version

Summary of OsREG584 (All List)

OrganismOryza sativa  
IDOsREG584  
SequenceGACGGCCC  
Annotation  
PPDB MotifGCCCA  Element II of Arabidopsis PCNA-2, cell cycle/meristematic expression  
PLACE Motif 
Total Entry Count1762  

Entry Sequences (1762 entries)

LocusGene modelSequenceDescription
Os01g0166800AK073783GGACGGCCCATTAGGCCCAATAConserved hypothetical protein. 
AK099378GGACGGCCCATTAGGCCCAATANONE 
J033026H10GGACGGCCCATTAGGCCCAATANONE 
J033067O18GGACGGCCCATTAGGCCCAATANONE 
J033108A17GGACGGCCCATTAGGCCCAATANONE 
J065015J11GGACGGCCCATTAGGCCCAATANONE 
J065204P09GGACGGCCCATTAGGCCCAATANONE 
Os01g0175100AK071289GACGGCCCGKv1.4 voltage-gated K+ channel family protein. 
J023088B10GACGGCCCGNONE 
J065122H15GACGGCCCGNONE 
J065140B19GACGGCCCGNONE 
J100031E12GACGGCCCGNONE 
J100068J03GACGGCCCGNONE 
J100083E12GACGGCCCGNONE 
Os01g0192550J065164G16GACGGCCCACGGConserved hypothetical protein. 
Os01g0258600J075028F17GACGGCCCAGGCCCACGGCCCACANONE 
J075061L04GACGGCCCAGGCCCACGGCCCACAConserved hypothetical protein. 
J075071B09GACGGCCCAGGCCCACGGCCCACANONE 
J075093E04GACGGCCCAGGCCCACGGCCCACANONE 
J100033B11GACGGCCCAGGCCCACGGCCCACANONE 
Os01g0316800009-188-E08GACGGCCCATTTNONE 
AK058821GACGGCCCATTTNONE 
AK119788GACGGCCCATTTSimilar to 26 proteasome complex subunit DSS1 (Deleted in split hand/split foot protein 1) (Split hand/foot deleted protein 1). 
J065098A09GACGGCCCATTTNONE 
J065102J21GACGGCCCATTTNONE 
J065173M10GACGGCCCATTTNONE 
J075066K08GACGGCCCATTTNONE 
J080302B04GACGGCCCATTTNONE 
J080310P14GACGGCCCATTTNONE 
J080311I23GACGGCCCATTTNONE 
J080319N12GACGGCCCATTTNONE 
J100024D14GACGGCCCATTTNONE 
J100055N12GACGGCCCATTTNONE 
Os01g0621700AK108938GACGGCCCAACCMyosin tail 2 domain containing protein. 
J100033P13GACGGCCCAACCNONE 
Os01g0657000AK108727GGGCCGTCCProtein of unknown function DUF1070 family protein. 
Os01g0686800006-098-B12GGACGGCCCAAATNONE 
006-113-H04GGACGGCCCAAATNONE 
AK060428GGACGGCCCAAATNONE 
AK098877GGACGGCCCAAATNONE 
AK098893GGACGGCCCAAATNONE 
AK121587GGACGGCCCAAATGuanine nucleotide-binding protein beta subunit-like protein (GPB-LR) (RWD). 
D38231GGACGGCCCAAATNONE 
J013001E12GGACGGCCCAAATNONE 
J013001N15GGACGGCCCAAATNONE 
J013098G22GGACGGCCCAAATNONE 
J023004P15GGACGGCCCAAATNONE 
J023014D09GGACGGCCCAAATNONE 
J023020G09GGACGGCCCAAATNONE 
J023034A19GGACGGCCCAAATNONE 
J023050I11GGACGGCCCAAATNONE 
J023079D13GGACGGCCCAAATNONE 
J023091B11GGACGGCCCAAATNONE 
J023099M03GGACGGCCCAAATNONE 
J023101H20GGACGGCCCAAATNONE 
J023106P14GGACGGCCCAAATNONE 
J023111F19GGACGGCCCAAATNONE 
J023132C22GGACGGCCCAAATNONE 
J023139O03GGACGGCCCAAATNONE 
J023146O10GGACGGCCCAAATNONE 
J033022G16GGACGGCCCAAATNONE 
J033030C10GGACGGCCCAAATNONE 
J033032G18GGACGGCCCAAATNONE 
J033034N09GGACGGCCCAAATNONE 
J033037K24GGACGGCCCAAATNONE 
J033038B22GGACGGCCCAAATNONE 
J033061E06GGACGGCCCAAATNONE 
J033065F08GGACGGCCCAAATNONE 
J033065I24GGACGGCCCAAATNONE 
J033069L01GGACGGCCCAAATNONE 
J033086N21GGACGGCCCAAATNONE 
J033102I06GGACGGCCCAAATNONE 
J033111N07GGACGGCCCAAATNONE 
J033118K11GGACGGCCCAAATNONE 
J033125D08GGACGGCCCAAATNONE 
J033129P22GGACGGCCCAAATNONE 
J033131L12GGACGGCCCAAATNONE 
J033139D08GGACGGCCCAAATNONE 
J033141J08GGACGGCCCAAATNONE 
J043024B14GGACGGCCCAAATNONE 
J053048G19GGACGGCCCAAATNONE 
J065023B15GGACGGCCCAAATNONE 
J065082C15GGACGGCCCAAATNONE 
J065087D24GGACGGCCCAAATNONE 
J065122D11GGACGGCCCAAATNONE 
J065128P13GGACGGCCCAAATNONE 
J065149I19GGACGGCCCAAATNONE 
J065154E16GGACGGCCCAAATNONE 
J065156K21GGACGGCCCAAATNONE 
J065166H09GGACGGCCCAAATNONE 
J065169F24GGACGGCCCAAATNONE 
J065194I16GGACGGCCCAAATNONE 
J065213M20GGACGGCCCAAATNONE 
J075020F19GGACGGCCCAAATNONE 
J075051J16GGACGGCCCAAATNONE 
J075093C18GGACGGCCCAAATNONE 
J075119H02GGACGGCCCAAATNONE 
J075120J11GGACGGCCCAAATNONE 
J075173A15GGACGGCCCAAATNONE 
J080302B05GGACGGCCCAAATNONE 
J080304G10GGACGGCCCAAATNONE 
J080305E13GGACGGCCCAAATNONE 
J080315L11GGACGGCCCAAATNONE 
J090005H15GGACGGCCCAAATNONE 
J090021C24GGACGGCCCAAATNONE 
J090025H24GGACGGCCCAAATNONE 
J090025M11GGACGGCCCAAATNONE 
J090026C22GGACGGCCCAAATNONE 
J090027H15GGACGGCCCAAATNONE 
J090034B17GGACGGCCCAAATNONE 
J090045G11GGACGGCCCAAATNONE 
J090048H02GGACGGCCCAAATNONE 
J090051N04GGACGGCCCAAATNONE 
J090052I06GGACGGCCCAAATNONE 
J090054L17GGACGGCCCAAATNONE 
J090060M22GGACGGCCCAAATNONE 
J090075N17GGACGGCCCAAATNONE 
J090079K13GGACGGCCCAAATNONE 
J090086H08GGACGGCCCAAATNONE 
J090094N20GGACGGCCCAAATNONE 
J100021F03GGACGGCCCAAATNONE 
J100031M01GGACGGCCCAAATNONE 
J100033I18GGACGGCCCAAATNONE 
J100034P07GGACGGCCCAAATNONE 
J100043M16GGACGGCCCAAATNONE 
J100046J12GGACGGCCCAAATNONE 
J100055F09GGACGGCCCAAATNONE 
J100057D19GGACGGCCCAAATNONE 
J100060O10GGACGGCCCAAATNONE 
J100064G09GGACGGCCCAAATNONE 
J100077F24GGACGGCCCAAATNONE 
J100080E12GGACGGCCCAAATNONE 
J100089J04GGACGGCCCAAATNONE 
Os01g0730300AK101207GTCAGTGGGCCGTCCHAD-superfamily hydrolase subfamily IIB protein. 
AK109542GTCAGTGGGCCGTCCNONE 
Os01g0764000006-021-G03GACGGCCCACCCACCAACNONE 
006-025-C07GACGGCCCACCCACCAACNONE 
006-029-G11GACGGCCCACCCACCAACNONE 
006-030-C04GACGGCCCACCCACCAACNONE 
006-035-E05GACGGCCCACCCACCAACNONE 
006-037-G01GACGGCCCACCCACCAACNONE 
006-038-C01GACGGCCCACCCACCAACNONE 
006-039-G05GACGGCCCACCCACCAACNONE 
006-042-E11GACGGCCCACCCACCAACNONE 
006-044-H04GACGGCCCACCCACCAACNONE 
006-045-A10GACGGCCCACCCACCAACNONE 
006-045-C05GACGGCCCACCCACCAACNONE 
006-047-A11GACGGCCCACCCACCAACNONE 
006-048-H10GACGGCCCACCCACCAACNONE 
006-050-C01GACGGCCCACCCACCAACNONE 
006-050-H11GACGGCCCACCCACCAACNONE 
006-051-G10GACGGCCCACCCACCAACNONE 
006-051-G11GACGGCCCACCCACCAACNONE 
006-056-B04GACGGCCCACCCACCAACNONE 
006-063-F04GACGGCCCACCCACCAACNONE 
006-063-H12GACGGCCCACCCACCAACNONE 
006-065-G09GACGGCCCACCCACCAACNONE 
006-067-F11GACGGCCCACCCACCAACNONE 
006-073-D10GACGGCCCACCCACCAACNONE 
006-074-G09GACGGCCCACCCACCAACNONE 
006-075-D04GACGGCCCACCCACCAACNONE 
006-077-C10GACGGCCCACCCACCAACNONE 
006-082-A10GACGGCCCACCCACCAACNONE 
006-084-C12GACGGCCCACCCACCAACNONE 
006-085-F05GACGGCCCACCCACCAACNONE 
006-087-H12GACGGCCCACCCACCAACNONE 
006-092-E10GACGGCCCACCCACCAACNONE 
006-094-C06GACGGCCCACCCACCAACNONE 
006-096-G11GACGGCCCACCCACCAACNONE 
006-097-H11GACGGCCCACCCACCAACNONE 
006-101-A07GACGGCCCACCCACCAACNONE 
006-101-G08GACGGCCCACCCACCAACNONE 
006-110-E08GACGGCCCACCCACCAACNONE 
006-111-D04GACGGCCCACCCACCAACNONE 
006-116-H04GACGGCCCACCCACCAACNONE 
AK058894GACGGCCCACCCACCAACNONE 
AK059818GACGGCCCACCCACCAACSimilar to Glutathione S-transferase I (EC 2.5.1.18) (GST-I) (GST-29) (GST class- phi). 
