version

Summary of OsREG582 (All List)

OrganismOryza sativa  
IDOsREG582  
SequenceGAAGCCCA  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count1169  

Entry Sequences (1169 entries)

LocusGene modelSequenceDescription
Os01g0104000AK072087TAGGCCCACAGAAGCCCATAANONE 
AK103808TAGGCCCACAGAAGCCCATAAC-type lectin domain containing protein. 
Os01g0104100AK072797TTATGGGCTTCTGTGGGCCTAZinc finger, RING-type domain containing protein. 
AK104280TTATGGGCTTCTGTGGGCCTANONE 
Os01g0104800AK067602GAAGCCCAATASas10/Utp3 family protein. 
J013109E04GAAGCCCAATANONE 
J033057M05GAAGCCCAATANONE 
J043021M24GAAGCCCAATANONE 
J090014N05GAAGCCCAATANONE 
J090077H23GAAGCCCAATANONE 
J090084H08GAAGCCCAATANONE 
Os01g0162400AK108484GTGGGCTTCConserved hypothetical protein. 
Os01g0203300015-045-F03ACATGGGCTTCNONE 
015-045-F03CCATGGGCTTCNONE 
AK106329ACATGGGCTTCConserved hypothetical protein. 
AK106329CCATGGGCTTCConserved hypothetical protein. 
Os01g0206600J065041P19TAATGGGCCTGAAGCCCACATGGCCCATAConserved hypothetical protein. 
Os01g0214300AK060604GAAGCCCAAGConserved hypothetical protein. 
Os01g0254000006-037-A11GAAGCCCATANONE 
006-059-H09GAAGCCCATANONE 
006-088-D11GAAGCCCATANONE 
006-112-B06GAAGCCCATANONE 
006-120-E12GAAGCCCATANONE 
AK111904GAAGCCCATANONE 
AK111979GAAGCCCATANONE 
AK119548GAAGCCCATANONE 
AY620417GAAGCCCATASimilar to NTGB2 (Fragment). 
J023112F13GAAGCCCATANONE 
J053066C19GAAGCCCATANONE 
J065006L12GAAGCCCATANONE 
J065019L17GAAGCCCATANONE 
J065081J05GAAGCCCATANONE 
J065085D02GAAGCCCATANONE 
J065203D03GAAGCCCATANONE 
J065210O20GAAGCCCATANONE 
J090062P06GAAGCCCATANONE 
J090063N07GAAGCCCATANONE 
J100061H24GAAGCCCATANONE 
Os01g0276000009-162-D08GAAGCCCAACANONE 
AK058917GAAGCCCAACASimilar to 60S ribosomal protein L30. 
AK119715GAAGCCCAACANONE 
AK122128GAAGCCCAACANONE 
J033132L17GAAGCCCAACANONE 
J065019G15GAAGCCCAACANONE 
J065033O12GAAGCCCAACANONE 
J065058J19GAAGCCCAACANONE 
J065069L03GAAGCCCAACANONE 
J065072E03GAAGCCCAACANONE 
J065112J06GAAGCCCAACANONE 
J065163C18GAAGCCCAACANONE 
J065170L20GAAGCCCAACANONE 
J065184O11GAAGCCCAACANONE 
J065199M19GAAGCCCAACANONE 
J065207P22GAAGCCCAACANONE 
J065211C12GAAGCCCAACANONE 
J075072K20GAAGCCCAACANONE 
J075100B16GAAGCCCAACANONE 
J075173F02GAAGCCCAACANONE 
J090083E15GAAGCCCAACANONE 
J100022F06GAAGCCCAACANONE 
J100064C04GAAGCCCAACANONE 
J100068F11GAAGCCCAACANONE 
Os01g0283000AK073165GAAGCCCACAConserved hypothetical protein. 
J033023G08GAAGCCCACANONE 
Os01g0283100004-018-B01TGTGGGCTTCNONE 
AK060908TGTGGGCTTCNONE 
AK071713TGTGGGCTTCSimilar to Ferripyochelin-binding protein-like. 
AK104205TGTGGGCTTCNONE 
AK122051TGTGGGCTTCNONE 
J023109L19TGTGGGCTTCNONE 
Os01g0328400006-092-H09GAAGCCCATAANONE 
009-085-A02GAAGCCCATAANONE 
012-078-B03GAAGCCCATAANONE 
AK061988GAAGCCCATAAUbiquitin. 
J013073B13GAAGCCCATAANONE 
J023135L09GAAGCCCATAANONE 
J023135O07GAAGCCCATAANONE 
J033027B12GAAGCCCATAANONE 
J033084P17GAAGCCCATAANONE 
J065010M05GAAGCCCATAANONE 
J065021N11GAAGCCCATAANONE 
J065021N12GAAGCCCATAANONE 
J065031K11GAAGCCCATAANONE 
J065072P04GAAGCCCATAANONE 
J065098D05GAAGCCCATAANONE 
J065122N23GAAGCCCATAANONE 
J065129L13GAAGCCCATAANONE 
J065135N13GAAGCCCATAANONE 
J065215N10GAAGCCCATAANONE 
J075120N22GAAGCCCATAANONE 
J090011G23GAAGCCCATAANONE 
J090014F06GAAGCCCATAANONE 
J090040G23GAAGCCCATAANONE 
J090075I20GAAGCCCATAANONE 
J090075N01GAAGCCCATAANONE 
J090089B04GAAGCCCATAANONE 
J090090F08GAAGCCCATAANONE 
J090091M17GAAGCCCATAANONE 
J090094L03GAAGCCCATAANONE 
J090099L06GAAGCCCATAANONE 
J100018A18GAAGCCCATAANONE 
J100027H13GAAGCCCATAANONE 
J100069C05GAAGCCCATAANONE 
J100086L10GAAGCCCATAANONE 
Os01g0639600005-018-A02GAAGCCCAAACNONE 
AK067056GAAGCCCAAACProtein of unknown function DUF1645 family protein. 
J013066M03GAAGCCCAAACNONE 
J013066O05GAAGCCCAAACNONE 
J013088M21GAAGCCCAAACNONE 
J065045F04GAAGCCCAAACNONE 
J080018F22GAAGCCCAAACNONE 
J080037B10GAAGCCCAAACNONE 
J080042G23GAAGCCCAAACNONE 
J080052B21GAAGCCCAAACNONE 
J080060H13GAAGCCCAAACNONE 
J100024A05GAAGCCCAAACNONE 
J100071A09GAAGCCCAAACNONE 
J100080K14GAAGCCCAAACNONE 
Os01g0698300AK058744TGTGGGCTTCNONE 
J090068O06TGTGGGCTTCNONE 
Os01g0706400AK065826CTGGGCTTCNONE 
AK066981CTGGGCTTCProtein of unknown function DUF292, eukaryotic domain containing protein. 
AK068355CTGGGCTTCNONE 
J013036F01CTGGGCTTCNONE 
J013049K18CTGGGCTTCNONE 
J013092D23CTGGGCTTCNONE 
J013100B17CTGGGCTTCNONE 
J033096D22CTGGGCTTCNONE 
J033108P15CTGGGCTTCNONE 
J033119E24CTGGGCTTCNONE 
J075169P09CTGGGCTTCNONE 
Os01g0710800013-097-E05GGTTGGGCTTGAAGCCCAACNONE 
AK069973GGTTGGGCTTGAAGCCCAACNONE 
AK071099GGTTGGGCTTGAAGCCCAACConserved hypothetical protein. 
J023081K01GGTTGGGCTTGAAGCCCAACNONE 
J023123E16GGTTGGGCTTGAAGCCCAACNONE 
J033066B11GGTTGGGCTTGAAGCCCAACNONE 
J065144G11GGTTGGGCTTGAAGCCCAACNONE 
Os01g0714800AK108555GAAGCCCACCWRKY transcription factor 26. 
AY870609GAAGCCCACCNONE 
Os01g0752300AK121755ATATGGGCTTCGGCCCATGASimilar to 60S ribosomal protein L18a-1. 
