAGGCCCAAGCCCAACCNONE 
J023147D04AGGGCCCAAGNONE 
J023147D04TAGGCCCAAGCCCAACCNONE 
J023147O15AGGGCCCAAGNONE 
J023147O15TAGGCCCAAGCCCAACCNONE 
J033102K23AGGGCCCAAGNONE 
J033102K23TAGGCCCAAGCCCAACCNONE 
J033106C17AGGGCCCAAGNONE 
J033106C17TAGGCCCAAGCCCAACCNONE 
J075033G19AGGGCCCAAGNONE 
J075033G19TAGGCCCAAGCCCAACCNONE 
J075039J18AGGGCCCAAGNONE 
J075039J18TAGGCCCAAGCCCAACCNONE 
J075050K20AGGGCCCAAGNONE 
J075050K20TAGGCCCAAGCCCAACCNONE 
J075075J03AGGGCCCAAGNONE 
J075075J03TAGGCCCAAGCCCAACCNONE 
J075080E16AGGGCCCAAGNONE 
J075080E16TAGGCCCAAGCCCAACCNONE 
J075086L08AGGGCCCAAGNONE 
J075086L08TAGGCCCAAGCCCAACCNONE 
J075091K19AGGGCCCAAGNONE 
J075091K19TAGGCCCAAGCCCAACCNONE 
J075099O20AGGGCCCAAGNONE 
J075099O20TAGGCCCAAGCCCAACCNONE 
J075104I06AGGGCCCAAGNONE 
J075104I06TAGGCCCAAGCCCAACCNONE 
J075137C16AGGGCCCAAGNONE 
J075137C16TAGGCCCAAGCCCAACCNONE 
J075152G03AGGGCCCAAGNONE 
J075152G03TAGGCCCAAGCCCAACCNONE 
J075176N12AGGGCCCAAGNONE 
J075176N12TAGGCCCAAGCCCAACCNONE 
J100086K11AGGGCCCAAGNONE 
J100086K11TAGGCCCAAGCCCAACCNONE 
Os03g0276500011-014-A06AACGGCCCAAGNONE 
012-043-E04AACGGCCCAAGNONE 
012-096-G01AACGGCCCAAGNONE 
014-005-A07AACGGCCCAAGNONE 
014-031-F09AACGGCCCAAGNONE 
014-040-C09AACGGCCCAAGNONE 
014-092-G02AACGGCCCAAGNONE 
AK072830AACGGCCCAAGNONE 
AK099275AACGGCCCAAGNONE 
AK109474AACGGCCCAAGSimilar to Heat shock protein 70. 
J013036E08AACGGCCCAAGNONE 
J013047P03AACGGCCCAAGNONE 
J013048H14AACGGCCCAAGNONE 
J013060E24AACGGCCCAAGNONE 
J013093N10AACGGCCCAAGNONE 
J013123K11AACGGCCCAAGNONE 
J013153C09AACGGCCCAAGNONE 
J023010D20AACGGCCCAAGNONE 
J023027O13AACGGCCCAAGNONE 
J023029B01AACGGCCCAAGNONE 
J023063G14AACGGCCCAAGNONE 
J023083D09AACGGCCCAAGNONE 
J023091M13AACGGCCCAAGNONE 
J023121M10AACGGCCCAAGNONE 
J023126D10AACGGCCCAAGNONE 
J023139H01AACGGCCCAAGNONE 
J023145B18AACGGCCCAAGNONE 
J033029G15AACGGCCCAAGNONE 
J033050K13AACGGCCCAAGNONE 
J033057L09AACGGCCCAAGNONE 
J033092M15AACGGCCCAAGNONE 
J065007N14AACGGCCCAAGNONE 
J065038E07AACGGCCCAAGNONE 
J065043A09AACGGCCCAAGNONE 
J065100C19AACGGCCCAAGNONE 
J065117C02AACGGCCCAAGNONE 
J065213I04AACGGCCCAAGNONE 
J090001F01AACGGCCCAAGNONE 
J090025D07AACGGCCCAAGNONE 
J090037C11AACGGCCCAAGNONE 
J090047N11AACGGCCCAAGNONE 
J090053O05AACGGCCCAAGNONE 
J090070F11AACGGCCCAAGNONE 
J090082O16AACGGCCCAAGNONE 
J090085F20AACGGCCCAAGNONE 
J090096N08AACGGCCCAAGNONE 
Os03g0279400AK101851CCACGGCCCAAGSimilar to Arginine biosynthesis bifunctional protein argJ 1 [Includes: Glutamate N-acetyltransferase (EC 2.3.1.35) (Ornithine acetyltransferase) (Ornithine transacetylase) (OATase); Amino-acid acetyltransferase (EC 2.3.1.1) (N-acetylglutamate synthase) (AGS)] [Contains: Arginine biosynthesis bifunctional protein argJ1 alpha chain; Arginine biosynthesis bifunctional protein argJ1 beta chain]. 
AK106253CCACGGCCCAAGNONE 
J023079P21CCACGGCCCAAGNONE 
J023120G14CCACGGCCCAAGNONE 
J090042F16CCACGGCCCAAGNONE 
Os03g0283300AK070169ATGGCCCAAGGGCCCATTTConserved hypothetical protein. 
Os03g0284000Os03g0284000CTTGGGCCGTGCTTGGGCTGCConserved hypothetical protein. 
Os03g0284600AK110712GAGGCCCAAGThioredoxin fold domain containing protein. 
Os03g0287900009-074-B07GGCCCGGCCCAAGNONE 
014-027-E07GGCCCGGCCCAAGNONE 
AK063663GGCCCGGCCCAAGSimilar to Protein disulfide isomerase. 
J065009N21GGCCCGGCCCAAGNONE 
Os03g0294600AK110762TCTGGCCCAAGSimilar to Importin-beta1. 
Os03g0309800004-019-H07CTTGGGCCCAAGCCCAACNONE 
AK060922CTTGGGCCCAAGCCCAACNONE 
AK098942CTTGGGCCCAAGCCCAACNONE 
AK106141CTTGGGCCCAAGCCCAACNONE 
AK111530CTTGGGCCCAAGCCCAACNONE 
AK111624CTTGGGCCCAAGCCCAACSimilar to PPR2. 
J013024C10CTTGGGCCCAAGCCCAACNONE 
J013043D15CTTGGGCCCAAGCCCAACNONE 
J013108I11CTTGGGCCCAAGCCCAACNONE 
J100058L07CTTGGGCCCAAGCCCAACNONE 
J100071I19CTTGGGCCCAAGCCCAACNONE 
Os03g0312600AK073391CTTGGGCCGGCSimilar to XPA-binding protein 1 (HUSSY-23). 
Os03g0335100AK107094CTTGGGCCGTTConserved hypothetical protein. 
Os03g0338600AK066604CTTGGGCCGAtRNA pseudouridine synthase family protein. 
Os03g0343900009-077-C03ACAGCCCAAGGCCCAAGNONE 
AK105813ACAGCCCAAGGCCCAAGPhotosystem II protein PsbX family protein. 
J100059N03ACAGCCCAAGGCCCAAGNONE 
J100079C20ACAGCCCAAGGCCCAAGNONE 
Os03g0344100009-166-F10CTTGGGCCGTGNONE 
AK061903CTTGGGCCGTGNONE 
AK065547CTTGGGCCGTGSimilar to ASF/SF2-like pre-mRNA splicing factor SRP32''. 
J023095G24CTTGGGCCGTGNONE 
J033087C06CTTGGGCCGTGNONE 
J053073I09CTTGGGCCGTGNONE 
J065189D11CTTGGGCCGTGNONE 
J090032B15CTTGGGCCGTGNONE 
Os03g0405500AK069583ATGGCCCAAGSimilar to PDI-like protein. 
Os03g0438400AK070383AAGGCCCAAGCCCAATAConserved hypothetical protein. 
J023054E02AAGGCCCAAGCCCAATANONE 
Os03g0577000012-055-F04CTTGGGCCTANONE 
AK061051CTTGGGCCTASimilar to Ribosomal protein S3 (Fragment). 
AK099146CTTGGGCCTANONE 
J065060A01CTTGGGCCTANONE 
J075079B17CTTGGGCCTANONE 
J075134K12CTTGGGCCTANONE 
J090048F23CTTGGGCCTANONE 
J090072I19CTTGGGCCTANONE 
J100087C19CTTGGGCCTANONE 
J100090C21CTTGGGCCTANONE 
Os03g0578200003-117-B07TCGTGGGCCCAAGNONE 
009-175-C06TCGTGGGCCCAAGNONE 
009-179-H05TCGTGGGCCCAAGNONE 
013-078-G11TCGTGGGCCCAAGNONE 
AK062224TCGTGGGCCCAAGNONE 
AK120432TCGTGGGCCCAAGConserved hypothetical protein. 
J013096L16TCGTGGGCCCAAGNONE 
J100042G12TCGTGGGCCCAAGNONE 
J100069F04TCGTGGGCCCAAGNONE 
J100073H14TCGTGGGCCCAAGNONE 
Os03g0633800AK073044GGGCTTGGGCCGTGGTGGGTGGGCCCCACACSimilar to IAA6 (Fragment). 
J065038L22GGGCTTGGGCCGTGGTGGGTGGGCCCCACACNONE 
J065185C13GGGCTTGGGCCGTGGTGGGTGGGCCCCACACNONE 
Os03g0651700006-061-B11GAGGCCCAAGNONE 
AK059828GAGGCCCAAGConserved hypothetical protein. 
Os03g0704400AK101297AAGGCCCAAGProtein kinase domain containing protein. 
AK101297CTTGGGCCAGProtein kinase domain containing protein. 
J033033I19AAGGCCCAAGNONE 
J033033I19CTTGGGCCAGNONE 
J090009M06AAGGCCCAAGNONE 
J090009M06CTTGGGCCAGNONE 
Os03g0708400006-108-F11CTTGGGCCGCNONE 
AK066216CTTGGGCCGCProtein of unknown function DUF1295 family protein. 