AK099142GACGGCCCACCCACCAACNONE 
J013119N15GACGGCCCACCCACCAACNONE 
J013123P15GACGGCCCACCCACCAACNONE 
J023055F24GACGGCCCACCCACCAACNONE 
J023125K17GACGGCCCACCCACCAACNONE 
J053050A20GACGGCCCACCCACCAACNONE 
J053056P10GACGGCCCACCCACCAACNONE 
J053074D19GACGGCCCACCCACCAACNONE 
J053078A14GACGGCCCACCCACCAACNONE 
J053086P10GACGGCCCACCCACCAACNONE 
J053094N23GACGGCCCACCCACCAACNONE 
J053095M23GACGGCCCACCCACCAACNONE 
J065006D02GACGGCCCACCCACCAACNONE 
J065030A17GACGGCCCACCCACCAACNONE 
J065030K04GACGGCCCACCCACCAACNONE 
J065035L12GACGGCCCACCCACCAACNONE 
J065046E12GACGGCCCACCCACCAACNONE 
J065065H19GACGGCCCACCCACCAACNONE 
J065073C01GACGGCCCACCCACCAACNONE 
J065105F01GACGGCCCACCCACCAACNONE 
J065131N16GACGGCCCACCCACCAACNONE 
J065144O13GACGGCCCACCCACCAACNONE 
J065160E12GACGGCCCACCCACCAACNONE 
J065160K02GACGGCCCACCCACCAACNONE 
J065163F09GACGGCCCACCCACCAACNONE 
J065165E18GACGGCCCACCCACCAACNONE 
J065174E04GACGGCCCACCCACCAACNONE 
J065175O08GACGGCCCACCCACCAACNONE 
J065191N24GACGGCCCACCCACCAACNONE 
J065193D19GACGGCCCACCCACCAACNONE 
J065198D04GACGGCCCACCCACCAACNONE 
J065200G09GACGGCCCACCCACCAACNONE 
J075016L06GACGGCCCACCCACCAACNONE 
J075017J11GACGGCCCACCCACCAACNONE 
J075019L08GACGGCCCACCCACCAACNONE 
J075028M08GACGGCCCACCCACCAACNONE 
J075029K05GACGGCCCACCCACCAACNONE 
J075039K04GACGGCCCACCCACCAACNONE 
J075047J22GACGGCCCACCCACCAACNONE 
J075079H13GACGGCCCACCCACCAACNONE 
J075095K14GACGGCCCACCCACCAACNONE 
J075111D21GACGGCCCACCCACCAACNONE 
J075131A19GACGGCCCACCCACCAACNONE 
J075147G20GACGGCCCACCCACCAACNONE 
J075158F11GACGGCCCACCCACCAACNONE 
J075166N10GACGGCCCACCCACCAACNONE 
J075196G09GACGGCCCACCCACCAACNONE 
J075198I24GACGGCCCACCCACCAACNONE 
J090001L08GACGGCCCACCCACCAACNONE 
J090026G07GACGGCCCACCCACCAACNONE 
J090050M15GACGGCCCACCCACCAACNONE 
J090071A01GACGGCCCACCCACCAACNONE 
J090072P16GACGGCCCACCCACCAACNONE 
J090078D22GACGGCCCACCCACCAACNONE 
J090089C18GACGGCCCACCCACCAACNONE 
J100019B07GACGGCCCACCCACCAACNONE 
J100019H15GACGGCCCACCCACCAACNONE 
J100019P09GACGGCCCACCCACCAACNONE 
J100023A16GACGGCCCACCCACCAACNONE 
J100023B09GACGGCCCACCCACCAACNONE 
J100026O18GACGGCCCACCCACCAACNONE 
J100027E09GACGGCCCACCCACCAACNONE 
J100028F22GACGGCCCACCCACCAACNONE 
J100029P05GACGGCCCACCCACCAACNONE 
J100031M19GACGGCCCACCCACCAACNONE 
J100032A11GACGGCCCACCCACCAACNONE 
J100036G19GACGGCCCACCCACCAACNONE 
J100038E22GACGGCCCACCCACCAACNONE 
J100040A12GACGGCCCACCCACCAACNONE 
J100040L02GACGGCCCACCCACCAACNONE 
J100043O13GACGGCCCACCCACCAACNONE 
J100045E20GACGGCCCACCCACCAACNONE 
J100046H18GACGGCCCACCCACCAACNONE 
J100047E08GACGGCCCACCCACCAACNONE 
J100050E08GACGGCCCACCCACCAACNONE 
J100050P14GACGGCCCACCCACCAACNONE 
J100051G10GACGGCCCACCCACCAACNONE 
J100052L12GACGGCCCACCCACCAACNONE 
J100056G24GACGGCCCACCCACCAACNONE 
J100066B15GACGGCCCACCCACCAACNONE 
J100068O15GACGGCCCACCCACCAACNONE 
J100070J16GACGGCCCACCCACCAACNONE 
J100074I22GACGGCCCACCCACCAACNONE 
J100075M12GACGGCCCACCCACCAACNONE 
J100077M09GACGGCCCACCCACCAACNONE 
J100077O14GACGGCCCACCCACCAACNONE 
J100079J08GACGGCCCACCCACCAACNONE 
J100080I16GACGGCCCACCCACCAACNONE 
Os01g0807000AK109751GACGGCCCAGAConserved hypothetical protein. 
AK109751GGGCCGTCConserved hypothetical protein. 
Os01g0810000AK102143ATATGGGCCGTCAGGCCCAATTNONE 
AK120752ATATGGGCCGTCAGGCCCAATTUtp11 family protein. 
J023006E09ATATGGGCCGTCAGGCCCAATTNONE 
J033086A13ATATGGGCCGTCAGGCCCAATTNONE 
J033133K07ATATGGGCCGTCAGGCCCAATTNONE 
J065066L16ATATGGGCCGTCAGGCCCAATTNONE 
J065161C01ATATGGGCCGTCAGGCCCAATTNONE 
J100027D18ATATGGGCCGTCAGGCCCAATTNONE 
J100063J12ATATGGGCCGTCAGGCCCAATTNONE 
Os01g0841000009-005-A12ATCTGGGCCGTCCNONE 
AK059601ATCTGGGCCGTCCENTH/VHS domain containing protein. 
AK103342ATCTGGGCCGTCCNONE 
J023022C02ATCTGGGCCGTCCNONE 
J023030C09ATCTGGGCCGTCCNONE 
J033075D24ATCTGGGCCGTCCNONE 
J033123O16ATCTGGGCCGTCCNONE 
J033126C16ATCTGGGCCGTCCNONE 
J065120M23ATCTGGGCCGTCCNONE 
J065190I23ATCTGGGCCGTCCNONE 
J090090G01ATCTGGGCCGTCCNONE 
Os01g0844800AK099801ATCTGGGCCGTCSimilar to Pumilio RBD (Fragment). 
AK102882ATCTGGGCCGTCNONE 
AK103686ATCTGGGCCGTCNONE 
Os01g0856900AK107570CGGACGGCCCGGTGlycoside hydrolase, starch-binding domain containing protein. 
J065081B03CGGACGGCCCGGTNONE 
J075028J03CGGACGGCCCGGTNONE 
J075052C05CGGACGGCCCGGTNONE 
J075199J04CGGACGGCCCGGTNONE 
J090052L20CGGACGGCCCGGTNONE 
J090075L24CGGACGGCCCGGTNONE 
Os01g0858900AK107493GACGGCCCCACCTGTCGlycosyl transferase, family 29 protein. 
J065097H23GACGGCCCCACCTGTCNONE 
J100070A02GACGGCCCCACCTGTCNONE 
J100072M10GACGGCCCCACCTGTCNONE 
Os01g0865600AK068033GGTGGGCCGTCNONE 
AK099677GGTGGGCCGTCBasic helix-loop-helix dimerisation region bHLH domain containing protein. 
J090007G21GGTGGGCCGTCNONE 
J090023C20GGTGGGCCGTCNONE 
J090039J16GGTGGGCCGTCNONE 
J090054K15GGTGGGCCGTCNONE 
Os01g0867300AK067919AATGGGCCGTCCGTCCGTCCSimilar to OSE2-like protein (Fragment). 
J013123H12AATGGGCCGTCCGTCCGTCCNONE 
J033046C11AATGGGCCGTCCGTCCGTCCNONE 
J033051I17AATGGGCCGTCCGTCCGTCCNONE 
U25283AATGGGCCGTCCGTCCGTCCNONE 
Os01g0867600AK102226CGGACGGCCCAGATSimilar to UDP-glucose:sterol glucosyltransferase (EC 2.4.1.173). 
Os01g0937300AK062872AGGTGGGCCGTCNONE 
J033136K12AGGTGGGCCGTCNONE 
J053048E20AGGTGGGCCGTCNONE 
J053088K08AGGTGGGCCGTCNONE 
J065011G23AGGTGGGCCGTCNONE 
J065202J09AGGTGGGCCGTCNONE 
Os01g0938900006-059-H02GACGGCCCAGCCCATTTNONE 
009-074-D12GACGGCCCAGCCCATTTNONE 
AK059437GACGGCCCAGCCCATTTNONE 
AK101971GACGGCCCAGCCCATTTSimilar to Nascent polypeptide-associated complex alpha subunit-like protein 3 (NAC-alpha-like protein 3) (Alpha-NAC-like protein 3). 
AK109341GACGGCCCAGCCCATTTNONE 
J023121P08GACGGCCCAGCCCATTTNONE 
J033046G24GACGGCCCAGCCCATTTNONE 
J033048E04GACGGCCCAGCCCATTTNONE 
J033048F04GACGGCCCAGCCCATTTNONE 
J033076L24GACGGCCCAGCCCATTTNONE 
J065173H07GACGGCCCAGCCCATTTNONE 
J065184H09GACGGCCCAGCCCATTTNONE 
Os01g0949200AK102412CGGACGGCCCACCANONE 
J033093A04CGGACGGCCCACCANONE 
J065053P06CGGACGGCCCACCANONE 
J100086D18CGGACGGCCCACCANONE 
Os01g0954400003-009-F12CGGGCCGTCNONE 
012-080-B09CGGGCCGTCNONE 
AK065709CGGGCCGTCSimilar to Hydroxyproline-rich glycoprotein DZ-HRGP precursor. 
AK104335CGGGCCGTCNONE 
J013039J02CGGGCCGTCNONE 
J033081E17CGGGCCGTCNONE 
J075058B02CGGGCCGTCNONE 
J075067K19CGGGCCGTCNONE 
J075120E23CGGGCCGTCNONE 
J075147I16CGGGCCGTCNONE 
Os01g0971900AK067739ATCCGACGGCCCAGASimilar to BPM. 
Os02g0119400AK060055GACGGCCCATATNONE 
AK102774GACGGCCCATATSimilar to Syntaxin 52 (AtSYP52). 
J033107H09GACGGCCCATATNONE 
J075175F09GACGGCCCATATNONE 
J090011H05GACGGCCCATATNONE 
J090091O05GACGGCCCATATNONE 
Os02g0121100012-035-F06CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
013-031-H05CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
013-058-E11CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
014-010-D01CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
AK070711CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGConserved hypothetical protein. 
AK119758CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J013033G12CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J023007M16CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J023020K20CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J023061H10CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J033027H20CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J033051E18CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J090005F12CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J090017A20CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J090018G11CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J090062C18CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100027N10CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100032L14CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100045C14CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100061M09CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100062K11CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100064H11CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100074H16CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
J100082N01CTCGCGCGGGGCCCATCCCCACTGACAGCTGGGCCGTCAGCCCACACGNONE 
Os02g0148600AK059287GACGGCCCAGAConserved hypothetical protein. 
Os02g0162500009-181-F03CCTGGGCCGTCNONE 
AK058907CCTGGGCCGTCNONE 
AK121223CCTGGGCCGTCSimilar to 40S ribosomal protein S14. 
J023090I10CCTGGGCCGTCNONE 
J023136J11CCTGGGCCGTCNONE 
J053097J20CCTGGGCCGTCNONE 
J053098F01CCTGGGCCGTCNONE 
J065065B09CCTGGGCCGTCNONE 
J065082M04CCTGGGCCGTCNONE 
J065188O05CCTGGGCCGTCNONE 
J075057P15CCTGGGCCGTCNONE 
J075061J08CCTGGGCCGTCNONE 
J075061N15CCTGGGCCGTCNONE 
J075131I08CCTGGGCCGTCNONE 
J075141H13CCTGGGCCGTCNONE 
J080062E14CCTGGGCCGTCNONE 
J080062P15CCTGGGCCGTCNONE 
J080318G17CCTGGGCCGTCNONE 
J080319G19CCTGGGCCGTCNONE 
J090001L10CCTGGGCCGTCNONE 
J090024I18CCTGGGCCGTCNONE 
J090033F24CCTGGGCCGTCNONE 
J090036M16CCTGGGCCGTCNONE 
J090040I24CCTGGGCCGTCNONE 
J090048P06CCTGGGCCGTCNONE 
J090049B12CCTGGGCCGTCNONE 
J090068C02CCTGGGCCGTCNONE 
J090069O04CCTGGGCCGTCNONE 
J090084H22CCTGGGCCGTCNONE 
J100022L03CCTGGGCCGTCNONE 
J100028O14CCTGGGCCGTCNONE 
J100028O18CCTGGGCCGTCNONE 
J100032A15CCTGGGCCGTCNONE 
J100033D21CCTGGGCCGTCNONE 
J100034J23CCTGGGCCGTCNONE 
J100043K22CCTGGGCCGTCNONE 
J100052M22CCTGGGCCGTCNONE 
J100053N03CCTGGGCCGTCNONE 
J100074N24CCTGGGCCGTCNONE 
J100082J10CCTGGGCCGTCNONE 
Os02g0192700004-020-H12CCTGGGCCGTCNONE 
006-024-H06CCTGGGCCGTCNONE 
006-042-F06CCTGGGCCGTCNONE 
006-050-D04CCTGGGCCGTCNONE 
006-059-E10CCTGGGCCGTCNONE 
006-070-B02CCTGGGCCGTCNONE 
006-084-A09CCTGGGCCGTCNONE 
006-114-E11CCTGGGCCGTCNONE 
006-117-E05CCTGGGCCGTCNONE 
009-126-D11CCTGGGCCGTCNONE 
AK061629CCTGGGCCGTCSimilar to Thioredoxin peroxidase. 
AK065909CCTGGGCCGTCNONE 
J013043E11CCTGGGCCGTCNONE 
J065038I09CCTGGGCCGTCNONE 
J065078C12CCTGGGCCGTCNONE 
J065122O14CCTGGGCCGTCNONE 
J065198H04CCTGGGCCGTCNONE 
Os02g0219900004-018-E11ATCGGACGGCCCACGTNONE 
AK060915ATCGGACGGCCCACGTNONE 
AK099194ATCGGACGGCCCACGTNONE 
AK104206ATCGGACGGCCCACGTNONE 
AK104393ATCGGACGGCCCACGTSimilar to Epstein-Barr nuclear antigen-1 (EBNA-1). 
J023109D07ATCGGACGGCCCACGTNONE 
Os02g0230200AK105482GACGGCCCATTTConserved hypothetical protein. 
Os02g0250600J075143F23AGTTGGGCCGTCLate embryogenesis abundant protein repeat containing protein. 
Os02g0478700AK099723GACGGCCCAGATRibosomal protein S27. 
J013089A06GACGGCCCAGATNONE 
J065068E01GACGGCCCAGATNONE 
J065217F15GACGGCCCAGATNONE 
Os02g0555000015-020-G02TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
AK065270TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
AK121253TGTGGGCTCTGGGCCGTGGGCCGTCProtein of unknown function, ATP binding family protein. 
