version

Summary of OsREG583 (All List)

OrganismOryza sativa  
IDOsREG583  
SequenceGACGCGAC  
Annotation  
PPDB Motif 
PLACE Motif 
Total Entry Count898  

Entry Sequences (898 entries)

LocusGene modelSequenceDescription
Os01g0104000AK072087GACGCGACGCACCGCNONE 
AK103808GACGCGACGCACCGCC-type lectin domain containing protein. 
Os01g0104100AK072797GCGGTGCGTCGCGTCZinc finger, RING-type domain containing protein. 
AK104280GCGGTGCGTCGCGTCNONE 
Os01g0134700AK111442GACGCGACCalmodulin binding protein-like family protein. 
J065141F12GACGCGACNONE 
J065156K22GACGCGACNONE 
J065160A12GACGCGACNONE 
Os01g0172200AK100326CCCACCACCACCTGTCGCGTCWW/Rsp5/WWP domain containing protein. 
Os01g0172400AK065102CGCGACGCGACNONE 
AK100365CGCGACGCGACNONE 
AK119523CGCGACGCGACNONE 
D73411CGCGACGCGACPhospholipase D alpha 1 precursor (EC 3.1.4.4) (PLD alpha 1) (Choline phosphatase 1) (Phosphatidylcholine-hydrolyzing phospholipase D 1). 
J013001N03CGCGACGCGACNONE 
J013052B12CGCGACGCGACNONE 
J013071F15CGCGACGCGACNONE 
J013108F19CGCGACGCGACNONE 
J023025E17CGCGACGCGACNONE 
J023083O10CGCGACGCGACNONE 
J023084M17CGCGACGCGACNONE 
J023100D16CGCGACGCGACNONE 
J023107O10CGCGACGCGACNONE 
J023119F08CGCGACGCGACNONE 
J033035B07CGCGACGCGACNONE 
J033052C18CGCGACGCGACNONE 
J033092H11CGCGACGCGACNONE 
J033096D02CGCGACGCGACNONE 
J033117A16CGCGACGCGACNONE 
J043010E08CGCGACGCGACNONE 
J043013C12CGCGACGCGACNONE 
J065001M15CGCGACGCGACNONE 
J065021O11CGCGACGCGACNONE 
J065089O20CGCGACGCGACNONE 
J065117N05CGCGACGCGACNONE 
J065129L11CGCGACGCGACNONE 
J065170F18CGCGACGCGACNONE 
J090066E11CGCGACGCGACNONE 
J090076N24CGCGACGCGACNONE 
J090093G21CGCGACGCGACNONE 
J100041H17CGCGACGCGACNONE 
J100050D07CGCGACGCGACNONE 
J100063A06CGCGACGCGACNONE 
Os01g0191900AK109125GTCGCGTCSimilar to Blind. 
J100031P20GTCGCGTCNONE 
J100060C15GTCGCGTCNONE 
J100073J17GTCGCGTCNONE 
J100082O12GTCGCGTCNONE 
Os01g0205900006-057-B04CGCACGCGACGCGACNONE 
AK060687CGCACGCGACGCGACNONE 
AK105932CGCACGCGACGCGACSimilar to Class III peroxidase GvPx2b (Fragment). 
J033143I12CGCACGCGACGCGACNONE 
J075013J08CGCACGCGACGCGACNONE 
J075090B11CGCACGCGACGCGACNONE 
J075143C17CGCACGCGACGCGACNONE 
J075147O13CGCACGCGACGCGACNONE 
J075161L02CGCACGCGACGCGACNONE 
Os01g0210500013-022-E05GACGCGACNONE 
013-041-A03GACGCGACNONE 
AK068329GACGCGACSimilar to SOUL-like protein. 
AK071702GACGCGACNONE 
AK104322GACGCGACNONE 
J065059L20GACGCGACNONE 
Os01g0268000AK107975GTCGCGTCGCHypothetical protein. 
J065065G10GTCGCGTCGCNONE 
J065196O11GTCGCGTCGCNONE 
Os01g0279700AK067683CGCGTCGCGTCNONE 
AK100107CGCGTCGCGTCMajor facilitator superfamily protein. 
J023004N09CGCGTCGCGTCNONE 
J075019L14CGCGTCGCGTCNONE 
J075187F21CGCGTCGCGTCNONE 
Os01g0305900Os01g0305900CGCGTCGCGTCGCSimilar to A-type R2R3 Myb protein (Fragment). 
Os01g0373400AK110973GACGCGACHomeodomain-like containing protein. 
Os01g0588200006-052-E10GACGCGACNONE 
AJ251563GACGCGACNONE 
AK070745GACGCGACVoltage-dependent anion channel. 
AK104055GACGCGACNONE 
AK104419GACGCGACNONE 
J023057A07GACGCGACNONE 
J023068C08GACGCGACNONE 
J023148E24GACGCGACNONE 
J090045O22GACGCGACNONE 
J090045P03GACGCGACNONE 
J090050C18GACGCGACNONE 
J100023F01GACGCGACNONE 
J100051I18GACGCGACNONE 
J100060P17GACGCGACNONE 
Os01g0613900014-018-D04GACGCGACNONE 
AK119181GACGCGACProtein of unknown function UPF0052 and CofD family protein. 
J023119M14GACGCGACNONE 
J065019A15GACGCGACNONE 
J075090J10GACGCGACNONE 
J075195H12GACGCGACNONE 
Os01g0623500AK066142CGCGACGCGACAAA ATPase domain containing protein. 
J013055O07CGCGACGCGACNONE 
J053069D06CGCGACGCGACNONE 
J053095J11CGCGACGCGACNONE 
J065106D24CGCGACGCGACNONE 
J065134H18CGCGACGCGACNONE 
J075066D09CGCGACGCGACNONE 
J090004M17CGCGACGCGACNONE 
J100039L05CGCGACGCGACNONE 
J100042E15CGCGACGCGACNONE 
J100043B18CGCGACGCGACNONE 
J100057L11CGCGACGCGACNONE 
J100067C24CGCGACGCGACNONE 
J100073H01CGCGACGCGACNONE 
J100081J21CGCGACGCGACNONE 
Os01g0623900J090025M21CACGCCACGCCACGCGACGCGACNONE 
J090082F22CACGCCACGCCACGCGACGCGACNONE 
J090084L02CACGCCACGCCACGCGACGCGACSimilar to Splicing factor, arginine/serine-rich 2 (Splicing factor SC35) (SC-35) (Splicing component, 35 kDa) (PR264 protein). 