Os03g0708600AK069199CACGGCCCAAGDEAD/DEAH box helicase, N-terminal domain containing protein. 
AK069658CACGGCCCAAGNONE 
J023008E04CACGGCCCAAGNONE 
J023030D22CACGGCCCAAGNONE 
J033027E16CACGGCCCAAGNONE 
J033046D09CACGGCCCAAGNONE 
J033068I10CACGGCCCAAGNONE 
J033135A12CACGGCCCAAGNONE 
J065027E22CACGGCCCAAGNONE 
J065191K23CACGGCCCAAGNONE 
J090054D15CACGGCCCAAGNONE 
J090058J15CACGGCCCAAGNONE 
Os03g0709000009-027-F11CTTGGGCCGGANONE 
009-147-F02CTTGGGCCGGANONE 
015-068-A04CTTGGGCCGGANONE 
AK062406CTTGGGCCGGAMembrane-associated proteins in eicosanoid and glutathione metabolism (MAPEG) family protein. 
Os03g0734400009-076-E05CTTGGGCCATNONE 
AK062628CTTGGGCCATRibosomal protein L7/L12 family protein. 
Os03g0746800AK101718AAGGCCCAAGWD-40 repeat containing protein. 
Os03g0748500AK110695TTTCGGCCCAAGNONE 
AK110695TTTCGGCCCAAGNONE 
Os03g0773300AK058587CTTGGGCCCCNONE 
Os03g0802300AK120564AGTGGGCCTTGGGCCGAGAConserved hypothetical protein. 
AK120687AGTGGGCCTTGGGCCGAGANONE 
Os03g0820100011-030-A10TCGGCCCAATAGGCCCAAGNONE 
011-031-C01TCGGCCCAATAGGCCCAAGNONE 
AK111534TCGGCCCAATAGGCCCAAGSimilar to Auxin-resistance protein AXR1. 
J013033L14TCGGCCCAATAGGCCCAAGNONE 
J013034D14TCGGCCCAATAGGCCCAAGNONE 
J013065N20TCGGCCCAATAGGCCCAAGNONE 
J013127A04TCGGCCCAATAGGCCCAAGNONE 
J013146A11TCGGCCCAATAGGCCCAAGNONE 
J023025D19TCGGCCCAATAGGCCCAAGNONE 
J023083K15TCGGCCCAATAGGCCCAAGNONE 
J033037N01TCGGCCCAATAGGCCCAAGNONE 
J033041H02TCGGCCCAATAGGCCCAAGNONE 
J043009M22TCGGCCCAATAGGCCCAAGNONE 
J090039L03TCGGCCCAATAGGCCCAAGNONE 
J090050L08TCGGCCCAATAGGCCCAAGNONE 
J090053J21TCGGCCCAATAGGCCCAAGNONE 
J090088G07TCGGCCCAATAGGCCCAAGNONE 
Os03g0820400009-042-F06GCCGGCCCAAGNONE 
009-046-E08GCCGGCCCAAGNONE 
009-079-B08GCCGGCCCAAGNONE 
009-111-H09GCCGGCCCAAGNONE 
009-150-D10GCCGGCCCAAGNONE 
015-073-H11GCCGGCCCAAGNONE 
AK119690GCCGGCCCAAGSimilar to ZPT2-13. 
AY286473GCCGGCCCAAGNONE 
AY305864GCCGGCCCAAGNONE 
J100051O21GCCGGCCCAAGNONE 
Os04g0117100009-025-D02GGGACCCACCCCACCCGGCCCAAGNONE 
009-056-D03GGGACCCACCCCACCCGGCCCAAGNONE 
009-145-F01GGGACCCACCCCACCCGGCCCAAGNONE 
009-146-C06GGGACCCACCCCACCCGGCCCAAGNONE 
009-186-C05GGGACCCACCCCACCCGGCCCAAGNONE 
AK060395GGGACCCACCCCACCCGGCCCAAGNONE 
AK121763GGGACCCACCCCACCCGGCCCAAGConserved hypothetical protein. 
J033090J17GGGACCCACCCCACCCGGCCCAAGNONE 
J065058O06GGGACCCACCCCACCCGGCCCAAGNONE 
J065058P05GGGACCCACCCCACCCGGCCCAAGNONE 
J065141C14GGGACCCACCCCACCCGGCCCAAGNONE 
J065162F07GGGACCCACCCCACCCGGCCCAAGNONE 
J065199N16GGGACCCACCCCACCCGGCCCAAGNONE 
J065214I05GGGACCCACCCCACCCGGCCCAAGNONE 
J075003L04GGGACCCACCCCACCCGGCCCAAGNONE 
J075014C14GGGACCCACCCCACCCGGCCCAAGNONE 
J075063K14GGGACCCACCCCACCCGGCCCAAGNONE 
J075111N19GGGACCCACCCCACCCGGCCCAAGNONE 
J075138E13GGGACCCACCCCACCCGGCCCAAGNONE 
J075189E23GGGACCCACCCCACCCGGCCCAAGNONE 
J080304J23GGGACCCACCCCACCCGGCCCAAGNONE 
J080310L07GGGACCCACCCCACCCGGCCCAAGNONE 
J080318A16GGGACCCACCCCACCCGGCCCAAGNONE 
J100054P14GGGACCCACCCCACCCGGCCCAAGNONE 
Os04g0206500AK110892TCGGCCCAAGUDP-glucuronosyl/UDP-glucosyltransferase family protein. 
Os04g0208400AK069629CTTGGGCCGTGCTTGGGCCGTGGCyclin-like F-box domain containing protein. 
Os04g0218600009-123-A05AAGGCCCAAGGCCCATCCNONE 
AK062873AAGGCCCAAGGCCCATCCNONE 
AK103472AAGGCCCAAGGCCCATCCConserved hypothetical protein. 
J090077A20AAGGCCCAAGGCCCATCCNONE 
Os04g0282400AK120187ATGGCCCAAGSimilar to FPF1 protein-like (RAA1). 
J013034O10ATGGCCCAAGNONE 
J013071G20ATGGCCCAAGNONE 
Os04g0432600AK058925CTGGGGCCCAAGConserved hypothetical protein. 
AK103967CTGGGGCCCAAGNONE 
AK121724CTGGGGCCCAAGNONE 
J033081P13CTGGGGCCCAAGNONE 
J033128L11CTGGGGCCCAAGNONE 
J065038G19CTGGGGCCCAAGNONE 
J065129A21CTGGGGCCCAAGNONE 
J065131P11CTGGGGCCCAAGNONE 
J065166I03CTGGGGCCCAAGNONE 
J065181L05CTGGGGCCCAAGNONE 
J100018I15CTGGGGCCCAAGNONE 
J100019H22CTGGGGCCCAAGNONE 
J100037O10CTGGGGCCCAAGNONE 
Os04g0444900AK063657TACGGCCCAAGSimilar to Alfin-1. 
AK098960TACGGCCCAAGNONE 
J065037L14TACGGCCCAAGNONE 
J065037P22TACGGCCCAAGNONE 
J065173O15TACGGCCCAAGNONE 
Os04g0462900006-094-A02CTTGGGCCTTNONE 
006-097-F05CTTGGGCCTTNONE 
009-129-A10CTTGGGCCTTNONE 
015-042-F07CTTGGGCCTTNONE 
AK058481CTTGGGCCTTNONE 
AK059483CTTGGGCCTTNONE 
AK061324CTTGGGCCTTNONE 
AK099100CTTGGGCCTTNONE 
AK102579CTTGGGCCTTNONE 
AK106322CTTGGGCCTTSimilar to Prohibitin. 
J065059J20CTTGGGCCTTNONE 
J065085I02CTTGGGCCTTNONE 
J065118N23CTTGGGCCTTNONE 
J065208K24CTTGGGCCTTNONE 
J075053B14CTTGGGCCTTNONE 
J075097M22CTTGGGCCTTNONE 
J075184B07CTTGGGCCTTNONE 
J075194A15CTTGGGCCTTNONE 
J080315G03CTTGGGCCTTNONE 
J090088H19CTTGGGCCTTNONE 
Os04g0547600AK109141GGGGCCCAAGPathogenesis-related transcriptional factor and ERF domain containing protein. 
AY339379GGGGCCCAAGNONE 
J065112J12GGGGCCCAAGNONE 
Os04g0551300AK103502CTTGGGCCGTCSimilar to Growth regulator like protein. 
Os04g0595000AK106907TTGGCCCAAGPeptidase A1, pepsin family protein. 
Os04g0611300009-006-G08GCCCGGCCCAAGNONE 
009-011-C01GCCCGGCCCAAGNONE 
009-036-B09GCCCGGCCCAAGNONE 
009-116-G09GCCCGGCCCAAGNONE 
009-126-E09GCCCGGCCCAAGNONE 
009-132-F09GCCCGGCCCAAGNONE 
009-151-G07GCCCGGCCCAAGNONE 
009-155-C07GCCCGGCCCAAGNONE 
009-163-G01GCCCGGCCCAAGNONE 
009-169-G08GCCCGGCCCAAGNONE 
009-191-B02GCCCGGCCCAAGNONE 
009-196-A08GCCCGGCCCAAGNONE 
009-198-E07GCCCGGCCCAAGNONE 
014-015-F04GCCCGGCCCAAGNONE 
015-087-H04GCCCGGCCCAAGNONE 
AK062605GCCCGGCCCAAGNONE 
AK063022GCCCGGCCCAAGConserved hypothetical protein. 
AK066749GCCCGGCCCAAGNONE 
AK104924GCCCGGCCCAAGNONE 
J065002M20GCCCGGCCCAAGNONE 
J065045L23GCCCGGCCCAAGNONE 
J065101E05GCCCGGCCCAAGNONE 
J065140J23GCCCGGCCCAAGNONE 
J065179G11GCCCGGCCCAAGNONE 
J065191B18GCCCGGCCCAAGNONE 
J065192E03GCCCGGCCCAAGNONE 
J065199H21GCCCGGCCCAAGNONE 
J075067F01GCCCGGCCCAAGNONE 
J075089L01GCCCGGCCCAAGNONE 
J075147K22GCCCGGCCCAAGNONE 
J080069G23GCCCGGCCCAAGNONE 
J100053D10GCCCGGCCCAAGNONE 
J100078C10GCCCGGCCCAAGNONE 
Os04g0631200013-003-B06GAGGCCCAAGNONE 
AK059277GAGGCCCAAGSimilar to Xyloglucan endotransglycosylase (Fragment). 