J013002L01TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
J023060A02TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
J023101O11TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
J023140A15TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
J033042H19TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
J033046C02TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
J033080N19TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
J065026I02TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
J065040C18TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
J090004I16TGTGGGCTCTGGGCCGTGGGCCGTCNONE 
Os02g0601800AB060276GACGGCCCGGATCCGACCCGCNONE 
AK099539GACGGCCCGGATCCGACCCGCNONE 
AK101873GACGGCCCGGATCCGACCCGCBromodomain containing protein. 
AK106801GACGGCCCGGATCCGACCCGCNONE 
AK121758GACGGCCCGGATCCGACCCGCNONE 
AK121891GACGGCCCGGATCCGACCCGCNONE 
J013059H01GACGGCCCGGATCCGACCCGCNONE 
J013092F08GACGGCCCGGATCCGACCCGCNONE 
J013146J04GACGGCCCGGATCCGACCCGCNONE 
J023001K12GACGGCCCGGATCCGACCCGCNONE 
J023002H16GACGGCCCGGATCCGACCCGCNONE 
J023013B10GACGGCCCGGATCCGACCCGCNONE 
J023081I22GACGGCCCGGATCCGACCCGCNONE 
J023084K19GACGGCCCGGATCCGACCCGCNONE 
J023150E24GACGGCCCGGATCCGACCCGCNONE 
J033023B18GACGGCCCGGATCCGACCCGCNONE 
J033025F18GACGGCCCGGATCCGACCCGCNONE 
J033048P08GACGGCCCGGATCCGACCCGCNONE 
J033060M24GACGGCCCGGATCCGACCCGCNONE 
J033070G06GACGGCCCGGATCCGACCCGCNONE 
J033088P12GACGGCCCGGATCCGACCCGCNONE 
J033105C13GACGGCCCGGATCCGACCCGCNONE 
J043009N18GACGGCCCGGATCCGACCCGCNONE 
J065103G21GACGGCCCGGATCCGACCCGCNONE 
J075039H15GACGGCCCGGATCCGACCCGCNONE 
J090014K10GACGGCCCGGATCCGACCCGCNONE 
J090022N02GACGGCCCGGATCCGACCCGCNONE 
J090033F18GACGGCCCGGATCCGACCCGCNONE 
J090033I04GACGGCCCGGATCCGACCCGCNONE 
J090041F11GACGGCCCGGATCCGACCCGCNONE 
J090045P20GACGGCCCGGATCCGACCCGCNONE 
J090054B01GACGGCCCGGATCCGACCCGCNONE 
J090055M12GACGGCCCGGATCCGACCCGCNONE 
J090071K09GACGGCCCGGATCCGACCCGCNONE 
J090098O16GACGGCCCGGATCCGACCCGCNONE 
J090099P15GACGGCCCGGATCCGACCCGCNONE 
J100050I16GACGGCCCGGATCCGACCCGCNONE 
Os02g0605600016-017-B02GATCCGACGGCCCGNONE 
AK066104GATCCGACGGCCCGLUC7 related family protein. 
J013052G16GATCCGACGGCCCGNONE 
J043022E03GATCCGACGGCCCGNONE 
J065105P10GATCCGACGGCCCGNONE 
Os02g0608500AK071922GACGGCCCCACCCGNONE 
AK099756GACGGCCCCACCCGSimilar to Ankyrin-kinase protein (Fragment). 
Os02g0644000AB081464GTGGCGTGGGCCGTCGGATCNONE 
AK101360GTGGCGTGGGCCGTCGGATCNONE 
AY062178GTGGCGTGGGCCGTCGGATCNONE 
J023043E22GTGGCGTGGGCCGTCGGATCNONE 
J033024F05GTGGCGTGGGCCGTCGGATCNONE 
J033035H01GTGGCGTGGGCCGTCGGATCNONE 
J033042J19GTGGCGTGGGCCGTCGGATCNONE 
J033057G18GTGGCGTGGGCCGTCGGATCNONE 
J033111F09GTGGCGTGGGCCGTCGGATCNONE 
J033115L11GTGGCGTGGGCCGTCGGATCNONE 
J033143I16GTGGCGTGGGCCGTCGGATCNONE 
J033143M21GTGGCGTGGGCCGTCGGATCNONE 
J075072B10GTGGCGTGGGCCGTCGGATCNONE 
J075072L04GTGGCGTGGGCCGTCGGATCNONE 
J075088F01GTGGCGTGGGCCGTCGGATCNONE 
J075196H23GTGGCGTGGGCCGTCGGATCNONE 
Os02g0679700AK108178GACGGCCCGGGProtein of unknown function DUF623, plant domain containing protein. 
J075112F23GACGGCCCGGGNONE 
Os02g0709300009-054-A02CGGGCCGTCNONE 
AK109446CGGGCCGTCConserved hypothetical protein. 
Os02g0751300J033055P08CGGACGGCCCAGATProtein of unknown function DUF581 family protein. 
Os02g0776800AB042415GACGGCCCATCANONE 
AK072308GACGGCCCATCAReplication protein A 70kDa. 
AK101212GACGGCCCATCANONE 
J033031B02GACGGCCCATCANONE 
J090004E18GACGGCCCATCANONE 
J090084C24GACGGCCCATCANONE 
Os02g0791800AK066282TACTGGGCCGTCCNONE 
AK099697TACTGGGCCGTCCWD-40 repeat containing protein. 
AY445625TACTGGGCCGTCCNONE 
J053065H07TACTGGGCCGTCCNONE 
J065108P05TACTGGGCCGTCCNONE 
J065154P22TACTGGGCCGTCCNONE 
J100037P04TACTGGGCCGTCCNONE 
J100068K05TACTGGGCCGTCCNONE 
Os02g0827600AK068455TCCGACGGCCCACCTGConserved hypothetical protein. 
Os03g0115200009-112-E09TCGGACGGCCCATGNONE 
AK071287TCGGACGGCCCATGSimilar to Partner of Nob1; Pno1p; Yor145cp like KH domain containing protein, transcripts identified by EST. 
J023088J06TCGGACGGCCCATGNONE 
J065075D17TCGGACGGCCCATGNONE 
J065108G15TCGGACGGCCCATGNONE 
J065165A16TCGGACGGCCCATGNONE 
J075015O12TCGGACGGCCCATGNONE 
J075022O06TCGGACGGCCCATGNONE 
J075031H14TCGGACGGCCCATGNONE 
J075033D10TCGGACGGCCCATGNONE 
J075070A04TCGGACGGCCCATGNONE 
J075127A05TCGGACGGCCCATGNONE 
J100070B16TCGGACGGCCCATGNONE 
Os03g0145600015-010-B10CGGACGGCCCATCTNONE 
AK106243CGGACGGCCCATCTQuinonprotein alcohol dehydrogenase-like domain containing protein. 
Os03g0145900J013045K15GACGGCCCGNONE 
J013051O08GACGGCCCGNONE 
J065054C08GACGGCCCGNONE 
J075053J16GACGGCCCGNONE 
Os03g0168200AK099530GGACGGCCCGGTConserved hypothetical protein. 
Os03g0187700009-155-F05CCGTGGGCCGTCCGATCNONE 
J033140E21CCGTGGGCCGTCCGATCNONE 
J033142E21CCGTGGGCCGTCCGATCNONE 
J065014P17CCGTGGGCCGTCCGATCNONE 
J065083L20CCGTGGGCCGTCCGATCNONE 
J065092E08CCGTGGGCCGTCCGATCNONE 
J065154C08CCGTGGGCCGTCCGATCTarget SNARE coiled-coil region domain containing protein. 
J075142H08CCGTGGGCCGTCCGATCNONE 
J075175K21CCGTGGGCCGTCCGATCNONE 
J090070B20CCGTGGGCCGTCCGATCNONE 
J100071M06CCGTGGGCCGTCCGATCNONE 
Os03g0197000AK071163GGACGGCCCATCGConserved hypothetical protein. 
J023079A07GGACGGCCCATCGNONE 
Os03g0200500005-016-A06AGTGGGCCGTCCNONE 
AK069251AGTGGGCCGTCC40S ribosomal protein S3a (CYC07 protein). 
AK104243AGTGGGCCGTCCNONE 
AK104699AGTGGGCCGTCCNONE 
D26060AGTGGGCCGTCCNONE 
J013024H20AGTGGGCCGTCCNONE 
J013029C14AGTGGGCCGTCCNONE 
J013035O17AGTGGGCCGTCCNONE 
J013066B11AGTGGGCCGTCCNONE 
J013066B12AGTGGGCCGTCCNONE 
J013066B13AGTGGGCCGTCCNONE 
J013152M04AGTGGGCCGTCCNONE 
J023001A03AGTGGGCCGTCCNONE 
J023013H23AGTGGGCCGTCCNONE 
J023042L07AGTGGGCCGTCCNONE 
J023081L11AGTGGGCCGTCCNONE 
J023088I23AGTGGGCCGTCCNONE 
J023092N22AGTGGGCCGTCCNONE 
J023126A20AGTGGGCCGTCCNONE 
J023139A17AGTGGGCCGTCCNONE 
J023150G12AGTGGGCCGTCCNONE 
J033026M10AGTGGGCCGTCCNONE 
J033031H24AGTGGGCCGTCCNONE 
J033036C22AGTGGGCCGTCCNONE 
J033037P08AGTGGGCCGTCCNONE 
J033045G14AGTGGGCCGTCCNONE 
J033048A13AGTGGGCCGTCCNONE 
J033048B13AGTGGGCCGTCCNONE 
J033048K11AGTGGGCCGTCCNONE 
J033066A06AGTGGGCCGTCCNONE 
J033072H01AGTGGGCCGTCCNONE 
J033082K07AGTGGGCCGTCCNONE 
J033091G20AGTGGGCCGTCCNONE 
J033095C14AGTGGGCCGTCCNONE 
J033101N24AGTGGGCCGTCCNONE 
J033105L15AGTGGGCCGTCCNONE 
J033107J18AGTGGGCCGTCCNONE 
J033112L02AGTGGGCCGTCCNONE 
J033117I17AGTGGGCCGTCCNONE 
J043003K06AGTGGGCCGTCCNONE 
J043016I20AGTGGGCCGTCCNONE 
J043021A10AGTGGGCCGTCCNONE 
J043034F14AGTGGGCCGTCCNONE 
J065002O17AGTGGGCCGTCCNONE 
J065014B14AGTGGGCCGTCCNONE 
J065054N19AGTGGGCCGTCCNONE 
J065112P18AGTGGGCCGTCCNONE 
J065121B20AGTGGGCCGTCCNONE 
J065170M08AGTGGGCCGTCCNONE 
J065194B05AGTGGGCCGTCCNONE 
J090040F01AGTGGGCCGTCCNONE 
J090078O20AGTGGGCCGTCCNONE 
J090078P21AGTGGGCCGTCCNONE 
J090084E11AGTGGGCCGTCCNONE 
J100080B11AGTGGGCCGTCCNONE 
Os03g0205500Os03g0205500CGGGCCGTCCCytochrome b5 domain containing protein. 
Os03g0219400AK100702ACATGGGCCGTCGlycoside hydrolase, family 20 protein. 
AK121985ACATGGGCCGTCNONE 
J023114O06ACATGGGCCGTCNONE 
J100043M20ACATGGGCCGTCNONE 
Os03g0307900AK072469GACGGCCCConserved hypothetical protein. 
Os03g0312300AK111364GACGGCCCGGCProtein of unknown function DUF26 domain containing protein. 
Os03g0321000AK103653GGGCCGTCCSimilar to Steroid membrane binding protein-like. 
Os03g0337800AK059309TGATGGGCCGACGGCCCAGCCCAGCCSimilar to 60S ribosomal protein L19 (Fragment). 
AK102721TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J023146K24TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J033069H01TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J033105G07TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065009B17TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065010F02TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065068A06TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065085M23TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065095H02TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065118O17TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065121I06TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065138J02TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065143L09TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065146P12TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065169D03TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065181E03TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065184C13TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065188D08TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J065188O16TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J075066J20TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J075081E13TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J075175B07TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J080301E05TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J080302B07TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J080316P06TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J080319C09TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J090038K21TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J090046J05TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J090098B03TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J100039N19TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J100041E17TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J100081L04TGATGGGCCGACGGCCCAGCCCAGCCNONE 
J100089N15TGATGGGCCGACGGCCCAGCCCAGCCNONE 
Os03g0387100AB026559ATCGGACGGCCCACGTGNONE 
AF022735ATCGGACGGCCCACGTGNONE 
AK058567ATCGGACGGCCCACGTGProteasome subunit alpha type 2 (EC 3.4.25.1) (20S proteasome alpha subunit B) (20S proteasome subunit alpha-2). 
AK101195ATCGGACGGCCCACGTGNONE 
J033030J15ATCGGACGGCCCACGTGNONE 
J033102N16ATCGGACGGCCCACGTGNONE 
J065056E08ATCGGACGGCCCACGTGNONE 
J065112M11ATCGGACGGCCCACGTGNONE 
J065170H07ATCGGACGGCCCACGTGNONE 
J075003P17ATCGGACGGCCCACGTGNONE 
J075074D06ATCGGACGGCCCACGTGNONE 
J075127F20ATCGGACGGCCCACGTGNONE 
J075129I01ATCGGACGGCCCACGTGNONE 
J075178A10ATCGGACGGCCCACGTGNONE 
J090071P12ATCGGACGGCCCACGTGNONE 
J100090D18ATCGGACGGCCCACGTGNONE 
Os03g0439800009-197-D03GACGGCCCAGTTNONE 
AK058503GACGGCCCAGTTNONE 
AK066154GACGGCCCAGTTConserved hypothetical protein. 