Os01g0637600AK106980GACGCGACSimilar to Peptide deformylase, chloroplast precursor (EC 3.5.1.88) (PDF) (Polypeptide deformylase). 
Os01g0639600005-018-A02GTCGCGTCNONE 
AK067056GTCGCGTCProtein of unknown function DUF1645 family protein. 
J013066M03GTCGCGTCNONE 
J013066O05GTCGCGTCNONE 
J013088M21GTCGCGTCNONE 
J065045F04GTCGCGTCNONE 
J080018F22GTCGCGTCNONE 
J080037B10GTCGCGTCNONE 
J080042G23GTCGCGTCNONE 
J080052B21GTCGCGTCNONE 
J080060H13GTCGCGTCNONE 
J100024A05GTCGCGTCNONE 
J100071A09GTCGCGTCNONE 
J100080K14GTCGCGTCNONE 
Os01g0662600009-056-E10GCGTCGCGTCTCNONE 
AK062234GCGTCGCGTCTCNONE 
AK098887GCGTCGCGTCTCNONE 
AK099656GCGTCGCGTCTCNONE 
AK119723GCGTCGCGTCTCSimilar to NifU-like protein. 
J013001K01GCGTCGCGTCTCNONE 
J013090F20GCGTCGCGTCTCNONE 
J013119A14GCGTCGCGTCTCNONE 
J013121P12GCGTCGCGTCTCNONE 
J033132I15GCGTCGCGTCTCNONE 
J075023F22GCGTCGCGTCTCNONE 
J075023M13GCGTCGCGTCTCNONE 
J100024D10GCGTCGCGTCTCNONE 
J100024N01GCGTCGCGTCTCNONE 
J100026H09GCGTCGCGTCTCNONE 
J100027H07GCGTCGCGTCTCNONE 
J100045K07GCGTCGCGTCTCNONE 
J100057K18GCGTCGCGTCTCNONE 
J100085C22GCGTCGCGTCTCNONE 
Os01g0678500AB071014GTCGCGTCNONE 
AB100696GTCGCGTCSimilar to Two-pore calcium channel. 
AK067839GTCGCGTCNONE 
AK100998GTCGCGTCNONE 
J013089O09GTCGCGTCNONE 
J013126J24GTCGCGTCNONE 
J013146L16GTCGCGTCNONE 
J013160D06GTCGCGTCNONE 
J090067N19GTCGCGTCNONE 
J090070E11GTCGCGTCNONE 
Os01g0681900AB008845GTGTGGGGACGCGACGCGNADH dependent Glutamate Synthase precursor (EC 1.4.1.14). 
AK105755GTGTGGGGACGCGACGCGNONE 
Os01g0692100J043022J20GACGCGACGlutathione S-transferase, N-terminal domain containing protein. 
J100032K22GACGCGACNONE 
Os01g0699400AK107168GAGACGCGACProtein kinase-like domain containing protein. 
Os01g0730900AK120751GTTGGTGGCGTCGCGTCChaperonin clpA/B family protein. 
J023004P12GTTGGTGGCGTCGCGTCNONE 
J065006G23GTTGGTGGCGTCGCGTCNONE 
Os01g0733200AK066316CGCGACGCGACSimilar to Heat shock transcription factor 29 (Fragment). 
AY344493CGCGACGCGACNONE 
J013066G03CGCGACGCGACNONE 
J090034J08CGCGACGCGACNONE 
Os01g0748100AK071261GCGTCGCGTCHypothetical protein. 
J023084C08GCGTCGCGTCNONE 
J065058A07GCGTCGCGTCNONE 
Os01g0752800009-155-D12GTCGCGTCGCNONE 
AK103612GTCGCGTCGCSimilar to HASP protein-like protein (Fragment). 
J013063A16GTCGCGTCGCNONE 
J023007N11GTCGCGTCGCNONE 
J033141J21GTCGCGTCGCNONE 
Os01g0774500AK069241GCGACGCGACGCGConserved hypothetical protein. 
Os01g0776700J065046N20CGCGTCTCGTCGCGTCGGCTCGGConserved hypothetical protein. 
J100086L02CGCGTCTCGTCGCGTCGGCTCGGNONE 
Os01g0812900009-200-B11CGCGTCGCGTCNONE 
AK121582CGCGTCGCGTCConserved hypothetical protein. 
J013120B14CGCGTCGCGTCNONE 
J023049H09CGCGTCGCGTCNONE 
J023107J02CGCGTCGCGTCNONE 
J033025F24CGCGTCGCGTCNONE 
J033037D14CGCGTCGCGTCNONE 
J033084J01CGCGTCGCGTCNONE 
J033128E11CGCGTCGCGTCNONE 
J065140B08CGCGTCGCGTCNONE 
J075019M06CGCGTCGCGTCNONE 
J075023B03CGCGTCGCGTCNONE 
J075053H24CGCGTCGCGTCNONE 
J075067J23CGCGTCGCGTCNONE 
J075069E12CGCGTCGCGTCNONE 
J075122C03CGCGTCGCGTCNONE 
J075146G01CGCGTCGCGTCNONE 
J075150L21CGCGTCGCGTCNONE 
J075156M23CGCGTCGCGTCNONE 
J075161H02CGCGTCGCGTCNONE 
J075170F21CGCGTCGCGTCNONE 
Os01g0860601011-099-B05GACGCGACNONE 
013-093-G06GACGCGACNONE 
AK069860GACGCGACSimilar to Ferredoxin, root R-B1. 
J065017K08GACGCGACNONE 
J065020D23GACGCGACNONE 
J065041N15GACGCGACNONE 
J065119F17GACGCGACNONE 
J065169G20GACGCGACNONE 
J065179F21GACGCGACNONE 
J065182L09GACGCGACNONE 
Os01g0875500012-063-E07CGCGTCGCGTCGCGNONE 
AK101399CGCGTCGCGTCGCGSimilar to Beta-galactosidase (EC 3.2.1.23). 