AK099331GAGGCCCAAGNONE 
J033024P08GAGGCCCAAGNONE 
J033041G02GAGGCCCAAGNONE 
J053075H12GAGGCCCAAGNONE 
J065016B13GAGGCCCAAGNONE 
J090075B22GAGGCCCAAGNONE 
J100084K17GAGGCCCAAGNONE 
Os04g0658300AK067399CTTGGGCCAGSimilar to Ribulose bisphosphate carboxylase/oxygenase activase, chloroplast precursor (RuBisCO activase) (RA). 
Os04g0661700AK066532CTTGGGCCTTConserved hypothetical protein. 
J065083O18CTTGGGCCTTNONE 
Os04g0663200006-074-D02CTGGCCCAAGNONE 
AK105958CTGGCCCAAGZinc finger, CCCH-type domain containing protein. 
AK111925CTGGCCCAAGNONE 
Os04g0677033J100048A06CTTGGGCCCGCAConserved hypothetical protein. 
Os04g0679800AK060662CTTGGGCCCCACCTGTCAGTSimilar to RNA-binding protein-like protein. 
AK099987CTTGGGCCCCACCTGTCAGTNONE 
J013130B11CTTGGGCCCCACCTGTCAGTNONE 
J065049C17CTTGGGCCCCACCTGTCAGTNONE 
J075191N12CTTGGGCCCCACCTGTCAGTNONE 
J075191P12CTTGGGCCCCACCTGTCAGTNONE 
J100031C07CTTGGGCCCCACCTGTCAGTNONE 
Os04g0686600AK068427CTTGGGCCAAProtein kinase domain containing protein. 
J013155F22CTTGGGCCAANONE 
J023020E07CTTGGGCCAANONE 
Os05g0101400009-126-G06AGTTGGGCTTGGGCCGCNONE 
AK067481AGTTGGGCTTGGGCCGCSimilar to 50S ribosomal protein L28, chloroplast precursor. 
J065124O10AGTTGGGCTTGGGCCGCNONE 
J065186D05AGTTGGGCTTGGGCCGCNONE 
J065193A14AGTTGGGCTTGGGCCGCNONE 
J075082A02AGTTGGGCTTGGGCCGCNONE 
J075100F11AGTTGGGCTTGGGCCGCNONE 
J075111O16AGTTGGGCTTGGGCCGCNONE 
J075172I24AGTTGGGCTTGGGCCGCNONE 
Os05g0128100009-051-B07CTTGGGCCGCCGGCCCATCTNONE 
009-127-B08CTTGGGCCGCCGGCCCATCTNONE 
009-144-H03CTTGGGCCGCCGGCCCATCTNONE 
009-176-B05CTTGGGCCGCCGGCCCATCTNONE 
AK108556CTTGGGCCGCCGGCCCATCTNONE 
AK119308CTTGGGCCGCCGGCCCATCTNONE 
AK120934CTTGGGCCGCCGGCCCATCTConserved hypothetical protein. 
J023036J15CTTGGGCCGCCGGCCCATCTNONE 
J065122L01CTTGGGCCGCCGGCCCATCTNONE 
J075104P10CTTGGGCCGCCGGCCCATCTNONE 
Os05g0137600AK099427TGATGGGCCTGGGTGGCCCAAGCCCATGTConserved hypothetical protein. 
Os05g0186000006-103-D10TAGGCCCAAGNONE 
009-047-D06TAGGCCCAAGNONE 
009-073-G05TAGGCCCAAGNONE 
009-084-G09TAGGCCCAAGNONE 
009-097-G04TAGGCCCAAGNONE 
009-111-D11TAGGCCCAAGNONE 
009-115-G01TAGGCCCAAGNONE 
009-131-B04TAGGCCCAAGNONE 
009-144-F05TAGGCCCAAGNONE 
009-154-D08TAGGCCCAAGNONE 
014-004-H02TAGGCCCAAGNONE 
AK058675TAGGCCCAAGNONE 
AK060420TAGGCCCAAGSimilar to 30S ribosomal protein S31, chloroplast (Fragment). 
AK061231TAGGCCCAAGNONE 
J065155C08TAGGCCCAAGNONE 
J075143K12TAGGCCCAAGNONE 
Os05g0400700009-099-F02GAGGCCCAAGNONE 
AK072739GAGGCCCAAGSimilar to DNA-directed RNA polymerase II 19 kDa polypeptide (EC 2.7.7.6) (RNA polymerase II subunit 5). 
AK103913GAGGCCCAAGNONE 
J023138C10GAGGCCCAAGNONE 
Os05g0443800AK106590CTTGGGCCAGSimilar to Plastid division protein ftsZ1 precursor. 
Os05g0446900AK101748CTTGGGCCTCTGGGCCTAGlycoside hydrolase, starch-binding domain containing protein. 
Os05g0484000AK106829TAGGCCCAAGProtein of unknown function DUF295 family protein. 
AK106829TCAGGCCCAAGProtein of unknown function DUF295 family protein. 
Os05g0490000011-076-C07CTTGGGCCGTANONE 
015-026-D07CTTGGGCCGTANONE 
015-074-A08CTTGGGCCGTANONE 
AK064335CTTGGGCCGTANONE 
AK101340CTTGGGCCGTAKrr1 family protein. 
J033034J18CTTGGGCCGTANONE 
Os05g0498400009-129-A03GAGGCCCAAGNONE 
009-192-D10GAGGCCCAAGNONE 
009-194-D06GAGGCCCAAGNONE 
AK058219GAGGCCCAAGSimilar to Protein translation factor SUI1. 
AK070301GAGGCCCAAGNONE 
J043038N18GAGGCCCAAGNONE 
J065027A13GAGGCCCAAGNONE 
J075040J15GAGGCCCAAGNONE 
J075165B14GAGGCCCAAGNONE 
Os05g0501300006-075-B11CTTGGGCCTTGNONE 
006-083-H08CTTGGGCCTTGNONE 
AK059889CTTGGGCCTTGSimilar to Flavoprotein wrbA (Trp repressor binding protein). 
J043030K02CTTGGGCCTTGNONE 
Os05g0531500AK120867CTTGGGCCGCProtein of unknown function DUF616 family protein. 
Os05g0547850009-102-F03AGATGGGCCTTGGGCCGAAANONE 
013-076-H08AGATGGGCCTTGGGCCGAAANONE 
AK058330AGATGGGCCTTGGGCCGAAANONE 
AK122158AGATGGGCCTTGGGCCGAAADNA-binding TFAR19-related protein family protein. 
AY626826AGATGGGCCTTGGGCCGAAANONE 
J043012O19AGATGGGCCTTGGGCCGAAANONE 
J043038O15AGATGGGCCTTGGGCCGAAANONE 
J053094L06AGATGGGCCTTGGGCCGAAANONE 
Os05g0548100AK060333CTCGGCCCAAGConserved hypothetical protein. 
AK060333TTTCGGCCCAAGGCCCATATConserved hypothetical protein. 
AK100682CTCGGCCCAAGNONE 
AK100682TTTCGGCCCAAGGCCCATATNONE 
J013151E01CTCGGCCCAAGNONE 
J013151E01TTTCGGCCCAAGGCCCATATNONE 
J023113L22CTCGGCCCAAGNONE 
J023113L22TTTCGGCCCAAGGCCCATATNONE 
J043027A19CTCGGCCCAAGNONE 
J043027A19TTTCGGCCCAAGGCCCATATNONE 
J075093E06CTCGGCCCAAGNONE 
J075093E06TTTCGGCCCAAGGCCCATATNONE 
J090060D15CTCGGCCCAAGNONE 
J090060D15TTTCGGCCCAAGGCCCATATNONE 
J090082J03CTCGGCCCAAGNONE 
J090082J03TTTCGGCCCAAGGCCCATATNONE 
J100050E01CTCGGCCCAAGNONE 
J100050E01TTTCGGCCCAAGGCCCATATNONE 
Os05g0552900AK102095AAGGCCCAAGMAP65/ASE1 family protein. 
Os05g0557200AK062090AGGGCCCAAGNONE 
AK102111AGGGCCCAAGArmadillo-like helical domain containing protein. 
J013047E13AGGGCCCAAGNONE 
J013089P04AGGGCCCAAGNONE 
J013130H17AGGGCCCAAGNONE 
J013132C20AGGGCCCAAGNONE 
J023001E06AGGGCCCAAGNONE 
J023108C09AGGGCCCAAGNONE 
J023125C12AGGGCCCAAGNONE 
J033023O10AGGGCCCAAGNONE 
J033033K16AGGGCCCAAGNONE 
J033064C11AGGGCCCAAGNONE 
J033071P07AGGGCCCAAGNONE 
J033072H14AGGGCCCAAGNONE 
J033084F06AGGGCCCAAGNONE 
J033084H11AGGGCCCAAGNONE 
J033097C05AGGGCCCAAGNONE 
J043009E20AGGGCCCAAGNONE 
J053035M10AGGGCCCAAGNONE 
J053043J22AGGGCCCAAGNONE 
J053082K10AGGGCCCAAGNONE 
J053094N13AGGGCCCAAGNONE 
Os05g0559900AK067197GGGCCTGGCCCAAGtRNA-binding arm domain containing protein. 
J013074C15GGGCCTGGCCCAAGNONE 
J013098O16GGGCCTGGCCCAAGNONE 
J033030M01GGGCCTGGCCCAAGNONE 
J090058H12GGGCCTGGCCCAAGNONE 
J090075M06GGGCCTGGCCCAAGNONE 
Os05g0567300013-039-F11TATTGGGCCGGCCCAAGNONE 
AK112068TATTGGGCCGGCCCAAGGTP-binding protein, HSR1-related domain containing protein. 