J065017G24GACGGCCCAGTTNONE 
J090084E18GACGGCCCAGTTNONE 
Os03g0445700AK071624CCGATCCGACGGCCCGSimilar to LOB domain protein 39. 
J023106M18CCGATCCGACGGCCCGNONE 
J065178J05CCGATCCGACGGCCCGNONE 
J065196F10CCGATCCGACGGCCCGNONE 
Os03g0577200006-030-H11ATCCGACGGCCCAGGNONE 
AK061735ATCCGACGGCCCAGGSimilar to Mps one binder kinase activator-like 1A (Mob1 homolog 1A) (Mob1A) (Mob1B) (Protein Mob4A). 
AK098953ATCCGACGGCCCAGGNONE 
AK099558ATCCGACGGCCCAGGNONE 
AK104547ATCCGACGGCCCAGGNONE 
J013034B14ATCCGACGGCCCAGGNONE 
J013066J17ATCCGACGGCCCAGGNONE 
J090033N14ATCCGACGGCCCAGGNONE 
Os03g0612600009-073-H01GACGGCCCAGCNONE 
AK071403GACGGCCCAGCRibosomal protein L25-like domain containing protein. 
Os03g0633800AK073044GATCCGACGGCCCSimilar to IAA6 (Fragment). 
J065038L22GATCCGACGGCCCNONE 
J065185C13GATCCGACGGCCCNONE 
Os03g0647800003-103-H03GACGGCCCATCTNONE 
006-104-G09GACGGCCCATCTNONE 
AK070243GACGGCCCATCTConserved hypothetical protein. 
J100056F22GACGGCCCATCTNONE 
Os03g0656900AK066416GACGGCCCGNusB/RsmB/TIM44 domain containing protein. 
J065157L23GACGGCCCGNONE 
J065166P22GACGGCCCGNONE 
Os03g0684400AK100086GATCGGACGGCCCAGATMg2+ transporter protein, CorA-like family protein. 
Os03g0690000AK062756GATCGGACGGCCCACGCConserved hypothetical protein. 
J080302F19GATCGGACGGCCCACGCNONE 
J080303J23GATCGGACGGCCCACGCNONE 
J080303K16GATCGGACGGCCCACGCNONE 
J080306B15GATCGGACGGCCCACGCNONE 
J080309C02GATCGGACGGCCCACGCNONE 
J080312F13GATCGGACGGCCCACGCNONE 
J080312M04GATCGGACGGCCCACGCNONE 
J080315L20GATCGGACGGCCCACGCNONE 
Os03g0726900AK072553GACGGCCCATTConserved hypothetical protein. 
AK100280GACGGCCCATTNONE 
Os03g0735300AK071715ATCCGACGGCCCAGGAlba, DNA/RNA-binding protein family protein. 
J065100I07ATCCGACGGCCCAGGNONE 
Os03g0746000AK073682GACGGCCCConserved hypothetical protein. 
AK073682GACGGCCCGCAConserved hypothetical protein. 
AK111472GACGGCCCNONE 
AK111472GACGGCCCGCANONE 
J090083F05GACGGCCCNONE 
J090083F05GACGGCCCGCANONE 
Os03g0747300006-120-B12GACGGCCCAGATNONE 
AK060347GACGGCCCAGATNONE 
AK071214GACGGCCCAGATProtein of unknown function DUF124 family protein. 
J023082F22GACGGCCCAGATNONE 
J043034I22GACGGCCCAGATNONE 
J053037D23GACGGCCCAGATNONE 
J053043C01GACGGCCCAGATNONE 
J053083D14GACGGCCCAGATNONE 
J053100J21GACGGCCCAGATNONE 
J065008H11GACGGCCCAGATNONE 
J065024G19GACGGCCCAGATNONE 
J065030G05GACGGCCCAGATNONE 
J065073N07GACGGCCCAGATNONE 
J065101N18GACGGCCCAGATNONE 
J065129O04GACGGCCCAGATNONE 
J065152M14GACGGCCCAGATNONE 
J065161L08GACGGCCCAGATNONE 
J065191G23GACGGCCCAGATNONE 
J090008A11GACGGCCCAGATNONE 
J090047J20GACGGCCCAGATNONE 
J090047J23GACGGCCCAGATNONE 
J090064C23GACGGCCCAGATNONE 
J090087H06GACGGCCCAGATNONE 
J100027M11GACGGCCCAGATNONE 
J100081M15GACGGCCCAGATNONE 
J100084C22GACGGCCCAGATNONE 
J100086C11GACGGCCCAGATNONE 
Os03g0752800AB041020GACGGCCCAAAANONE 
AF058697GACGGCCCAAAAMADS14 protein. 
AF139664GACGGCCCAAAANONE 
AK121171GACGGCCCAAAANONE 
AY332478GACGGCCCAAAANONE 
AY551916GACGGCCCAAAANONE 
J023081C04GACGGCCCAAAANONE 
Os03g0769600AK100054GGGCCGTCResB-like family protein. 
Os03g0793500AK103407GACGGCCCACANONE 
AK121620GACGGCCCACASimilar to Casein kinase-like protein. 
Os03g0797600006-034-B06GGACGGCCCACGTACAGCCCATCAAGGCCCATATNONE 
009-066-A01GGACGGCCCACGTACAGCCCATCAAGGCCCATATNONE 
014-035-H08GGACGGCCCACGTACAGCCCATCAAGGCCCATATNONE 
AK067446GGACGGCCCACGTACAGCCCATCAAGGCCCATATSimilar to Helix-loop-helix protein homolog. 
AK068388GGACGGCCCACGTACAGCCCATCAAGGCCCATATNONE 
AK104412GGACGGCCCACGTACAGCCCATCAAGGCCCATATNONE 
Os03g0807200011-031-F07GTTTGGGCCGGGCCGTCNONE 
AK063932GTTTGGGCCGGGCCGTCNONE 
AK103496GTTTGGGCCGGGCCGTCProtein of unknown function DUF1639 family protein. 
J033131A04GTTTGGGCCGGGCCGTCNONE 
J065109O03GTTTGGGCCGGGCCGTCNONE 
J080001M11GTTTGGGCCGGGCCGTCNONE 
J080002H18GTTTGGGCCGGGCCGTCNONE 
J080005I08GTTTGGGCCGGGCCGTCNONE 
J080006B05GTTTGGGCCGGGCCGTCNONE 
J080006D17GTTTGGGCCGGGCCGTCNONE 
J080007M19GTTTGGGCCGGGCCGTCNONE 
J080011E07GTTTGGGCCGGGCCGTCNONE 
J080012H06GTTTGGGCCGGGCCGTCNONE 
J080014D08GTTTGGGCCGGGCCGTCNONE 
J080017D06GTTTGGGCCGGGCCGTCNONE 
J080017K17GTTTGGGCCGGGCCGTCNONE 
J080020B17GTTTGGGCCGGGCCGTCNONE 
J080021O05GTTTGGGCCGGGCCGTCNONE 
J080021O15GTTTGGGCCGGGCCGTCNONE 
J080023I18GTTTGGGCCGGGCCGTCNONE 
J080025A21GTTTGGGCCGGGCCGTCNONE 
J080027P22GTTTGGGCCGGGCCGTCNONE 
J080028M22GTTTGGGCCGGGCCGTCNONE 
J080029B09GTTTGGGCCGGGCCGTCNONE 
J080029M07GTTTGGGCCGGGCCGTCNONE 
J080029M17GTTTGGGCCGGGCCGTCNONE 
J080030H23GTTTGGGCCGGGCCGTCNONE 
J080030K16GTTTGGGCCGGGCCGTCNONE 
J080030L19GTTTGGGCCGGGCCGTCNONE 
J080031A12GTTTGGGCCGGGCCGTCNONE 
J080031N21GTTTGGGCCGGGCCGTCNONE 
J080032G05GTTTGGGCCGGGCCGTCNONE 
J080032P20GTTTGGGCCGGGCCGTCNONE 
J080033H20GTTTGGGCCGGGCCGTCNONE 
J080034H22GTTTGGGCCGGGCCGTCNONE 
J080034J03GTTTGGGCCGGGCCGTCNONE 
J080034J16GTTTGGGCCGGGCCGTCNONE 
J080034N01GTTTGGGCCGGGCCGTCNONE 
J080035K20GTTTGGGCCGGGCCGTCNONE 
J080036I04GTTTGGGCCGGGCCGTCNONE 
J080036I19GTTTGGGCCGGGCCGTCNONE 
J080036O21GTTTGGGCCGGGCCGTCNONE 
J080038D06GTTTGGGCCGGGCCGTCNONE 
J080039J15GTTTGGGCCGGGCCGTCNONE 
J080039P18GTTTGGGCCGGGCCGTCNONE 
J080041H20GTTTGGGCCGGGCCGTCNONE 
J080041M11GTTTGGGCCGGGCCGTCNONE 
J080042F14GTTTGGGCCGGGCCGTCNONE 
J080043G10GTTTGGGCCGGGCCGTCNONE 
J080043J02GTTTGGGCCGGGCCGTCNONE 
J080044C19GTTTGGGCCGGGCCGTCNONE 
J080044G11GTTTGGGCCGGGCCGTCNONE 
J080045M03GTTTGGGCCGGGCCGTCNONE 
J080045N07GTTTGGGCCGGGCCGTCNONE 
J080047K14GTTTGGGCCGGGCCGTCNONE 
J080049I21GTTTGGGCCGGGCCGTCNONE 
J080050A06GTTTGGGCCGGGCCGTCNONE 
J080050I16GTTTGGGCCGGGCCGTCNONE 
J080050N16GTTTGGGCCGGGCCGTCNONE 
J080052C23GTTTGGGCCGGGCCGTCNONE 
J080052D18GTTTGGGCCGGGCCGTCNONE 
J080052F20GTTTGGGCCGGGCCGTCNONE 
J080052F23GTTTGGGCCGGGCCGTCNONE 
J080053M03GTTTGGGCCGGGCCGTCNONE 
J080054G13GTTTGGGCCGGGCCGTCNONE 
J080054H12GTTTGGGCCGGGCCGTCNONE 
J080055N03GTTTGGGCCGGGCCGTCNONE 
J080056E07GTTTGGGCCGGGCCGTCNONE 
J080057L04GTTTGGGCCGGGCCGTCNONE 
J080063O19GTTTGGGCCGGGCCGTCNONE 
J080064E21GTTTGGGCCGGGCCGTCNONE 
J080065D18GTTTGGGCCGGGCCGTCNONE 
J080065F18GTTTGGGCCGGGCCGTCNONE 
J080065H14GTTTGGGCCGGGCCGTCNONE 
J080065K15GTTTGGGCCGGGCCGTCNONE 
J080065M24GTTTGGGCCGGGCCGTCNONE 
J080066B18GTTTGGGCCGGGCCGTCNONE 
J080066B19GTTTGGGCCGGGCCGTCNONE 
J080071H19GTTTGGGCCGGGCCGTCNONE 
J080072E18GTTTGGGCCGGGCCGTCNONE 
J080074K21GTTTGGGCCGGGCCGTCNONE 
J080075B06GTTTGGGCCGGGCCGTCNONE 
J080076H07GTTTGGGCCGGGCCGTCNONE 
J080079D16GTTTGGGCCGGGCCGTCNONE 
J080082B20GTTTGGGCCGGGCCGTCNONE 
J080084N16GTTTGGGCCGGGCCGTCNONE 
J080085L07GTTTGGGCCGGGCCGTCNONE 
J080086L04GTTTGGGCCGGGCCGTCNONE 
J080086M07GTTTGGGCCGGGCCGTCNONE 
J080087D02GTTTGGGCCGGGCCGTCNONE 
J080087D15GTTTGGGCCGGGCCGTCNONE 
J080087J19GTTTGGGCCGGGCCGTCNONE 
J080088G20GTTTGGGCCGGGCCGTCNONE 
J080092M15GTTTGGGCCGGGCCGTCNONE 
J080093O10GTTTGGGCCGGGCCGTCNONE 
J080095L09GTTTGGGCCGGGCCGTCNONE 
J080096A18GTTTGGGCCGGGCCGTCNONE 
J080097C03GTTTGGGCCGGGCCGTCNONE 
J090019J07GTTTGGGCCGGGCCGTCNONE 
J090024N12GTTTGGGCCGGGCCGTCNONE 
J090049I09GTTTGGGCCGGGCCGTCNONE 
Os03g0822700005-010-E01GACGGCCCGGCCCNONE 
006-088-H12GACGGCCCGGCCCNONE 
AK061682GACGGCCCGGCCCNONE 
AK101448GACGGCCCGGCCCArmadillo-like helical domain containing protein. 