AK102715CGCGTCGCGTCGCGNONE 
J023104F17CGCGTCGCGTCGCGNONE 
J023128M07CGCGTCGCGTCGCGNONE 
J033022B13CGCGTCGCGTCGCGNONE 
J033034C09CGCGTCGCGTCGCGNONE 
J033037E13CGCGTCGCGTCGCGNONE 
J033044E15CGCGTCGCGTCGCGNONE 
J033085M16CGCGTCGCGTCGCGNONE 
J033087L24CGCGTCGCGTCGCGNONE 
J033089G01CGCGTCGCGTCGCGNONE 
J033093D16CGCGTCGCGTCGCGNONE 
J033102B22CGCGTCGCGTCGCGNONE 
J033108E02CGCGTCGCGTCGCGNONE 
J033115P07CGCGTCGCGTCGCGNONE 
J033122A10CGCGTCGCGTCGCGNONE 
J090033B09CGCGTCGCGTCGCGNONE 
J090038A15CGCGTCGCGTCGCGNONE 
J090053G04CGCGTCGCGTCGCGNONE 
J090069H01CGCGTCGCGTCGCGNONE 
J090093F16CGCGTCGCGTCGCGNONE 
Os01g0926400AK063916GTCGCGTCGCNONE 
AK073976GTCGCGTCGCSimilar to Pectin-glucuronyltransferase. 
Os01g0937300AK062872GTCGCGTCNONE 
J033136K12GTCGCGTCNONE 
J053048E20GTCGCGTCNONE 
J053088K08GTCGCGTCNONE 
J065011G23GTCGCGTCNONE 
J065202J09GTCGCGTCNONE 
Os01g0949200AK102412GACGCGACNONE 
J033093A04GACGCGACNONE 
J065053P06GACGCGACNONE 
J100086D18GACGCGACNONE 
Os02g0462800AK110587CGCGTCGCGTCGCGTCGCGWRKY transcription factor 42 (Transcription factor WRKY02). 
AY676923CGCGTCGCGTCGCGTCGCGNONE 
Os02g0471500AK120615GTCGCGTCGCNONE 
AK120927GTCGCGTCGCProtein phosphatase 2C-like domain containing protein. 
Os02g0491400AK073233GTCGCGTCSimilar to Peptidylprolyl isomerase. 
J090046J15GTCGCGTCNONE 
Os02g0556800AK060580CGCACGCGACGCGACNONE 
AK100187CGCACGCGACGCGACConserved hypothetical protein. 
J065162A21CGCACGCGACGCGACNONE 
J075093B20CGCACGCGACGCGACNONE 
J075097N04CGCACGCGACGCGACNONE 
Os02g0565000AK120665GACGCGACHomeodomain-like containing protein. 
J100070C12GACGCGACNONE 
J100074L08GACGCGACNONE 
Os02g0572000AK105571GACGCGACConserved hypothetical protein. 
Os02g0605600016-017-B02CGCGTCGCGTCNONE 
AK066104CGCGTCGCGTCLUC7 related family protein. 
J013052G16CGCGTCGCGTCNONE 
J043022E03CGCGTCGCGTCNONE 
J065105P10CGCGTCGCGTCNONE 
Os02g0634900006-032-G12GTCGCGTCNONE 
006-033-E09GTCGCGTCNONE 
006-117-F10GTCGCGTCNONE 
006-118-E01GTCGCGTCNONE 
013-056-G08GTCGCGTCNONE 
AK059769GTCGCGTCNONE 
AK068583GTCGCGTCNONE 
AK072855GTCGCGTCProteasome subunit alpha type 2 (EC 3.4.25.1) (20S proteasome alpha subunit B) (20S proteasome subunit alpha-2). 
AK106210GTCGCGTCNONE 
J023138P05GTCGCGTCNONE 
J023143J07GTCGCGTCNONE 
J033022O09GTCGCGTCNONE 
J033111L02GTCGCGTCNONE 
J033135O03GTCGCGTCNONE 
J065005K19GTCGCGTCNONE 
J065044C17GTCGCGTCNONE 
J065116K09GTCGCGTCNONE 
J065119O21GTCGCGTCNONE 
J075014L05GTCGCGTCNONE 
J075109H16GTCGCGTCNONE 
J075117D04GTCGCGTCNONE 
Os02g0651900AK101633GACGCGACNONE 
AK102949GACGCGACConserved hypothetical protein. 
J080018N20GACGCGACNONE 
J080062I19GACGCGACNONE 
J100064N12GACGCGACNONE 
J100083B11GACGCGACNONE 
J100089D08GACGCGACNONE 
Os02g0669500AK111117GACGCGACProtein of unknown function DUF241, plant family protein. 
Os02g0697200015-013-B10GACGCGACNONE 
AK059475GACGCGACNONE 
AK102993GACGCGACConserved hypothetical protein. 
J033079I18GACGCGACNONE 
J033082A14GACGCGACNONE 
J065047H08GACGCGACNONE 
J065131M14GACGCGACNONE 
Os02g0697700AK120209GTCGCGTCConserved hypothetical protein. 
J013038N05GTCGCGTCNONE 
J013170I01GTCGCGTCNONE 
J033144L08GTCGCGTCNONE 
J033145L08GTCGCGTCNONE 
J043004E24GTCGCGTCNONE 
J065032A08GTCGCGTCNONE 
J065166F03GTCGCGTCNONE 
J075174D13GTCGCGTCNONE 
J100019I19GTCGCGTCNONE 
J100073F13GTCGCGTCNONE 
Os02g0700000AK100709GAGACGCGACPWWP domain containing protein. 
J013072L20GAGACGCGACNONE 
J023115E12GAGACGCGACNONE 
J033099N14GAGACGCGACNONE 
J033148H17GAGACGCGACNONE 
J100074E14GAGACGCGACNONE 
Os02g0708100AK059630CGCGACGCGACNONE 
AK102055CGCGACGCGACSimilar to Carbamoyl phosphate synthetase small subunit (EC 6.3.5.5). 
Os02g0735700012-001-A03GACGCGACNONE 
AK120217GACGCGACAnkyrin repeat containing protein. 
J013040N22GACGCGACNONE 
J065163P05GACGCGACNONE 
J100041E23GACGCGACNONE 
J100090G21GACGCGACNONE 
Os02g0753800AK101787CGCGACGCGACGCGACGCSimilar to Annexin p35. 
Os02g0762400AK103084GACGCGACCyclin-dependent kinase inhibitor family protein. 
AK103084GCGACGCGACGCGCyclin-dependent kinase inhibitor family protein. 
Os02g0770100AK111651GACGCGACGCGACConserved hypothetical protein. 
J023029P14GACGCGACGCGACNONE 
J065119C17GACGCGACGCGACNONE 
Os02g0789600AK101046CGCGTCGCGTCNONE 
AK112100CGCGTCGCGTCSimilar to DEM2. 