Os05g0568800006-084-D04CAGGTGGGCTTGGGCCGCANONE 
009-009-B11CAGGTGGGCTTGGGCCGCANONE 
009-014-E10CAGGTGGGCTTGGGCCGCANONE 
009-107-C04CAGGTGGGCTTGGGCCGCANONE 
009-133-H08CAGGTGGGCTTGGGCCGCANONE 
AK059883CAGGTGGGCTTGGGCCGCAProtein of unknown function DUF1645 family protein. 
Os05g0572900AK103180GTTGGGCCCAAGProtein prenyltransferase domain containing protein. 
Os05g0575300AK068873AATTGGGCCCAAGNONE 
J013170P17AATTGGGCCCAAGNONE 
Os05g0576600AK107732CTTGGGCCATConserved hypothetical protein. 
Os05g0595400006-103-B08AAGGCCCAAGNONE 
009-117-H06AAGGCCCAAGNONE 
AK061858AAGGCCCAAGNONE 
AK066391AAGGCCCAAGSimilar to Nucleoside diphosphate kinase III (EC 2.7.4.6) (NDK III) (NDP kinase III) (NDPK III). 
J013109B15AAGGCCCAAGNONE 
J023003J16AAGGCCCAAGNONE 
J023027P15AAGGCCCAAGNONE 
J023106M08AAGGCCCAAGNONE 
J023122O03AAGGCCCAAGNONE 
J033081D04AAGGCCCAAGNONE 
J033086G23AAGGCCCAAGNONE 
J033115F13AAGGCCCAAGNONE 
Os06g0116400006-082-G06ACATGGGCTCGGCCCAAGCCACGTCNONE 
AK058327ACATGGGCTCGGCCCAAGCCACGTCNONE 
AK105979ACATGGGCTCGGCCCAAGCCACGTCHigh-affinity nickel-transporter family protein. 
J065083I24ACATGGGCTCGGCCCAAGCCACGTCNONE 
J100072O18ACATGGGCTCGGCCCAAGCCACGTCNONE 
Os06g0124900009-128-B12CCAGGCCCAAGCCCAACCNONE 
009-186-H09CCAGGCCCAAGCCCAACCNONE 
AK062901CCAGGCCCAAGCCCAACCConserved hypothetical protein. 
J013056D13CCAGGCCCAAGCCCAACCNONE 
J013056D17CCAGGCCCAAGCCCAACCNONE 
J013066A13CCAGGCCCAAGCCCAACCNONE 
J013066C03CCAGGCCCAAGCCCAACCNONE 
J013066F01CCAGGCCCAAGCCCAACCNONE 
J023078D03CCAGGCCCAAGCCCAACCNONE 
J033113N02CCAGGCCCAAGCCCAACCNONE 
J065019F09CCAGGCCCAAGCCCAACCNONE 
J065048C21CCAGGCCCAAGCCCAACCNONE 
J065077L13CCAGGCCCAAGCCCAACCNONE 
J065082J09CCAGGCCCAAGCCCAACCNONE 
J065113H16CCAGGCCCAAGCCCAACCNONE 
J065147A20CCAGGCCCAAGCCCAACCNONE 
J065180A13CCAGGCCCAAGCCCAACCNONE 
J065198M18CCAGGCCCAAGCCCAACCNONE 
J065207K19CCAGGCCCAAGCCCAACCNONE 
J075109H13CCAGGCCCAAGCCCAACCNONE 
Os06g0168000AK059250CTTGGGCCGGGCCNONE 
AK099356CTTGGGCCGGGCCGlutathione S-transferase, C-terminal-like domain containing protein. 
J033040E19CTTGGGCCGGGCCNONE 
J033097H04CTTGGGCCGGGCCNONE 
J075087M11CTTGGGCCGGGCCNONE 
J075146H06CTTGGGCCGGGCCNONE 
J075188H11CTTGGGCCGGGCCNONE 
J090071D03CTTGGGCCGGGCCNONE 
J090097L20CTTGGGCCGGGCCNONE 
J100051M05CTTGGGCCGGGCCNONE 
J100082H13CTTGGGCCGGGCCNONE 
Os06g0199500AK060939TACTGGGCCCAAGGCCCAAATNONE 
AK064613TACTGGGCCCAAGGCCCAAATSimilar to Phosphopantothenoylcysteine decarboxylase (EC 4.1.1.36) (Halotolerance protein Hal3a) (AtHal3a) (PPCDC) (AtCoaC). 
AK100138TACTGGGCCCAAGGCCCAAATNONE 
Os06g0213900AK106922TAGGCCCAAGCCCConserved hypothetical protein. 
J090028K09TAGGCCCAAGCCCNONE 
J100078N13TAGGCCCAAGCCCNONE 
Os06g0257200J053059P05TCGGCCCAAGNONE 
J075006K03TCGGCCCAAGNONE 
J075067F07TCGGCCCAAGNONE 
J075068F14TCGGCCCAAGNONE 
J075068H14TCGGCCCAAGNONE 
J075098N06TCGGCCCAAGNONE 
J075099F08TCGGCCCAAGNONE 
J075154G24TCGGCCCAAGNONE 
J075195H09TCGGCCCAAGNONE 
Os06g0291100J043017O10CCGAGCCGGCCCAAGTCAGCCCACAAHypothetical protein. 
Os06g0326500AK068142CTTGGGCCCTMitochondrial glycoprotein family protein. 
AK071483CTTGGGCCCTNONE 
J053065A20CTTGGGCCCTNONE 
J065082D14CTTGGGCCCTNONE 
Os06g0484600009-122-D10ATGGCCCAAGCCCAAGNONE 
AK062871ATGGCCCAAGCCCAAGSimilar to Pherophorin-S precursor. 
J075017F14ATGGCCCAAGCCCAAGNONE 
J075021E06ATGGCCCAAGCCCAAGNONE 
J075054C10ATGGCCCAAGCCCAAGNONE 
Os06g0539066J065210J16CTTGGGCCAAConserved hypothetical protein. 
Os06g0585200016-065-C02CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCNONE 
AK068592CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCNONE 
AK073844CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCNONE 
AK106549CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCConserved hypothetical protein. 
J013154A14CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCNONE 
J100049K24CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCNONE 
J100059C18CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCNONE 
J100082N13CGGGCCGTGCTTGGGCCGGCGGCTCGGCACGTGGGCCGGCNONE 
Os06g0590301J033139K16TTGGCCCAAGCCCAAGNONE 
J065011M13TTGGCCCAAGCCCAAGNONE 
J065027D20TTGGCCCAAGCCCAAGNONE 
J065039O05TTGGCCCAAGCCCAAGGlucose/ribitol dehydrogenase family protein. 
J065051O10TTGGCCCAAGCCCAAGNONE 
J065128I21TTGGCCCAAGCCCAAGNONE 
J065163P10TTGGCCCAAGCCCAAGNONE 
J065169H02TTGGCCCAAGCCCAAGNONE 
Os06g0670500AK059079AAGGCCCAAGNONE 
Os06g0674800J065007E09AAGGCCCAAGNONE 
J065037D21AAGGCCCAAGHypothetical protein. 
J065063P14AAGGCCCAAGNONE 
J065128K24AAGGCCCAAGNONE 
J065188F06AAGGCCCAAGNONE 
J065199I24AAGGCCCAAGNONE 
J065214N19AAGGCCCAAGNONE 
Os06g0683200AK060024CTTGGGCCGTASimilar to 50S ribosomal protein L24, chloroplast precursor (CL24). 
AK070432CTTGGGCCGTANONE 
J023002B12CTTGGGCCGTANONE 
J023054E10CTTGGGCCGTANONE 
J023123F19CTTGGGCCGTANONE 
J065035K13CTTGGGCCGTANONE 
J065129P09CTTGGGCCGTANONE 
J065184B14CTTGGGCCGTANONE 
Os06g0710300AK121344CTTGGGCCGAAUncharacterized protein UPF0114 family protein. 
J043016B12CTTGGGCCGAANONE 
J065104H21CTTGGGCCGAANONE 
Os06g0714500AK100047ATGGCCCAAGAAA ATPase domain containing protein. 
AK119628ATGGCCCAAGNONE 
J013120N13ATGGCCCAAGNONE 
J013154C19ATGGCCCAAGNONE 
J023031A09ATGGCCCAAGNONE 
J023073G20ATGGCCCAAGNONE 
J023086A06ATGGCCCAAGNONE 
J023086L11ATGGCCCAAGNONE 
J033045N11ATGGCCCAAGNONE 
J065124D11ATGGCCCAAGNONE 
J065135A15ATGGCCCAAGNONE 
J065146E06ATGGCCCAAGNONE 
J065175E12ATGGCCCAAGNONE 
J075004A21ATGGCCCAAGNONE 
J075072C20ATGGCCCAAGNONE 
J075078O21ATGGCCCAAGNONE 
J075145E13ATGGCCCAAGNONE 
J075196K08ATGGCCCAAGNONE 
J090095L18ATGGCCCAAGNONE 
Os06g0715400012-007-C01GAGGCCCAAGGCCCATACNONE 
012-038-G03GAGGCCCAAGGCCCATACNONE 
AK071262GAGGCCCAAGGCCCATACt-snare domain containing protein. 
AK073963GAGGCCCAAGGCCCATACNONE 
J023085J06GAGGCCCAAGGCCCATACNONE 
J033073I09GAGGCCCAAGGCCCATACNONE 
J080316N15GAGGCCCAAGGCCCATACNONE 
J090062N15GAGGCCCAAGGCCCATACNONE 
Os06g0716800014-028-E06GAGGCCCAAGNONE 
016-046-F04GAGGCCCAAGNONE 
AK071639GAGGCCCAAGEukaryotic transcription factor, DNA-binding domain containing protein. 