J023091N05GACGGCCCGGCCCNONE 
Os03g0856200009-070-B07GACGGCCCATCANONE 
009-135-H05GACGGCCCATCANONE 
J100067D22GACGGCCCATCANONE 
J100067L13GACGGCCCATCANONE 
J100073I07GACGGCCCATCANONE 
J100080D01GACGGCCCATCANONE 
Os03g0858700006-024-D11GGTGGGGCTGGGCCGTCNONE 
AK061723GGTGGGGCTGGGCCGTCProtein of unknown function DUF1499 family protein. 
AK064976GGTGGGGCTGGGCCGTCNONE 
J013001B23GGTGGGGCTGGGCCGTCNONE 
Os04g0218600009-123-A05GTGTGGGCCGTCNONE 
AK062873GTGTGGGCCGTCNONE 
AK103472GTGTGGGCCGTCConserved hypothetical protein. 
J090077A20GTGTGGGCCGTCNONE 
Os04g0407300AK101793GACGGCCCATCGNONE 
AK121980GACGGCCCATCGHypothetical protein. 
J033065K23GACGGCCCATCGNONE 
J033108L11GACGGCCCATCGNONE 
Os04g0504600J065162K24GACGGCCCAACANONE 
Os04g0551300AK103502CTTGGGCCGTCSimilar to Growth regulator like protein. 
Os04g0585100012-055-B08GGACGGCCCATGANONE 
AK105286GGACGGCCCATGAZinc finger, DHHC-type domain containing protein. 
Os04g0614500AK100259TGATGGGCCGTCAminotransferase class-III family protein. 
Os04g0640800AK065522GTTTGGGCCGTCProgrammed cell death protein 2, C-terminal domain containing protein. 
Os04g0644100AK106954CGGACGGCCCAGATSterile alpha motif homology domain containing protein. 
Os04g0654700006-097-D06AATTGGGCCGTCCNONE 
013-016-H01AATTGGGCCGTCCNONE 
AB055495AATTGGGCCGTCCNONE 
AF072849AATTGGGCCGTCCNONE 
AK062107AATTGGGCCGTCCNONE 
AK099088AATTGGGCCGTCCSimilar to COP9 signalosome complex subunit 5b (EC 3.4.-.-) (Signalosome subunit 5b) (Jun activation domain-binding homolog 1). 
J013038I16AATTGGGCCGTCCNONE 
J013038J23AATTGGGCCGTCCNONE 
J013038L17AATTGGGCCGTCCNONE 
J013038N18AATTGGGCCGTCCNONE 
J013038O18AATTGGGCCGTCCNONE 
J013124A09AATTGGGCCGTCCNONE 
J023007N04AATTGGGCCGTCCNONE 
J033023C02AATTGGGCCGTCCNONE 
J033030M18AATTGGGCCGTCCNONE 
J033068I09AATTGGGCCGTCCNONE 
J033100E04AATTGGGCCGTCCNONE 
J065153E19AATTGGGCCGTCCNONE 
J065207I02AATTGGGCCGTCCNONE 
J075007A07AATTGGGCCGTCCNONE 
J075036M04AATTGGGCCGTCCNONE 
J075147I03AATTGGGCCGTCCNONE 
J075197L11AATTGGGCCGTCCNONE 
Os04g0668700012-043-D01ATCTGGGCCGTCCNONE 
AK065237ATCTGGGCCGTCCPhosphatidylinositol 3- and 4-kinase, catalytic domain containing protein. 
J013002G17ATCTGGGCCGTCCNONE 
J013002I02ATCTGGGCCGTCCNONE 
J013059C11ATCTGGGCCGTCCNONE 
J013059D22ATCTGGGCCGTCCNONE 
J013063G18ATCTGGGCCGTCCNONE 
J013088O04ATCTGGGCCGTCCNONE 
J013095K03ATCTGGGCCGTCCNONE 
J013096K15ATCTGGGCCGTCCNONE 
J013100O17ATCTGGGCCGTCCNONE 
J013102F10ATCTGGGCCGTCCNONE 
J013111L07ATCTGGGCCGTCCNONE 
J013127E24ATCTGGGCCGTCCNONE 
J013130A10ATCTGGGCCGTCCNONE 
J013134L13ATCTGGGCCGTCCNONE 
J023109G08ATCTGGGCCGTCCNONE 
J033022E17ATCTGGGCCGTCCNONE 
J033022N13ATCTGGGCCGTCCNONE 
J033026D04ATCTGGGCCGTCCNONE 
J033028M05ATCTGGGCCGTCCNONE 
J033037E04ATCTGGGCCGTCCNONE 
J033042D11ATCTGGGCCGTCCNONE 
J033044N20ATCTGGGCCGTCCNONE 
J033046K11ATCTGGGCCGTCCNONE 
J033046M21ATCTGGGCCGTCCNONE 
J033076E19ATCTGGGCCGTCCNONE 
J033076J24ATCTGGGCCGTCCNONE 
J033086N03ATCTGGGCCGTCCNONE 
J033095F22ATCTGGGCCGTCCNONE 
J033115F17ATCTGGGCCGTCCNONE 
J033117M06ATCTGGGCCGTCCNONE 
J033125D22ATCTGGGCCGTCCNONE 
J033129J10ATCTGGGCCGTCCNONE 
J033145E18ATCTGGGCCGTCCNONE 
J043021F24ATCTGGGCCGTCCNONE 
J053046G14ATCTGGGCCGTCCNONE 
J053090P03ATCTGGGCCGTCCNONE 
J065042N10ATCTGGGCCGTCCNONE 
J065053B13ATCTGGGCCGTCCNONE 
J065085G03ATCTGGGCCGTCCNONE 
J065173J11ATCTGGGCCGTCCNONE 
J090014M14ATCTGGGCCGTCCNONE 
J090027J07ATCTGGGCCGTCCNONE 
J090039E23ATCTGGGCCGTCCNONE 
J090051C15ATCTGGGCCGTCCNONE 
J090055H06ATCTGGGCCGTCCNONE 
J090062L03ATCTGGGCCGTCCNONE 
J100017L21ATCTGGGCCGTCCNONE 
J100024B07ATCTGGGCCGTCCNONE 
J100032G07ATCTGGGCCGTCCNONE 
J100040N09ATCTGGGCCGTCCNONE 
J100062N03ATCTGGGCCGTCCNONE 
J100078E07ATCTGGGCCGTCCNONE 
J100080E14ATCTGGGCCGTCCNONE 
J100084D07ATCTGGGCCGTCCNONE 
Os04g0685100AK065262CCGTGGGCCGTCRibosomal biogenesis regulatory protein family protein. 
J013002J24CCGTGGGCCGTCNONE 
J013030M11CCGTGGGCCGTCNONE 
J033139J12CCGTGGGCCGTCNONE 
J065013D12CCGTGGGCCGTCNONE 
J065117J01CCGTGGGCCGTCNONE 
J065143K20CCGTGGGCCGTCNONE 
J065181E12CCGTGGGCCGTCNONE 
J065184A17CCGTGGGCCGTCNONE 
J065193B13CCGTGGGCCGTCNONE 
J065196H01CCGTGGGCCGTCNONE 
J075072G17CCGTGGGCCGTCNONE 
J075077B02CCGTGGGCCGTCNONE 
J075088A06CCGTGGGCCGTCNONE 
J075099H13CCGTGGGCCGTCNONE 
J075111O04CCGTGGGCCGTCNONE 
J075131F20CCGTGGGCCGTCNONE 
J075139K01CCGTGGGCCGTCNONE 
J075194I16CCGTGGGCCGTCNONE 
Os05g0100500AK071466GATCGGACGGCCCAGGSimilar to Debaryomyces hansenii chromosome F of strain CBS767 of Debaryomyces hansenii. 
Os05g0121500006-117-B10GACGGCCCAATNONE 
009-059-D04GACGGCCCAATNONE 
J065066C12GACGGCCCAATConserved hypothetical protein. 
J075013I12GACGGCCCAATNONE 
J090046D18GACGGCCCAATNONE 
Os05g0170000003-129-C04CCGATCCGACGGCCCAGANONE 
AK100216CCGATCCGACGGCCCAGAProtein of unknown function DUF266, plant family protein. 
AK103412CCGATCCGACGGCCCAGANONE 
J023045H21CCGATCCGACGGCCCAGANONE 
J033128G01CCGATCCGACGGCCCAGANONE 
J065017O10CCGATCCGACGGCCCAGANONE 
J065032H11CCGATCCGACGGCCCAGANONE 
J065120G09CCGATCCGACGGCCCAGANONE 
Os05g0256000AK104927TATTGGGCCAGGACGGCCCAACASimilar to TGF-beta receptor-interacting protein 1. 
AK111524TATTGGGCCAGGACGGCCCAACANONE 
J023025D23TATTGGGCCAGGACGGCCCAACANONE 
J033086I23TATTGGGCCAGGACGGCCCAACANONE 
J033087F17TATTGGGCCAGGACGGCCCAACANONE 
J033091C01TATTGGGCCAGGACGGCCCAACANONE 
J090048L01TATTGGGCCAGGACGGCCCAACANONE 
J090087G08TATTGGGCCAGGACGGCCCAACANONE 
J100040G23TATTGGGCCAGGACGGCCCAACANONE 
Os05g0348100006-028-F04ATCGGACGGCCCATGTAGCCCAACTNONE 
009-036-C03ATCGGACGGCCCATGTAGCCCAACTNONE 
009-040-H02ATCGGACGGCCCATGTAGCCCAACTNONE 
009-173-H12ATCGGACGGCCCATGTAGCCCAACTNONE 
AK061434ATCGGACGGCCCATGTAGCCCAACTConserved hypothetical protein. 
J065137N04ATCGGACGGCCCATGTAGCCCAACTNONE 
J065164C10ATCGGACGGCCCATGTAGCCCAACTNONE 
J065210H22ATCGGACGGCCCATGTAGCCCAACTNONE 
Os05g0358500AK060575GACGGCCCNONE 
AK100777GACGGCCCProtein phosphatase 2C-like domain containing protein. 
Os05g0365500AK072352GACGGCCCAACProtein prenyltransferase domain containing protein. 
J043027P13GACGGCCCAACNONE 
Os05g0379300AK109293GACGGCCCATCTConserved hypothetical protein. 
Os05g0408200AK100057GACGGCCCSBP domain containing protein. 
J065182F20GACGGCCCNONE 
Os05g0430200J090095K16ATCCGACGGCCCGNONE 
Os05g0458400AK069936GATCCGACGGCCCAAACSimilar to AAA-metalloprotease FtsH. 
Os05g0480700AK100850AACTGGGCCGTCCSimilar to Vacuolar ATP synthase subunit E (EC 3.6.3.14) (V-ATPase E subunit) (Vacuolar proton pump E subunit). 
J023123I11AACTGGGCCGTCCNONE 
Os05g0559900AK067197ACATGGGCCGTCtRNA-binding arm domain containing protein. 
J013074C15ACATGGGCCGTCNONE 
J013098O16ACATGGGCCGTCNONE 
J033030M01ACATGGGCCGTCNONE 
J090058H12ACATGGGCCGTCNONE 
J090075M06ACATGGGCCGTCNONE 
Os05g0566800AK065748TCGTGGGCCGTCCold acclimation protein COR413-TM1. 
AY181210TCGTGGGCCGTCNONE 
Os05g0571400009-019-B04GACGGCCCGGCCCAGTTNONE 
009-043-H02GACGGCCCGGCCCAGTTNONE 
AK062369GACGGCCCGGCCCAGTTConserved hypothetical protein. 
Os05g0587400AK102121GACGGCCCATAAPrefoldin domain containing protein. 
J033084N12GACGGCCCATAANONE 
Os05g0589000AK061980GACGGCCCAAACGCGGAGAGNONE 
AK099181GACGGCCCAAACGCGGAGAGConserved hypothetical protein. 
Os05g0597100011-044-C10GGACGGCCCAGCNONE 
AF255711GGACGGCCCAGCNONE 
AK072845GGACGGCCCAGCSimilar to Nucleolar histone deacetylase HD2-p39. 
J023050H16GGACGGCCCAGCNONE 
J023135M22GGACGGCCCAGCNONE 
J023141B21GGACGGCCCAGCNONE 
J023142J09GGACGGCCCAGCNONE 
J033025E09GGACGGCCCAGCNONE 
J033111A20GGACGGCCCAGCNONE 
J033126I01GGACGGCCCAGCNONE 
Os06g0105900AK072638CCATGGGCCGTCCGConserved hypothetical protein. 
Os06g0125200015-099-F09TTGGCCCAGGGCCGTCNONE 
AK102200TTGGCCCAGGGCCGTCProtein of unknown function DUF581 family protein. 
J033030E04TTGGCCCAGGGCCGTCNONE 
J033058K06TTGGCCCAGGGCCGTCNONE 
J033060O13TTGGCCCAGGGCCGTCNONE 
J033068B04TTGGCCCAGGGCCGTCNONE 
J033087E11TTGGCCCAGGGCCGTCNONE 
J033113N12TTGGCCCAGGGCCGTCNONE 
J065110P15TTGGCCCAGGGCCGTCNONE 
J075174B01TTGGCCCAGGGCCGTCNONE 
Os06g0152400AK064640ATCCGACGGCCCAGATSimilar to Hexaprenyldihydroxybenzoate methyltransferase, mitochondrial precursor (EC 2.1.1.114) (Dihydroxyhexaprenylbenzoate methyltransferase) (3,4- dihydroxy-5-hexaprenylbenzoate methyltransferase) (DHHB methyltransferase) (DHHB-MT) (DHHB-MTase). 