Os03g0115100AK121101GTCGCGTCMevalonate and galactokinase family protein. 
J100074B18GTCGCGTCNONE 
Os03g0116800012-097-D10CCCACGCGACGCGACNONE 
016-024-H10CCCACGCGACGCGACNONE 
AK066955CCCACGCGACGCGACConserved hypothetical protein. 
AK068678CCCACGCGACGCGACNONE 
AK104839CCCACGCGACGCGACNONE 
J013033G16CCCACGCGACGCGACNONE 
J013091C10CCCACGCGACGCGACNONE 
J013158H22CCCACGCGACGCGACNONE 
J023106K11CCCACGCGACGCGACNONE 
J065051O15CCCACGCGACGCGACNONE 
J065129G22CCCACGCGACGCGACNONE 
J075001K02CCCACGCGACGCGACNONE 
J075011O03CCCACGCGACGCGACNONE 
J075024K04CCCACGCGACGCGACNONE 
J075026E07CCCACGCGACGCGACNONE 
J075037O14CCCACGCGACGCGACNONE 
J075071D17CCCACGCGACGCGACNONE 
J075084M05CCCACGCGACGCGACNONE 
J075114B06CCCACGCGACGCGACNONE 
J075128C23CCCACGCGACGCGACNONE 
J075153A13CCCACGCGACGCGACNONE 
J075158A15CCCACGCGACGCGACNONE 
J075165P09CCCACGCGACGCGACNONE 
J075167M21CCCACGCGACGCGACNONE 
J075170F11CCCACGCGACGCGACNONE 
J075186F12CCCACGCGACGCGACNONE 
J075186L13CCCACGCGACGCGACNONE 
J075189A01CCCACGCGACGCGACNONE 
J075192D19CCCACGCGACGCGACNONE 
Os03g0126900AK109217GTCGCGTCGCGTCConserved hypothetical protein. 
J065085G16GTCGCGTCGCGTCNONE 
J100086C03GTCGCGTCGCGTCNONE 
Os03g0131200AB020502GACGCGACNONE 
AK062174GACGCGACNONE 
AK066378GACGCGACSimilar to Catalase isozyme 2 (EC 1.11.1.6). 
AY339372GACGCGACNONE 
J013060B21GACGCGACNONE 
J013149P20GACGCGACNONE 
J023060E16GACGCGACNONE 
J043004A19GACGCGACNONE 
J053029N09GACGCGACNONE 
J053072I10GACGCGACNONE 
J065016G02GACGCGACNONE 
J065022E22GACGCGACNONE 
J065024K17GACGCGACNONE 
J065035E10GACGCGACNONE 
J065036D13GACGCGACNONE 
J065041E06GACGCGACNONE 
J065064H14GACGCGACNONE 
J065067I06GACGCGACNONE 
J065080C01GACGCGACNONE 
J065086K23GACGCGACNONE 
J065087L12GACGCGACNONE 
J065090I05GACGCGACNONE 
J065117E23GACGCGACNONE 
J065120A10GACGCGACNONE 
J065120L22GACGCGACNONE 
J065123F02GACGCGACNONE 
J065128G02GACGCGACNONE 
J065142B04GACGCGACNONE 
J065143K12GACGCGACNONE 
J065148B18GACGCGACNONE 
J065153C16GACGCGACNONE 
J065163J11GACGCGACNONE 
J065168L24GACGCGACNONE 
J065181J11GACGCGACNONE 
J065190F19GACGCGACNONE 
J065209E24GACGCGACNONE 
J065210G04GACGCGACNONE 
J065217H17GACGCGACNONE 
J065219I20GACGCGACNONE 
J075001M13GACGCGACNONE 
J075007B08GACGCGACNONE 
J075009I01GACGCGACNONE 
J075014C11GACGCGACNONE 
J075014L02GACGCGACNONE 
J075016E07GACGCGACNONE 
J075017J02GACGCGACNONE 
J075018F07GACGCGACNONE 
J075018N07GACGCGACNONE 
J075019B06GACGCGACNONE 
J075024F21GACGCGACNONE 
J075026B18GACGCGACNONE 
J075026M12GACGCGACNONE 
J075032B13GACGCGACNONE 
J075033O09GACGCGACNONE 
J075041A09GACGCGACNONE 
J075045L13GACGCGACNONE 
J075048N11GACGCGACNONE 
J075052A14GACGCGACNONE 
J075061B17GACGCGACNONE 
J075061I05GACGCGACNONE 
J075066I11GACGCGACNONE 
J075066P09GACGCGACNONE 
J075068F03GACGCGACNONE 
J075068P22GACGCGACNONE 
J075080I15GACGCGACNONE 
J075081I07GACGCGACNONE 
J075082K01GACGCGACNONE 
J075083A18GACGCGACNONE 
J075086O11GACGCGACNONE 
J075087E02GACGCGACNONE 
J075087M19GACGCGACNONE 
J075088G23GACGCGACNONE 
J075092K18GACGCGACNONE 
J075095H15GACGCGACNONE 
J075095K12GACGCGACNONE 
J075096L06GACGCGACNONE 
J075100H23GACGCGACNONE 
J075100K01GACGCGACNONE 
J075102K21GACGCGACNONE 
J075104F24GACGCGACNONE 
J075106C17GACGCGACNONE 
J075106E06GACGCGACNONE 
J075106M19GACGCGACNONE 
J075106O12GACGCGACNONE 
J075108I09GACGCGACNONE 
J075111M06GACGCGACNONE 
J075112E12GACGCGACNONE 
J075114C04GACGCGACNONE 
J075120A06GACGCGACNONE 
J075120D14GACGCGACNONE 
J075122P15GACGCGACNONE 
J075123A11GACGCGACNONE 
J075123L12GACGCGACNONE 
J075127G14GACGCGACNONE 
J075127H09GACGCGACNONE 
J075128M04GACGCGACNONE 
J075129J04GACGCGACNONE 
J075130J01GACGCGACNONE 
J075137N02GACGCGACNONE 
J075137O14GACGCGACNONE 
J075138H22GACGCGACNONE 
J075139P16GACGCGACNONE 
J075141G08GACGCGACNONE 
J075142C17GACGCGACNONE 
J075143B09GACGCGACNONE 
J075156I11GACGCGACNONE 
J075158M03GACGCGACNONE 
J075166I21GACGCGACNONE 
J075167C08GACGCGACNONE 
J075170C12GACGCGACNONE 
J075170F08GACGCGACNONE 
J075170G04GACGCGACNONE 
J075172N16GACGCGACNONE 
J075172P13GACGCGACNONE 
J075173G24GACGCGACNONE 
J075175D01GACGCGACNONE 
J075175K01GACGCGACNONE 
J075181O04GACGCGACNONE 
J075186A04GACGCGACNONE 
J075190B08GACGCGACNONE 
J075190M24GACGCGACNONE 
J075193D18GACGCGACNONE 
J075193H03GACGCGACNONE 
J075195N18GACGCGACNONE 
J080001N20GACGCGACNONE 
J080006K17GACGCGACNONE 
J080012I16GACGCGACNONE 
J080013K20GACGCGACNONE 
J080018N01GACGCGACNONE 
J080041G15GACGCGACNONE 
J080048L15GACGCGACNONE 
J080049A21GACGCGACNONE 
J080075G12GACGCGACNONE 
J080076O09GACGCGACNONE 
J080078P10GACGCGACNONE 
J080084D10GACGCGACNONE 
J090005N07GACGCGACNONE 
Os03g0140700AK070000GTCCGTCCCCCGCGCGACGCGACTetratricopeptide-like helical domain containing protein. 