AK103968GAGGCCCAAGNONE 
J023099K10GAGGCCCAAGNONE 
J065036H06GAGGCCCAAGNONE 
J065049K01GAGGCCCAAGNONE 
J065060N02GAGGCCCAAGNONE 
J065204C12GAGGCCCAAGNONE 
J065213P15GAGGCCCAAGNONE 
J080001K17GAGGCCCAAGNONE 
J080006L04GAGGCCCAAGNONE 
J080008A10GAGGCCCAAGNONE 
J080008E16GAGGCCCAAGNONE 
J080010L22GAGGCCCAAGNONE 
J080011N22GAGGCCCAAGNONE 
J080014K12GAGGCCCAAGNONE 
J080018F08GAGGCCCAAGNONE 
J080018N02GAGGCCCAAGNONE 
J080021N10GAGGCCCAAGNONE 
J080029B02GAGGCCCAAGNONE 
J080030D07GAGGCCCAAGNONE 
J080032A16GAGGCCCAAGNONE 
J080034M13GAGGCCCAAGNONE 
J080038F06GAGGCCCAAGNONE 
J080039K15GAGGCCCAAGNONE 
J080042M20GAGGCCCAAGNONE 
J080048N14GAGGCCCAAGNONE 
J080050F23GAGGCCCAAGNONE 
J080051C22GAGGCCCAAGNONE 
J080053B19GAGGCCCAAGNONE 
J080056J19GAGGCCCAAGNONE 
J080056K05GAGGCCCAAGNONE 
J080060C09GAGGCCCAAGNONE 
J080060K21GAGGCCCAAGNONE 
J080065J17GAGGCCCAAGNONE 
J080067A16GAGGCCCAAGNONE 
J080075I03GAGGCCCAAGNONE 
J080076D21GAGGCCCAAGNONE 
J080078G16GAGGCCCAAGNONE 
J080085K15GAGGCCCAAGNONE 
J080089C14GAGGCCCAAGNONE 
J080091N22GAGGCCCAAGNONE 
J080094N12GAGGCCCAAGNONE 
J090032N05GAGGCCCAAGNONE 
Os07g0122300015-004-G08CTTGGGCCCTNONE 
015-004-G08CTTGGGCCTCTGTGGGCTTGNONE 
AK103212CTTGGGCCCTNONE 
AK103212CTTGGGCCTCTGTGGGCTTGNONE 
AK119295CTTGGGCCCTProtein of unknown function DUF1719, Oryza sativa family protein. 
AK119295CTTGGGCCTCTGTGGGCTTGProtein of unknown function DUF1719, Oryza sativa family protein. 
J033122M09CTTGGGCCCTNONE 
J033122M09CTTGGGCCTCTGTGGGCTTGNONE 
J090007P13CTTGGGCCCTNONE 
J090007P13CTTGGGCCTCTGTGGGCTTGNONE 
Os07g0158300006-049-G04CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
AK099188CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
AK104773CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J013106F16CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J013123H22CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J023029J02CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J023029J03CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J033138N08CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J075011F05CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J075022F10CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J075071L13CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J075094B08CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J075119B21CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J075140L02CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J075199O21CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080001I17CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080005M04CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080011P17CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080026B14CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080026C12CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080030N16CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080035K23CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080039J22CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080045D04CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080050C06CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080050K14CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080051I09CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080053F18CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080053G10CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080055F05CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080057E22CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080058F17CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080063C18CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080065E02CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080066E06CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080067O05CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080068N15CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080071O04CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080074A20CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080074E14CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080074L05CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080075E08CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080075H07CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080077D04CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080077N15CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080078A07CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080079H22CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080080F20CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080080M22CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080081K09CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080081L04CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080090K09CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080093O13CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080094A18CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080094E10CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080094H06CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J080096I21CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
J100081A19CTTGGGCCCTAATGGGCTCCAGGCCCAACCNONE 
Os07g0158900AK064980GCGGCCCAAGCyclin-like F-box domain containing protein. 
Os07g0162600015-024-F04CTTGGGCCCGGANONE 
AK105789CTTGGGCCCGGANONE 
AK106274CTTGGGCCCGGAEsterase/lipase/thioesterase domain containing protein. 
J100026E18CTTGGGCCCGGANONE 
J100037B07CTTGGGCCCGGANONE 
J100090H11CTTGGGCCCGGANONE 
Os07g0205700AK120553GTTTGGGCCCAAGSimilar to Xaa-Pro dipeptidase (EC 3.4.-.-). 
J065022J24GTTTGGGCCCAAGNONE 
Os07g0301200AB110202CTTGGGCCGTGCTTGGGCCGTGGNONE 
AK073463CTTGGGCCGTGCTTGGGCCGTGGSimilar to RNA helicase (Fragment). 
Os07g0459200AK066819GCTGGGCTTGGGCCAACCGAGCCGNONE 
AK102099GCTGGGCTTGGGCCAACCGAGCCGSimilar to Possible kinase. 
Os07g0490300AK068288GCCGGCCCAAGSimilar to Preproacrosin. 
J013149P03GCCGGCCCAAGNONE 
J065039L14GCCGGCCCAAGNONE 
J100024A06GCCGGCCCAAGNONE 
Os07g0490400AK067941CTTGGGCCGGCPeptidylprolyl isomerase, FKBP-type domain containing protein. 
J013121F22CTTGGGCCGGCNONE 
Os07g0498900AK073263CTTGGGCCCAGCCCACCAACProtein of unknown function DUF231, plant domain containing protein. 
J033024K20CTTGGGCCCAGCCCACCAACNONE 
J065207I19CTTGGGCCCAGCCCACCAACNONE 
Os07g0555400AK070977CTTGGGCCGTGCTTGGGCTGAConserved hypothetical protein. 
Os07g0558200AK065243TCAGGCCCAAGInositol monophosphatase family protein. 
Os07g0565000AK121056GTTTGGGCCTTCTTGGGCCGASimilar to 40S ribosomal protein S11. 
J023056G18GTTTGGGCCTTCTTGGGCCGANONE 
J065131K04GTTTGGGCCTTCTTGGGCCGANONE 
J065190L19GTTTGGGCCTTCTTGGGCCGANONE 
J065209B06GTTTGGGCCTTCTTGGGCCGANONE 
J065216P11GTTTGGGCCTTCTTGGGCCGANONE 
J090088F06GTTTGGGCCTTCTTGGGCCGANONE 
Os07g0570700AK065242AGTTGGGCCCAAGCCCACGTGRibosome recycling factor family protein. 
J013002I12AGTTGGGCCCAAGCCCACGTGNONE 
Os07g0572500AK108612TTGGCCCAAGConserved hypothetical protein. 
Os07g0573700AK070473CAAGGCCCAAGNucleotide-sugar transporter family protein. 
Os07g0594400J065137M02ACGTGGGCTTGGGCCACGGGCCGAConserved hypothetical protein. 
J065218E03ACGTGGGCTTGGGCCACGGGCCGANONE 
Os07g0602600AK065696CTTGGGCCATSimilar to RNA binding protein. 
J013035K23CTTGGGCCATNONE 
Os07g0632600AK058943AAGGCCCAAGNONE 
J065034J15AAGGCCCAAGNONE 
Os07g0673100AK060100GAGGCCCAAGNONE 
AK103678GAGGCCCAAGRibosomal protein S8E family protein. 
AK104794GAGGCCCAAGNONE 
Os08g0109300AK061825CTTGGGCCTCNONE 
AK066688CTTGGGCCTCSimilar to Adenylate kinase, chloroplast (EC 2.7.4.3) (ATP-AMP transphosphorylase). 
J023013L12CTTGGGCCTCNONE 
Os08g0116500009-007-E05GAGGCCCACGATCCGGCCCAAGNONE 
009-074-C07GAGGCCCACGATCCGGCCCAAGNONE 
009-098-A07GAGGCCCACGATCCGGCCCAAGNONE 
009-100-C03GAGGCCCACGATCCGGCCCAAGNONE 
009-136-E04GAGGCCCACGATCCGGCCCAAGNONE 
009-138-B08GAGGCCCACGATCCGGCCCAAGNONE 
009-144-B06GAGGCCCACGATCCGGCCCAAGNONE 
009-184-E04GAGGCCCACGATCCGGCCCAAGNONE 
009-189-F01GAGGCCCACGATCCGGCCCAAGNONE 
013-006-E05GAGGCCCACGATCCGGCCCAAGNONE 
013-015-C10GAGGCCCACGATCCGGCCCAAGNONE 
013-019-F09GAGGCCCACGATCCGGCCCAAGNONE 
013-020-C01GAGGCCCACGATCCGGCCCAAGNONE 
013-021-F05GAGGCCCACGATCCGGCCCAAGNONE 
013-035-D08GAGGCCCACGATCCGGCCCAAGNONE 
013-038-C09GAGGCCCACGATCCGGCCCAAGNONE 
013-054-B07GAGGCCCACGATCCGGCCCAAGNONE 
013-061-G10GAGGCCCACGATCCGGCCCAAGNONE 
013-074-B01GAGGCCCACGATCCGGCCCAAGNONE 
013-079-B06GAGGCCCACGATCCGGCCCAAGNONE 
013-099-B09GAGGCCCACGATCCGGCCCAAGNONE 
013-099-G11GAGGCCCACGATCCGGCCCAAGNONE 
014-023-F04GAGGCCCACGATCCGGCCCAAGNONE 
014-032-C07GAGGCCCACGATCCGGCCCAAGNONE 
014-045-E02GAGGCCCACGATCCGGCCCAAGNONE 
014-085-C02GAGGCCCACGATCCGGCCCAAGNONE 
014-087-F04GAGGCCCACGATCCGGCCCAAGNONE 
014-089-C04GAGGCCCACGATCCGGCCCAAGNONE 
014-090-E01GAGGCCCACGATCCGGCCCAAGNONE 
014-094-G11GAGGCCCACGATCCGGCCCAAGNONE 
014-097-B07GAGGCCCACGATCCGGCCCAAGNONE 
015-024-A12GAGGCCCACGATCCGGCCCAAGNONE 
015-032-C06GAGGCCCACGATCCGGCCCAAGNONE 
016-053-E09GAGGCCCACGATCCGGCCCAAGNONE 
016-081-F10GAGGCCCACGATCCGGCCCAAGNONE 
AK058240GAGGCCCACGATCCGGCCCAAGSimilar to 60S acidic ribosomal protein P1 (L12). 