J013049F10ATATGGGCTTCGGCCCATGANONE 
J013088L10ATATGGGCTTCGGCCCATGANONE 
J023020B21ATATGGGCTTCGGCCCATGANONE 
J023038M01ATATGGGCTTCGGCCCATGANONE 
J033058H15ATATGGGCTTCGGCCCATGANONE 
J033088C04ATATGGGCTTCGGCCCATGANONE 
J033115N19ATATGGGCTTCGGCCCATGANONE 
J033131H04ATATGGGCTTCGGCCCATGANONE 
J065067E05ATATGGGCTTCGGCCCATGANONE 
J065085C07ATATGGGCTTCGGCCCATGANONE 
J065095D12ATATGGGCTTCGGCCCATGANONE 
J065124B19ATATGGGCTTCGGCCCATGANONE 
J065181H07ATATGGGCTTCGGCCCATGANONE 
J065197B09ATATGGGCTTCGGCCCATGANONE 
J075090K22ATATGGGCTTCGGCCCATGANONE 
J075101P17ATATGGGCTTCGGCCCATGANONE 
J075181F13ATATGGGCTTCGGCCCATGANONE 
J075190H19ATATGGGCTTCGGCCCATGANONE 
J090004P17ATATGGGCTTCGGCCCATGANONE 
J090066I03ATATGGGCTTCGGCCCATGANONE 
Os01g0861000AK058707GAAGCCCATCAConserved hypothetical protein. 
Os01g0889800003-107-A06GAAGCCCATGGGCCTCNONE 
005-016-H12GAAGCCCATGGGCCTCNONE 
AK070087GAAGCCCATGGGCCTCRhodanese-like domain containing protein. 
AK104708GAAGCCCATGGGCCTCNONE 
J013035D13GAAGCCCATGGGCCTCNONE 
J013068K01GAAGCCCATGGGCCTCNONE 
J023042J18GAAGCCCATGGGCCTCNONE 
J053023F13GAAGCCCATGGGCCTCNONE 
J053026M13GAAGCCCATGGGCCTCNONE 
J053033N15GAAGCCCATGGGCCTCNONE 
J053035I16GAAGCCCATGGGCCTCNONE 
J053039A11GAAGCCCATGGGCCTCNONE 
J053039K22GAAGCCCATGGGCCTCNONE 
J053043B08GAAGCCCATGGGCCTCNONE 
J053068K09GAAGCCCATGGGCCTCNONE 
J053082D11GAAGCCCATGGGCCTCNONE 
J053092N12GAAGCCCATGGGCCTCNONE 
J053099A19GAAGCCCATGGGCCTCNONE 
J065027F17GAAGCCCATGGGCCTCNONE 
J065039B13GAAGCCCATGGGCCTCNONE 
J065139N16GAAGCCCATGGGCCTCNONE 
J065205B22GAAGCCCATGGGCCTCNONE 
Os01g0897200AK061505GAAGCCCACNONE 
AK065055GAAGCCCACNONE 
AK100403GAAGCCCACSimilar to Ribonuclease 2 precursor (EC 3.1.27.1). 
AK105061GAAGCCCACNONE 
AK121862GAAGCCCACNONE 
J013001J04GAAGCCCACNONE 
J033103A19GAAGCCCACNONE 
J075005P18GAAGCCCACNONE 
J090027D12GAAGCCCACNONE 
J090032M01GAAGCCCACNONE 
J090079K10GAAGCCCACNONE 
J100018O17GAAGCCCACNONE 
J100080H14GAAGCCCACNONE 
J100088D08GAAGCCCACNONE 
Os01g0897300006-029-B03GAAGCCCAGNONE 
006-047-G03GAAGCCCAGNONE 
AK061032GAAGCCCAGRibonuclease T2 family protein. 
AK106167GAAGCCCAGNONE 
J065166D04GAAGCCCAGNONE 
J065195J12GAAGCCCAGNONE 
J075069K20GAAGCCCAGNONE 
Os01g0908100AK072293GAAGCCCACARabGAP/TBC domain containing protein. 
J065010B13GAAGCCCACANONE 
J065010M12GAAGCCCACANONE 
J065047C19GAAGCCCACANONE 
J065069B18GAAGCCCACANONE 
J065071K24GAAGCCCACANONE 
J065142P04GAAGCCCACANONE 
J065170E11GAAGCCCACANONE 
Os01g0913400AK099881TGGTGGGCTTCProtein prenyltransferase domain containing protein. 
Os01g0924000004-020-C09GAAGCCCACAANONE 
005-014-A06GAAGCCCACAANONE 
009-085-G12GAAGCCCACAANONE 
009-123-A08GAAGCCCACAANONE 
009-134-A05GAAGCCCACAANONE 
009-137-F06GAAGCCCACAANONE 
016-016-B08GAAGCCCACAANONE 
AF050674GAAGCCCACAANONE 
AK061690GAAGCCCACAASimilar to Chloroplast 50S ribosomal protein L27 (Fragment). 
AK120797GAAGCCCACAANONE 
J013040A15GAAGCCCACAANONE 
J013104L20GAAGCCCACAANONE 
J013127E12GAAGCCCACAANONE 
J013158O05GAAGCCCACAANONE 
J023012E09GAAGCCCACAANONE 
J023126L23GAAGCCCACAANONE 
J023143B03GAAGCCCACAANONE 
J065005B16GAAGCCCACAANONE 
J065101J15GAAGCCCACAANONE 
J065105K16GAAGCCCACAANONE 
J065155K16GAAGCCCACAANONE 
J065171M17GAAGCCCACAANONE 
J065182F07GAAGCCCACAANONE 
J065187D10GAAGCCCACAANONE 
J065194I24GAAGCCCACAANONE 
J065207E24GAAGCCCACAANONE 
J075001C24GAAGCCCACAANONE 
J075090O10GAAGCCCACAANONE 
J075095H17GAAGCCCACAANONE 
J075109M24GAAGCCCACAANONE 
J075123C18GAAGCCCACAANONE 
J075148G22GAAGCCCACAANONE 
J090009B09GAAGCCCACAANONE 
J090075K17GAAGCCCACAANONE 
J090081H23GAAGCCCACAANONE 
J090097H21GAAGCCCACAANONE 
J100063P14GAAGCCCACAANONE 
Os01g0929500AK111399GAAGCCCAGTASimilar to Carbonyl reductase-like protein. 
AK120263GAAGCCCAGTANONE 
Os01g0939700AK059803CTGGGCTTCNONE 
AK070588CTGGGCTTCSimilar to Esterase D (EC 3.1.1.1). 
AK111469CTGGGCTTCNONE 
J090021L11CTGGGCTTCNONE 
Os01g0971600AK070366GAAGCCCAGCSimilar to Sn-glycerol-3-phosphate dehydrogenase (Fragment). 
Os01g0974500015-047-H07ATTGGGCTTCNONE 
AK064109ATTGGGCTTCPectinacetylesterase family protein. 
Os02g0148600AK059287GCTGGGCTTCConserved hypothetical protein. 
Os02g0150100AK060595GAAGCCCAGCCSimilar to DEAD-box protein abstrakt. 
Os02g0200900J090088F16CCGTGGGCTTCNONE 
Os02g0250600J075143F23AAATGGGCTTCATGGGCCGCLate embryogenesis abundant protein repeat containing protein. 
Os02g0461200012-026-A12GAAGCCCACACGNONE 
AK063459GAAGCCCACACGConserved hypothetical protein. 
J065183F11GAAGCCCACACGNONE 
J075190G18GAAGCCCACACGNONE 
Os02g0467200014-053-H06GAAGCCCATAANONE 
AK063704GAAGCCCATAAConserved hypothetical protein. 
J065197J05GAAGCCCATAANONE 
Os02g0580700AK073664AGTTGGGCTTCConserved hypothetical protein. 
J090060F24AGTTGGGCTTCNONE 
Os02g0616100006-043-E12GAAGCCCACGGNONE 
006-043-G11GAAGCCCACGGNONE 
006-053-C05GAAGCCCACGGNONE 
006-059-C04GAAGCCCACGGNONE 
006-068-F02GAAGCCCACGGNONE 
006-071-B10GAAGCCCACGGNONE 
006-084-A03GAAGCCCACGGNONE 
006-086-F07GAAGCCCACGGNONE 
006-105-B05GAAGCCCACGGNONE 
006-109-A06GAAGCCCACGGNONE 
009-105-B10GAAGCCCACGGNONE 
009-153-H09GAAGCCCACGGNONE 
AK060972GAAGCCCACGGConserved hypothetical protein. 
AK104643GAAGCCCACGGNONE 
J075074K09GAAGCCCACGGNONE 
Os02g0643500AK068423GAAGCCCACPentapeptide repeat containing protein. 
Os02g0681100AK100584GAAGCCCACGAAProtein of unknown function DUF604 family protein. 