Os03g0143700AK066360CGCGACGCGACGCGACConserved hypothetical protein. 
J013066M09CGCGACGCGACGCGACNONE 
J023087N24CGCGACGCGACGCGACNONE 
Os03g0146000006-105-H06GTCGCGTCGCGTCGCGTCGAGTCGAGTCNONE 
AK061250GTCGCGTCGCGTCGCGTCGAGTCGAGTCSimilar to RAB1X. 
AK099130GTCGCGTCGCGTCGCGTCGAGTCGAGTCNONE 
J023043D11GTCGCGTCGCGTCGCGTCGAGTCGAGTCNONE 
J043009O17GTCGCGTCGCGTCGCGTCGAGTCGAGTCNONE 
Os03g0171900006-070-A01GTCGCGTCGCNONE 
AK061079GTCGCGTCGCNONE 
AK105642GTCGCGTCGCSimilar to Alanine:glyoxylate aminotransferase-like protein (Fragment). 
Os03g0180800AK070649GTCGCGTCZIM domain containing protein. 
J065121B15GTCGCGTCNONE 
J075067G15GTCGCGTCNONE 
Os03g0203000AK065462GACGCGACConserved hypothetical protein. 
Os03g0214400AK067931GACGCGACGCSimilar to Digalactosyldiacylglycerol synthase 2. 
Os03g0233000015-086-B02GTCGCGTCNONE 
016-065-A11GTCGCGTCNONE 
AK069495GTCGCGTCProtein of unknown function DUF607 family protein. 
J100032A20GTCGCGTCNONE 
J100053C19GTCGCGTCNONE 
J100053H13GTCGCGTCNONE 
Os03g0295300009-157-G05GTCGCGTCNONE 
Os03g0297400AK060653GCCACGTCGCGTCGCNONE 
AK061403GCCACGTCGCGTCGCNONE 
AK101597GCCACGTCGCGTCGCMalonyl CoA-acyl carrier protein transacylase family protein. 
Os03g0302800AK061293GCGACGCGACGCGConserved hypothetical protein. 
Os03g0319300006-021-E05GTCGCGTCGCGNONE 
006-022-H12GTCGCGTCGCGNONE 
009-187-E02GTCGCGTCGCGNONE 
AF042840GTCGCGTCGCGNONE 
AK059756GTCGCGTCGCGCalmodulin (CaM). 
AK070090GTCGCGTCGCGNONE 
J065017J02GTCGCGTCGCGNONE 
J065028G17GTCGCGTCGCGNONE 
J065045N09GTCGCGTCGCGNONE 
J065078F21GTCGCGTCGCGNONE 
J065091H01GTCGCGTCGCGNONE 
J065112B19GTCGCGTCGCGNONE 
J065186E08GTCGCGTCGCGNONE 
J065199G12GTCGCGTCGCGNONE 
J075030K07GTCGCGTCGCGNONE 
J075050B02GTCGCGTCGCGNONE 
J075057G07GTCGCGTCGCGNONE 
J075070F01GTCGCGTCGCGNONE 
J075093N12GTCGCGTCGCGNONE 
J075095K13GTCGCGTCGCGNONE 
J075102D14GTCGCGTCGCGNONE 
J075103B17GTCGCGTCGCGNONE 
J075114K05GTCGCGTCGCGNONE 
J075142F18GTCGCGTCGCGNONE 
J075154L11GTCGCGTCGCGNONE 
J075185F08GTCGCGTCGCGNONE 
J090012A14GTCGCGTCGCGNONE 
J090044L10GTCGCGTCGCGNONE 
J100044C12GTCGCGTCGCGNONE 
J100088J19GTCGCGTCGCGNONE 
Os03g0437200006-066-E02GCGTCGCGTCGCNONE 
AK059839GCGTCGCGTCGCZinc finger, C2H2-type domain containing protein. 
AY295345GCGTCGCGTCGCNONE 
Os03g0634000014-034-A03CGCGTCGCGTCGCNONE 
AK063673CGCGTCGCGTCGCSimilar to THA4. 
Os03g0690000AK062756GACGCGACConserved hypothetical protein. 
J080302F19GACGCGACNONE 
J080303J23GACGCGACNONE 
J080303K16GACGCGACNONE 
J080306B15GACGCGACNONE 
J080309C02GACGCGACNONE 
J080312F13GACGCGACNONE 
J080312M04GACGCGACNONE 
J080315L20GACGCGACNONE 
Os03g0751600006-043-F03GACGCGACNONE 
006-050-G05GACGCGACNONE 
006-059-F10GACGCGACNONE 
AK061520GACGCGACHeavy metal transport/detoxification protein domain containing protein. 
AK104665GACGCGACNONE 
Os03g0754200AK065954GGGCCTGACGCGACNONE 
AK067890GGGCCTGACGCGACNONE 
AK103031GGGCCTGACGCGACSimilar to Triosephosphate isomerase, cytosolic (EC 5.3.1.1) (TIM) (Triose- phosphate isomerase). 
J090023B20GGGCCTGACGCGACNONE 
J090058C20GGGCCTGACGCGACNONE 
Os03g0764600AK105625GACGCGACHomeodomain-like containing protein. 
Os03g0772600AK120949GAGACGCGACGCGACGCGACGCGSimilar to Lectin-like receptor kinase 7;2. 