AK064640ATCTGGGCCGTCCSimilar to Hexaprenyldihydroxybenzoate methyltransferase, mitochondrial precursor (EC 2.1.1.114) (Dihydroxyhexaprenylbenzoate methyltransferase) (3,4- dihydroxy-5-hexaprenylbenzoate methyltransferase) (DHHB methyltransferase) (DHHB-MT) (DHHB-MTase). 
J075086I24ATCCGACGGCCCAGATNONE 
J075086I24ATCTGGGCCGTCCNONE 
J075127E23ATCCGACGGCCCAGATNONE 
J075127E23ATCTGGGCCGTCCNONE 
J075157B19ATCCGACGGCCCAGATNONE 
J075157B19ATCTGGGCCGTCCNONE 
J090038E06ATCCGACGGCCCAGATNONE 
J090038E06ATCTGGGCCGTCCNONE 
Os06g0506600009-119-E12GACGGCCCGCANONE 
J023086A18GACGGCCCGCANONE 
J033036I02GACGGCCCGCANONE 
J033125C16GACGGCCCGCANONE 
J065013I11GACGGCCCGCANONE 
J065026O21GACGGCCCGCANONE 
J065060H10GACGGCCCGCANONE 
J065067A15GACGGCCCGCANONE 
J065068F07GACGGCCCGCANONE 
J065085N06GACGGCCCGCANONE 
J065108N10GACGGCCCGCANONE 
J065161O11GACGGCCCGCANONE 
J065185J15GACGGCCCGCANONE 
J065191H18GACGGCCCGCANONE 
J065199J09GACGGCCCGCANONE 
J075005G03GACGGCCCGCANONE 
J075018C16GACGGCCCGCANONE 
J075061K20GACGGCCCGCANONE 
J075069J06GACGGCCCGCANONE 
J075075H19GACGGCCCGCANONE 
J075076D20GACGGCCCGCANONE 
J075078D16GACGGCCCGCANONE 
J075100J19GACGGCCCGCANONE 
J075110M11GACGGCCCGCANONE 
J075157N05GACGGCCCGCANONE 
J075171F20GACGGCCCGCANONE 
J075177G08GACGGCCCGCANONE 
J075179G08GACGGCCCGCANONE 
Os06g0562700AK109753GACGGCCCACGTConserved hypothetical protein. 
Os06g0597600AK120804GACGGCCCAromatic-ring hydroxylase family protein. 
Os06g0667400AK065424GACGGCCCAGATConserved hypothetical protein. 
AK065580GACGGCCCAGATNONE 
Os06g0673500J100018J12GACGGCCCATGTNONE 
J100072F13GACGGCCCATGTSimilar to Ubiquitin. 
Os06g0683800AK110639GACGGCCCConserved hypothetical protein. 
Os06g0690600AK107925GACGGCCCAACTConserved hypothetical protein. 
Os06g0702800009-039-E05GGACGGCCCATGANONE 
AK073948GGACGGCCCATGAHypothetical protein. 
J023108K23GGACGGCCCATGANONE 
J033072H04GGACGGCCCATGANONE 
J065008G05GGACGGCCCATGANONE 
J065128J12GGACGGCCCATGANONE 
J065131A01GGACGGCCCATGANONE 
J065173B12GGACGGCCCATGANONE 
Os06g0709100006-057-D06GCTGGGCCGTCNONE 
011-040-A08GCTGGGCCGTCNONE 
016-044-A01GCTGGGCCGTCNONE 
AK059732GCTGGGCCGTCNONE 
AK070881GCTGGGCCGTCCyclin-like F-box domain containing protein. 
AK103683GCTGGGCCGTCNONE 
J065026P10GCTGGGCCGTCNONE 
J090017L13GCTGGGCCGTCNONE 
Os06g0726800AK070518GATCCGACGGCCCAGATG2/mitotic-specific cyclin 2 (B-like cyclin) (CycOs2). 
J023055K12GATCCGACGGCCCAGATNONE 
J053032B13GATCCGACGGCCCAGATNONE 
X82036GATCCGACGGCCCAGATNONE 
Os07g0101500AK059667CGGGCCGTCCNONE 
AK071749CGGGCCGTCCSimilar to Sterol 4-alpha-methyl-oxidase (Fragment). 
J023112L07CGGGCCGTCCNONE 
J065050F03CGGGCCGTCCNONE 
J090015C05CGGGCCGTCCNONE 
J090045C11CGGGCCGTCCNONE 
Os07g0124600AK073437GATCCGACGGCCCGGARNA-binding region RNP-1 (RNA recognition motif) domain containing protein. 
J033042K24GATCCGACGGCCCGGANONE 
J033136G07GATCCGACGGCCCGGANONE 
J065092I12GATCCGACGGCCCGGANONE 
J065132F04GATCCGACGGCCCGGANONE 
J065143I11GATCCGACGGCCCGGANONE 
Os07g0142900003-001-H01ATTTGGGCCGTCCNONE 
AK060737ATTTGGGCCGTCCAldo/keto reductase family protein. 
AK064848ATTTGGGCCGTCCNONE 
Os07g0180900006-055-B11GACGGCCCATCTNONE 
006-103-F09GACGGCCCATCTNONE 
011-009-E03GACGGCCCATCTNONE 
011-035-H08GACGGCCCATCTNONE 
014-043-F08GACGGCCCATCTNONE 
AK060711GACGGCCCATCTRibosomal protein L4/L1e family protein. 
AK060963GACGGCCCATCTNONE 
AK104447GACGGCCCATCTNONE 
AK104504GACGGCCCATCTNONE 
AK104629GACGGCCCATCTNONE 
J023003P15GACGGCCCATCTNONE 
J023075H14GACGGCCCATCTNONE 
J033101N17GACGGCCCATCTNONE 
J033132M11GACGGCCCATCTNONE 
J065081C24GACGGCCCATCTNONE 
J080004L10GACGGCCCATCTNONE 
J080009H21GACGGCCCATCTNONE 
J080013F01GACGGCCCATCTNONE 
J080022K24GACGGCCCATCTNONE 
J080023C22GACGGCCCATCTNONE 
J080024M16GACGGCCCATCTNONE 
J080026K06GACGGCCCATCTNONE 
J080030J23GACGGCCCATCTNONE 
J080030L05GACGGCCCATCTNONE 
J080031G03GACGGCCCATCTNONE 
J080033C03GACGGCCCATCTNONE 
J080033D02GACGGCCCATCTNONE 
J080035A11GACGGCCCATCTNONE 
J080035A14GACGGCCCATCTNONE 
J080039E08GACGGCCCATCTNONE 
J080040L15GACGGCCCATCTNONE 
J080040M03GACGGCCCATCTNONE 
J080041L21GACGGCCCATCTNONE 
J080043E09GACGGCCCATCTNONE 
J080048B14GACGGCCCATCTNONE 
J080048O09GACGGCCCATCTNONE 
J080051H01GACGGCCCATCTNONE 
J080052H06GACGGCCCATCTNONE 
J080065K05GACGGCCCATCTNONE 
J080066D10GACGGCCCATCTNONE 
J080066E23GACGGCCCATCTNONE 
J080069F10GACGGCCCATCTNONE 
J080074M06GACGGCCCATCTNONE 
J080075D13GACGGCCCATCTNONE 
J080076G02GACGGCCCATCTNONE 
J080082G15GACGGCCCATCTNONE 
J080082K06GACGGCCCATCTNONE 
J080082P12GACGGCCCATCTNONE 
J080085F01GACGGCCCATCTNONE 
J080090H22GACGGCCCATCTNONE 
J080092D07GACGGCCCATCTNONE 
J080094M03GACGGCCCATCTNONE 
J080094O10GACGGCCCATCTNONE 
J090008I06GACGGCCCATCTNONE 
J100058N20GACGGCCCATCTNONE 
J100060M07GACGGCCCATCTNONE 
J100062M08GACGGCCCATCTNONE 
J100064L07GACGGCCCATCTNONE 
J100073H16GACGGCCCATCTNONE 
J100074C10GACGGCCCATCTNONE 
J100075N06GACGGCCCATCTNONE 
J100087P11GACGGCCCATCTNONE 
J100088B13GACGGCCCATCTNONE 
J100088J16GACGGCCCATCTNONE 
J100088L17GACGGCCCATCTNONE 
J100088O12GACGGCCCATCTNONE 
Os07g0209000AK059111GATCGGACGGCCCAGATSimilar to Dolichyl-di-phosphooligosaccharide-protein glycotransferase (Oligosaccharyltransferase)-like. 
AK099319GATCGGACGGCCCAGATNONE 
Os07g0224000009-060-E01GACGGCCCACTNONE 
J065042D20GACGGCCCACTNONE 
J065127D14GACGGCCCACTNONE 
J065176C24GACGGCCCACTNONE 
J065188M12GACGGCCCACTNONE 
J065194L14GACGGCCCACTNONE 
J075060P09GACGGCCCACTNONE 
J075134C14GACGGCCCACTRibosomal protein L24E family protein. 
J075192M12GACGGCCCACTNONE 
J100032N01GACGGCCCACTNONE 
Os07g0546700009-110-H10TACTGGGCCGTCNONE 
AK058262TACTGGGCCGTCNONE 
J065154I05TACTGGGCCGTCNONE 
J065175P09TACTGGGCCGTCNONE 
J065187F11TACTGGGCCGTCNONE 
J075114K16TACTGGGCCGTCNONE 
J090031L21TACTGGGCCGTCNONE 
U86017TACTGGGCCGTCSimilar to 60S ribosomal protein L38. 
Os07g0563700AK121078GGACGGCCCAGATIKI3 family protein. 
Os07g0586000AK069212ATCGGACGGCCCConserved hypothetical protein. 
Os07g0589000AK069813CCGATCCGACGGCCCGLateral organ boundaries, LOB domain containing protein. 
J023030F23CCGATCCGACGGCCCGNONE 
J065165H21CCGATCCGACGGCCCGNONE 
J065193G01CCGATCCGACGGCCCGNONE 
J075093F03CCGATCCGACGGCCCGNONE 
Os07g0623300AK070292GACGGCCCACASimilar to Splicing factor SC35. 
J023050C05GACGGCCCACANONE 
J090025O12GACGGCCCACANONE 
Os07g0681500AK103662GATCGGACGGCCCAGATNONE 
AK121650GATCGGACGGCCCAGATAnkyrin repeat containing protein. 
Os07g0688100AK101635ATATGGGCCGTCProtein prenyltransferase domain containing protein. 
J033055B02ATATGGGCCGTCNONE 
J090013O08ATATGGGCCGTCNONE 
J090074A17ATATGGGCCGTCNONE 
Os08g0117400006-086-A09GACGGCCCACCANONE 
006-103-C02GACGGCCCACCANONE 
AK059891GACGGCCCACCASimilar to Calmodulin 1 (Fragment). 
AK103863GACGGCCCACCANONE 
AY224521GACGGCCCACCANONE 
J033149E23GACGGCCCACCANONE 
J065062E05GACGGCCCACCANONE 
J065083O05GACGGCCCACCANONE 
J065116D14GACGGCCCACCANONE 
J065158F16GACGGCCCACCANONE 
J065179N16GACGGCCCACCANONE 
J065206N23GACGGCCCACCANONE 
Os08g0162500AK121633GACGGCCCACCTGTConserved hypothetical protein. 
J033105E19GACGGCCCACCTGTNONE 
J080012K11GACGGCCCACCTGTNONE 
J080041I12GACGGCCCACCTGTNONE 
J080049G05GACGGCCCACCTGTNONE 
J080050P09GACGGCCCACCTGTNONE 
J080051A10GACGGCCCACCTGTNONE 
J080054G05GACGGCCCACCTGTNONE 
J080058M08GACGGCCCACCTGTNONE 
J080064N23GACGGCCCACCTGTNONE 
J080072L15GACGGCCCACCTGTNONE 
J080096H09GACGGCCCACCTGTNONE 
J100079I08GACGGCCCACCTGTNONE 
Os08g0192800AK059490ATCTGGGCCGTCCGATCNONE 
AK101678ATCTGGGCCGTCCGATCNONE 
AK120613ATCTGGGCCGTCCGATCBromodomain containing protein. 
J080039B22ATCTGGGCCGTCCGATCNONE 
J080039I23ATCTGGGCCGTCCGATCNONE 
J080074D19ATCTGGGCCGTCCGATCNONE 
J080086N13ATCTGGGCCGTCCGATCNONE 
Os08g0195400006-057-E04CGATGGGCCGTCNONE 
006-060-B10CGATGGGCCGTCNONE 
AK070464CGATGGGCCGTCConserved hypothetical protein. 
AK104389CGATGGGCCGTCNONE 
AK106140CGATGGGCCGTCNONE 
J023013G08CGATGGGCCGTCNONE 
J023054K19CGATGGGCCGTCNONE 
J023089D18CGATGGGCCGTCNONE 
J023092K05CGATGGGCCGTCNONE 
J033025A08CGATGGGCCGTCNONE 
J033067P12CGATGGGCCGTCNONE 
J033098A10CGATGGGCCGTCNONE 
J065219L04CGATGGGCCGTCNONE 
J090021P06CGATGGGCCGTCNONE 
J090062M05CGATGGGCCGTCNONE 
J090079F15CGATGGGCCGTCNONE 
J100041H19CGATGGGCCGTCNONE 
Os08g0224200AK101331CGGACGGCCCGGTSimilar to Ythdf2-prov protein. 