J023106A15GAAGCCCACGAANONE 
Os02g0688900AK066093GAAGCCCAACTGPI transamidase subunit PIG-U family protein. 
J065007D18GAAGCCCAACTNONE 
J065040G21GAAGCCCAACTNONE 
J065103G03GAAGCCCAACTNONE 
J065175F18GAAGCCCAACTNONE 
J065202A07GAAGCCCAACTNONE 
J075006C01GAAGCCCAACTNONE 
J075178F24GAAGCCCAACTNONE 
Os02g0741500AK068867GAAGCCCAGCRibbon-helix-helix domain containing protein. 
Os02g0762300AK106684GAAGCCCACAAProtein of unknown function UPF0021 family protein. 
J090060M09GAAGCCCACAANONE 
J100083E05GAAGCCCACAANONE 
Os02g0791400009-106-F11TATTGGGCTTCNONE 
AK062787TATTGGGCTTCCytochrome oxidase c, subunit VIb family protein. 
Os02g0802400J065054M13GAAGCCCACGTNONE 
J065061I04GAAGCCCACGTNONE 
J065112M15GAAGCCCACGTEF-Hand type domain containing protein. 
J100050L24GAAGCCCACGTNONE 
J100059D20GAAGCCCACGTNONE 
Os02g0832700AK099439TGTTGGGCCTTTGGGCTTCSimilar to Metal tolerance protein C2 (AtMTPc2). 
Os03g0116500AF106844CTGGGCTTCNONE 
AK101870CTGGGCTTCConstitutive photomorphogenic 11. 
J023055L16CTGGGCTTCNONE 
J023088I16CTGGGCTTCNONE 
J033070E21CTGGGCTTCNONE 
J065124N22CTGGGCTTCNONE 
J075152A19CTGGGCTTCNONE 
J075181J21CTGGGCTTCNONE 
J090011F23CTGGGCTTCNONE 
Os03g0116800012-097-D10GAAGCCCACCACNONE 
016-024-H10GAAGCCCACCACNONE 
AK066955GAAGCCCACCACConserved hypothetical protein. 
AK068678GAAGCCCACCACNONE 
AK104839GAAGCCCACCACNONE 
J013033G16GAAGCCCACCACNONE 
J013091C10GAAGCCCACCACNONE 
J013158H22GAAGCCCACCACNONE 
J023106K11GAAGCCCACCACNONE 
J065051O15GAAGCCCACCACNONE 
J065129G22GAAGCCCACCACNONE 
J075001K02GAAGCCCACCACNONE 
J075011O03GAAGCCCACCACNONE 
J075024K04GAAGCCCACCACNONE 
J075026E07GAAGCCCACCACNONE 
J075037O14GAAGCCCACCACNONE 
J075071D17GAAGCCCACCACNONE 
J075084M05GAAGCCCACCACNONE 
J075114B06GAAGCCCACCACNONE 
J075128C23GAAGCCCACCACNONE 
J075153A13GAAGCCCACCACNONE 
J075158A15GAAGCCCACCACNONE 
J075165P09GAAGCCCACCACNONE 
J075167M21GAAGCCCACCACNONE 
J075170F11GAAGCCCACCACNONE 
J075186F12GAAGCCCACCACNONE 
J075186L13GAAGCCCACCACNONE 
J075189A01GAAGCCCACCACNONE 
J075192D19GAAGCCCACCACNONE 
Os03g0128100003-107-E07TTATGGGCTTCNONE 
AK062279TTATGGGCTTCSimilar to Callose synthase 1 catalytic subunit. 
AK105008TTATGGGCTTCNONE 
Os03g0135600J065183G03TTATGGGCTTCAnkyrin repeat containing protein. 
Os03g0137500006-040-G01GAAGCCCATATNONE 
015-054-G04GAAGCCCATATNONE 
AK060148GAAGCCCATATNONE 
AK073584GAAGCCCATATNONE 
AK100231GAAGCCCATATSimilar to VDAC3.1. 
J013146L24GAAGCCCATATNONE 
J023022O09GAAGCCCATATNONE 
J023049J19GAAGCCCATATNONE 
J023133L05GAAGCCCATATNONE 
J023143P12GAAGCCCATATNONE 
J033040B12GAAGCCCATATNONE 
J033050O14GAAGCCCATATNONE 
J033066G05GAAGCCCATATNONE 
J065007J18GAAGCCCATATNONE 
J100067H13GAAGCCCATATNONE 
Os03g0138600Os03g0138600AGTTGGGCCGAAGAAGCCCATAProtein of unknown function DUF810 family protein. 
Os03g0142900011-054-A05GAAGCCCATCTNONE 
AK067103GAAGCCCATCTNONE 
AK120438GAAGCCCATCTProtein of unknown function DUF946, plant family protein. 
J013097D18GAAGCCCATCTNONE 
J013098E18GAAGCCCATCTNONE 
J013099I17GAAGCCCATCTNONE 
J013108C09GAAGCCCATCTNONE 
J023045J15GAAGCCCATCTNONE 
J033034E13GAAGCCCATCTNONE 
J033095F07GAAGCCCATCTNONE 
J033102N22GAAGCCCATCTNONE 
J065016C14GAAGCCCATCTNONE 
J065034E13GAAGCCCATCTNONE 
J065065F21GAAGCCCATCTNONE 
J065159M09GAAGCCCATCTNONE 
J075012C13GAAGCCCATCTNONE 
J075017P18GAAGCCCATCTNONE 
J075018M03GAAGCCCATCTNONE 
J075021H19GAAGCCCATCTNONE 
J075070K23GAAGCCCATCTNONE 
J075077B18GAAGCCCATCTNONE 
J075085E20GAAGCCCATCTNONE 
J075090N23GAAGCCCATCTNONE 
J075137M16GAAGCCCATCTNONE 
J075151E03GAAGCCCATCTNONE 
J090042L02GAAGCCCATCTNONE 
J090060C21GAAGCCCATCTNONE 
J090089I17GAAGCCCATCTNONE 
J100024L19GAAGCCCATCTNONE 
J100025A06GAAGCCCATCTNONE 
J100033C24GAAGCCCATCTNONE 
J100052J17GAAGCCCATCTNONE 
J100063H10GAAGCCCATCTNONE 
J100073P04GAAGCCCATCTNONE 
J100075D01GAAGCCCATCTNONE 
J100077J17GAAGCCCATCTNONE 
J100087F03GAAGCCCATCTNONE 
J100087F09GAAGCCCATCTNONE 
Os03g0148000AK110468ATTTGGGCTTCProtein of unknown function DUF677 family protein. 
Os03g0148400AK072852GAAGCCCAAAProtein of unknown function DUF740 family protein. 
J023138H13GAAGCCCAAANONE 
Os03g0178400AK108257GAAGCCCACCACCAACEpoxide hydrolase family protein. 
Os03g0192400009-081-A03GAAGCCCACNONE 
009-159-B02GAAGCCCACNONE 
AK070573GAAGCCCACGRIM-19 family protein. 
J023056B01GAAGCCCACNONE 
J023075G06GAAGCCCACNONE 
J033048K16GAAGCCCACNONE 
J033048L16GAAGCCCACNONE 
J053031H23GAAGCCCACNONE 
J065002H14GAAGCCCACNONE 
J065006G22GAAGCCCACNONE 
J065032G13GAAGCCCACNONE 
J065056A09GAAGCCCACNONE 
J065078I01GAAGCCCACNONE 
J065095G01GAAGCCCACNONE 
J065095I18GAAGCCCACNONE 
J065134M18GAAGCCCACNONE 
J065158P07GAAGCCCACNONE 
J065165K17GAAGCCCACNONE 
J065181J12GAAGCCCACNONE 
J065189N09GAAGCCCACNONE 
J065200D13GAAGCCCACNONE 
J065202H20GAAGCCCACNONE 
J065215K20GAAGCCCACNONE 
J075049N19GAAGCCCACNONE 
J075147J16GAAGCCCACNONE 
J090081E19GAAGCCCACNONE 
J100017C16GAAGCCCACNONE 
J100039M16GAAGCCCACNONE 
J100043E23GAAGCCCACNONE 
J100063L12GAAGCCCACNONE 
J100079F22GAAGCCCACNONE 
Os03g0199000J023145E02CTGGGCTTCNONE 
J065046E14CTGGGCTTCNONE 
Os03g0259600AK108532GAAGCCCACAUbiquitin domain containing protein. 