Os03g0784400AK103474GCGTCGCGTCProtein of unknown function DUF1692 domain containing protein. 
J023135I15GCGTCGCGTCNONE 
J033130D12GCGTCGCGTCNONE 
J043035E20GCGTCGCGTCNONE 
J065206K15GCGTCGCGTCNONE 
J075053J20GCGTCGCGTCNONE 
J075129B11GCGTCGCGTCNONE 
J090003E22GCGTCGCGTCNONE 
J100023E23GCGTCGCGTCNONE 
Os03g0784500AK109744CATCCACCCGCGTCGCGTCTCNONE 
Os03g0794800AK070933GCGACGCGACSimilar to XRN3. 
Os04g0389800AK109628GTCGCGTCSimilar to Acetohydroxyacid synthase. 
Os04g0390000AK067777GACGCGACNONE 
AK068713GACGCGACNONE 
AK098921GACGCGACSimilar to 2-oxoglutarate dehydrogenase, E1 component. 
Os04g0405500011-007-D12CGCGTCGCGTCCCTCANONE 
AK063263CGCGTCGCGTCCCTCAConserved hypothetical protein. 
J065166G19CGCGTCGCGTCCCTCANONE 
J075180M09CGCGTCGCGTCCCTCANONE 
Os04g0430600009-014-G12CGCGTCGCGTCNONE 
015-019-A08CGCGTCGCGTCNONE 
015-048-C08CGCGTCGCGTCNONE 
015-085-E11CGCGTCGCGTCNONE 
AK072050CGCGTCGCGTCNONE 
AK106337CGCGTCGCGTCConserved hypothetical protein. 
J065037C09CGCGTCGCGTCNONE 
J075125G18CGCGTCGCGTCNONE 
Os04g0586100009-190-F11CGCGACGCGACGCCCCACCNONE 
AK063206CGCGACGCGACGCCCCACCProtein of unknown function DUF581 family protein. 
Os04g0648600AK108279GACGCGACConserved hypothetical protein. 
Os05g0187100012-066-F01GACGCGACGCNONE 
AK067988GACGCGACGCSimilar to Hexokinase. 
Os05g0382600AK068231GTCGCGTCAnnexin family protein. 
J013147O19GTCGCGTCNONE 
Os05g0424800AK121054CTCGCGCGTCGCGTCSimilar to AER274Wp. 
J023055P22CTCGCGCGTCGCGTCNONE 
J023102M21CTCGCGCGTCGCGTCNONE 
J033088E13CTCGCGCGTCGCGTCNONE 
J033123K17CTCGCGCGTCGCGTCNONE 
J065176L18CTCGCGCGTCGCGTCNONE 
J075002F14CTCGCGCGTCGCGTCNONE 
J075005E10CTCGCGCGTCGCGTCNONE 
J075005K21CTCGCGCGTCGCGTCNONE 
J075007A18CTCGCGCGTCGCGTCNONE 
J075021J16CTCGCGCGTCGCGTCNONE 
J075040K11CTCGCGCGTCGCGTCNONE 
J075061A14CTCGCGCGTCGCGTCNONE 
J075106H07CTCGCGCGTCGCGTCNONE 
J075109M22CTCGCGCGTCGCGTCNONE 
J075121O13CTCGCGCGTCGCGTCNONE 
J075132M08CTCGCGCGTCGCGTCNONE 
J075153B19CTCGCGCGTCGCGTCNONE 
J075158L15CTCGCGCGTCGCGTCNONE 
J075187G20CTCGCGCGTCGCGTCNONE 
J100079N17CTCGCGCGTCGCGTCNONE 
Os05g0446800AK065861GACGCGACNONE 
AK071336GACGCGACNONE 
AK099450GACGCGACSimilar to Arginyl-tRNA--protein transferase 1 (EC 2.3.2.8) (R-transferase 1) (Arginyltransferase 1) (Arginine-tRNA--protein transferase 1). Splice isoform ATE1-2. 
Os05g0450300AK071191GACGCGACGCGConserved hypothetical protein. 
J023084G11GACGCGACGCGNONE 
Os05g0506000AF031609CGACACGTGACGCGACNONE 
AK062012CGACACGTGACGCGACNONE 
AK098900CGACACGTGACGCGACNONE 
AK122090CGACACGTGACGCGACSimilar to MS5-like protein (Fragment). 
J013002B13CGACACGTGACGCGACNONE 
J023149G13CGACACGTGACGCGACNONE 
J033123O20CGACACGTGACGCGACNONE 
J080315O17CGACACGTGACGCGACNONE 
Os05g0508300Os05g0508300GTCGCGTCGCSimilar to Papain-like cysteine peptidase XBCP3. 
Os05g0519800AK069435CGCGTCGCGTCProtein of unknown function DUF28 family protein. 
J023024L22CGCGTCGCGTCNONE 
Os05g0540000003-107-E10GTCGCGTCNONE 
AK100416GTCGCGTCConserved hypothetical protein. 
J023087M19GTCGCGTCNONE 
Os05g0551500AK108248GTCGCGTCNONE 
AK109642GTCGCGTCProtein of unknown function DUF1639 family protein. 
J075084B02GTCGCGTCNONE 
Os05g0551700AK071216GTCGCGTCGCGtRNA isopentenyltransferase family protein. 
Os05g0576600AK107732GACGCGACGCGACConserved hypothetical protein. 
Os05g0577700AK107217GCTGGGCTGGGCCCCTCGCGCGCGACGCGACSimilar to Protein kinase. 
AY224453GCTGGGCTGGGCCCCTCGCGCGCGACGCGACNONE 
Os05g0579600Os05g0579600CGCGACGCGACHomeodomain-like containing protein. 
Os06g0130400AK065212GCGTCGCGTCSimilar to 1-aminocyclopropane-1-carboxylate synthase (EC 4.4.1.14) (Fragment). 
Os06g0166000009-023-G02CGCGTCGCGTCGCGTCNONE 
AK060317CGCGTCGCGTCGCGTCCyclin-like F-box domain containing protein. 
J075052L22CGCGTCGCGTCGCGTCNONE 
J075078E03CGCGTCGCGTCGCGTCNONE 
J075115M08CGCGTCGCGTCGCGTCNONE 
J075192G08CGCGTCGCGTCGCGTCNONE 
J100036C01CGCGTCGCGTCGCGTCNONE 
J100070J02CGCGTCGCGTCGCGTCNONE 
J100088C24CGCGTCGCGTCGCGTCNONE 
Os06g0213900AK106922GTCGCGTCCCACCConserved hypothetical protein. 