J023079C09GAGGCCCACGATCCGGCCCAAGNONE 
J023107O19GAGGCCCACGATCCGGCCCAAGNONE 
J053029K21GAGGCCCACGATCCGGCCCAAGNONE 
J053073P11GAGGCCCACGATCCGGCCCAAGNONE 
J053074B04GAGGCCCACGATCCGGCCCAAGNONE 
J053078M14GAGGCCCACGATCCGGCCCAAGNONE 
J065001E12GAGGCCCACGATCCGGCCCAAGNONE 
J065006J12GAGGCCCACGATCCGGCCCAAGNONE 
J065015C06GAGGCCCACGATCCGGCCCAAGNONE 
J065025D13GAGGCCCACGATCCGGCCCAAGNONE 
J065029A04GAGGCCCACGATCCGGCCCAAGNONE 
J065031D23GAGGCCCACGATCCGGCCCAAGNONE 
J065032E24GAGGCCCACGATCCGGCCCAAGNONE 
J065034P16GAGGCCCACGATCCGGCCCAAGNONE 
J065043B04GAGGCCCACGATCCGGCCCAAGNONE 
J065044A15GAGGCCCACGATCCGGCCCAAGNONE 
J065062D18GAGGCCCACGATCCGGCCCAAGNONE 
J065079G13GAGGCCCACGATCCGGCCCAAGNONE 
J065080A19GAGGCCCACGATCCGGCCCAAGNONE 
J065080A20GAGGCCCACGATCCGGCCCAAGNONE 
J065089N19GAGGCCCACGATCCGGCCCAAGNONE 
J065111O07GAGGCCCACGATCCGGCCCAAGNONE 
J065115N15GAGGCCCACGATCCGGCCCAAGNONE 
J065131A04GAGGCCCACGATCCGGCCCAAGNONE 
J065138H02GAGGCCCACGATCCGGCCCAAGNONE 
J065139K10GAGGCCCACGATCCGGCCCAAGNONE 
J065144A02GAGGCCCACGATCCGGCCCAAGNONE 
J065155J17GAGGCCCACGATCCGGCCCAAGNONE 
J065159D18GAGGCCCACGATCCGGCCCAAGNONE 
J065159I18GAGGCCCACGATCCGGCCCAAGNONE 
J065167H12GAGGCCCACGATCCGGCCCAAGNONE 
J065174C22GAGGCCCACGATCCGGCCCAAGNONE 
J065184A05GAGGCCCACGATCCGGCCCAAGNONE 
J065188M15GAGGCCCACGATCCGGCCCAAGNONE 
J065191D23GAGGCCCACGATCCGGCCCAAGNONE 
J065203C07GAGGCCCACGATCCGGCCCAAGNONE 
J065207C23GAGGCCCACGATCCGGCCCAAGNONE 
J065207L16GAGGCCCACGATCCGGCCCAAGNONE 
J065212F01GAGGCCCACGATCCGGCCCAAGNONE 
J065212F05GAGGCCCACGATCCGGCCCAAGNONE 
J075037B07GAGGCCCACGATCCGGCCCAAGNONE 
J075042F15GAGGCCCACGATCCGGCCCAAGNONE 
J075059J03GAGGCCCACGATCCGGCCCAAGNONE 
J075068M18GAGGCCCACGATCCGGCCCAAGNONE 
J075079E13GAGGCCCACGATCCGGCCCAAGNONE 
J075081F12GAGGCCCACGATCCGGCCCAAGNONE 
J075083I05GAGGCCCACGATCCGGCCCAAGNONE 
J075123K23GAGGCCCACGATCCGGCCCAAGNONE 
J075142F16GAGGCCCACGATCCGGCCCAAGNONE 
J075156N03GAGGCCCACGATCCGGCCCAAGNONE 
J075162K05GAGGCCCACGATCCGGCCCAAGNONE 
J075171E08GAGGCCCACGATCCGGCCCAAGNONE 
J075177N03GAGGCCCACGATCCGGCCCAAGNONE 
J075182K17GAGGCCCACGATCCGGCCCAAGNONE 
J075186K02GAGGCCCACGATCCGGCCCAAGNONE 
J075191K05GAGGCCCACGATCCGGCCCAAGNONE 
J080011E10GAGGCCCACGATCCGGCCCAAGNONE 
J080016M21GAGGCCCACGATCCGGCCCAAGNONE 
J080017A17GAGGCCCACGATCCGGCCCAAGNONE 
J080031O09GAGGCCCACGATCCGGCCCAAGNONE 
J080039G21GAGGCCCACGATCCGGCCCAAGNONE 
J080041B01GAGGCCCACGATCCGGCCCAAGNONE 
J080050G20GAGGCCCACGATCCGGCCCAAGNONE 
J080054A12GAGGCCCACGATCCGGCCCAAGNONE 
J080058O08GAGGCCCACGATCCGGCCCAAGNONE 
J080061N04GAGGCCCACGATCCGGCCCAAGNONE 
J080064L23GAGGCCCACGATCCGGCCCAAGNONE 
J080064P05GAGGCCCACGATCCGGCCCAAGNONE 
J080069I17GAGGCCCACGATCCGGCCCAAGNONE 
J080070E07GAGGCCCACGATCCGGCCCAAGNONE 
J080071B20GAGGCCCACGATCCGGCCCAAGNONE 
J080074L08GAGGCCCACGATCCGGCCCAAGNONE 
J080076N08GAGGCCCACGATCCGGCCCAAGNONE 
J080081A14GAGGCCCACGATCCGGCCCAAGNONE 
J080081J17GAGGCCCACGATCCGGCCCAAGNONE 
J080085N14GAGGCCCACGATCCGGCCCAAGNONE 
J080090B09GAGGCCCACGATCCGGCCCAAGNONE 
J080097L11GAGGCCCACGATCCGGCCCAAGNONE 
J080306H13GAGGCCCACGATCCGGCCCAAGNONE 
J080307H13GAGGCCCACGATCCGGCCCAAGNONE 
J080311F12GAGGCCCACGATCCGGCCCAAGNONE 
J080316L23GAGGCCCACGATCCGGCCCAAGNONE 
J080318H02GAGGCCCACGATCCGGCCCAAGNONE 
J090016L15GAGGCCCACGATCCGGCCCAAGNONE 
J090019I02GAGGCCCACGATCCGGCCCAAGNONE 
J090031G21GAGGCCCACGATCCGGCCCAAGNONE 
J090066C15GAGGCCCACGATCCGGCCCAAGNONE 
J100032I02GAGGCCCACGATCCGGCCCAAGNONE 
J100032N07GAGGCCCACGATCCGGCCCAAGNONE 
J100032N16GAGGCCCACGATCCGGCCCAAGNONE 
J100041P21GAGGCCCACGATCCGGCCCAAGNONE 
J100048M04GAGGCCCACGATCCGGCCCAAGNONE 
J100048M14GAGGCCCACGATCCGGCCCAAGNONE 
J100063B08GAGGCCCACGATCCGGCCCAAGNONE 
J100088E20GAGGCCCACGATCCGGCCCAAGNONE 
J100090I08GAGGCCCACGATCCGGCCCAAGNONE 
Os08g0150800AK101530CTTGGGCCCACTTGSimilar to Tyrosyl-tRNA synthetase (Tyrosyl-tRNA ligase; TyrRS). class-I aaRS. 
AK101530CTTGGGCCGASimilar to Tyrosyl-tRNA synthetase (Tyrosyl-tRNA ligase; TyrRS). class-I aaRS. 
Os08g0158900AK067062TAGGCCCAAGGTP1/OBG domain containing protein. 
J013089F04TAGGCCCAAGNONE 
J013092D16TAGGCCCAAGNONE 
J033120K14TAGGCCCAAGNONE 
J033133F24TAGGCCCAAGNONE 
J033145A10TAGGCCCAAGNONE 
J033145A11TAGGCCCAAGNONE 
J053048H24TAGGCCCAAGNONE 
J053075H10TAGGCCCAAGNONE 
Os08g0159000AK073617CTTGGGCCTANONE 
AK103973CTTGGGCCTASimilar to DnaJ homolog subfamily C member 1. 
J023130H14CTTGGGCCTANONE 
J033051J11CTTGGGCCTANONE 
J065101C10CTTGGGCCTANONE 
J065168B04CTTGGGCCTANONE 
J065184E22CTTGGGCCTANONE 
J080021D11CTTGGGCCTANONE 
J080025H10CTTGGGCCTANONE 
J080026N19CTTGGGCCTANONE 
J080034A12CTTGGGCCTANONE 
J080040L02CTTGGGCCTANONE 
J080042H19CTTGGGCCTANONE 
J080047B05CTTGGGCCTANONE 
J080047E09CTTGGGCCTANONE 
J080047I01CTTGGGCCTANONE 
J080052H19CTTGGGCCTANONE 
J080062K13CTTGGGCCTANONE 
J080063A22CTTGGGCCTANONE 
J080068G18CTTGGGCCTANONE 
J080068N19CTTGGGCCTANONE 
J080076G08CTTGGGCCTANONE 
J080077H13CTTGGGCCTANONE 
J080077K06CTTGGGCCTANONE 
J080093D15CTTGGGCCTANONE 
J080094D21CTTGGGCCTANONE 
J080097A20CTTGGGCCTANONE 
J080097E21CTTGGGCCTANONE 
J080097N17CTTGGGCCTANONE 
J100071K18CTTGGGCCTANONE 
J100072F09CTTGGGCCTANONE 
Os08g0191900AK067587CTTGGGCCGTGProtein prenyltransferase domain containing protein. 
AK099016CTTGGGCCGTGNONE 
J013032I08CTTGGGCCGTGNONE 
J013050I24CTTGGGCCGTGNONE 
J013128E05CTTGGGCCGTGNONE 
Os08g0328300AK102227GCGGCCCAAGNONE 
AK105392GCGGCCCAAGENT domain containing protein. 