J065064G04GAAGCCCACANONE 
J065116I06GAAGCCCACANONE 
J065165C14GAAGCCCACANONE 
J075173K24GAAGCCCACANONE 
Os03g0270200012-009-A03GAAGCCCATTNONE 
AK066896GAAGCCCATTNONE 
AK102826GAAGCCCATTSplicing factor PWI domain containing protein. 
J013042L05GAAGCCCATTNONE 
J013091L22GAAGCCCATTNONE 
J013096P13GAAGCCCATTNONE 
J013118M15GAAGCCCATTNONE 
J013151N20GAAGCCCATTNONE 
J033061D07GAAGCCCATTNONE 
J033086L04GAAGCCCATTNONE 
J033099J11GAAGCCCATTNONE 
J033109C10GAAGCCCATTNONE 
J033116F13GAAGCCCATTNONE 
J065019F13GAAGCCCATTNONE 
J065089O14GAAGCCCATTNONE 
J065158D07GAAGCCCATTNONE 
J065160G19GAAGCCCATTNONE 
J065168N10GAAGCCCATTNONE 
J065208E17GAAGCCCATTNONE 
J075001A15GAAGCCCATTNONE 
J075010G15GAAGCCCATTNONE 
J075016L23GAAGCCCATTNONE 
J075019A06GAAGCCCATTNONE 
J075023B13GAAGCCCATTNONE 
J075032P15GAAGCCCATTNONE 
J075045F05GAAGCCCATTNONE 
J075053O13GAAGCCCATTNONE 
J075057P06GAAGCCCATTNONE 
J075061C19GAAGCCCATTNONE 
J075078B10GAAGCCCATTNONE 
J075086A20GAAGCCCATTNONE 
J075127A16GAAGCCCATTNONE 
J075128E07GAAGCCCATTNONE 
J075129C06GAAGCCCATTNONE 
J075130M14GAAGCCCATTNONE 
J075136H13GAAGCCCATTNONE 
J075149M17GAAGCCCATTNONE 
J075156L08GAAGCCCATTNONE 
J075160P12GAAGCCCATTNONE 
J075164J01GAAGCCCATTNONE 
J075173N05GAAGCCCATTNONE 
J075177O03GAAGCCCATTNONE 
J075188K11GAAGCCCATTNONE 
J090009A02GAAGCCCATTNONE 
J090019O12GAAGCCCATTNONE 
J090065H05GAAGCCCATTNONE 
J090067E24GAAGCCCATTNONE 
J090080C03GAAGCCCATTNONE 
J090090A04GAAGCCCATTNONE 
J090098D13GAAGCCCATTNONE 
J100060D03GAAGCCCATTNONE 
J100062D05GAAGCCCATTNONE 
J100074A08GAAGCCCATTNONE 
Os03g0273800AK059223CGCGACGCCATGGGCTTCNONE 
AK067356CGCGACGCCATGGGCTTCNONE 
AK100173CGCGACGCCATGGGCTTCPyrimidine 5-nucleotidase family protein. 
Os03g0279600006-070-A07GAAGCCCAGCCNONE 
AK061080GAAGCCCAGCCConserved hypothetical protein. 
AK071043GAAGCCCAGCCNONE 
AK103191GAAGCCCAGCCNONE 
J065077E22GAAGCCCAGCCNONE 
J065208F22GAAGCCCAGCCNONE 
J075156K12GAAGCCCAGCCNONE 
Os03g0288400Os03g0288400GAAGCCCAAACConserved hypothetical protein. 
Os03g0289200016-011-H02CTGGGCTTCNONE 
AK064364CTGGGCTTCSimilar to H/ACA ribonucleoprotein complex subunit 1-like protein (GCR 101 snRNP). 
AK073108CTGGGCTTCNONE 
J043024P22CTGGGCTTCNONE 
J100074J04CTGGGCTTCNONE 
Os03g0305400009-198-D04GAAGCCCATCANONE 
013-012-C06GAAGCCCATCANONE 
014-034-D01GAAGCCCATCANONE 
AK071397GAAGCCCATCAUniversal stress protein (Usp) family protein. 
J023012O22GAAGCCCATCANONE 
J023097A13GAAGCCCATCANONE 
J023107P16GAAGCCCATCANONE 
J023113C14GAAGCCCATCANONE 
Os03g0372900AK100417GAAGCCCACGGGCyclin-like F-box domain containing protein. 
Os03g0390700AB110190GAAGCCCACAANONE 
AK103600GAAGCCCACAASimilar to Transthyretin-like protein. 
J065188H06GAAGCCCACAANONE 
Os03g0393900AK069809TATTGGGCTTCCATGGGCCTCSimilar to S.tuberosum patatin (Fragment). 
J023030J03TATTGGGCTTCCATGGGCCTCNONE 
Os03g0438900AK111048GAAGCCCACAHypothetical protein. 
Os03g0604600J090093K23GAAGCCCAGTAConserved hypothetical protein. 
Os03g0725300011-085-E09TAATGGGCTTCNONE 
AK063969TAATGGGCTTCSimilar to Dbr1-prov protein. 
AK073636TAATGGGCTTCNONE 
J033050L15TAATGGGCTTCNONE 
J053082G03TAATGGGCTTCNONE 
Os03g0744700AK071178GAAGCCCAAACConserved hypothetical protein. 
J075006D24GAAGCCCAAACNONE 
J075165F21GAAGCCCAAACNONE 
Os03g0751400AK069033TATTGGGCTTCSimilar to 50S ribosomal protein l6. 
J023004G24TATTGGGCTTCNONE 
J065176D08TATTGGGCTTCNONE 
Os03g0766000AK070596GAAGCCCATTANONE 
AK104743GAAGCCCATTANONE 
AK106079GAAGCCCATTANONE 
J013063M09GAAGCCCATTANONE 
J023056A03GAAGCCCATTANONE 
J043038L07GAAGCCCATTANONE 
J053067N16GAAGCCCATTANONE 
J053073G09GAAGCCCATTANONE 
J053075I19GAAGCCCATTANONE 
Os03g0772800009-023-E05GAAGCCCACAANONE 
009-059-F12GAAGCCCACAANONE 
009-114-B08GAAGCCCACAANONE 
009-115-G09GAAGCCCACAANONE 
009-151-D08GAAGCCCACAANONE 
009-158-A10GAAGCCCACAANONE 
009-191-H02GAAGCCCACAANONE 
009-192-E05GAAGCCCACAANONE 
009-197-F11GAAGCCCACAANONE 
AK059576GAAGCCCACAANONE 
AK121608GAAGCCCACAACytochrome c oxidase, subunit VIa family protein. 
J023087H20GAAGCCCACAANONE 
J023105P14GAAGCCCACAANONE 
J033026P15GAAGCCCACAANONE 
J033042K10GAAGCCCACAANONE 
J033133C09GAAGCCCACAANONE 
J065123K13GAAGCCCACAANONE 
J075190D03GAAGCCCACAANONE 
J080310M14GAAGCCCACAANONE 
J080317L14GAAGCCCACAANONE 
J100067J19GAAGCCCACAANONE 
J100079H21GAAGCCCACAANONE 
Os03g0774600AK066871GAAGCCCAGHypothetical protein. 
J053033J17GAAGCCCAGNONE 
Os03g0797000AK073440ACATGGGCTTCSimilar to Indole synthase. 
Os03g0807200011-031-F07GAAGCCCAAGNONE 
AK063932GAAGCCCAAGNONE 
AK103496GAAGCCCAAGProtein of unknown function DUF1639 family protein. 