J090028K09GTCGCGTCCCACCNONE 
J100078N13GTCGCGTCCCACCNONE 
Os06g0223300AK111776GCGTCGCGTCGCGTCSimilar to TDR8 protein. 
J023075K19GCGTCGCGTCGCGTCNONE 
Os06g0225300AK065224CGCGACGCGACNONE 
AK100258CGCGACGCGACSimilar to SERK1 (Fragment). 
J013002G23CGCGACGCGACNONE 
Os06g0500000J065064K10CGCGACGCGACConserved hypothetical protein. 
J065148C10CGCGACGCGACNONE 
J065183N06CGCGACGCGACNONE 
J065203F05CGCGACGCGACNONE 
Os06g0597600AK120804GCGACGCGACGCGAromatic-ring hydroxylase family protein. 
Os06g0613500AK070970GTCGCGTCGCGCGCSimilar to Helix-loop-helix protein homolog. 
J023066J03GTCGCGTCGCGCGCNONE 
Os06g0633100AK107791GTCGCGTCGCGTCGCGCCCACAAConserved hypothetical protein. 
J065001N11GTCGCGTCGCGTCGCGCCCACAANONE 
Os06g0644800006-051-A11CGCGTCGCGTCGCGTCGCNONE 
006-061-C06CGCGTCGCGTCGCGTCGCNONE 
006-086-A03CGCGTCGCGTCGCGTCGCNONE 
006-091-B11CGCGTCGCGTCGCGTCGCNONE 
AK105643CGCGTCGCGTCGCGTCGCNONE 
AK109442CGCGTCGCGTCGCGTCGCMannose-6-phosphate receptor, binding domain containing protein. 
J065083E17CGCGTCGCGTCGCGTCGCNONE 
Os06g0673500J100018J12GACGCGACGCNONE 
J100072F13GACGCGACGCSimilar to Ubiquitin. 
Os06g0683400009-047-C07GACGCGACNONE 
009-060-B06GACGCGACNONE 
013-057-F12GACGCGACNONE 
AK111852GACGCGACNONE 
AK111897GACGCGACNONE 
AK112082GACGCGACSimilar to EF-hand Ca2+-binding protein CCD1. 
J065104C07GACGCGACNONE 
J065187J11GACGCGACNONE 
J065197L08GACGCGACNONE 
J100045K14GACGCGACNONE 
J100074M08GACGCGACNONE 
J100088H21GACGCGACNONE 
Os06g0707200006-022-G09GACGCGACGCNONE 
AK059411GACGCGACGCNONE 
AK071568GACGCGACGCProtein of unknown function DUF563 family protein. 
J065101E21GACGCGACGCNONE 
Os07g0166800006-038-C11GTCGCGTCNONE 
012-080-F02GTCGCGTCNONE 
AK070524GTCGCGTCRad6 (Ubiquitin carrier protein). 
AK121382GTCGCGTCNONE 
J023022D19GTCGCGTCNONE 
J023055G02GTCGCGTCNONE 
J023073E02GTCGCGTCNONE 
J023125B08GTCGCGTCNONE 
J023127H21GTCGCGTCNONE 
J033052G01GTCGCGTCNONE 
J033067F13GTCGCGTCNONE 
J065046L14GTCGCGTCNONE 
J065178D11GTCGCGTCNONE 
J065205N17GTCGCGTCNONE 
J075006K17GTCGCGTCNONE 
J075051D20GTCGCGTCNONE 
J075109L04GTCGCGTCNONE 
J090024K15GTCGCGTCNONE 
J090025N04GTCGCGTCNONE 
J090049N09GTCGCGTCNONE 
J090070N12GTCGCGTCNONE 
J090078O21GTCGCGTCNONE 
J090083L07GTCGCGTCNONE 
J100063K16GTCGCGTCNONE 
J100083D14GTCGCGTCNONE 
Os07g0206900AK107761GACGCGACProtein of unknown function DUF642 family protein. 
Os07g0530700AK060014GACGCGACGCNONE 
Os07g0584500003-129-F05GTCGCGTCGCGTCNONE 
006-119-H08GTCGCGTCGCGTCNONE 
011-022-G03GTCGCGTCGCGTCNONE 
AK067725GTCGCGTCGCGTCRNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
AK121109GTCGCGTCGCGTCNONE 
J013055C05GTCGCGTCGCGTCNONE 
J013062F12GTCGCGTCGCGTCNONE 
J013069J22GTCGCGTCGCGTCNONE 
J013114I11GTCGCGTCGCGTCNONE 
J023072P12GTCGCGTCGCGTCNONE 
Os07g0657100AK108253CGCGACGCGACGCGGlyoxalase/extradiol ring-cleavage dioxygenase domain containing protein. 
AK108253CGCGACGCGACGCGGlyoxalase/extradiol ring-cleavage dioxygenase domain containing protein. 
J075072F01CGCGACGCGACGCGNONE 
J075072F01CGCGACGCGACGCGNONE 
J075078C21CGCGACGCGACGCGNONE 
J075078C21CGCGACGCGACGCGNONE 
J075147E12CGCGACGCGACGCGNONE 
J075147E12CGCGACGCGACGCGNONE 
J075180N10CGCGACGCGACGCGNONE 
J075180N10CGCGACGCGACGCGNONE 
J075197D01CGCGACGCGACGCGNONE 
J075197D01CGCGACGCGACGCGNONE 
Os07g0682800AK066262GTCGCGTCSimilar to Apyrase-like protein. 
Os07g0691200AK068807GACGCGACNONE 
AK072158GACGCGACNONE 
J013001D13GACGCGACNONE 
J013022D09GACGCGACNONE 
J013028C24GACGCGACNONE 
J013032M14GACGCGACNONE 
J023097E13GACGCGACNONE 
J065095A22GACGCGACNONE 
Os07g0695400015-036-B08CGCGTCGCGTCGCNONE 
015-036-B08GCGTCGCGTCGCGTGCGNONE 
AK100615CGCGTCGCGTCGCNONE 
AK100615GCGTCGCGTCGCGTGCGNONE 
AK106304CGCGTCGCGTCGCKIP1-like domain containing protein. 
AK106304GCGTCGCGTCGCGTGCGKIP1-like domain containing protein. 