Os08g0412200006-028-H07CTTGGGCCATNONE 
AJ575234CTTGGGCCATNONE 
AK059631CTTGGGCCATRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
AK099367CTTGGGCCATNONE 
AK104578CTTGGGCCATNONE 
J033071L08CTTGGGCCATNONE 
J065197K18CTTGGGCCATNONE 
Os08g0459100AK121795CTTGGGCCCGCCCCCACGTLeucine-rich repeat, cysteine-containing containing protein. 
Os08g0460800015-094-E01TTGGCCCAAGGCCCAGTTCyclin-like F-box domain containing protein. 
Os08g0463500AK058457TAGGCCCAAGZinc finger, C2H2-type domain containing protein. 
Os08g0469500AK109599TAGGCCCAAGConserved hypothetical protein. 
Os08g0499200AK120828TAGGCCCAAGSimilar to Chloride channel protein CLC-f (AtCLC-f). Splice isoform 2. 
Os08g0515800006-067-C11AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
009-131-F05AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
016-026-E03AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
AK061787AGCCCATGGGCCTTATCTCGGCCCAAGMitochodrial transcription termination factor-related family protein. 
J013032E15AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
J013032E16AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
J033140O22AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
J065058M21AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
J065090D03AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
J065115G12AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
J065124N11AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
J100021K19AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
J100035P15AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
J100043J19AGCCCATGGGCCTTATCTCGGCCCAAGNONE 
Os08g0526500016-063-D04CCAGCCCAGTTAGGCCCAAGCCCATTANONE 
AK073431CCAGCCCAGTTAGGCCCAAGCCCATTASimilar to SOX-1 protein. 
J033042D10CCAGCCCAGTTAGGCCCAAGCCCATTANONE 
J065019E02CCAGCCCAGTTAGGCCCAAGCCCATTANONE 
Os08g0556200009-008-D12GACGGCCCAAGGTATGGGCNONE 
AK121222GACGGCCCAAGGTATGGGCSimilar to Dihydroneopterin aldolase. 
J023090H22GACGGCCCAAGGTATGGGCNONE 
J075027J23GACGGCCCAAGGTATGGGCNONE 
J075032L14GACGGCCCAAGGTATGGGCNONE 
J075053H04GACGGCCCAAGGTATGGGCNONE 
J075171P20GACGGCCCAAGGTATGGGCNONE 
J100057F12GACGGCCCAAGGTATGGGCNONE 
Os09g0120033AK069069CTTGGGCCAGCCCAGCConserved hypothetical protein. 
AK069069CTTGGGCCTCConserved hypothetical protein. 
Os09g0325300011-005-H08TCGGCCCAAACTTGGGCCGGCCCGTTNONE 
AK068435TCGGCCCAAACTTGGGCCGGCCCGTTConserved hypothetical protein. 
AK073998TCGGCCCAAACTTGGGCCGGCCCGTTNONE 
J033071H21TCGGCCCAAACTTGGGCCGGCCCGTTNONE 
J065214H05TCGGCCCAAACTTGGGCCGGCCCGTTNONE 
Os09g0363700AK103667TGTTGGGCCGGCCCAAGConserved hypothetical protein. 
J075001L14TGTTGGGCCGGCCCAAGNONE 
J075049M23TGTTGGGCCGGCCCAAGNONE 
J075051I04TGTTGGGCCGGCCCAAGNONE 
J075073L04TGTTGGGCCGGCCCAAGNONE 
J075077E03TGTTGGGCCGGCCCAAGNONE 
J075083J11TGTTGGGCCGGCCCAAGNONE 
J075094J22TGTTGGGCCGGCCCAAGNONE 
J075112E08TGTTGGGCCGGCCCAAGNONE 
J075137J23TGTTGGGCCGGCCCAAGNONE 
J075192E02TGTTGGGCCGGCCCAAGNONE 
J100039K04TGTTGGGCCGGCCCAAGNONE 
Os09g0388400AK069644CTTGGGCCGGGCCTGGCTGGGCGGCCCATATCof protein family protein. 
J023147A17CTTGGGCCGGGCCTGGCTGGGCGGCCCATATNONE 
Os09g0395400AK109221ATGGCCCATGTGGCCCAAGConserved hypothetical protein. 
J075009I06ATGGCCCATGTGGCCCAAGNONE 
Os09g0401200AK063980CTGGCCCAAATAGGCCCAAGGCCCATTTSimilar to HSP associated protein like. 
Os09g0411700005-017-C05TTCGGCCCAAGNONE 
009-163-B01TTCGGCCCAAGNONE 
AK058290TTCGGCCCAAGPpiC-type peptidyl-prolyl cis-trans isomerase domain containing protein. 
AK104919TTCGGCCCAAGNONE 
AK121091TTCGGCCCAAGNONE 
J013039D20TTCGGCCCAAGNONE 
J023066F16TTCGGCCCAAGNONE 
J023082H09TTCGGCCCAAGNONE 
J023088H05TTCGGCCCAAGNONE 
J065013G09TTCGGCCCAAGNONE 
J065065C12TTCGGCCCAAGNONE 
J065111I04TTCGGCCCAAGNONE 
J065179H22TTCGGCCCAAGNONE 
J075023N14TTCGGCCCAAGNONE 
J090041J17TTCGGCCCAAGNONE 
J100031J21TTCGGCCCAAGNONE 
J100057A18TTCGGCCCAAGNONE 
J100068P22TTCGGCCCAAGNONE 
Os09g0437900AK107833TCCGGCCCAAGSimilar to Adrenodoxin. 
Os09g0477700AK121644CTTGGGCCGTTConserved hypothetical protein. 
Os09g0495200AK102989CTTGGGCCAAGTGGGCTTTConserved hypothetical protein. 
J075062H18CTTGGGCCAAGTGGGCTTTNONE 
J075098G06CTTGGGCCAAGTGGGCTTTNONE 
Os09g0554000J065123C23GACGGCCCAAGSimilar to Mitochondrial phosphate transporter. 
Os09g0572900AK069270TCGTGGGCCTCTCGGCCCAAGSimilar to Dynamin-related protein 1E (Dynamin-like protein E) (Dynamin-like protein 4) (Dynamin-like protein DLP2). 
Os09g0573000AK073399CTTGGGCCGAGAGGCCCACGAProtein prenyltransferase domain containing protein. 
Os11g0127700AK103742CTGGGCTTGGGCCGGCCCACTHypothetical protein. 
J090083M11CTGGGCTTGGGCCGGCCCACTNONE 
Os11g0128400AK102291CTTGGGCCGGACDC45-like protein family protein. 
AK102291TGCGGCCCAAGCDC45-like protein family protein. 
J033089K18CTTGGGCCGGANONE 
J033089K18TGCGGCCCAAGNONE 
Os11g0130200AK059458CTTGGGCCTGProtein of unknown function DUF309 family protein. 
J075195F21CTTGGGCCTGNONE 
Os11g0148000AK108267CTTGGGCCAASodium/calcium exchanger membrane region domain containing protein. 
J065051O11CTTGGGCCAANONE 
J065110G12CTTGGGCCAANONE 
Os11g0219400AK069850GGCCGGGCTTGGGCCGTGAnkyrin repeat containing protein. 
AK099123GGCCGGGCTTGGGCCGTGNONE 
J023143G18GGCCGGGCTTGGGCCGTGNONE 
Os11g0276000AK108684CTTGGGCCGGGCNONE 
Os11g0423200AK111297AAGGCCCAAGHypothetical protein. 
Os11g0473000AK060156AAGGCCCAAGGCCCATCANONE 
AK065994AAGGCCCAAGGCCCATCASimilar to ER lumen protein retaining receptor (HDEL receptor) (PGP169-12). 
AK104759AAGGCCCAAGGCCCATCANONE 
Os11g0497000AK111924CAAGGCCCAAGGCCCAAGGCCCAAAGCCCAAATSimilar to Ubiquitin activating enzyme-like protein (SUMO activating enzyme 1a). 
J065090J11CAAGGCCCAAGGCCCAAGGCCCAAAGCCCAAATNONE 
J065097A08CAAGGCCCAAGGCCCAAGGCCCAAAGCCCAAATNONE 
J065123J10CAAGGCCCAAGGCCCAAGGCCCAAAGCCCAAATNONE 
J075096F04CAAGGCCCAAGGCCCAAGGCCCAAAGCCCAAATNONE 
J080065C15CAAGGCCCAAGGCCCAAGGCCCAAAGCCCAAATNONE 
J090033J04CAAGGCCCAAGGCCCAAGGCCCAAAGCCCAAATNONE 
J090072N23CAAGGCCCAAGGCCCAAGGCCCAAAGCCCAAATNONE 
J100021E08CAAGGCCCAAGGCCCAAGGCCCAAAGCCCAAATNONE 
J100063H21CAAGGCCCAAGGCCCAAGGCCCAAAGCCCAAATNONE 
Os11g0544000AK066017GCCGGCCCAACTCGGCCCAAGConserved hypothetical protein. 
AK071393GCCGGCCCAACTCGGCCCAAGNONE 
J013050C10GCCGGCCCAACTCGGCCCAAGNONE 
J013118O12GCCGGCCCAACTCGGCCCAAGNONE 
Os11g0549665006-027-H01GCCACACGGCCCAAGTAGGCCCAGGNONE 
006-083-C01GCCACACGGCCCAAGTAGGCCCAGGNONE 
AK072644GCCACACGGCCCAAGTAGGCCCAGGNONE 
AK101587GCCACACGGCCCAAGTAGGCCCAGGConserved hypothetical protein. 