J033131A04GAAGCCCAAGNONE 
J065109O03GAAGCCCAAGNONE 
J080001M11GAAGCCCAAGNONE 
J080002H18GAAGCCCAAGNONE 
J080005I08GAAGCCCAAGNONE 
J080006B05GAAGCCCAAGNONE 
J080006D17GAAGCCCAAGNONE 
J080007M19GAAGCCCAAGNONE 
J080011E07GAAGCCCAAGNONE 
J080012H06GAAGCCCAAGNONE 
J080014D08GAAGCCCAAGNONE 
J080017D06GAAGCCCAAGNONE 
J080017K17GAAGCCCAAGNONE 
J080020B17GAAGCCCAAGNONE 
J080021O05GAAGCCCAAGNONE 
J080021O15GAAGCCCAAGNONE 
J080023I18GAAGCCCAAGNONE 
J080025A21GAAGCCCAAGNONE 
J080027P22GAAGCCCAAGNONE 
J080028M22GAAGCCCAAGNONE 
J080029B09GAAGCCCAAGNONE 
J080029M07GAAGCCCAAGNONE 
J080029M17GAAGCCCAAGNONE 
J080030H23GAAGCCCAAGNONE 
J080030K16GAAGCCCAAGNONE 
J080030L19GAAGCCCAAGNONE 
J080031A12GAAGCCCAAGNONE 
J080031N21GAAGCCCAAGNONE 
J080032G05GAAGCCCAAGNONE 
J080032P20GAAGCCCAAGNONE 
J080033H20GAAGCCCAAGNONE 
J080034H22GAAGCCCAAGNONE 
J080034J03GAAGCCCAAGNONE 
J080034J16GAAGCCCAAGNONE 
J080034N01GAAGCCCAAGNONE 
J080035K20GAAGCCCAAGNONE 
J080036I04GAAGCCCAAGNONE 
J080036I19GAAGCCCAAGNONE 
J080036O21GAAGCCCAAGNONE 
J080038D06GAAGCCCAAGNONE 
J080039J15GAAGCCCAAGNONE 
J080039P18GAAGCCCAAGNONE 
J080041H20GAAGCCCAAGNONE 
J080041M11GAAGCCCAAGNONE 
J080042F14GAAGCCCAAGNONE 
J080043G10GAAGCCCAAGNONE 
J080043J02GAAGCCCAAGNONE 
J080044C19GAAGCCCAAGNONE 
J080044G11GAAGCCCAAGNONE 
J080045M03GAAGCCCAAGNONE 
J080045N07GAAGCCCAAGNONE 
J080047K14GAAGCCCAAGNONE 
J080049I21GAAGCCCAAGNONE 
J080050A06GAAGCCCAAGNONE 
J080050I16GAAGCCCAAGNONE 
J080050N16GAAGCCCAAGNONE 
J080052C23GAAGCCCAAGNONE 
J080052D18GAAGCCCAAGNONE 
J080052F20GAAGCCCAAGNONE 
J080052F23GAAGCCCAAGNONE 
J080053M03GAAGCCCAAGNONE 
J080054G13GAAGCCCAAGNONE 
J080054H12GAAGCCCAAGNONE 
J080055N03GAAGCCCAAGNONE 
J080056E07GAAGCCCAAGNONE 
J080057L04GAAGCCCAAGNONE 
J080063O19GAAGCCCAAGNONE 
J080064E21GAAGCCCAAGNONE 
J080065D18GAAGCCCAAGNONE 
J080065F18GAAGCCCAAGNONE 
J080065H14GAAGCCCAAGNONE 
J080065K15GAAGCCCAAGNONE 
J080065M24GAAGCCCAAGNONE 
J080066B18GAAGCCCAAGNONE 
J080066B19GAAGCCCAAGNONE 
J080071H19GAAGCCCAAGNONE 
J080072E18GAAGCCCAAGNONE 
J080074K21GAAGCCCAAGNONE 
J080075B06GAAGCCCAAGNONE 
J080076H07GAAGCCCAAGNONE 
J080079D16GAAGCCCAAGNONE 
J080082B20GAAGCCCAAGNONE 
J080084N16GAAGCCCAAGNONE 
J080085L07GAAGCCCAAGNONE 
J080086L04GAAGCCCAAGNONE 
J080086M07GAAGCCCAAGNONE 
J080087D02GAAGCCCAAGNONE 
J080087D15GAAGCCCAAGNONE 
J080087J19GAAGCCCAAGNONE 
J080088G20GAAGCCCAAGNONE 
J080092M15GAAGCCCAAGNONE 
J080093O10GAAGCCCAAGNONE 
J080095L09GAAGCCCAAGNONE 
J080096A18GAAGCCCAAGNONE 
J080097C03GAAGCCCAAGNONE 
J090019J07GAAGCCCAAGNONE 
J090024N12GAAGCCCAAGNONE 
J090049I09GAAGCCCAAGNONE 
Os03g0844700J090056L22GAAGCCCACASimilar to Inner membrane protein ALBINO3, chloroplast precursor. Splice isoform 2. 
Os03g0848100J013028M09TGTTGGGCTGGGCTTCNONE 
J065080L17TGTTGGGCTGGGCTTCNONE 
J065083C11TGTTGGGCTGGGCTTCNONE 
Os04g0132500AK112081GAAGCCCAATNONE 
AK121779GAAGCCCAATProtein kinase-like domain containing protein. 
Os04g0389800AK109628GAAGCCCAACASimilar to Acetohydroxyacid synthase. 
Os04g0416000J065041L09TCATGGGCTGGGCTTCNONE 
J065050F15TCATGGGCTGGGCTTCNONE 
J065053M14TCATGGGCTGGGCTTCProtein of unknown function DUF1279 domain containing protein. 
J065057I09TCATGGGCTGGGCTTCNONE 
J065132E14TCATGGGCTGGGCTTCNONE 
J065144L23TCATGGGCTGGGCTTCNONE 
J065154N13TCATGGGCTGGGCTTCNONE 
J065158P16TCATGGGCTGGGCTTCNONE 
J080302F01TCATGGGCTGGGCTTCNONE 
J080308G20TCATGGGCTGGGCTTCNONE 
Os04g0432600AK058925GAAGCCCACConserved hypothetical protein. 
AK103967GAAGCCCACNONE 
AK121724GAAGCCCACNONE 
J033081P13GAAGCCCACNONE 
J033128L11GAAGCCCACNONE 
J065038G19GAAGCCCACNONE 
J065129A21GAAGCCCACNONE 
J065131P11GAAGCCCACNONE 
J065166I03GAAGCCCACNONE 
J065181L05GAAGCCCACNONE 
J100018I15GAAGCCCACNONE 
J100019H22GAAGCCCACNONE 
J100037O10GAAGCCCACNONE 
Os04g0445100014-052-B04GAAGCCCAGCAAACGGCCCATCANONE 
AK063700GAAGCCCAGCAAACGGCCCATCASimilar to 22.7 kDa class IV heat shock protein precursor. 
Os04g0451100AK106764GAAGCCCATCTConserved hypothetical protein. 
Os04g0473400AK067896GAAGCCCATTASimilar to 60S ribosomal protein L6-B (L17) (YL16) (RP18). 
J013123D20GAAGCCCATTANONE 
J033108A09GAAGCCCATTANONE 
J065196E24GAAGCCCATTANONE 
J100066B16GAAGCCCATTANONE 
Os04g0486500AK111976GAAGCCCACTGGCCCACCGCCCACACGACCGTTGSimilar to Mitotic spindle checkpoint protein MAD2. 
Os04g0494600AK110895AGCCCATGGGCTTCProtein of unknown function DUF642 family protein. 
Os04g0505700AK071138GAAGCCCAGLeucine-rich repeat, cysteine-containing subtype containing protein. 
J023081C03GAAGCCCAGNONE 
J033108O05GAAGCCCAGNONE 
J100079D03GAAGCCCAGNONE 
Os04g0602900AK065982GAAGCCCAGNONE 
AK100414GAAGCCCAGIsoprenylcysteine carboxyl methyltransferase family protein. 
J013045J05GAAGCCCAGNONE 
J065196I21GAAGCCCAGNONE 
J065205B13GAAGCCCAGNONE 
J090017J24GAAGCCCAGNONE 
Os04g0609700AK101763GCTGGGCTTCZinc finger, FYVE/PHD-type domain containing protein. 
Os04g0669300AK071148GAAGCCCAACADynamin family protein. 
Os04g0676100Os04g0676100AATGGGCTTCSimilar to Thioredoxin X, chloroplast precursor. 
Os05g0128100009-051-B07TAATGGGCTTCNONE 
009-127-B08TAATGGGCTTCNONE 
009-144-H03TAATGGGCTTCNONE 
009-176-B05TAATGGGCTTCNONE 
AK108556TAATGGGCTTCNONE 
AK119308TAATGGGCTTCNONE 
AK120934TAATGGGCTTCConserved hypothetical protein. 
J023036J15TAATGGGCTTCNONE 
J065122L01TAATGGGCTTCNONE 
J075104P10TAATGGGCTTCNONE 
Os05g0137600AK099427TGTTGGGCTTCConserved hypothetical protein. 
Os05g0186000006-103-D10AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
009-047-D06AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
009-073-G05AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
009-084-G09AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
009-097-G04AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
009-111-D11AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
009-115-G01AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
009-131-B04AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
009-144-F05AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
009-154-D08AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
014-004-H02AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
AK058675AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
AK060420AAAGCCCAATCCATGGGCCTGGGCTTCSimilar to 30S ribosomal protein S31, chloroplast (Fragment). 