J023108B01CGCGTCGCGTCGCNONE 
J023108B01GCGTCGCGTCGCGTGCGNONE 
Os08g0127700012-086-F03GACGCGACGCNONE 
AK059350GACGCGACGCNONE 
AK099242GACGCGACGCNONE 
AK121348GACGCGACGCConserved hypothetical protein. 
J033027J18GACGCGACGCNONE 
J065012F22GACGCGACGCNONE 
J065046N17GACGCGACGCNONE 
J065197B02GACGCGACGCNONE 
J100018P04GACGCGACGCNONE 
J100052C14GACGCGACGCNONE 
J100083A12GACGCGACGCNONE 
Os08g0266600011-054-F07GTCGCGTCNONE 
AK099812GTCGCGTCNitrous oxide reductase, N-terminal domain containing protein. 
J013099F18GTCGCGTCNONE 
Os08g0402500AK108881GCGCGCGACGCGACGCGConserved hypothetical protein. 
Os08g0423400AK072922GTCGCGTCConserved hypothetical protein. 
J023146P06GTCGCGTCNONE 
Os08g0449850J075182C20GACGCGACConserved hypothetical protein. 
Os08g0484700J065041E01CGCGACGCGACHomeodomain-like containing protein. 
Os08g0564300006-049-F07GTCGCGTCGCTGGGCTNONE 
AK105923GTCGCGTCGCTGGGCTNONE 
Os09g0243200AK107718GTCGCGTCZinc finger, RING-type domain containing protein. 
Os09g0251800006-100-E12CGCGACGCGACGCNONE 
AK061218CGCGACGCGACGCC2 calcium/lipid-binding region, CaLB domain containing protein. 
AK104010CGCGACGCGACGCNONE 
J065048A02CGCGACGCGACGCNONE 
J065073P10CGCGACGCGACGCNONE 
J065075B09CGCGACGCGACGCNONE 
J065112B05CGCGACGCGACGCNONE 
J090014H10CGCGACGCGACGCNONE 
Os09g0300800012-029-E11GACGCGACNONE 
AK063465GACGCGACProtein of unknown function DUF247, plant family protein. 
Os09g0413700006-030-F11GACGCGACNONE 
AK061445GACGCGACConserved hypothetical protein. 
AK065233GACGCGACNONE 
J013002H15GACGCGACNONE 
J023009E11GACGCGACNONE 
J100073M10GACGCGACNONE 
Os09g0419200006-022-F05GACGCGACNONE 
006-027-H05GACGCGACNONE 
006-031-G10GACGCGACNONE 
006-046-G06GACGCGACNONE 
AB122055GACGCGACNONE 
AK067949GACGCGACNAD-dependent epimerase/dehydratase family protein. 
AK104860GACGCGACNONE 
AK107198GACGCGACNONE 
J013025L23GACGCGACNONE 
J013128P15GACGCGACNONE 
J023108L23GACGCGACNONE 
J023109C04GACGCGACNONE 
Os09g0445600AK107839GAGACGCGACGCConserved hypothetical protein. 
Os09g0465600AB107218GTCGCGTCNONE 
AK068061GTCGCGTCSimilar to Glucose-6-phosphate isomerase-like protein (Fragment). 
AY224509GTCGCGTCNONE 
Os09g0480100009-120-H03GTCGCGTCGCNONE 
AK062866GTCGCGTCGCConserved hypothetical protein. 
Os09g0497400009-087-E03CGCGTCGCGTCNONE 
AK058354CGCGTCGCGTCNONE 
J013159B19CGCGTCGCGTCNONE 
J023011D22CGCGTCGCGTCNONE 
J023081K05CGCGTCGCGTCNONE 
J033060O14CGCGTCGCGTCNONE 
J075020I08CGCGTCGCGTCNONE 
J075034J03CGCGTCGCGTCNONE 
J075049M15CGCGTCGCGTCNONE 
J075065K02CGCGTCGCGTCNONE 
J075099L06CGCGTCGCGTCNONE 
Os09g0534800009-128-G09CGCGACGCGACCGAGCCGNONE 
009-128-G09GAGACGCGACNONE 
AF464908CGCGACGCGACCGAGCCGNONE 
AF464908GAGACGCGACNONE 
AK068941CGCGACGCGACCGAGCCGTranscription initiation factor IIB (General transcription factor TFIIB). 
AK068941GAGACGCGACTranscription initiation factor IIB (General transcription factor TFIIB). 
J013170A08CGCGACGCGACCGAGCCGNONE 
J013170A08GAGACGCGACNONE 
J023123L05CGCGACGCGACCGAGCCGNONE 
J023123L05GAGACGCGACNONE 
J043020O05CGCGACGCGACCGAGCCGNONE 
J043020O05GAGACGCGACNONE 
Os11g0201266J065095K20GACGCGACNONE 
J065159E23GACGCGACNONE 
J075054I16GACGCGACNONE 
J075081N23GACGCGACNONE 
J075099P05GACGCGACNONE 
J075162F02GACGCGACNONE 
J075183E01GACGCGACNONE 
J075196P06GACGCGACNONE 
Os11g0239600012-053-G11GACGCGACNONE 
014-086-F08GACGCGACNONE 
015-001-A01GACGCGACNONE 
AK065416GACGCGACEsterase/lipase/thioesterase domain containing protein. 
J065041A15GACGCGACNONE 
Os11g0244800AK103215GCGACGCGACGCGSimilar to Alfin-1. 
J065009E13GCGACGCGACGCGNONE 
J065027D16GCGACGCGACGCGNONE 
J065085B06GCGACGCGACGCGNONE 
J065180O17GCGACGCGACGCGNONE 
J090010C16GCGACGCGACGCGNONE 
J090039K20GCGACGCGACGCGNONE 
Os11g0542100J065162B12GTCGCGTCGCZinc finger, RING-type domain containing protein. 
Os11g0705200AK102199GCGTCGCGTCSimilar to Scarecrow-like 9 (Fragment). 
J033087D22GCGTCGCGTCNONE 
Os12g0114100AK067447GTCGCGTCGCSimilar to MAP kinase-like protein. 
AK072172GTCGCGTCGCNONE 
J013075O15GTCGCGTCGCNONE 
J013129I24GTCGCGTCGCNONE 
J090058A14GTCGCGTCGCNONE 
Os12g0141000J065041B13GACGCGACGCConserved hypothetical protein. 
J065110D03GACGCGACGCNONE 
J065183O10GACGCGACGCNONE 
Os12g0182200009-110-C10GTCGCGTCGCNONE 
AK069414GTCGCGTCGCNONE 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.