Os08g0230000014-096-F01CCGTGGGCCGGGCCGTCGGGCCGTANONE 
AK067127CCGTGGGCCGGGCCGTCGGGCCGTAConserved hypothetical protein. 
J013096C05CCGTGGGCCGGGCCGTCGGGCCGTANONE 
J100032D12CCGTGGGCCGGGCCGTCGGGCCGTANONE 
Os08g0412100AK072641AAATGGGCCGTCDisease resistance protein family protein. 
Os08g0414300AK072217ATCCGACGGCCCAGATConserved hypothetical protein. 
J065039C07ATCCGACGGCCCAGATNONE 
J065098N11ATCCGACGGCCCAGATNONE 
J065120J15ATCCGACGGCCCAGATNONE 
J075076H12ATCCGACGGCCCAGATNONE 
J075101N16ATCCGACGGCCCAGATNONE 
J080010A07ATCCGACGGCCCAGATNONE 
J080023C16ATCCGACGGCCCAGATNONE 
J080027G22ATCCGACGGCCCAGATNONE 
J080053D02ATCCGACGGCCCAGATNONE 
J080065E17ATCCGACGGCCCAGATNONE 
J080068C15ATCCGACGGCCCAGATNONE 
J090061J10ATCCGACGGCCCAGATNONE 
Os08g0425000AK105302GCCGGGCCGTCCConserved hypothetical protein. 
Os08g0461300AK065651GACGGCCCAACCCyclin-like F-box domain containing protein. 
Os08g0478500AK099704GATCCGACGGCCCAGAPeptidase C19, ubiquitin carboxyl-terminal hydrolase 2 family protein. 
Os08g0540000AK070813GATCCGACGGCCCAGATProtein of unknown function DUF914, eukaryotic family protein. 
J090058N13GATCCGACGGCCCAGATNONE 
Os08g0544800009-168-G01ACGCGTCCTGGGCCGTCGGATCNONE 
011-046-D09ACGCGTCCTGGGCCGTCGGATCNONE 
012-003-C08ACGCGTCCTGGGCCGTCGGATCNONE 
012-042-B06ACGCGTCCTGGGCCGTCGGATCNONE 
013-035-H12ACGCGTCCTGGGCCGTCGGATCNONE 
013-072-A10ACGCGTCCTGGGCCGTCGGATCNONE 
014-010-B11ACGCGTCCTGGGCCGTCGGATCNONE 
014-097-E06ACGCGTCCTGGGCCGTCGGATCNONE 
015-003-E12ACGCGTCCTGGGCCGTCGGATCNONE 
015-040-B04ACGCGTCCTGGGCCGTCGGATCNONE 
AK060536ACGCGTCCTGGGCCGTCGGATCNONE 
AK102666ACGCGTCCTGGGCCGTCGGATCNONE 
AK119660ACGCGTCCTGGGCCGTCGGATCPCF2. 
D87261ACGCGTCCTGGGCCGTCGGATCNONE 
J090049N23ACGCGTCCTGGGCCGTCGGATCNONE 
J090084G06ACGCGTCCTGGGCCGTCGGATCNONE 
Os08g0550100AB070258GACGGCCCAGCTCAGCCCAGCNONE 
AK061287GACGGCCCAGCTCAGCCCAGCSimilar to 26S proteasome subunit RPN3a. 
Os08g0556200009-008-D12GACGGCCCAAGGTATGGGCNONE 
AK121222GACGGCCCAAGGTATGGGCSimilar to Dihydroneopterin aldolase. 
J023090H22GACGGCCCAAGGTATGGGCNONE 
J075027J23GACGGCCCAAGGTATGGGCNONE 
J075032L14GACGGCCCAAGGTATGGGCNONE 
J075053H04GACGGCCCAAGGTATGGGCNONE 
J075171P20GACGGCCCAAGGTATGGGCNONE 
J100057F12GACGGCCCAAGGTATGGGCNONE 
Os08g0564100AK063258TGATGGGCCGTCSimilar to ATP-binding cassette, sub-family F, member 2 (Iron inhibited ABC transporter 2) (HUSSY-18). 
Os09g0281800AK105291GGACGGCCCAGATConserved hypothetical protein. 
Os09g0325700011-041-G03GGACGGCCCGGANONE 
AK063334GGACGGCCCGGASimilar to Protein phpsphatase 2C (PP2C) (EC 3.1.3.16). 
J080317M24GGACGGCCCGGANONE 
Os09g0367900011-030-A03CCGATCCGACGGCCCAGATNONE 
AK061601CCGATCCGACGGCCCAGATNONE 
AK063310CCGATCCGACGGCCCAGATHypothetical protein. 
J100063G01CCGATCCGACGGCCCAGATNONE 
Os09g0372900006-044-C02GACGGCCCNONE 
AK059785GACGGCCCCyclin-like F-box domain containing protein. 
AK067586GACGGCCCNONE 
AK100129GACGGCCCNONE 
J023009I10GACGGCCCNONE 
J065195A19GACGGCCCNONE 
J065202M02GACGGCCCNONE 
J065215H14GACGGCCCNONE 
Os09g0434200AK062015GGACGGCCCAGTANONE 
AK062015GGGCCGTCNONE 
AK103447GGACGGCCCAGTAZinc finger, RING-type domain containing protein. 
AK103447GGGCCGTCZinc finger, RING-type domain containing protein. 
Os09g0467700AK061600GGGCCGTCCGATCConserved hypothetical protein. 
Os09g0468900AK120990GCTGGGCCGTCCConserved hypothetical protein. 
J013123P13GCTGGGCCGTCCNONE 
J023013I09GCTGGGCCGTCCNONE 
J023023G08GCTGGGCCGTCCNONE 
J023043E08GCTGGGCCGTCCNONE 
J033124D24GCTGGGCCGTCCNONE 
J065047I07GCTGGGCCGTCCNONE 
J065093C16GCTGGGCCGTCCNONE 
J090088O03GCTGGGCCGTCCNONE 
J100032M21GCTGGGCCGTCCNONE 
Os09g0480600AK107853ATCTGGGCCGTCCHypothetical protein. 
Os09g0554000J065123C23GACGGCCCAAGSimilar to Mitochondrial phosphate transporter. 
Os09g0559800AK071542GTTGGGCCTGGACGGCCCATGGSimilar to Transporter-like protein. 
J013063N24GTTGGGCCTGGACGGCCCATGGNONE 
Os11g0286800AK072702GACGGCCCGTerpene synthase family protein. 
AK100763GACGGCCCGNONE 
AK107355GACGGCCCGNONE 
J013026O22GACGGCCCGNONE 
J013065A14GACGGCCCGNONE 
J013129G22GACGGCCCGNONE 
J023119J04GACGGCCCGNONE 
Os11g0586300AK072257GGACGGCCCAAATConserved hypothetical protein. 
Os11g0620400AK068224ATCGGACGGCCCACGTNONE 
AK120270ATCGGACGGCCCACGTConserved hypothetical protein. 
Os11g0660500009-031-D10ATCTGGGCCGTCCNONE 
009-100-G09ATCTGGGCCGTCCNONE 
009-162-G10ATCTGGGCCGTCCNONE 
009-183-H11ATCTGGGCCGTCCNONE 
013-010-B11ATCTGGGCCGTCCNONE 
013-050-A05ATCTGGGCCGTCCNONE 
013-070-E10ATCTGGGCCGTCCNONE 
AK105453ATCTGGGCCGTCCSimilar to Translationally controlled tumor protein (Fragment). 
D12626ATCTGGGCCGTCCNONE 
J013128M15ATCTGGGCCGTCCNONE 
J023004I19ATCTGGGCCGTCCNONE 
J033114F08ATCTGGGCCGTCCNONE 
J033147I20ATCTGGGCCGTCCNONE 
J065031M04ATCTGGGCCGTCCNONE 
J065033J03ATCTGGGCCGTCCNONE 
J065038E01ATCTGGGCCGTCCNONE 
J065048O06ATCTGGGCCGTCCNONE 
J065054E01ATCTGGGCCGTCCNONE 
J065075N08ATCTGGGCCGTCCNONE 
J065080C07ATCTGGGCCGTCCNONE 
J065096A12ATCTGGGCCGTCCNONE 
J065115P22ATCTGGGCCGTCCNONE 
J065122I21ATCTGGGCCGTCCNONE 
J065127A13ATCTGGGCCGTCCNONE 
J065158B06ATCTGGGCCGTCCNONE 
J065162E04ATCTGGGCCGTCCNONE 
J065162E05ATCTGGGCCGTCCNONE 
J065163L06ATCTGGGCCGTCCNONE 
J065177B16ATCTGGGCCGTCCNONE 
J065181M15ATCTGGGCCGTCCNONE 
J065201G15ATCTGGGCCGTCCNONE 
J065202J06ATCTGGGCCGTCCNONE 
J075002B19ATCTGGGCCGTCCNONE 
J075008G19ATCTGGGCCGTCCNONE 
J075010P05ATCTGGGCCGTCCNONE 
J075018H23ATCTGGGCCGTCCNONE 
J075051E18ATCTGGGCCGTCCNONE 
J075053C24ATCTGGGCCGTCCNONE 
J075077B06ATCTGGGCCGTCCNONE 
J075080B11ATCTGGGCCGTCCNONE 
J075083M04ATCTGGGCCGTCCNONE 
J075085H01ATCTGGGCCGTCCNONE 
J075109E11ATCTGGGCCGTCCNONE 
J075111O09ATCTGGGCCGTCCNONE 
J075130D13ATCTGGGCCGTCCNONE 
J075132H13ATCTGGGCCGTCCNONE 
J075147H19ATCTGGGCCGTCCNONE 
J075148J01ATCTGGGCCGTCCNONE 
J075159A18ATCTGGGCCGTCCNONE 
J075166F03ATCTGGGCCGTCCNONE 
J075191F09ATCTGGGCCGTCCNONE 
J075192K09ATCTGGGCCGTCCNONE 
J080006P15ATCTGGGCCGTCCNONE 
J080013J18ATCTGGGCCGTCCNONE 
J080023O06ATCTGGGCCGTCCNONE 
J080024I17ATCTGGGCCGTCCNONE 
J080029P03ATCTGGGCCGTCCNONE 
J080030C14ATCTGGGCCGTCCNONE 
J080038K15ATCTGGGCCGTCCNONE 
J080042I15ATCTGGGCCGTCCNONE 
J080053L07ATCTGGGCCGTCCNONE 
J080061H12ATCTGGGCCGTCCNONE 
J080064H24ATCTGGGCCGTCCNONE 
J080066J20ATCTGGGCCGTCCNONE 
J080074N07ATCTGGGCCGTCCNONE 
J080079F16ATCTGGGCCGTCCNONE 
J080079O07ATCTGGGCCGTCCNONE 
J080092E15ATCTGGGCCGTCCNONE 
J080301F19ATCTGGGCCGTCCNONE 
J080302O21ATCTGGGCCGTCCNONE 
J080306L02ATCTGGGCCGTCCNONE 
J080307F16ATCTGGGCCGTCCNONE 
J080307G01ATCTGGGCCGTCCNONE 
J080307K01ATCTGGGCCGTCCNONE 
J080309O22ATCTGGGCCGTCCNONE 
J080311E17ATCTGGGCCGTCCNONE 
J080311N08ATCTGGGCCGTCCNONE 
J080312O12ATCTGGGCCGTCCNONE 
J080315C08ATCTGGGCCGTCCNONE 
J080316D07ATCTGGGCCGTCCNONE 
J080318C17ATCTGGGCCGTCCNONE 
J090004B08ATCTGGGCCGTCCNONE 
J090009K02ATCTGGGCCGTCCNONE 
J090025O15ATCTGGGCCGTCCNONE 
J090026L03ATCTGGGCCGTCCNONE 
J090036P17ATCTGGGCCGTCCNONE 
J090047A21ATCTGGGCCGTCCNONE 
J090053O03ATCTGGGCCGTCCNONE 
J090059C04ATCTGGGCCGTCCNONE 
J090062O21ATCTGGGCCGTCCNONE 
J090064M11ATCTGGGCCGTCCNONE 
J090070C14ATCTGGGCCGTCCNONE 
J090075I03ATCTGGGCCGTCCNONE 
J090081G22ATCTGGGCCGTCCNONE 
J090083E18ATCTGGGCCGTCCNONE 
J090084A05ATCTGGGCCGTCCNONE 
J100019L11ATCTGGGCCGTCCNONE 
J100022D16ATCTGGGCCGTCCNONE 
J100042F09ATCTGGGCCGTCCNONE 
J100051J12ATCTGGGCCGTCCNONE 
J100065G21ATCTGGGCCGTCCNONE 
J100066D08ATCTGGGCCGTCCNONE 
J100069H04ATCTGGGCCGTCCNONE 
J100078I16ATCTGGGCCGTCCNONE 
J100090D15ATCTGGGCCGTCCNONE 
Os11g0703900011-004-D05GACGGCCCACTTGNONE 
011-014-C03GACGGCCCACTTGNONE 
011-016-C01GACGGCCCACTTGNONE 
011-017-B04GACGGCCCACTTGNONE 
011-017-E09GACGGCCCACTTGNONE 
011-019-E12GACGGCCCACTTGNONE 
011-021-H12GACGGCCCACTTGNONE 
011-025-H02GACGGCCCACTTGNONE 
011-027-B09GACGGCCCACTTGNONE 
011-039-G07GACGGCCCACTTGNONE 
011-044-G07GACGGCCCACTTGNONE 
011-046-F11GACGGCCCACTTGNONE 
011-070-F02GACGGCCCACTTGNONE 
011-071-A07GACGGCCCACTTGNONE 
011-082-A03GACGGCCCACTTGNONE 
011-086-B09GACGGCCCACTTGNONE 
011-092-C04GACGGCCCACTTGNONE 
012-006-F02GACGGCCCACTTGNONE 
012-011-G08GACGGCCCACTTGNONE 
012-026-C06GACGGCCCACTTGNONE 
012-026-G06GACGGCCCACTTGNONE 
012-028-E05GACGGCCCACTTGNONE 
012-040-A05GACGGCCCACTTGNONE 
012-045-C01GACGGCCCACTTGNONE 
012-046-A10GACGGCCCACTTGNONE 
012-047-H09GACGGCCCACTTGNONE 
012-059-A12GACGGCCCACTTGNONE 
012-072-D06GACGGCCCACTTGNONE 
012-073-D05GACGGCCCACTTGNONE 
012-076-D08GACGGCCCACTTGNONE 
012-079-G05GACGGCCCACTTGNONE 
012-080-A04GACGGCCCACTTGNONE 
012-080-E01GACGGCCCACTTGNONE 
012-083-C03GACGGCCCACTTGNONE 
012-083-G06GACGGCCCACTTGNONE 
012-086-G02GACGGCCCACTTGNONE 
012-091-A07GACGGCCCACTTGNONE 
012-094-G10GACGGCCCACTTGNONE 
012-098-A07GACGGCCCACTTGNONE 
012-100-G04GACGGCCCACTTGNONE 
015-001-A11GACGGCCCACTTGNONE 
015-033-E01GACGGCCCACTTGNONE 
015-047-F12GACGGCCCACTTGNONE 
015-054-E05GACGGCCCACTTGNONE 
015-063-H02GACGGCCCACTTGNONE 
015-075-E10GACGGCCCACTTGNONE 
015-086-F05GACGGCCCACTTGNONE 
016-031-A08GACGGCCCACTTGNONE 
016-053-A03GACGGCCCACTTGNONE 
016-054-C09GACGGCCCACTTGNONE 
016-079-C08GACGGCCCACTTGNONE 
AK065431GACGGCCCACTTGHeat shock protein 70. 