AK061231AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
J065155C08AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
J075143K12AAAGCCCAATCCATGGGCCTGGGCTTCNONE 
Os05g0194600AK102487CTGGGCTTCPeptidase M22, O-sialoglycoprotein endopeptidase family protein. 
J100032M01CTGGGCTTCNONE 
J100041A08CTGGGCTTCNONE 
Os05g0203800AK111723GAAGCCCACAASimilar to MADS box protein. 
J023023K24GAAGCCCACAANONE 
J023027E19GAAGCCCACAANONE 
Os05g0224800AK111685GAAGCCCAAATSimilar to Modification methyltransferase, cytosine-specific. 
J013170M08GAAGCCCAAATNONE 
Os05g0244600009-176-H11TTATGGGCCCAAATGAAGCCCACNONE 
AK073979TTATGGGCCCAAATGAAGCCCACNucleic acid-binding, OB-fold domain containing protein. 
J065085L13TTATGGGCCCAAATGAAGCCCACNONE 
J065086F22TTATGGGCCCAAATGAAGCCCACNONE 
J065124H03TTATGGGCCCAAATGAAGCCCACNONE 
J065170C22TTATGGGCCCAAATGAAGCCCACNONE 
J065197K01TTATGGGCCCAAATGAAGCCCACNONE 
J075110M09TTATGGGCCCAAATGAAGCCCACNONE 
J090074F17TTATGGGCCCAAATGAAGCCCACNONE 
J100071O17TTATGGGCCCAAATGAAGCCCACNONE 
Os05g0363600AK108572TAATGGGCTTCConserved hypothetical protein. 
Os05g0383100AK121835TATTGGGCTTCClathrin adaptor complex, medium chain family protein. 
Os05g0459300009-006-D08ATTTGGGCTTCNONE 
AK062312ATTTGGGCTTCNONE 
AK119604ATTTGGGCTTCNONE 
AK121463ATTTGGGCTTCConserved hypothetical protein. 
J023145E12ATTTGGGCTTCNONE 
Os05g0461000006-113-A06GAAGCCCAACNONE 
AB042259GAAGCCCAACNONE 
AK059189GAAGCCCAACNONE 
AK066739GAAGCCCAACClathrin adaptor complex, small chain family protein. 
AK099044GAAGCCCAACNONE 
AK104166GAAGCCCAACNONE 
Os05g0500500AK110627CGATGGGCTTCHSP20-like chaperone domain containing protein. 
Os05g0512500009-036-D05AAATGGGCTTCNONE 
AK062441AAATGGGCTTCCT20 family protein. 
J080003C10AAATGGGCTTCNONE 
J080046G11AAATGGGCTTCNONE 
Os05g0524200AK071990GAAGCCCAATDual specificity protein phosphatase domain containing protein. 
Os05g0526300AK099438GAAGCCCATTANONE 
Os05g0541500AK101190CTTGGGCTTCCyclin-like F-box domain containing protein. 
AK101531CTTGGGCTTCNONE 
J033030F10CTTGGGCTTCNONE 
Os05g0554100AK073023GTGGGCTTCRibosomal protein L7/L12 family protein. 
AK101756GTGGGCTTCNONE 
Os05g0559900AK067197GAAGCCCAAGGCCCAAACtRNA-binding arm domain containing protein. 
J013074C15GAAGCCCAAGGCCCAAACNONE 
J013098O16GAAGCCCAAGGCCCAAACNONE 
J033030M01GAAGCCCAAGGCCCAAACNONE 
J090058H12GAAGCCCAAGGCCCAAACNONE 
J090075M06GAAGCCCAAGGCCCAAACNONE 
Os05g0565000AK102673GAAGCCCACGGCCCATTASimilar to 60S ribosomal protein L18a-1. 
J033102C12GAAGCCCACGGCCCATTANONE 
J033124C13GAAGCCCACGGCCCATTANONE 
J043003L04GAAGCCCACGGCCCATTANONE 
J043006N08GAAGCCCACGGCCCATTANONE 
Os05g0571600Os05g0571600GGTGGGCTTCConserved hypothetical protein. 
Os05g0594800AK058332GAAGCCCAGCCCACCAAdhesion regulating molecule family protein. 
AK068013GAAGCCCAGCCCACCANONE 
J013129L24GAAGCCCAGCCCACCANONE 
Os05g0596600AK107823GTGGGCTTCNONE 
AK121149GTGGGCTTCSimilar to SMC5 protein. 
Os06g0115400AK111656GAAGCCCAAAGCCCACASimilar to Superoxide dismutase [Fe], chloroplast (EC 1.15.1.1) (Fragment). 
Os06g0116400006-082-G06GAAGCCCAGCCNONE 
AK058327GAAGCCCAGCCNONE 
AK105979GAAGCCCAGCCHigh-affinity nickel-transporter family protein. 
J065083I24GAAGCCCAGCCNONE 
J100072O18GAAGCCCAGCCNONE 
Os06g0116600AK103500CTGGGCTTCProteinase inhibitor, propeptide domain containing protein. 
J033131B10CTGGGCTTCNONE 
J075154F17CTGGGCTTCNONE 
J075169L23CTGGGCTTCNONE 
Os06g0135340J065061D17GAAGCCCAGTANONE 
J065159A10GAAGCCCAGTAConserved hypothetical protein. 
Os06g0168000AK059250TGATGGGCTTCNONE 
AK099356TGATGGGCTTCGlutathione S-transferase, C-terminal-like domain containing protein. 
J033040E19TGATGGGCTTCNONE 
J033097H04TGATGGGCTTCNONE 
J075087M11TGATGGGCTTCNONE 
J075146H06TGATGGGCTTCNONE 
J075188H11TGATGGGCTTCNONE 
J090071D03TGATGGGCTTCNONE 
J090097L20TGATGGGCTTCNONE 
J100051M05TGATGGGCTTCNONE 
J100082H13TGATGGGCTTCNONE 
Os06g0291100J043017O10CTTGGGCTTCCGGCCCAGCHypothetical protein. 
Os06g0298400AK066952GAAGCCCATATWW/Rsp5/WWP domain containing protein. 
J013090J20GAAGCCCATATNONE 
J033024J05GAAGCCCATATNONE 
J033033H19GAAGCCCATATNONE 
J033057J15GAAGCCCATATNONE 
J065047L24GAAGCCCATATNONE 
J065198L23GAAGCCCATATNONE 
J065218N03GAAGCCCATATNONE 
J090001F10GAAGCCCATATNONE 
J090025N24GAAGCCCATATNONE 
J090073E16GAAGCCCATATNONE 
Os06g0304500AK119441GAAGCCCATTAAGGCCCACTCRS1/YhbY domain containing protein. 
J075143M24GAAGCCCATTAAGGCCCACTNONE 
J075194D03GAAGCCCATTAAGGCCCACTNONE 
Os06g0600100AK065619AAAAGCCCACGAAGCCCAACASimilar to TAT-binding protein homolog (Fragment). 
Os06g0644100006-034-H12GAAGCCCACAANONE 
009-111-A04GAAGCCCACAANONE 
009-153-H08GAAGCCCACAANONE 
AK059777GAAGCCCACAACarboxypeptidase regulatory region domain containing protein. 
J023011D18GAAGCCCACAANONE 
J043030D15GAAGCCCACAANONE 
J053079B12GAAGCCCACAANONE 
J053079F07GAAGCCCACAANONE 
J065006C11GAAGCCCACAANONE 
J065007D15GAAGCCCACAANONE 
J065012C09GAAGCCCACAANONE 
J065019J01GAAGCCCACAANONE 
J065034K17GAAGCCCACAANONE 
J065040M09GAAGCCCACAANONE 
J065059B09GAAGCCCACAANONE 
J065070A22GAAGCCCACAANONE 
J065099A13GAAGCCCACAANONE 
J065141F08GAAGCCCACAANONE 
J065152G12GAAGCCCACAANONE 
J065181I04GAAGCCCACAANONE 
J065198E17GAAGCCCACAANONE 
J065201N23GAAGCCCACAANONE 
J065202M07GAAGCCCACAANONE 
J065208F11GAAGCCCACAANONE 
J090031B20GAAGCCCACAANONE 
J090099B14GAAGCCCACAANONE 
J100032C05GAAGCCCACAANONE 
J100057O07GAAGCCCACAANONE 
J100077M07GAAGCCCACAANONE 
J100081E21GAAGCCCACAANONE 
Os06g0644800006-051-A11AGTTGGGCTTCNONE 
006-061-C06AGTTGGGCTTCNONE 
006-086-A03AGTTGGGCTTCNONE 
006-091-B11AGTTGGGCTTCNONE 
AK105643AGTTGGGCTTCNONE 
AK109442AGTTGGGCTTCMannose-6-phosphate receptor, binding domain containing protein. 