AK106162GCCACACGGCCCAAGTAGGCCCAGGNONE 
J013051C18GCCACACGGCCCAAGTAGGCCCAGGNONE 
J013067E02GCCACACGGCCCAAGTAGGCCCAGGNONE 
J013169N16GCCACACGGCCCAAGTAGGCCCAGGNONE 
J023049M16GCCACACGGCCCAAGTAGGCCCAGGNONE 
J023050I19GCCACACGGCCCAAGTAGGCCCAGGNONE 
J023063H21GCCACACGGCCCAAGTAGGCCCAGGNONE 
J023063K01GCCACACGGCCCAAGTAGGCCCAGGNONE 
J023108O17GCCACACGGCCCAAGTAGGCCCAGGNONE 
J023115H08GCCACACGGCCCAAGTAGGCCCAGGNONE 
J023117O16GCCACACGGCCCAAGTAGGCCCAGGNONE 
J023129J01GCCACACGGCCCAAGTAGGCCCAGGNONE 
J023133I23GCCACACGGCCCAAGTAGGCCCAGGNONE 
J023143P10GCCACACGGCCCAAGTAGGCCCAGGNONE 
J033045J08GCCACACGGCCCAAGTAGGCCCAGGNONE 
J033050I15GCCACACGGCCCAAGTAGGCCCAGGNONE 
J033051A04GCCACACGGCCCAAGTAGGCCCAGGNONE 
J033060C24GCCACACGGCCCAAGTAGGCCCAGGNONE 
J033069L21GCCACACGGCCCAAGTAGGCCCAGGNONE 
J033103H04GCCACACGGCCCAAGTAGGCCCAGGNONE 
J033112L21GCCACACGGCCCAAGTAGGCCCAGGNONE 
J033118O16GCCACACGGCCCAAGTAGGCCCAGGNONE 
J033126B10GCCACACGGCCCAAGTAGGCCCAGGNONE 
J033133P10GCCACACGGCCCAAGTAGGCCCAGGNONE 
J033144H19GCCACACGGCCCAAGTAGGCCCAGGNONE 
J033145H19GCCACACGGCCCAAGTAGGCCCAGGNONE 
J043029L04GCCACACGGCCCAAGTAGGCCCAGGNONE 
J075066N17GCCACACGGCCCAAGTAGGCCCAGGNONE 
J075150D02GCCACACGGCCCAAGTAGGCCCAGGNONE 
J075158D05GCCACACGGCCCAAGTAGGCCCAGGNONE 
J090009I10GCCACACGGCCCAAGTAGGCCCAGGNONE 
J090048D05GCCACACGGCCCAAGTAGGCCCAGGNONE 
J090085E02GCCACACGGCCCAAGTAGGCCCAGGNONE 
J090085H13GCCACACGGCCCAAGTAGGCCCAGGNONE 
J100029L21GCCACACGGCCCAAGTAGGCCCAGGNONE 
J100041M06GCCACACGGCCCAAGTAGGCCCAGGNONE 
J100045B04GCCACACGGCCCAAGTAGGCCCAGGNONE 
J100077C04GCCACACGGCCCAAGTAGGCCCAGGNONE 
Os11g0586300AK072257CCAGGCCCAAGConserved hypothetical protein. 
Os11g0644750009-018-E07CTTGGGCCTCNONE 
009-075-B11CTTGGGCCTCNONE 
009-098-C10CTTGGGCCTCNONE 
AK062734CTTGGGCCTCPlant disease resistance response protein family protein. 
Os11g0660000AK066709GCGGCCCAAGSodium/calcium exchanger membrane region domain containing protein. 
J013074O18GCGGCCCAAGNONE 
J023081H12GCGGCCCAAGNONE 
J065072E24GCGGCCCAAGNONE 
J065186K08GCGGCCCAAGNONE 
J075079E19GCGGCCCAAGNONE 
J075093J05GCGGCCCAAGNONE 
J075124I21GCGGCCCAAGNONE 
J075187F09GCGGCCCAAGNONE 
J090037O16GCGGCCCAAGNONE 
Os12g0123900016-031-A06CTTGGGCCGGCCCACTNONE 
AK061862CTTGGGCCGGCCCACTHypothetical protein. 
J013031P10CTTGGGCCGGCCCACTNONE 
J053034P22CTTGGGCCGGCCCACTNONE 
J053046O16CTTGGGCCGGCCCACTNONE 
J053048D20CTTGGGCCGGCCCACTNONE 
J090031I07CTTGGGCCGGCCCACTNONE 
J100025B02CTTGGGCCGGCCCACTNONE 
Os12g0124700AK073156TGCGGCCCAAGCDC45-like protein family protein. 
J090013O22TGCGGCCCAAGNONE 
Os12g0188900012-030-C08CCCGGCCCAAGNONE 
J013027N23CCCGGCCCAAGConserved hypothetical protein. 
J013156K23CCCGGCCCAAGNONE 
J023134K02CCCGGCCCAAGNONE 
J033051M18CCCGGCCCAAGNONE 
J033143K05CCCGGCCCAAGNONE 
J080003C24CCCGGCCCAAGNONE 
J080004K05CCCGGCCCAAGNONE 
J080009D14CCCGGCCCAAGNONE 
J080014L12CCCGGCCCAAGNONE 
J080020E23CCCGGCCCAAGNONE 
J080021K20CCCGGCCCAAGNONE 
J080024B19CCCGGCCCAAGNONE 
J080024C12CCCGGCCCAAGNONE 
J080031K10CCCGGCCCAAGNONE 
J080034G09CCCGGCCCAAGNONE 
J080036C10CCCGGCCCAAGNONE 
J080037K18CCCGGCCCAAGNONE 
J080039J17CCCGGCCCAAGNONE 
J080040A20CCCGGCCCAAGNONE 
J080042B06CCCGGCCCAAGNONE 
J080046P07CCCGGCCCAAGNONE 
J080047G02CCCGGCCCAAGNONE 
J080049E12CCCGGCCCAAGNONE 
J080056N14CCCGGCCCAAGNONE 
J080059K10CCCGGCCCAAGNONE 
J080064F05CCCGGCCCAAGNONE 
J080064I04CCCGGCCCAAGNONE 
J080064K17CCCGGCCCAAGNONE 
J080069A15CCCGGCCCAAGNONE 
J080071E22CCCGGCCCAAGNONE 
J080071M24CCCGGCCCAAGNONE 
J080074C17CCCGGCCCAAGNONE 
J080075J07CCCGGCCCAAGNONE 
J080079F11CCCGGCCCAAGNONE 
J080083F15CCCGGCCCAAGNONE 
J080084N21CCCGGCCCAAGNONE 
J080086O03CCCGGCCCAAGNONE 
J080089K02CCCGGCCCAAGNONE 
J080092K22CCCGGCCCAAGNONE 
J080093P09CCCGGCCCAAGNONE 
J090001N04CCCGGCCCAAGNONE 
J090041M02CCCGGCCCAAGNONE 
Os12g0223300006-037-D03GAGGCCCAAGNONE 
006-037-D03GAGGCCCAAGNONE 
AJ429043GAGGCCCAAGNONE 
AJ429043GAGGCCCAAGNONE 
AK060133GAGGCCCAAGSimilar to Outer membrane cytochrome b(5) (Fragment). 
AK060133GAGGCCCAAGSimilar to Outer membrane cytochrome b(5) (Fragment). 
AK073017GAGGCCCAAGNONE 
AK073017GAGGCCCAAGNONE 
J065085K05GAGGCCCAAGNONE 
J065085K05GAGGCCCAAGNONE 
J075053C01GAGGCCCAAGNONE 
J075053C01GAGGCCCAAGNONE 
J075055O06GAGGCCCAAGNONE 
J075055O06GAGGCCCAAGNONE 
J075073B01GAGGCCCAAGNONE 
J075073B01GAGGCCCAAGNONE 
J075089M07GAGGCCCAAGNONE 
J075089M07GAGGCCCAAGNONE 
J075095E16GAGGCCCAAGNONE 
J075095E16GAGGCCCAAGNONE 
J075112O19GAGGCCCAAGNONE 
J075112O19GAGGCCCAAGNONE 
J075143A11GAGGCCCAAGNONE 
J075143A11GAGGCCCAAGNONE 
J075173D24GAGGCCCAAGNONE 
J075173D24GAGGCCCAAGNONE 
J075199G18GAGGCCCAAGNONE 
J075199G18GAGGCCCAAGNONE 
J090030N06GAGGCCCAAGNONE 
J090030N06GAGGCCCAAGNONE 
J100052H12GAGGCCCAAGNONE 
J100052H12GAGGCCCAAGNONE 
J100079F09GAGGCCCAAGNONE 
J100079F09GAGGCCCAAGNONE 
Os12g0223700J075049J03CTTGGGCCAAAAGCCCAAGHypothetical protein. 
J075101F23CTTGGGCCAAAAGCCCAAGNONE 
Os12g0244000AK106408CTTGGGCTCGGCCCAAGHypothetical protein. 
Os12g0508300009-006-G07CCCGGCCCAAGNONE 
009-133-E05CCCGGCCCAAGNONE 
009-137-F10CCCGGCCCAAGNONE 
014-024-A06CCCGGCCCAAGNONE 
AK059123CCCGGCCCAAGRibosomal protein S14 family protein. 
J100088E22CCCGGCCCAAGNONE 
Os12g0534700AK122037GCCCGGCCCAAGProtein kinase-like domain containing protein. 
J033112P03GCCCGGCCCAAGNONE 
J090022G02GCCCGGCCCAAGNONE 
J090066N06GCCCGGCCCAAGNONE 
J100064H18GCCCGGCCCAAGNONE 
J100074N21GCCCGGCCCAAGNONE 
J100081P16GCCCGGCCCAAGNONE 
Os12g0564400009-069-F12GAGGCCCAAAAGCCCAAGGCCCAAGGCCCAAACNONE 
AK059949GAGGCCCAAAAGCCCAAGGCCCAAGGCCCAAACSimilar to Thylakoid lumenal 21.5 kDa protein, chloroplast precursor. 
AK104548GAGGCCCAAAAGCCCAAGGCCCAAGGCCCAAACNONE 
Os12g0621700AK073528CCCGGCCCAAGConserved hypothetical protein. 
J033043M23CCCGGCCCAAGNONE 
J033114G18CCCGGCCCAAGNONE 
J033120E10CCCGGCCCAAGNONE 
J033143J21CCCGGCCCAAGNONE 
J065080M02CCCGGCCCAAGNONE 
J065138O22CCCGGCCCAAGNONE 
J090048B16CCCGGCCCAAGNONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.