AK119255GACGGCCCACTTGNONE 
J013021C12GACGGCCCACTTGNONE 
J013021C17GACGGCCCACTTGNONE 
J023027B08GACGGCCCACTTGNONE 
J023078A21GACGGCCCACTTGNONE 
J023097M06GACGGCCCACTTGNONE 
J023100O04GACGGCCCACTTGNONE 
J023107B17GACGGCCCACTTGNONE 
J023108L24GACGGCCCACTTGNONE 
J023109L05GACGGCCCACTTGNONE 
J033022M22GACGGCCCACTTGNONE 
J033023K21GACGGCCCACTTGNONE 
J033031L11GACGGCCCACTTGNONE 
J033034H10GACGGCCCACTTGNONE 
J033037B16GACGGCCCACTTGNONE 
J033037F16GACGGCCCACTTGNONE 
J033037H07GACGGCCCACTTGNONE 
J033046E22GACGGCCCACTTGNONE 
J033050N12GACGGCCCACTTGNONE 
J033064F10GACGGCCCACTTGNONE 
J033064N10GACGGCCCACTTGNONE 
J033066O09GACGGCCCACTTGNONE 
J033068H01GACGGCCCACTTGNONE 
J033068J07GACGGCCCACTTGNONE 
J033070B10GACGGCCCACTTGNONE 
J033070G13GACGGCCCACTTGNONE 
J033073O13GACGGCCCACTTGNONE 
J033075B07GACGGCCCACTTGNONE 
J033079L15GACGGCCCACTTGNONE 
J033081J06GACGGCCCACTTGNONE 
J033086G13GACGGCCCACTTGNONE 
J033086N07GACGGCCCACTTGNONE 
J033086O05GACGGCCCACTTGNONE 
J033091A15GACGGCCCACTTGNONE 
J033091D05GACGGCCCACTTGNONE 
J033094C12GACGGCCCACTTGNONE 
J033099P03GACGGCCCACTTGNONE 
J033107L09GACGGCCCACTTGNONE 
J033108D16GACGGCCCACTTGNONE 
J033109E12GACGGCCCACTTGNONE 
J033109K14GACGGCCCACTTGNONE 
J033112P22GACGGCCCACTTGNONE 
J033116F12GACGGCCCACTTGNONE 
J033116K01GACGGCCCACTTGNONE 
J033118F19GACGGCCCACTTGNONE 
J033121J10GACGGCCCACTTGNONE 
J033126H04GACGGCCCACTTGNONE 
J033131G17GACGGCCCACTTGNONE 
J033131L05GACGGCCCACTTGNONE 
J033136A08GACGGCCCACTTGNONE 
J033136H22GACGGCCCACTTGNONE 
J033143F01GACGGCCCACTTGNONE 
J065040M10GACGGCCCACTTGNONE 
J065046F17GACGGCCCACTTGNONE 
J065048G20GACGGCCCACTTGNONE 
J065071N06GACGGCCCACTTGNONE 
J065084I24GACGGCCCACTTGNONE 
J065171B01GACGGCCCACTTGNONE 
J065191J21GACGGCCCACTTGNONE 
J065199I20GACGGCCCACTTGNONE 
J075076C02GACGGCCCACTTGNONE 
J090002P12GACGGCCCACTTGNONE 
J090003A11GACGGCCCACTTGNONE 
J090003H11GACGGCCCACTTGNONE 
J090009M22GACGGCCCACTTGNONE 
J090009O11GACGGCCCACTTGNONE 
J090014N09GACGGCCCACTTGNONE 
J090015A18GACGGCCCACTTGNONE 
J090016E16GACGGCCCACTTGNONE 
J090016I07GACGGCCCACTTGNONE 
J090017O07GACGGCCCACTTGNONE 
J090019E10GACGGCCCACTTGNONE 
J090020D24GACGGCCCACTTGNONE 
J090021M16GACGGCCCACTTGNONE 
J090022F13GACGGCCCACTTGNONE 
J090023H03GACGGCCCACTTGNONE 
J090024E15GACGGCCCACTTGNONE 
J090024G19GACGGCCCACTTGNONE 
J090026J19GACGGCCCACTTGNONE 
J090030E20GACGGCCCACTTGNONE 
J090030I15GACGGCCCACTTGNONE 
J090032F04GACGGCCCACTTGNONE 
J090033N22GACGGCCCACTTGNONE 
J090033O19GACGGCCCACTTGNONE 
J090036F08GACGGCCCACTTGNONE 
J090039A13GACGGCCCACTTGNONE 
J090042N07GACGGCCCACTTGNONE 
J090043C15GACGGCCCACTTGNONE 
J090043N09GACGGCCCACTTGNONE 
J090053J10GACGGCCCACTTGNONE 
J090054F14GACGGCCCACTTGNONE 
J090057N12GACGGCCCACTTGNONE 
J090061P13GACGGCCCACTTGNONE 
J090062F17GACGGCCCACTTGNONE 
J090065H15GACGGCCCACTTGNONE 
J090067P11GACGGCCCACTTGNONE 
J090068M09GACGGCCCACTTGNONE 
J090069E24GACGGCCCACTTGNONE 
J090069K16GACGGCCCACTTGNONE 
J090070N07GACGGCCCACTTGNONE 
J090072M09GACGGCCCACTTGNONE 
J090075I24GACGGCCCACTTGNONE 
J090075M04GACGGCCCACTTGNONE 
J090077D24GACGGCCCACTTGNONE 
J090080M17GACGGCCCACTTGNONE 
J090080O14GACGGCCCACTTGNONE 
J090081C12GACGGCCCACTTGNONE 
J090084N21GACGGCCCACTTGNONE 
J090084O21GACGGCCCACTTGNONE 
J090087J18GACGGCCCACTTGNONE 
J090092L17GACGGCCCACTTGNONE 
J090097A08GACGGCCCACTTGNONE 
J100017E24GACGGCCCACTTGNONE 
J100018K11GACGGCCCACTTGNONE 
J100019A16GACGGCCCACTTGNONE 
J100023I23GACGGCCCACTTGNONE 
J100024D07GACGGCCCACTTGNONE 
J100025H12GACGGCCCACTTGNONE 
J100027K19GACGGCCCACTTGNONE 
J100028C23GACGGCCCACTTGNONE 
J100029A14GACGGCCCACTTGNONE 
J100029O19GACGGCCCACTTGNONE 
J100030I09GACGGCCCACTTGNONE 
J100030J16GACGGCCCACTTGNONE 
J100031C01GACGGCCCACTTGNONE 
J100031N06GACGGCCCACTTGNONE 
J100033H04GACGGCCCACTTGNONE 
J100034L20GACGGCCCACTTGNONE 
J100036K13GACGGCCCACTTGNONE 
J100039M02GACGGCCCACTTGNONE 
J100040J01GACGGCCCACTTGNONE 
J100042O21GACGGCCCACTTGNONE 
J100042P20GACGGCCCACTTGNONE 
J100047K22GACGGCCCACTTGNONE 
J100049B16GACGGCCCACTTGNONE 
J100052M10GACGGCCCACTTGNONE 
J100053B05GACGGCCCACTTGNONE 
J100053B20GACGGCCCACTTGNONE 
J100055I11GACGGCCCACTTGNONE 
J100056A13GACGGCCCACTTGNONE 
J100057C08GACGGCCCACTTGNONE 
J100057N11GACGGCCCACTTGNONE 
J100057P07GACGGCCCACTTGNONE 
J100059E16GACGGCCCACTTGNONE 
J100063N14GACGGCCCACTTGNONE 
J100069H01GACGGCCCACTTGNONE 
J100071C17GACGGCCCACTTGNONE 
J100071K09GACGGCCCACTTGNONE 
J100077D07GACGGCCCACTTGNONE 
J100078P22GACGGCCCACTTGNONE 
J100080F11GACGGCCCACTTGNONE 
J100081L07GACGGCCCACTTGNONE 
J100083B10GACGGCCCACTTGNONE 
J100083K17GACGGCCCACTTGNONE 
J100085B22GACGGCCCACTTGNONE 
J100085L21GACGGCCCACTTGNONE 
J100086B11GACGGCCCACTTGNONE 
J100087E06GACGGCCCACTTGNONE 
J100087P07GACGGCCCACTTGNONE 
J100089H24GACGGCCCACTTGNONE 
Os12g0109600AK107606TCTGGGCCGACGGCCCATGGCCCAGProtein of unknown function DUF1677, Oryza sativa family protein. 
J053026B13TCTGGGCCGACGGCCCATGGCCCAGNONE 
J053033C09TCTGGGCCGACGGCCCATGGCCCAGNONE 
J053059G21TCTGGGCCGACGGCCCATGGCCCAGNONE 
J053071A13TCTGGGCCGACGGCCCATGGCCCAGNONE 
J075007L19TCTGGGCCGACGGCCCATGGCCCAGNONE 
J075071J20TCTGGGCCGACGGCCCATGGCCCAGNONE 
J075110F18TCTGGGCCGACGGCCCATGGCCCAGNONE 
Os12g0111600009-151-A07GACGGCCCGNONE 
AK119685GACGGCCCGNONE 
AK120264GACGGCCCGHypoxia induced protein conserved region family protein. 
J013047D01GACGGCCCGNONE 
J023111D22GACGGCCCGNONE 
J023128C07GACGGCCCGNONE 
J065170J03GACGGCCCGNONE 
J065198L01GACGGCCCGNONE 
J100037I18GACGGCCCGNONE 
J100073O19GACGGCCCGNONE 
Os12g0481100AK073151GACGGCCCACGAAAGCCCATCASimilar to RNA helicase. 
Os12g0535900006-061-F02GGGCCGTCNONE 
AK069422GGGCCGTCPlus-3 domain containing protein. 
AK109358GGGCCGTCNONE 
Os12g0588900AK069966GACGGCCCAGCTAGGCCCAATTConserved hypothetical protein. 
AK069966GGACGGCCCAGGConserved hypothetical protein. 
J023038A10GACGGCCCAGCTAGGCCCAATTNONE 
J023038A10GGACGGCCCAGGNONE 
J065061J23GACGGCCCAGCTAGGCCCAATTNONE 
J065061J23GGACGGCCCAGGNONE 
J065176O08GACGGCCCAGCTAGGCCCAATTNONE 
J065176O08GGACGGCCCAGGNONE 
J075143K13GACGGCCCAGCTAGGCCCAATTNONE 
J075143K13GGACGGCCCAGGNONE 
Os12g0624800AK103828GACGGCCCHypothetical protein. 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.