J065083E17AGTTGGGCTTCNONE 
Os06g0670100AK102577GAAGCCCAAACHypothetical protein. 
Os06g0683400009-047-C07GAAGCCCACCACNONE 
009-060-B06GAAGCCCACCACNONE 
013-057-F12GAAGCCCACCACNONE 
AK111852GAAGCCCACCACNONE 
AK111897GAAGCCCACCACNONE 
AK112082GAAGCCCACCACSimilar to EF-hand Ca2+-binding protein CCD1. 
J065104C07GAAGCCCACCACNONE 
J065187J11GAAGCCCACCACNONE 
J065197L08GAAGCCCACCACNONE 
J100045K14GAAGCCCACCACNONE 
J100074M08GAAGCCCACCACNONE 
J100088H21GAAGCCCACCACNONE 
Os06g0695400AK073198GAAGCCCAGCHaem peroxidase family protein. 
J033022I15GAAGCCCAGCNONE 
Os06g0711600016-047-G09GAAGCCCACCACNONE 
AK064384GAAGCCCACCACmRNA splicing factor SYF2 family protein. 
AK102831GAAGCCCACCACNONE 
J013072P18GAAGCCCACCACNONE 
J023049G01GAAGCCCACCACNONE 
J023088I01GAAGCCCACCACNONE 
J033023I22GAAGCCCACCACNONE 
J033106I12GAAGCCCACCACNONE 
J033109G07GAAGCCCACCACNONE 
J065030F22GAAGCCCACCACNONE 
J065132H19GAAGCCCACCACNONE 
J080301D07GAAGCCCACCACNONE 
J080305C09GAAGCCCACCACNONE 
J080312C03GAAGCCCACCACNONE 
J080313I15GAAGCCCACCACNONE 
J080315B09GAAGCCCACCACNONE 
J090056N21GAAGCCCACCACNONE 
J100027B07GAAGCCCACCACNONE 
Os06g0714100AK121079GAAGCCCAAATComplex 1 LYR protein family protein. 
J023062M13GAAGCCCAAATNONE 
J043020D18GAAGCCCAAATNONE 
J065073A17GAAGCCCAAATNONE 
J065158D09GAAGCCCAAATNONE 
J065195H04GAAGCCCAAATNONE 
J065214P13GAAGCCCAAATNONE 
J080079I22GAAGCCCAAATNONE 
J100031M06GAAGCCCAAATNONE 
J100036I12GAAGCCCAAATNONE 
Os06g0716200J100070M15GAAGCCCAGTAThaumatin, pathogenesis-related family protein. 
J100082O07GAAGCCCAGTANONE 
Os06g0731700J065089G16GAAGCCCAAGNONE 
J065157E16GAAGCCCAAGNONE 
Os07g0486000AK069343TATTGGGCTTCSimilar to MSH4. 
Os07g0498300009-045-C02CCATGGGCTTCNONE 
009-060-A09CCATGGGCTTCNONE 
009-121-C04CCATGGGCTTCNONE 
009-157-G09CCATGGGCTTCNONE 
009-197-B02CCATGGGCTTCNONE 
AK059124CCATGGGCTTCConserved hypothetical protein. 
AK119800CCATGGGCTTCNONE 
J065184M18CCATGGGCTTCNONE 
J075009G21CCATGGGCTTCNONE 
J075013O03CCATGGGCTTCNONE 
J075061C22CCATGGGCTTCNONE 
J075094E12CCATGGGCTTCNONE 
J075148C01CCATGGGCTTCNONE 
Os07g0516200AK061373ACATGGGCTTCSimilar to Endoribonuclease, L-PSP family. 
Os07g0516900AK061900AACTGGGCTTCSimilar to RNA Binding Protein 45. 
Os07g0530700AK060014CCATGGGCTTCNONE 
AK099533CCATGGGCTTCConserved hypothetical protein. 
Os07g0598900015-040-C12GCTGGGCTTCNONE 
AK102627GCTGGGCTTCCobalamin (vitamin B12) biosynthesis P47K domain containing protein. 
AK106521GCTGGGCTTCNONE 
J033087C18GCTGGGCTTCNONE 
J033099K03GCTGGGCTTCNONE 
J065054E02GCTGGGCTTCNONE 
J090055O05GCTGGGCTTCNONE 
Os07g0611700AK109158GAAGCCCATACTGGCCCAATTPeptidase C1A, papain family protein. 
Os07g0611800Os07g0611800GAAGCCCATACTGGCCCAATTNONE 
Os07g0628500AK059560CTGGGCTTCNONE 
AK070963CTGGGCTTCBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
AY222337CTGGGCTTCNONE 
J023068N18CTGGGCTTCNONE 
J023088M08CTGGGCTTCNONE 
J033072H21CTGGGCTTCNONE 
Os07g0653100J065130E21AATTGGGCTTCConserved hypothetical protein. 
J065186P07AATTGGGCTTCNONE 
Os07g0682000AK110569CTTGGGCTTCHeavy metal transport/detoxification protein domain containing protein. 
Os07g0688100AK101635TCATGGGCTTCProtein prenyltransferase domain containing protein. 
J033055B02TCATGGGCTTCNONE 
J090013O08TCATGGGCTTCNONE 
J090074A17TCATGGGCTTCNONE 
Os08g0117400006-086-A09GAAGCCCATCGNONE 
006-103-C02GAAGCCCATCGNONE 
AK059891GAAGCCCATCGSimilar to Calmodulin 1 (Fragment). 
AK103863GAAGCCCATCGNONE 
AY224521GAAGCCCATCGNONE 
J033149E23GAAGCCCATCGNONE 
J065062E05GAAGCCCATCGNONE 
J065083O05GAAGCCCATCGNONE 
J065116D14GAAGCCCATCGNONE 
J065158F16GAAGCCCATCGNONE 
J065179N16GAAGCCCATCGNONE 
J065206N23GAAGCCCATCGNONE 
Os08g0178100AK101717TATTGGGCTTCPep3/Vps18/deep orange domain containing protein. 
Os08g0236900AK109597GAAGCCCAGCCCConserved hypothetical protein. 
Os08g0327400AK070992CGATGGGCTTCSimilar to Enoyl-ACP reductase (Fragment). 
J023077K10CGATGGGCTTCNONE 
J065075F06CGATGGGCTTCNONE 
J065112N14CGATGGGCTTCNONE 
J090028K07CGATGGGCTTCNONE 
J090039C15CGATGGGCTTCNONE 
J090048I11CGATGGGCTTCNONE 
J090083M10CGATGGGCTTCNONE 
Os08g0387050J043038F21GAAGCCCAGCCGAGCCGGCCCACAGCCCAGCCConserved hypothetical protein. 
Os08g0430200AK064881CTGGGCTTCUV excision repair protein Rad23 family protein. 
J013000J24CTGGGCTTCNONE 
Os08g0476000AK066585GAAGCCCACCCNONE 
Os08g0489300AK059000GAAGCCCATATNONE 
AK104597GAAGCCCATATDNA glycosylase family protein. 
J013160G13GAAGCCCATATNONE 
J100078P21GAAGCCCATATNONE 
Os08g0525600AK103172GAAGCCCACCACSimilar to Peptidylprolyl isomerase; FK506-binding protein. 
Os08g0529400J100040D07GTGGGCTTCCyclin-like F-box domain containing protein. 
Os08g0548900006-043-D07GTGGGCTTCNONE 
006-043-H11GTGGGCTTCNONE 
006-081-G06GTGGGCTTCNONE 
006-109-E04GTGGGCTTCNONE 
011-033-E04GTGGGCTTCNONE 
AK061808GTGGGCTTCSimilar to Proteasome subunit alpha type 7 (EC 3.4.25.1) (20S proteasome alpha subunit D) (20S proteasome subunit alpha-4). 
AK098875GTGGGCTTCNONE 
J013001D12GTGGGCTTCNONE 
J033126N14GTGGGCTTCNONE 
J053069M09GTGGGCTTCNONE 
J053098E10GTGGGCTTCNONE 
J053101C24GTGGGCTTCNONE 
J065002F21GTGGGCTTCNONE 
J065006C22GTGGGCTTCNONE 
J065076J02GTGGGCTTCNONE 
J065134M22GTGGGCTTCNONE 
J075007M19GTGGGCTTCNONE 
J075040I11GTGGGCTTCNONE 
J075047E20GTGGGCTTCNONE 
J075052D22GTGGGCTTCNONE 
J075076L13GTGGGCTTCNONE 
J075157P22GTGGGCTTCNONE 
J075161M18GTGGGCTTCNONE 
J075168P22GTGGGCTTCNONE 
J075181E04GTGGGCTTCNONE 
U92540GTGGGCTTCNONE 
Os08g0553450Os08g0553450GAAGCCCATGAHypothetical protein. 
Os08g0558000J080005K14GAAGCCCATACNONE 
Os09g0103400016-041-C04GAAGCCCAAANONE 
016-041-C04GAAGCCCAAGNONE 
016-045-D02GAAGCCCAAANONE 
016-045-D02GAAGCCCAAGNONE 
AK064377GAAGCCCAAAConserved hypothetical protein. 
AK064377GAAGCCCAAGConserved hypothetical protein. 
J043010E20GAAGCCCAAANONE 
J043010E20GAAGCCCAAGNONE 
Os09g0323000AK121426GAAGCCCAAGSimilar to UDP-galactose 4-epimerase-like protein. 
Os09g0344700J080011F14GAAGCCCACNONE 
J080011G13GAAGCCCACNONE 
J080016C06GAAGCCCACNONE 
J080034K13GAAGCCCACNONE 
J080043N08GAAGCCCACNONE 
J080068E01GAAGCCCACConserved hypothetical protein. 
J080068L12GAAGCCCACNONE 
J080071N01GAAGCCCACNONE 
J080075D11GAAGCCCACNONE 
J080076D14GAAGCCCACNONE 
J080093L23GAAGCCCACNONE 
J080093N22GAAGCCCACNONE 
Os09g0439600AK100577GAAGCCCAAAExo70 exocyst complex subunit family protein. 
J090071K03GAAGCCCAAANONE 
Os09g0526800014-002-D10GAAGCCCAGCNONE 
AK060048GAAGCCCAGCNONE 
AK072174GAAGCCCAGCNONE 
AK105121GAAGCCCAGCNC domain containing protein. 
J013135P13GAAGCCCAGCNONE 
J033135C23GAAGCCCAGCNONE 
J043036C17GAAGCCCAGCNONE 
J065066N16GAAGCCCAGCNONE 
Os09g0539100AK071977GAAGCCCAGSimilar to 3-dehydroquinate synthase-like protein. 
AK098959GAAGCCCAGNONE 
Os11g0116400AK059833GCTGGGCCGATGGGCTTCSimilar to Elongation factor P (EF-P). 
Os11g0127600015-021-H02TTGTGGGCTTCNONE 
016-038-B06TTGTGGGCTTCNONE 
016-079-H06TTGTGGGCTTCNONE 
016-085-G02TTGTGGGCTTCNONE 
016-086-C02TTGTGGGCTTCNONE 
AK067922TTGTGGGCTTCNo apical meristem (NAM) protein domain containing protein. 
J013121J10TTGTGGGCTTCNONE 
Os11g0128400AK102291GAAGCCCATATCDC45-like protein family protein. 
J033089K18GAAGCCCATATNONE 
Os11g0132700AK103286TTGTGGGCTTCCGGCCCAAATCytochrome cd1-nitrite reductase-like, C-terminal haem d1 domain containing protein. 
Os11g0146700AK065900GAAGCCCAATANONE 
AK072412GAAGCCCAATARED-like, C-terminal family protein. 
Os11g0147600AK111127GCTGGGCTTCHypothetical protein. 
Os11g0171700015-007-C07GAAGCCCACNONE 
AK064084GAAGCCCACNONE 
Os11g0210500AK070886GAAGCCCATCTNONE 
J023069O03GAAGCCCATCTNONE 
J100038M22GAAGCCCATCTNONE 
J100066M06GAAGCCCATCTNONE 
Os11g0227600AK101375GAAGCCCAACAConserved hypothetical protein. 
AK102193GAAGCCCAACANONE 
J033087C03GAAGCCCAACANONE 
Os11g0231400AK108047TAATGGGCTTCProtein of unknown function DUF295 family protein. 
Os11g0425800AK066603GAAGCCCAATTSimilar to 60S ribosomal protein L13a. 
J065063A20GAAGCCCAATTNONE 
J075021H08GAAGCCCAATTNONE 
J075058J10GAAGCCCAATTNONE 
J075088B15GAAGCCCAATTNONE 
J075099E15GAAGCCCAATTNONE 
J075110F13GAAGCCCAATTNONE 
J075150G18GAAGCCCAATTNONE 
J080312E14GAAGCCCAATTNONE 
Os11g0481600AK109900GAAGCCCACGGConserved hypothetical protein. 
Os11g0484300AK121422TTTTGGGCTTCSimilar to Mcm2-prov protein. 
Os11g0531700006-023-B12GAAGCCCATCTNONE 
AK059751GAAGCCCATCTNUDIX hydrolase domain containing protein. 
AK099204GAAGCCCATCTNONE 
Os12g0100100006-036-G03GGGCTTGGGCTTCNONE 
AK061492GGGCTTGGGCTTCSimilar to ALY protein. 
AK068452GGGCTTGGGCTTCNONE 
J013153E18GGGCTTGGGCTTCNONE 
J033140D06GGGCTTGGGCTTCNONE 
J065046A19GGGCTTGGGCTTCNONE 
J065061F08GGGCTTGGGCTTCNONE 
J065101I03GGGCTTGGGCTTCNONE 
J065158B05GGGCTTGGGCTTCNONE 
J065162H06GGGCTTGGGCTTCNONE 
J065195I23GGGCTTGGGCTTCNONE 
J065218E07GGGCTTGGGCTTCNONE 
Os12g0112250J013069O10GAAGCCCACASaposin B domain containing protein. 
J065206G04GAAGCCCACANONE 
J080302C06GAAGCCCACANONE 
J080306K06GAAGCCCACANONE 
J080307O09GAAGCCCACANONE 
J080310J07GAAGCCCACANONE 
J080311G18GAAGCCCACANONE 
J080318C07GAAGCCCACANONE 
Os12g0131300J090086B06TTGTGGGCTTCCGGCCCAAATHypothetical protein. 
Os12g0150100009-047-B11GAAGCCCACANONE 
009-047-B11GAAGCCCACAANONE 
AK105075GAAGCCCACASimilar to 60S ribosomal protein L26A. 
AK105075GAAGCCCACAASimilar to 60S ribosomal protein L26A. 
J013067G22GAAGCCCACANONE 
J013067G22GAAGCCCACAANONE 
J033103F08GAAGCCCACANONE 
J033103F08GAAGCCCACAANONE 
J065029P11GAAGCCCACANONE 
J065029P11GAAGCCCACAANONE 
J065043B18GAAGCCCACANONE 
J065043B18GAAGCCCACAANONE 
J065123E16GAAGCCCACANONE 
J065123E16GAAGCCCACAANONE 
J065141O20GAAGCCCACANONE 
J065141O20GAAGCCCACAANONE 
J065161O04GAAGCCCACANONE 
J065161O04GAAGCCCACAANONE 
J065201M07GAAGCCCACANONE 
J065201M07GAAGCCCACAANONE 
J075058I23GAAGCCCACANONE 
J075058I23GAAGCCCACAANONE 
J075172J08GAAGCCCACANONE 
J075172J08GAAGCCCACAANONE 
J100040L13GAAGCCCACANONE 
J100040L13GAAGCCCACAANONE 
Os12g0277500006-025-D06AGATGGGCTTCNONE 
AK061410AGATGGGCTTCNONE 
AK119217AGATGGGCTTCNONE 
AK119223AGATGGGCTTCNONE 
Os12g0278900AK106816GAAGCCCACAAPeptidase C1A, papain family protein. 
Os12g0527500AK109836GAAGCCCAAGCyclin-like F-box domain containing protein. 
Os12g0634600009-019-G12TAATGGGCTTCNONE 
AK070357TAATGGGCTTCConserved hypothetical protein. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.